See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/317118760

Morphological identification and DNA barcoding of a new species of

Parabrachiella (Siphonostomatoida: Lernaeopodidae) with aspects of their
intraspecific variation

Article  in  Acta tropica · May 2017

DOI: 10.1016/j.actatropica.2017.05.025

CITATIONS READS

0 218

3 authors:

Martin Montes Raul Castro

Centro de Estudios Parasitologicos y de Vectores CEPAVE University of Antofagasta
31 PUBLICATIONS   55 CITATIONS    53 PUBLICATIONS   294 CITATIONS   

SEE PROFILE SEE PROFILE

Sergio R. Martorelli
National Scientific and Technical Research Council- CONICET CCT-LA PLATA
141 PUBLICATIONS   1,193 CITATIONS   

SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Lenaeopodidae on Chilean fishes View project

Colobomatus in Chilean fishes View project

All content following this page was uploaded by Raul Castro on 11 January 2018.

The user has requested enhancement of the downloaded file.

 Acta Tropica 173 (2017) 34–44

Contents lists available at ScienceDirect

Acta Tropica
journal homepage: www.elsevier.com/locate/actatropica

Morphological identification and DNA barcoding of a new species of MARK

Parabrachiella (Siphonostomatoida: Lernaeopodidae) with aspects of their
intraspecific variation
⁎
M.M. Montesa, , R. Castro-Romerob, S.R. Martorellia
a
Centro de Estudios Parasitológicos y Vectores (CEPAVE), Consejo Nacional del Investigaciones Científicas y Técnicas, Universidad Nacional de La Plata (CCT-La Plata
CONICET-UNLP), Calle 120 s/n e/60 y 64, 1900, La Plata, Buenos Aires, Argentina
b
Universidad de Antofagasta, Facultad de Ciencias del Mar y recursos naturales, Departamento de Ciencias Acuáticas y Ambientales, Casilla 170, Antofagasta, Chile

A R T I C L E I N F O A B S T R A C T

Keywords: We present a detailed morphological description and a DNA barcoding of Parabrachiella platensis n. sp. collected
Argentina from Mugil liza Valenciennes in Samborombon Bay (Buenos Aires, Argentina). This new species was compared
Brackish water with two Parabrachiella species parasitic on mugilids: Parabrachiella exilis (Shiino, 1956) and Parabrachiella
Symbiont copepod mugilis (Kabata, Raibaut et Ben Hassine, 1971). Parabrachiella platensis n. sp. differs from those species in the
Juvenile mullet
shape of posterior processes, the anal slit with two pairs of bipartite papillae, the size of cephalothorax, the
COI
trunk, the maxilla, the microhabitat on the host, and the lack of caudal rami. On the host, the new species was in
the nostrils (a new site for a species of the genus Parabrachiella) and in the fins base. Some minor morphological
differences were observed in relation to the locations on the host. The molecular analysis conducted based on
mtDNA-COI between specimens of the new species on the fins and nostrils showed a genetic similarity of 99.8%.
This percentage supports that the specimens found in nostrils and fins base could represent a single species. New
studies on P. platensis n. sp., including infection of the same fish with the two forms, could bring some new
information. Anyway according to the genetic information provided and the minimal morphological differences
spotted we conclude that the two forms are a single specie. The differences observed are possibly influenced by
the place of the host where the two forms of copepods were found, nostrils and fins. The new species was also
molecularly compared to other five species of Parabrachiella including P. exilis (parasitizing mugilid from Chile),
Parabrachiella anisotremis, Parabrachiella auriculata, Parabrachiella merluccii, and P. hugu (the last two sequences
were taken from the GenBank). The genetic distance of 9% among P. platensis n. sp. and P. exilis, which is the
close morphological related species, allow to states that these two copepods on mugilids belong to different
species and then validating the morphological differences found between them.

1. Introduction 1891), parasitizing the whitemouth drummer, Micropogonias furnieri

(Desmarest). Another congener—Parabrachiella insidiosa (Heller, 1865),
The Lernaeopodidae is one of the most numerous families of was found by Sardella and Timi (1995) on Merluccius hubbsi Marini.
copepods and its representatives are extensively adapted to parasitism. Cantatore et al. (2012) provided a list of copepods parasites of fishes
Most of the lernaeopodid species represents narrow host specificity and from the Argentine Sea and found Parabrachiella amphipacifica (Ho,
parasitize specific anatomical locations on their fish hosts (Piasecki 1982) infecting Cottunculus granulosus Karrer.
et al., 2010). The genus Parabrachiella Wilson, 1915 is one of the most Mugilids (mullets) have been reported as hosts for many lernaopo-
numerous genera in this species-rich family. According to Piasecki et al. did copepods. In Chile, Parabrachiella exilis (Shiino, 1956), was reported
(2010), the genus Parabrachiella contains 67 species. In Argentina, by Castro Romero and Baeza Kuroki (1986) on flathead grey mullet,
Etchegoin et al. (2006) redescribed Parabrachiella spinicephala Ring- Mugil cephalus Linnaeus. Knoff et al. (1994) reported P. exilis hosted by
uelet, 1945, a parasite of the Brazilian sandperch, Pinguipes brasilianus lebranche mullet, Mugil liza Valenciennes, from Brazil. Parabrachiella
Cuvier. In the same country, Sardella et al. (1995) and Alarcos and mugilis (Kabata, Raibaut et Ben Hassine, 1971) was reported parasitiz-
Etchegoin (2010) reported Parabrachiella chevreuxii (Van Beneden, ing golden grey mullet Liza aurata (Risso), in the North Atlantic, the

⁎
Corresponding author.
E-mail address: martinmiguelmontes@gmail.com (M.M. Montes).

http://dx.doi.org/10.1016/j.actatropica.2017.05.025
Received 28 November 2016; Received in revised form 9 May 2017; Accepted 20 May 2017
Available online 22 May 2017
0001-706X/ © 2017 Elsevier B.V. All rights reserved.
M.M. Montes et al. Acta Tropica 173 (2017) 34–44

