Sample Question Paper: Class Xii BIOLOGY (044) TERM II (2021-22)

SAMPLE QUESTION PAPER
CLASS XII
BIOLOGY (044)
TERM II (2021-22)
Max. Marks 35 Time allowed: 2 hours
General Instructions:
i) All questions are compulsory.
ii) The question paper has three sections and 13 questions. All questions are
compulsory.
iii) Section–A has 6 questions of 2 marks each; Section–B has 6 questions of 3 marks
each; and Section–C has a case-based question of 5 marks.
iv) There is no overall choice. However, internal choices have been provided in
some questions. A student has to attempt only one of the alternatives in such
questions.
v) Wherever necessary, neat and properly labeled diagrams should be drawn.
Q. No. Marks
Section A
1 Humans have innate immunity for protection against pathogens that may 2
enter the gut along with food. What are the two barriers that protect the
body from such pathogens?
2 A patient admitted in ICU was diagnosed to have suffered from 2

myocardial infarction. The condition of coronary artery is depicted in the
image below.
Name two bioactive agents and their mode of action that can improve this
condition.
OR
Substantiate by giving two reasons as to why a holistic understanding of
the flora and fauna the cropland is required before introducing an
appropriate biocontrol method.
1
3 Identify the compound chemical structure is shown below. State any three 2
of its physical properties.
4 Water samples were collected at points A, B and C in a segment of a river 2

near a sugar factory and tested for BOD level. The BOD levels of samples
A, B and C were 400 mg/L, 480 mg/L and 8 mg/L respectively.
What is this indicative of? Explain why the BOD level gets reduced
considerably at the collection point C?
5 An ecologist study an area with population A, thriving on unlimited 2

resources and showing exponential growth, introduced population B and
C to the same area.
What will be the effect on the growth pattern of the population A, B and C
when living together in the same habitat?
6 With the decline in the population of fig species it was noticed that the 2
population of wasp species also started to decline. What is the
relationship between the two and what could be the possible reason for
decline of wasps?
OR
With the increase in the global temperature, the inhabitants of Antarctica
are facing fluctuations in the temperature. Out of the regulators and the
conformers, which of the two will have better chances of survival?
Give two adaptations that support them to survive in the ambient
environment? Give one suitable example.
2
SECTION B
7 How do normal cells get transformed into cancerous neoplastic cells? 3

Elaborate giving three examples of inducing agent.
OR
A person is suffering from a high-grade fever. Which symptoms will help
to identify if he/she is suffering from Typhoid, Pneumonia or Malaria?
8 Recognition of an antigenic protein of a pathogen or exposure to a 3

pathogen occurs during many types of immune responses, including
active immunity and induced active immunity.
Specify the types of responses elicited when human beings get
encountered by a pathogen.
9 In a pathological lab, a series of steps were undertaken for finding the 3

gene of interest. Describe the steps, or make a flow chart showing the
process of amplification of this gene of interest.
10 a. ‘The Evil Quartet’ describes the rates of species extinction due to 3

human activities. Explain how the population of organisms is affected
by fragmentation the habitats.
b. Introduction of alien species has led to environmental damage and
decline of indigenous species. Give any one example of how it has
affected the indigenous species?
c. Could the extinction of Steller’s sea cow and passenger pigeon be
saved by man? Give reasons to support your answer.
11 a. The image shown below is of a sacred grove found in India. Explain 3

how has human involvement helped in the preservation of these
biodiversity rich regions.
b. Value of Z (regression coefficient) is considered for measuring the

species richness of an area. If the value of Z is 0.7 for area A ,and
0.15 for area B, which area has higher species richness and a steeper
slope?
3
12 The image below depicts the result of gel electrophoresis 3
If the ladder represents sequence length upto 3000 base pairs (bp),
a. Which of the bands (I - IV) correspond to 2500 bp and 100 bp
respectively?
b. Explain the basis of this kind of separation and also mention the
significance of this process.
SECTION C
13 Some restriction enzymes break a phosphodiester bond on both the DNA 5

strands, such that only one end of each molecule is cut and these ends
have regions of single stranded DNA. BamH1is one such restriction
enzyme which binds at the recognition sequence, 5’-GGATCC- 3’and
cleaves these sequences just after the 5’- guanine on each strand.
a. What is the objective of this action?
b. Explain how the gene of interest is introduced into a vector.
c. You are given the DNA shown below.
5’ ATTTTGAGGATCCGTAATGTCCT 3’
3’ TAAAACTCCTAGGCATTACAGGA 5’
If this DNA was cut with BamHI, how many DNA fragments would
you expect? Write the sequence of these double-stranded DNA
fragments with their respective polarity.
d. A gene M was introduced into E.coli cloning vector PBR322 at
BamH1 site. What will be its impact on the recombinant plamids?
Give a possible way by which you could differentiate non
recombinant to recombinant plasmids.
4
OR
GM crops especially Bt crops are known to have higher resistance to pest
attacks. To substantiate this an experimental study was conducted in 4
different farmlands growing Bt and non Bt-Cotton crops. The farm lands
had the same dimensions, fertility and were under similar climatic
conditions. The histogram below shows the usage of pesticides on Bt
crops and non-Bt crops in these farm lands.
a. Which of the above 4 farm lands has successfully applied the concepts
of Biotechnology to show better management practices and use of
agrochemicals? If you had to cultivate, which crop would you prefer (Bt
or Non- Bt) and why?
b. Cotton Bollworms were introduced in another experimental study on
the above farm lands wherein no pesticide was used. Explain what
effect would a Bt and Non Bt crop have on the pest.
***

Sample Question Paper: Class Xii BIOLOGY (044) TERM II (2021-22)

Uploaded by

Copyright:

Available Formats

Sample Question Paper: Class Xii BIOLOGY (044) TERM II (2021-22)

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Sample Question Paper: Class Xii BIOLOGY (044) TERM II (2021-22)

Uploaded by

Copyright:

Available Formats

SAMPLE QUESTION PAPER

2 A patient admitted in ICU was diagnosed to have suffered from 2

4 Water samples were collected at points A, B and C in a segment of a river 2

5 An ecologist study an area with population A, thriving on unlimited 2

7 How do normal cells get transformed into cancerous neoplastic cells? 3

8 Recognition of an antigenic protein of a pathogen or exposure to a 3

9 In a pathological lab, a series of steps were undertaken for finding the 3

10 a. ‘The Evil Quartet’ describes the rates of species extinction due to 3

11 a. The image shown below is of a sacred grove found in India. Explain 3

b. Value of Z (regression coefficient) is considered for measuring the

13 Some restriction enzymes break a phosphodiester bond on both the DNA 5

You might also like