Mediterranean Sea, the Lake of Tunis (lagoon), and the Gulf of Oman at of each primer (10 μM), and 6 μl Taq DNA polymerase (5 U/ml). Each
Muscat (Kabata et al., 1971). well contained 10.5 ml mixture and 2 ml genomic DNA. The PCR
During the nostrils and fins examinations in juvenile M. liza from reaction profile was comprised of an initial step of 2 min at 95 °C and 5
Samborombón Bay, copepods of Parabrachiella sp. were found. cycles of 94 °C for 30 s, annealing at 45 °C for 40 s, and extension at
The aim of the study was to determine the taxonomic status of the 72 °C for 1 min, 35 cycles of 94 °C for 30 s, annealing at 51 °C for 40 s,
specimens parasitic on M. liza and its relationships with P. exilis, which and extension at 72 °C for 1 min, final extension at 72 °C for 10 min.
is also parasitic on mugilid, with other three fishes species collected in Amplicons were visualized on 2% agarose E-GelH 96-well system
Antofagasta (Chile) waters, and with another two species from (Invitrogen). The PCR amplification products where placed in 96-wells
GenBank. plate containing 6.25 μl of 10% trehalose and posted to the University
of Guelph for DNA sequencing. The COI barcode sequence was obtained
2. Materials and methods according with the protocol of Ivanova and Grainger (2006). The
sequencing of Chilean fish specimens was carried out in Macrogen Inc.
2.1. Specimens and taxonomy (Korea).
Sequences were edited by eye using the platform GENEIOUS 5.1.7.
Fish samples were collected in the Ajó River (36°20′12′′S, Barcode fragment alignments were assembled using MAFFT v.7 (Katoh
56°54′17″W), Samborombón Bay, Buenos Aires province, Argentina, and Standley, 2013). We checked the nucleotide alignment for the
from 15 March through 21 September 2009. Fish were captured with a presence of pseudogenes in Geneiuos Pro, using the translated amino
modified Garlito/Bituron stationary net (Colautti 1998) plus a trawl net acid sequences based on the invertebrate mitochondrial genetic code.
10 m long with a 5 mm stretched mesh in the wings and a 2.5 mm The best partitioning scheme and substitution model for each DNA
stretched mesh in the codend. Captured fish were fixed with 10% (v/v) partition was chosen under the Bayesian Information Criterion (BIC;
aqueous formalin, weighed, and measured. Some fish were carried to Schwarz 1978) using the “greedy” search strategy in Partition Finder v.
the laboratory alive and the parasites found were fixed for DNA 1.1.1 (Lanfear et al., 2012). The barcode fragment dataset was
extraction as we mention below. The fish specimens ranged from 3.64 partitioned into first-, second-, and third-codon positions with the
to 23.4 cm in standard length and from approximately 1 to 400 g in appropriate nucleotide substitution model implemented for each codon
weight. The nasal cavities were dissected under a stereomicroscope, position (TIM+G for the first and second (Posada 2003); and HKY+G
and parasites detected were removed and stored in 10% buffered for the third codon position (Hasegawa et al., 1985)). Ergasilus sp. was
formalin. Parasite appendages were dissected, cleared in lactic acid, used as the outgroup for the COI data set.
and examined under light microscopy. Drawings were made with the The phylogenetic reconstruction was carried out using Bayesian
aid of a drawing tube. Measurements for females and males are given in Inference (BI) through MrBayes v. 3.2.1 (Ronquist et al., 2012). The
mm as mean values followed by ranges in parentheses. Terminology phylogenetic trees were reconstructed using two parallel analyses of
follows Huys and Boxshall (1991), but detailed terminology related to Metropolis-Coupled Markov Chain Monte Carlo (MCMC) for 20 × 106
body parts is based on Kabata (1979). Specimens fixed in formalin, generations each to estimate the posterior probability (PP) distribution.
were dehydrated in a series of increasing concentrations of ethanol, Topologies were sampled every 1000 generations. The first 25% of the
dried to the critical point in an EMITECH model K850, and sputter- sampled trees were discarded as ‘burn in’.
coated with gold. Samples were then observed and photographed in a All P. platensis n. sp. sequences, trace files (electrophenogram),
Philips SEM 505 microscope equipped with digital-imaging program primer sequences used, and the specimen data were deposited in the
(Soft Imaging System ADDA II [SIS]). public project “Parasites of fish and Invertebrates from Argentina
(Code = TREAR) in the Barcode of Life Database (BOLD) (www.
2.2. Molecular data barcodinglife.org). All obtained sequences were also deposited in
GenBank (Table 1). The holotype, the allotype, and the paratypes of
Copepod specimens, collected from the nostrils and the fins were the new species were deposited in the invertebrate collection of the
preserved separately in 96% ethanol and kept at −20 °C until DNA Museo de La Plata, Argentina.
extraction. Specimens of four other Parabrachiella species from fishes of Family Lernaeopodidae Milne Edwards, 1840
Chile were included in the analysis: Parabrachiella anisotremi (Castro Genus Parabrachiella Wilson C.B., 1915
Romero et Baeza Kuroki, 1989); Parabrachiella auriculata (Castro Parabrachiella platensis n. sp.
Romero et Baeza Kuroki, 1987), P. exilis, and Parabrachiella kabatai Type-host: Mugil liza (Mugiliformes: Mugilidae); local name ‘lisa’,
(Luque et Farfan, 1991). Sequences of Parabrachiella merluccii (Bassett- English name “Lebranche mullet”.
Smith, 1896) and Parabrachiella hugu (Yamaguti, 1939), deposited in Type locality: Ajó River, south of Samborombón Bay, Argentina
Bold Systems Public Data Portal and in GenBank, respectively, were (36°20′S, 56°54′W).
also included in the mtDNA-COI analysis (Table 1). The Chilean Attachment site: Nostrils (primary) and fins.
Parabrachiella specimens for DNA extraction came from the private Prevalence: 49.30% (nostrils) and 17.61% (fins).
collection of one of the authors (RCR). A COI sequence of Ergasilus von Mean intensity: 2.16 (nostrils) and 1.7 (fins).
Nordmann, 1832 from the IBOL project: TREAR, was also included as Type material: Deposited in the invertebrate collection of the Museo
outgroup. de La Plata, Argentina. Holotype adult female: MLP-Cr 26948 and
For DNA extraction a sample of 2–3 mm3 of ethanol-preserved allotype adult male: MLP-Cr 26949. Four paratypes adult females with
tissue, 5 ml of insect Lysis Buffer, and 0.5 ml of Proteinase K, 20 mg/ml the male: MLP-Cr 26945-47 and MLP-Cr 26950
were placed in each well of 96-well Eppendorf plate for DNA extraction. Etymology: The species name “platensis” refers to the name of the
Genomic DNA was extracted according to the glass fibre (GF) protocol estuary of La Plata River where the parasite was found.
for DNA extraction using 96-well plates by Ivanova et al. (2006a,b). Description (Figs. 1–11)
Amplification of the 5′ barcode region of COI was made using the Adult Female [Based on 20 ovigerous specimens.] Measurements in
HCO2198_t1 (Folmer et al. (1994) tailed) (CAGGAAACAGCTATGACT- Table 2. Body typically lernaeopodid. Cephalothorax (Fig. 1A and B)
AAACTTCAGGGTGACCAAAAAATCA), and LCO1490_t1 (Folmer et al. subcylindrical, dorsal shield widening terminally, reinforced by more
(1994) tailed) (TGTAAAACGACGGCCAGTGGTCAACAAATCATAAAGA- sclerotized cuticle, (Fig. 1C). Antennule (Figs. 1D and 3C) four-
TATTGG) primers. PCR reactions were performed in 96-well plates. The segmented with swollen basal segment, and short solus at boundary
reaction master mix consisted of 625 μl of 10% trehalose, 200 μl water, between third and fourth segment (Fig. 3C). Distal segment armature
125 μl of buffer, 62.5 μl MgCl2 (50 mM), 6.25 μl dNTP (10 mM), 12.5 μl (Figs. 1D and 3C) with short process 3, simple seta 6, bifid seta 5, and

35
M.M. Montes et al. Acta Tropica 173 (2017) 34–44

Table 1
Details of copepods parasites of marine fishes Chile used in this study.

Copepod parasites species [Code Host (Family) A C G T

Poecilostomatoida
Ergasilidae
Ergasilus sp. [Erg] Mugil liza Valenciennes, 1836 (Mugilidae) KU557411 678 172 118 141 247

Siphonostomatoida
Lernaeopodidae
Parabrachiella hugu (Yamaguti, 1939) “Spheroides rubripes” = Takifugu rubripes KT030285 558 163 68 100 227
Parabrachiella merlucci (Bassett-Smith, 1896) Merluccius merluccius (Linnaeus, 1758) KT208689 667 205 88 105 269
Parabrachiella anisotremi (Castro Romero & Baeza Kuroki, 1989) Anisotremus scapularis Tschudi,1846 (Pomadasidae) KX815887 597 186 78 90 243
KX815888 615 193 77 96 249
KX815889 639 202 80 95 262
KX815890 651 204 83 97 267
Parabrachiella auriculata (Castro Romero & Baeza Kuroki, 1987) Cilus gilberti Abbott, 1899 (Sciaenidae) KX815906 603 191 79 95 238
KX815907 630 197 84 102 247
KX815908 654 209 86 102 257
Parabrachiella exilis (Shiino, 1956) Mugil cephalus Linnaeus, 1758 KY026072 609 194 78 96 241
sensu Castro-Romero & Baeza-Kuroki 1986 KY026073 681 218 90 109 264
KY026074 699 220 93 110 276
sensu Knoff et al. (1986) Mugil liza Valenciennes, 1836 (Mugilidae)
sensu Shiino (1956) “Kyphosus lembus” = Kyphosus vaigiensis (Quoy et Gaimard, 1825)

Parabrachiella kabatai (Luque & Farfan, 1991) Isacia conceptionis (Cuvier, 1831) KY026075 666 200 74 289 103
KY026076 666 199 75 104 288
KY026077 666 199 75 104 288
KY026078 627 193 67 94 273

Parabrachiella platensis n. sp. (nostrils) Mugil liza Valenciennes, 1836 (Mugilidae) KY026080 666 211 78 100 277
KY026081 666 210 79 101 276
KY026082 666 210 78 101 277
KY026083 660 207 77 101 275
Parabrachiella platensis n. sp. (fins) Mugil liza Valenciennes, 1836 (Mugilidae) KY026084 666 210 78 101 277
KY026085 666 210 78 101 277

seta 4 plus short process 1 (not forming gibber). Antenna (Figs. 2A and robust, no armature on myxal area. Claw (Figs. 2I, 4B and C ) slightly
B, 3D ) biramous, sympod-exopod long axis, exopod globose with short curved, barb stout, shaft with denticulate disto-ventral margin. A row
distal seta and another distolaterally margin (Fig. 3D). Endopod two- with at least 5 denticles (commonly 5) on surface of claw near its base
segmented. Apical armature (Figs. 2B, 3D) with robust curved hook 1, (Fig. 4B), at each side (not observed with optic microscopy) and two
slender seta 2, and seta 5, process 4 on lateral side, and ventrally to the denticles on lateral surface close to the base in in copepods located on
latter a pad of scale-like denticles on ventral margin. Labrum and fins (Fig. 4B).
labium forming buccal cone (Fig. 3E). Labrum bearing rostral seta Trunk (Fig. 1A and B), with two pairs of short, blunt posterior
ventrally (Fig. 2C), and fine setules. Labium margin with rows of dense (lateral) processes, dorsal anal region encircled by single pair of short
setae, without sensilla on disto-ventral surface (Fig. 3E) or with two papillae on each side (not visible with optic microscopy) with short
sensilla (one on each side) near distal margin (Fig. 3F) (only observed in ventral lobes bearing oviduct-orifice (Fig. 3A and B). Very short ventral
the SEM). Mandible (Fig. 2D) with coxa globose, short; gnathobase genital process (Fig. 3B). Anal area with three short tubercles in
blade with 3 secondary teeth. Dental formula: P1, S1, P1, S1, P1, S1, B4. specimens attached to fins (Fig. 4C). Egg sacs with 30–60 eggs (Fig. 1A).
Last secondary tooth smallest. Maxilla (Fig. 1A and B) medium size, Adult Male [Based on 20 specimens.] Measurements in Table 2. Body
arms separated, not fused (partially fused, in some specimens), with male type A (Fig. 5A) according to Kabata (1979). Cephalothorax about
short nipple-like structure near base (Figs. 1A and B, 3A). Bulla short 40% trunk length. Antennule three segmented (Figs. 5B, 6A–C ). Basal
(Fig. 2G) with manubrium and expanded anchor (Fig. 2H). Maxillule segment longest and second and third segments approximately same
(Figs. 2E, 3E and F) bilobate, inner lobe with two long setae of unequal length. Distal segment armed with elements 1, 2, 3, 4, 5, and 6
length (differences in length shown in Fig. 3E and F), outer lobe with (Fig. 6C). Solus present (Fig. 6B) between second and third segment
one (in copepods from fins) or two short setae of unequal length (in (not detected with optic microscopy). Whip not detected. Antenna
Fig. 3F only one seta visible). Maxilliped (Fig. 2F) subchelate. Corpus (Figs. 5C, 6A and D) biramous, elongate, and prehensile. Sympod

Table 2
Measurements of Parabrachiella platensis n. sp. from the nostrils and fins.

Measurements P. nasalis n. sp. from nostrils P. nasalis n. sp. from fins

FEMALES Body long 3.19 (2.59–3.97) 2.18 (1.24–3.32)

Cephalothorax long by wide 1.98 (1.65–2.51) by 0.33 (0.28–0.36) 1.25 (0.73–1.97) by 0.37 0.30–0.46)
Maxila long by wide 0.72 (0.57–0.84) by 0.28 (0.22–0.38) 0.49 (0.46–0.62) by 0.24 (0.18–0.33)
Bulla long 0.28 (0.22–0.38)
Trunk long by wide 1.21 (0.94–1.46) by 0.92 (0.78–1.27) 0.93 (0.51–1.35) by 0.70 (0.26–1.08)
Trunk lateral processes 0.23 (0.19–0.34) by 0.13 (0.11–0.2) 0.13 (0.11–0.15) by 0.09 (0.07–0.13)
Trunk Ventral lobes bearing oviduct, long by wide 0.11 (0.09–0.14) by 0.07 (0.04–0.08)
Egg Sac long by diameter 1.27 (1.13–1.46) by 0.41 (0.32–0.54) 1.22 (0.72–1.76) by 0.44 (0.40–0.51)
MALES Body long 0.61 (0.54–0.68) 0.67 (0.59–0.77)
Cephalothorax long by wide 0.26 (0.24–0.28) by 0.27 (0.23–0.32) 0.27 (0.26–0.30) by 0.18 (0.14–0.21)
Trunk long by wide 0.35 (0.31–0.40) by 0.28 (0.18–0.38) 0.39 (0.34–0.47) by 0.16 (0.15–0.77)

36
M.M. Montes et al. Acta Tropica 173 (2017) 34–44

Fig. 1. Parabrachiella platensis n. sp. from nostrils. Female. A. Lateral view. Parabrachiella platensis n. sp. from fins Female. B. Ventral view. C. Dorsal shield of cephalothorax. D. Antennule.
Abbreviations: 1, 3, 4, 5, 6, armature; An, antenna; Ce, Cephalothorax; Ds, Dorsal shield; Es, Egg sac; M, Maxilla; Mxp, Maxilliped; N, Nipple like structure; Pp, Posterior process; T, Trunk.
Scale bars: A, 500 μm; B, 250 μm; C, 150 μm; D, 5 μm.

cylindrical, unarmed. Exopod bulbous, one-segmented, with two short curved.

spines on dorsal surface (in nostrils specimens). Endopod, two segmen- Trunk with long axis of genital trunk slightly curved ventrally
ted, longer than exopod. Terminal segment with hook 1, seta 2, process (Fig. 5A). Two distal genital lobes (Fig. 5G).
4 on outer surface, and seta 5 on ventral margin; ventral surface of Parabrachiella exilis Shiino,1956
distal segment with pad of denticles. Buccal cone (Fig. 6A and D) Type-host: Mugil cephalus (Mugiliformes: Mugilidae); local name
formed by labrum and labium. Labrum armed distally with setiform “lisa”, English name “grey mullet”.
process, labium without sensilla. Mandible (Fig. 5F) blade with at least Type locality: Antofagasta, Chile.
three teeth;. Maxillule (Fig. 6A and D) bilobate; inner lobe with 2 large, Attachment site: fins.
unequal subcylindrical setae and outer lobe with minute seta in ventral Prevalence: 17.61% (fins).
position (Fig. 6D). Maxilla (Figs. 5D, 6A) with basal segment of length Mean intensity: 1.
slightly greater than width, subchela strongly curved distally. Max- Adult Female [Based on 5 ovigerous specimens. Only a small number
illiped (Figs. 5E, 6E) with robust corpus without armature; subchela of details have been added concerning trunk posterior margin pro-
with robust base, nearly cylindrical, tapering at apex. Claw strongly cesses, which have been revealed via SEM.]

37
M.M. Montes et al. Acta Tropica 173 (2017) 34–44

Fig. 2. Parabrachiella platensis n. sp. A. Antenna. B. Apical detail of antenna armature. C. Labrum. D. Mandible. E. Maxillule. F. Maxilliped. G. Maxilla showing the distal end of bulla. H.
Bulla. I. Claw of maxilliped. Abbreviations: a, anchor; Ab, Anexed barb; Cl, Claw; Co, Corpus; En, Endopod; Ex, Exopod; I, Inner lobe; L, Labium; O, outer lobe; Rd, Row denticles; Rs,
Rostral setules. Scale bars: A and B, 5 μm; C, 10 μm; D, 25 μm; E, 10 μm; F, 50 μm; G, 250 μm; H, 100 μm: I, 25 μm.

Female trunk subrectangular with two pairs of posterior, blunt, han all other species treated (Fig. 8), presenting a genetic distance of
processes and a short, dorsal, caudal rami (Fig. 7A and B). 14–18% from the other species used in this study (Table 3).

2.3. Molecular results 3. Discussion

The content of adenine, guanine, cytosine, and thymine for Most of the 138 copepods specimens acquired from the host were
Parabrachiella species is listed in Table 1. The six specimens of P. dissected from the nostrils and only few specimens were collected from
platensis n. sp. analysed (four from the nostrils and two from the fins) the fins. For this reason, we assumed that the preferable location of the
showed a close distance with a similarity of 99.8%, with sequences new species is the nostrils. Parabrachiella specimens collected from fins
differing only by 1 or 2 bp. showed several minor morphological differences with respect to those
The genetic distance was only 0.2–0.4% among the specimens located in the nostrils. Parabrachiella platensis n. sp. residing within the
collected in fins and nostrils Table 4. This result confirmed that both nostrils has a pair of small papillae on each side of the anal slit; while
sets parasitizing different habitats on the host would belong to the the specimens from the fins have three tubercles in that region. Also,
unique species showing minimal morphological differences. near the distal margin of the labium, the fins specimens have a pair of
The interspecific genetic distance (Table 3) among P. exilis and P. seta that are absent in P. platensis n. sp. located on the nostrils. Detailed
platensis n. sp. is 9%, both forming a clade more apomorphic than the examination of the maxilliped with SEM reveals that P. platensis n. sp.
others species studied (Fig. 8). Parabrachiella platensis showed a 16% of from nostrils has an external armature with two groups of at least 5
genetic distance from P. auriculata, 12% from both P. anisotremi and P. denticles each at the base of the claw, whereas the specimens from fins
kabatai, and 14% from also both P. merluccii and P. hugu. have only two denticles. The maxillule also provides other differences;
It is notorious the position of P. hugu, which is located more basal P. platensis n. sp. copepods from nostrils bears two setae on the outer

38
M.M. Montes et al. Acta Tropica 173 (2017) 34–44

Fig. 3. SEM Parabrachiella platensis n. sp. from nostrils. Female. A. Ventral view showing the trunk and processes. B. Detail of processes and papillae. C. Lateral view of the antennule,
showing the solus and armature. D. Armature of endopod of the antenna. E. Buccal cone and maxillule. F. Maxillule and labium of Parabrachiella platensis n. sp. from fins. Abbreviations: 1,
2, 4, 5, 6, armature; Ap, Anal papilae; Bc, Buccal cone; Gl, genital lobe bearing oviduct opening; Gp, Genital process; I, Inner lobe; Lb, labium; Mx, maxillule; O, outer lobe; pa, pad; Pp,
posterior processes; S, solus; Se, sensilia. Scale bar: A, 200 μm; B, 100 μm;C, 10 μm; D, 5 μm; E, 20 μm, F, 20 μm.

lobe while fin specimens present only one seta. Finally, the antennules not conspecific with any of the above species. The difference between
of P. platensis n. sp. from nostrils have a well-developed solus which is the new species and those described for mugilids are the size and shape
not observed in the specimens from the fins. of the posterior processes, the length of maxilla, the shape of the
Together, the low intraspecific genetic distance between the speci- maxillary arm, the shape and relative size of the trunk and finally, it’s
mens collected from the fin and nostrils (0.2–0.4%) and the close appendages.
morphological similarity between the two morphotypes, do not support A comparison was made between the newly described specimens
the description as two separate species. This, differences agree with parasitizing M. liza, with two species of copepods infecting Mugilidae
those presented by Costa et al. (2007) and Hill et al. (2001) who fishes: P. exilis and P. mugilis
reported a distance of 0.5–0.8% among three geographic separate The females of P. platensis n. sp. are smaller than the specimens of P.
populations of crustaceans Calanus helgolandicus Claus, 1863. Despite exilis found by Knoff et al. (1994), but similar in size to those examined
of that, Burns et al. (2007) using COI sequences noticed that some valid by Shiino (1956) and Castro-Romero and Baez-Kuroki (1986). Other
butterfly species differ “only by one to three nucleotides”. New studies differences between P. platensis n. sp. and the P. exilis specimen lie in
on P. platensis n. sp., including infection of the same fish with the two the sizes of the cephalothorax (1.98 vs. 2.48 long), the second maxilla
forms, could bring some new information. Anyway according to the (0.72 vs. 1.28 long), the egg sac (1.27 vs. 2.14 long), and the trunk
genetic information provided and the minimal morphological differ- (1.21 vs. 1.62 long). Furthermore, the specimens described by Shiino
ences spotted we conclude that the two forms are a single specie. The (1956) had a longer trunk (1.69 long). Parabrachiella platensis n. sp.
differences observed are possibly influenced by the place of the host differs from P. exilis in the shape of the posterior processes—which are
where the two forms of copepods were found, nostrils and fins. short and obtuse in P. platensis n. sp. vs. subconical in P. exilis (sensu
Parabrachiella includes at least 67 species (Piasecki et al., 2010) of Shiino, 1956). In addition, the small digitiform processes, (i.e., caudal
which 35 hold two pairs of posterior processes on the trunk (Castro rami), dorsally located occurring in P. exilis, (Fig. 7, and Fig. 19A and C
Romero and Baeza Kuroki, 1987; Piasecki et al., 2010). The parasitic of Shiino, 1956) are not present in the new species. Parabrachiella
specimens examined from the host M. liza in Argentina during the platensis n. sp. compared with P. exilis has short oviduct-orifice
present study were compared with this last group of species. Close processes (similar in size to the posterior processes), two pairs of small
examination led to the conclusion that the now described specimens are bipartite papillae laterally flanking the anal slit (in nostrils specimens),

39
M.M. Montes et al. Acta Tropica 173 (2017) 34–44

caudal rami. Furthermore, the species occupy different microhabitats

on the host: P. mugilis lives attached to the fins, while P. platensis n. sp.
were found either on inside the nasal cavity (a new site for a species of
the genus Parabrachiella), or attached to the fins base. In this case, the
females compared have a longer trunk (1.31 vs. 1.21 long), a smaller
cephalothorax (1.56 vs. 1.98 long), and bigger maxilla (1.5 vs. 0.72
long). The male of P. mugilis is smaller than the male of P. platensis n. sp.
(0.33 vs. 0.61 long).
The morphology per se indicates that Parabrachiella parasitizing
mugilids (P. exilis, P. mugilis and P. platensis n. sp.) are different species.
According to the description presented in this paper, it is clear that
the Parabrachiella species that parasitize South American mugilids
represent a close related species, at least in the case of species that
parasitize M. liza from Argentina and M. cephalus from Chile.
Similarities between these copepod species make difficult to distinguish
between them, but a high-resolution analysis of the posterior margin of
the trunk has revealed significant differences in the anal region.
The genital area, which includes processes and lobes associated with
the oviducts orifices, exhibit different shapes and degrees of develop-
ment, which depend on the age or sexual maturity of the female
specimen, for this, we must work only with adult gravid females. The
anal area can also show morphological variation concerning associated
projections, which are often species-specific. These anal tubercles are
typically not considered caudal rami. Parabrachiella exilis bears the
caudal rami located dorsally in that region (see present Fig. 7A and B)
corresponding to the “a much shorter dorsal pair, whose members are
closely adjoining each other on midline” sensu Shiino (1956; Fig. 19A
and C).
When the posterior region of the trunk is examined using light
microscopy, several processes are often seen in the same plane,
obscuring their identity. When viewed using SEM, however, features
of the distal margin or surface of the trunk become clearer, and anal
processes or papillae-like structures become evident. The description of
this area in new species must be approached with care, especially
concerning the presence of caudal rami.
The presence of sensilla on the labium surface is observed only in
the specimens of P. platensis n. sp. from fins base and not in those from
nostrils. This feature seems to be relevant for the feeding activity of
these copepods in their microhabitat. No previous reports have ever
been made of this kind of setae at that position.
DNA barcoding (Hebert et al., 2003) analysis has demonstrated to
be useful in free-livings copepods (Blanco-Bercial et al., 2011, 2014;
Buckling et al., 1995). Also in species-level identifications of different
taxa including crustaceans (Costa et al., 2007; Dippenaar et al., 2010;
Morales-Serna et al., 2014) and used recently by González et al. (2016),
for identification and description of a new species for the caligid
Lepeophtheirus confusum González, Castro, Muñoz et López, 2016.
The morphological and the mtDNA-COI evidence allow to separate
P. platensis n. sp. from P. exilis (with a genetic distance of 9%). They are
forming a clade, (both parasitizing mugilids), with a genetic distance of
12–16% from other Parabrachiella species here compared.
Fig. 4. Parabrachiella platensis n. sp. A. Posterior view of the Parabrachiella platensis n. sp.
Avise (2000) and Waugh (2007) gave values of 1–2% for the
from fins. B. Armature claw maxilliped. A. Claw of maxilliped of the Parabrachiella intraspecific distance of mitochondrial genes and less than 10% of
platensis n. sp. from fins. Abbreviations: At, anal tubercles; Ab, Anexed barb; Cl, Claw; D, interspecific variation. In some cases, a lower genetic distance can
denticles; Gp, Genital process; Pp, Posterior process; Rd, Row of denticles. Scale bars: A, differentiate species using the COI gene.
100 μm; B, 20 μm;C, 10 μm. For caligids the level of genetic distance observed is bigger
compared with other free living and parasitic copepods, González
and lack of caudal rami. The pairs of bipartite papillae flanking the anal et al. (2016), report the level of genetic distance for Lepeophtheirus
slit has not been previously reported in other Parabrachiella species. confusum range from 17 to 25% with other Lepeophtheirus species (based
The comparison of P. mugilis parasitic on L. aurata and leaping on COI). Morales-Serna et al. (2014) working with 11 Caligus species
mullet, Liza saliens (Risso), from Tunis (Kabata et al., 1971) with the states the genetic distances among species ranging from 8.42 to
described specimen likewise indicates that the two copepods are 20.87%. Oines and Heuch (2005) found distances of 18–20% among
different species. Parabrachiella mugilis has a single pair of posterior Caligus species.
processes (caudal rami) at the end of the trunk along with a short For free living crustaceans, Costa et al. (2007) report genetic
genital process, while P. platensis n. sp. has two posterior processes on distances inside the same species of 4.92% in one crab genus to
the trunk, in addition to small papillae around the anal slit lacking 31–39% in the amphipods.

40
M.M. Montes et al. Acta Tropica 173 (2017) 34–44

Fig. 5. Parabrachiella platensis n. sp. from fins. Male. A. Lateral view. B. Antennule. C. Antenna. D. Maxilla. E. Maxilliped. F. Mandible. G. Caudal rami. Abbreviations: 1, 2, 3, 4, 5, 6
armature; Ce, Cephalothorax; En, Endopodo; Ex, exopodo; Gl, Genital lobe; M, maxilla; Mxp, Maxilliped; T, Trunk. Scale bars: A, 125 μm. B, 17 μm. C, 12 μm. D, 25 μm. E, 25 μm. F,
13 μm. G, 13 μm.

Costa et al. (2014) found genetic distance of 6–16% distinguishing sp. (in nostrils and fins), in Argentina. The exact identity of P. exilis for
three lineages in Acartia tonsa, previously known only by its morphol- those specimens reported from Brazil by Knoff et al. (1994) must be
ogy. tested using both morphology and molecular studies, they could belong
Castro-Romero et al. (2016) reported genetic distance among to P. platensis n. sp. based on the host species and morphology, but can
Pennellidae: Peniculus cf. fistula Nordmann, 1832 specimens from not be affirmed without a morphological and molecular study of that
different host differ by 0.95%, Metapeniculus antofagastiensis Castro- copepod. This study disagree with Lebepe and Dippenaar (2016) who
Romero et Baeza-Kuroki, 1985 specimens 0.44%, and for Trifur cf. suggest only one species parasitizing Mugilids.
tortuosus Wilson, 1917 2.25%. By the other hand the genetic distance It is important to note that in species of medium to short size, like
among P. cf. fistula and M. antofagastiensis is 17.86%, and P. cf. fistula those reported here, the armature of the antennules or the antenna are
differing from T. cf. tortuosus by 18.16%, these tree species of sometimes hard to define, even at high magnification using optical
pennellidae genera well recognized and differentiated by its morphol- microscopy. Also, it is necessary to use SEM to detect their real
ogy. armature.
Dippenaar et al. (2010) reported the use of COI in crustaceans to Summarizing, the new species is characterized by having two pairs
reveal possible cryptic species of symbiotic copepods Nessipus orientalis of posterior processes on the posterior margin of the trunk, a papillae
on elasmobranch. These authors found an average distance within the around the anal cavity, a lack of caudal rami, and near its base, and
two clades 17.44% clearly a level expected for interspecific relation- different to the secondary teeth reported for some species of the genus,
ships. The genetic distance among different parasitic copepods can the presence of at least 5 denticles in a row on the lateral surface of the
present a wide range of variation, in accord to their reproductive maxilliped claw, near its base different to the secondary teeth reported
history, and evolutionary speed. Hebert et al. (2003), states that low for some species of Parabrachiella. In addition to describing a new
genetic distance is due to short histories of reproductive isolations species of Parabrachiella, the results obtained allow to report some
which need to be studied in each order, family, genus, and its species in features of its interspecific variation and also to know the DNA barcode
order to have a wide picture of this aspect for the parasitic copepods on for other two Parabrachiella (P. exilis and P. kabatai) for which this
fishes. genetic information was unknown until now. The presence on the same
At the moment Parabrachiella species that parasitize South American host of P. platensis n. sp. on the fins and in the nasal cavities
mugilids include P. exilis (on fins) in Chile and Peru, and P. platensis n. demonstrates a case of radiation into specialized microhabitats.

41
M.M. Montes et al. Acta Tropica 173 (2017) 34–44

Fig. 6. SEM of Parabrachiella platensis n. sp. from nostrils. Male A. Lateral view. B, C Antennule. D. Antenna, buccal cone and maxillule. E. Maxilliped. Abbreviations: 1, 2, 3, 4, 5, 6,
armature; A, antennules; An, antenna; I, inner lobe; M, maxilla; Mx, maxillule; Mxp, maxilliped; O, outer lobe; s, solus. Scale bar: A, C and E, 20 μm; B and D, 10 μm.

Fig. 7. SEM of Parabrachiella exilis, female on fins of Mugil cephalus from Chile. A. Posterior view without sac eggs. B. Posterior end with sac eggs. Abbreviations: Cr, caudal rami; E, egg; Es,
Egg sac; Gp, Genital process; Pp, Posterior process; T, Trunk. Scale bars: A, 100 μm; B, 200 μm.

Table 3 Table 4
Genetic distance (expressed in percentage) among species of copepods. Abreviattions: Erg., Intraspecific genetic distances (expressed in percentage) in copepods.
Ergasilus; P. ani, Parabrachiella anisotremis; P. aur., Parabrachiella auriculata; P. exi., Abreviattions: Dist., Intraespecific genetic distance; Erg., Ergasilus; P. ani,
Parabrachiella exilis; P. hug., Parabrachiella hugu; P. kab., Parabrachiella kabatai; P. mer., Parabrachiella anisotremis; P. aur., Parabrachiella auriculata; P. exi.,
Parabrachiella merlucci; P. pla., Parabrachiella platensis n. sp. Parabrachiella exilis; P. hug., Parabrachiella hugu; P. kab., Parabrachiella kabatai;
P. mer., Parabrachiella merlucci; n/c, not calculated, P. pla., Parabrachiella
Erg. P. aur. P. ani. P. kab. P. pla. P. mer. P. exi. P. hug platensis n. sp.; Var., Variance.

Erg. 2 2 2 2 2 2 2 Dist. Var.

P. aur. 27 1 2 2 2 2 2
P. ani. 28 13 2 1 1 2 2 Erg. n/c n/c
P. kab. 29 16 16 1 2 1 2 P. aur. 0.1 0.1
P. pla. 27 16 12 12 1 1 2 P. ani. 0.7 0.3
P. mer. 30 16 15 16 14 2 2 P. kab. 0.7 0.3
P. exi. 27 17 14 12 9 15 2 P. pla. 0.3 0.2
P. hug. 26 18 16 15 14 18 16 P. mer. n/c n/c
P. exi. 0.8 0.3
P. hug. n/c n/c

42
M.M. Montes et al. Acta Tropica 173 (2017) 34–44

Fig. 8. Phylogenetic position of the new species of Parabrachiella platensis n. sp. from fins and nostrils based on the COI gene obtained with the analysis by Bayesian Inference algorithm.
Ergasilus sp. was used as the outgroup. Abbreviations: ANISOT, Parabrachiella anisotromi; AURICU, Parabrachiella auriculata; EXILIS, Parabrachiella exilis; HUGU, Parabrachiella hugu;
KABATAI, Parabrachiella kabatai; MERLUCCI, Parabrachiella merlucci; PLATENS = Parabrachiella platensis n. sp. from the nostrils; PLATE_A1 and PLATE_A3, Parabrachiella platensis n. sp.
from the Fins.

New studies including more species of Parabrachiella could elucidate Buckling, A., Frost, B.W., Kocher, T.D., 1995. Molecular systematic of six Calanus and
three Metridia species (Calanoida: Copepoda). Mar. Biol. 121, 165–664.
the real relationships among the genus species and especially for the Burns, J.M., Janzen, D.H., Hajibabaei, M., Hallwachs, W., Hebert, P.D.N., 2007. DNA
case of P. hugu which appears as plesiomorphic to the species treated barcodes of closely related (but morphologically and ecologically distinct) species of
here. skipper butterflies (Hesperiidae) can differ by only one to three nucleotides. J.
Lepidoptera Soc. 61 (3), 138–153.
Cantatore, D.M.P., Braicovich, P.E., Alarcos, A.J., Lanfranchi, A.L., Rossin, M.L., Vales,
Acknowledgements D.G., Timi, J.T., 2012. New records of parasitic copepods (Crustacea, Copepoda) from
marine fishes in the Argentinean Sea. Acta Parasitol. 57, 83–89.
Castro Romero, R., Baeza Kuroki, H., 1987. Some species of Neobrachiella Kabata, 1979
The authors thank Joanna Browne from Griffith School of
(Copepoda: Lernaopodidae), parasitic on Chilean fishes, with description of
Environment and Australian Rivers Institute – Coast and Estuaries Neobrachiella paralichthyos sp. nov. from Paralichthys adspersus (Steindachner).
and Marine Invertebrates, Melbourne Museum, Australia and Philip Crustaceana 51 (3), 245–253.
Castro Romero, R., Baeza Kuroki, H., 1987. Four new species of Neobrachiella (Copepoda:
Whitford from Biology Department Capital University Columbus,
Lernaeopodidae) parasitic on Sciaena genus (Teleostei: Sciaenidae) in the South
Cecilia Morgan and Sabrina Martorelli for useful advice in improving Pacific. Est. Ocean. 6, 1–24.
the manuscript. We also want to thanks Agustin Solari for providing Castro-Romero, R., Montes, M.M., Martorelli, S., Sepulveda, D., Tapia, S., Martines-
samples of juvenile M. liza, Felicia Cardillo for helping in P. platensis n. Aquino, A., 2016. Integrative taxonomy of Peniculus, Metapeniculus, and Trifur
(Siphonostomatoida: Pennellidae), copepod parasites of marine fishes from Chile:
sp. collection, Mariela Theiller (CINDECA) for taking SEM images, M. species delimitation analysis using DNA barcoding and morphological evidence. Syst.
Marcia Montes for the preliminary draws, and Samanta Faiad (departa- Biodivers. 14, 1–18.
ment of “Ilustracion Cientifica” from the Facultad de Ciencias Naturales Colautti, D.C., 1998. Sobre la utilización de trampas para peces en las lagunas
pampásicas. Rev. Ictiol. 6, 17–23.
y Museo (FCNyM)) for the final draws. This work was partially funded Costa, F.O., de Waard, J.R., Boutillier, J., Ratnasingham, S., Dooh, R.T., Hajibabaei, M.,
by a research grant from the Agencia Nacional de Promoción Científica Hebert, P.D.N., 2007. Biological identifications through DNA barcodes: the case of
y Técnica (PICT 34412/05 and PID 0257) to S. R. Martorelli. Raul the Crustacea. Can. J. Fish. Aquat. Sci. 64 (2), 272–295.
Costa, Bargoza, Silva Rodriguez, K.L.F., Marinho Costa, R., Vallinoto, M., Schneider, H.,
Castro wishes to express thanks to Universidad de Antofagasta where Sampaio, I., 2014. Genetic variability of Acartia tonsa (Crustacea: Copepoda) on the
part of this research was carried out. Brasilian coast. J. Plankton Res. 36, 1419–1422.
Dippenaar, S.M., Mathibela, R.B., Bloomer, P., 2010. Cytochrome oxidase I sequences
reveal possible cryptic diversity in the cosmopolitan symbiotic copepod Nesippus
References orientalis Heller, 1868 (Pandaridae: Siphonostomatoida) on elasmobranch hosts from
the KwaZulu-Natal coast of South Africa. Exp. Parasitol. 125 (1), 42–50.
Alarcos, A.A., Etchegoin, J.A., 2010. Parasite assemblages of estuarine-dependent marine Etchegoin, J.A., Timi, J.T., Lanfranchi, A.L., 2006. Redescription of Neobrachiella
fishes from Mar Chiquita coastal lagoon (Buenos Aires Province, Argentina). spinicephala (Ringuelet, 1945) parasitic on Pinguipes brasilianus Cuvier, 1829 from
Parasitol. Res. 107, 1083–1091. Argentina, with the first description of the male. Acta Parasitol. 51 (4), 290–293.
Avise, J.C., 2000. Phylogeography: The History and Formation of Species. Havard Folmer, O., Black, M., Hoeh, W., Lutz, R., Vrijenhoek, R., 1994. DNA primers for
University Press, London. amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan
Blanco-Bercial, L., Bradford-Grieve, J., Bucklin, A., 2011. Molecular phylogeny of the invertebrate. Mol. Mar. Biol. Biotechnol. 3, 294–299.
Calanoid (Crustacea: Copepoda). Mol. Phylogenet. Evol. 59, 103–113. González, M.T., Castro, R., Muñoz, G., López, Z., 2016. Sea lice (Siphonostomatoida;
Blanco-Bercial, L., Cornils, A., Copley, N., Bucklin, A., 2014. DNA barcoding of marine Caligidae) diversity on littoral fishes from the south-eastern Pacific coast determined
copepods: assessment of analytical approachs to species identifications. PLOS Curr. from morphology and molecular analysis, with description of a new species
Tree Life 1, 1–22. (Lepeophtheirus confusum). Parasitol. Int. 65 (6), 685–695.

43
M.M. Montes et al. Acta Tropica 173 (2017) 34–44

Hasegawa, M., Kishino, H., Yano, T., 1985. Dating of the human ape splitting by a supplicans (Barnard, 1955) and Eubrachiella sublobulata (Barnard, 1955) (Copepoda:
molecular clock of mitochondrial DNA. J. Mol. Evol. 22, 160–174. Siphonostomatoida: Lernaeopodidae) deposited in the Iziko South African Museum.
Hebert, P.D.N., Ratnesinghan, S., de Waard, J.R., 2003. Barcoding animal life cytochrome Zootaxa 4061 (1), 1–51.
C. oxidase subunit (divergence among closely relates species. Proc. R. Soc. B Biol. Sci. Morales-Serna, F.N., Pinacho-Pinacho, C.D., Gómez, S., Pérez-Ponce de León, G., 2014.
270 (Suppl. 1), S96–S99. Diversity of sea lice (Copepoda: Caligidae) parasitic on marine fishes with
Hill, R.S., Allen, L.D., Bucklin, A., 2001. Multiplexed species-specific PCR protocol to commercial and aquaculture importance in Chamela Bay, Pacific coast of Mexico by
discriminate four N. Atlantic Calanus species, with an mtDNA gene tree for ten using morphology and DNA barcoding, With description of a new species of Caligus.
Calanus species. Mar. Biol. 139 (2), 279–287. Parasitol. Int. 63 (69), 79.
Huys, R., Boxshall, G.A., 1991. Copepod Evolution. The Ray Society, London. Oines, O., Heuch, P.A., 2005. Identification of sea louse species of the genus Caligus using
Ivanova, N.V., Grainger, C., 2006. Dye Terminator Sequencing of COI for the 3730 DNA mtDNA. J. Mar. Biol. Assoc. U.K. 85, 73–79.
Analyzer (Applied Biosystems). Protocols. Sequencing. CCDB Accessed 18 September Piasecki, W., Młynarczyk, M., Hayward, C.J., 2010. Parabrachiella jarai sp. nov.
2013. http://ccdb.ca/docs/CCDB_Sequencing.pdf. (Crustacea: Copepoda: Siphonostomatoida) parasitic on Sillago sihama
Ivanova, N.V., de Waard, J.R., Hebert, P.D.N., 2006a. An inexpensive, automation (Actinopterygii: Perciformes: Sillaginidae). Exp. Parasitol. 125 (1), 55–62.
friendly protocol for recovering high-quality DNA. Mol. Ecol. Notes 6 (4), 998–1002. Posada, D., 2003. Using Modeltest and PAUP* to select a model of nucleotide substitution.
Ivanova, N.V., de Waard, J.R., Hebert, P.D.N., 2006b. Glass Fiber Plate DNA Extraction In: Baxevanis, A.D., Davison, D.B., Page, R.D.M., Petsko, G.A., Stein, L.D., Stormo,
Protocol: Manual Protocol Employing Centrifugation Protocol. Protocols. Sequencing. G.D. (Eds.), Current Protocols in Bioinformatics. John Wiley & Sons, New York, pp.
CCDB. Available on line at: http://ccdb.ca/docs/CCDB_Advances_Methods_Release_ 6.5.1–6.5.14.
No1_Nov3rd_2006.pdf, Accessed 18 September 2013. Ronquist, F., Teslenko, M., van der Mark, P., Ayres, D.L., Darling, A., Höhna, S., Liu, L.,
Kabata, Z., Raibaut, A., Ben Hassine, O.K., 1971. Eubrachiella mugilis sp. nov. un copepode Suchard, M.A., Huelsenbeck, J.P., 2012. MrBayes 3.2: efficient Bayesian phylogenetic
parasite des muges de Tunisie 2. Bull. de l'Institut Nat. Scien. et Tech. d’Oceanogra, inference and model choice across large model space. Syst. Biol. 61 (83), 539-542.
Peche de Salammbo, pp. 87–93. Sardella, N.H., Timi, J.T., 1995. Parasite communities of Merluccius hubbsi from the
Kabata, Z., 1979. Parasitic Copepoda of British Fishes. The Ray Society, London. Argentinian-Uruguayan common fishing zone. Fish. Res. 27, 81–88.
Katoh, K., Standley, D.M., 2013. MAFFT multiple sequence alignment software version 7: Sardella, N.H., Etchegoin, J.A., Martorelli, S.R., 1995. Las comunidades parasitarias de
improvements in performance and usability. Mol. Biol. Evol. 30 (4), 772–780. Micropogonias furnieri (Corvina) en Argentina. Bol. Inst. Ocean. Venezuela, Univ.
Knoff, M., Luque, J., Takemoto, R.M., 1994. Parasitic copepods on Mugil platanus Günther, Oriente 34, 41–47.
(Osteichtyes, Mugilidae) from the coast of the state of Rio de Janeiro, Brazil. Rev. Schwarz, G., 1978. Estimating the dimension of a model. Ann. Stat. 6, 461–464.
Bras. Parasitol. Vet. 3, 45–56. Shiino, 1956. Copepods parasitic on Japanese fishes, 12. Family Lernaeopodidae. Rep.
Lanfear, R., Calcott, B., Ho, S.Y., Guindon, S., 2012. Partition Finder: combined selection Fac. Fish. Univer. Mie 2, 269–311.
of partitioning schemes and substitution models for phylogenetic analyses. Mol. Biol. Waugh, J., 2007. DNA barcoding in animal species: progress, potential and pitfalls.
Evol. 26 (6), 1695-1701. Bioessays 29 (2), 188–197.
Lebepe, M.C., Dippenaar, S.D., 2016. 2016. Bernard’s Brachiella sp., Parabrachiella

44

View publication stats