Lei et al.

Biotechnology for Biofuels 2012, 5:18

http://www.biotechnologyforbiofuels.com/content/5/1/18

RESEARCH Open Access

Expression of fatty acid synthesis genes and fatty

acid accumulation in Haematococcus pluvialis
under different stressors
Anping Lei1†, Huan Chen1†, Guoming Shen2, Zhangli Hu1, Lei Chen3 and Jiangxin Wang3,4*

Abstract
Background: Biofuel has been the focus of intensive global research over the past few years. The development of
4th generation biofuel production (algae-to-biofuels) based on metabolic engineering of algae is still in its infancy,
one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production.
Although fatty acid (FA) biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up
in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation.
Results: We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a
potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA
composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity,
high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion
treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed
much. Correlation analysis showed that acyl carrier protein (ACP), 3-ketoacyl-ACP-synthase (KAS), and acyl-ACP
thioesterase (FATA) gene expression had significant correlations with monounsaturated FA (MUFA) synthesis and
polyunsaturated FA (PUFA) synthesis.
Conclusions: We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and
may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to
improve microalgal biofuel quality and production.
Keywords: Biofuel, Gene expression, Fatty acid synthesis, Green microalgae

Background includes mainly palmitic acid, stearic acid, oleic acid,

With the economic development, fossil fuels from non- linoleic acid and other long-chain fatty acids and esters
renewable resources will eventually run out. According formed by alcohols [2]. Therefore, raw materials con-
to BP Statistical Review of World Energy 2010, two taining higher content of fatty acid (FA) should be cho-
main energy resources, crude oil and natural gas, may sen for biofuel production. However, the traditional
be used up in only 45.7 and 62.8 years, respectively [1]. biofuel were mainly derived from soybeans, corn, rape-
Thus there is an urgent need to find alternative new seed, castor oil and other crops, which inevitably induce
energy. Since biofuel is renewable, environmentally more serious food crisis. Microalgae biofuel is believed
friendly, safe to use, with wide applications, as well as to be a powerful potential solver to this issue [3-7] and
biodegradable, it has become a major focus on intensive biofuels from metabolic modified microalgae is regarded
global research and development of new energy. as the 4th generation of biofuels [8].
Although the composition of biofuel is complex, it The importance of screening high FA content micro-
algae species and optimization for large biomass culture
* Correspondence: jiangxin.wang@asu.edu conditions were recognized as early as in 1980s [9].
† Contributed equally Research in this area mainly focused on comparing FA
3
School of Chemical Engineering and Technology, Tianjin University, Tianjin,
People’s Republic of China composition in different microalgae and a variety of
Full list of author information is available at the end of the article

© 2012 Lei et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons
Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in
any medium, provided the original work is properly cited.
Lei et al. Biotechnology for Biofuels 2012, 5:18 Page 2 of 11
http://www.biotechnologyforbiofuels.com/content/5/1/18

stress on content and composition of the FA in microal- malonyl-CoA:ACP transacylase (MCTK) have been
gae [10-12]. Microalgal biofuels production has gained a deposited in the GenBank database under the accession
renewed interest in recent years but is still not econom- numbers, HM560033, HM560034, HM560035,
ically feasible due to several limitations related to algal HM560036, and HM560037, respectively. Together with
culture, for instance, at present, the cost of microalgal other two known FA synthesis genes, biotin carboxylase
biofuel is still much higher than conventional diesel (BC) and stearoyl-ACP-desaturase (SAD), total seven
[13]. It is well known that microalgae biofuels could not genes were investigated in this study (Figure 1).
make an impact on the fuel market until they are eco-
nomically feasible. One of the main barriers is the high Expression of FA synthesis related genes
producing cost due to our lacking of understanding of Haematocccus cells grown under different stress condi-
microalgal growth, metabolism and biofuels production. tions and were harvested for RNA isolation. cDNA
To address this important issue, scientists generally synthesis and gene expression of FA synthesis related
believe that metabolic engineering is an effective solu- genes were explored using quantitative real-time RT-
tion. In recent years, more emphasis focuses on disco- PCR. The results showed that the mRNA levels of most
vering metabolic engineering methods to improve selected genes were significantly or very significantly up-
content of microalgal FAs in vivo [14-17]. However, regulated under all stress conditions, with all genes were
though FA biosynthesis pathway in higher plants and up-regulated under Fe + AC and HT conditions, and
microalgae have been explored [10,18], multiple genes some genes, such as FATA, SAD and FAD, were more
expression and their relationship with FA synthesis in sensitive to treatments (Figure 2).
microalgae has not been fully reported. BC, as a subunit of acetyl coenzyme A carboxylase
Haematococcus pluvialis, a green microalga with high biotin carboxylase, involves in catalyzing acetyl-CoA to
commercial values that has the ability to synthesize and malonyl-CoA, the first step of de novo FA synthesis
accumulate large amounts of red carotenoid astaxanthin (Figure 1). It is intriguing that different conditions had
(ca. 2% of dry weight) under various stress conditions [12], various impacts on BC mRNA level (Figure 2a). For
is a good model to study FA accumulation as a potential instance, no change of BC mRNA was observed under
astanxanthin feedstock with FA as byproducts [19]. In this AC treatment, while 1,626 fold of up-regulation was
study, we cloned five main FA synthesis genes from H. detected under HT. The change was 4.8 fold under Fe
pluvialis (Figure 1), and explored their expression patterns treatment, however, the combined salinity treatment (Fe
using quantitative real-time RT-PCR under different treat- + AC) resulted in about 10 fold up-regulation, which
ments, such as high salt, high/low temperature, and nitro- was almost 2 fold of up-regulation under Fe. Under LT,
gen depletion. All treatment conditions selected had BC mRNA level was increased up to 4.8 fold, which was
impact on the accumulation of lipid and astaxanthin far lower than that of HT (1,626), indicating that FA
[12,20,21]. At the same time, FA contents and composi- biosynthesis in H. pluvialis is more sensitive to high
tion was analyzed by GC-MS to study the correlations temperature than low temperature. Depletion of nitro-
between FA synthesis and gene expression patterns. gen (NL) also induced BC expression level at about 1.3
The aims of this research were: i) to determine an fold. Student’s t test analysis showed that NL signifi-
environmental stress treatment potential for high FA cantly (p <0.05), Fe, Fe + AC, LT, and HT treatments
production and quality in this microalgae; ii) to explore very significantly (p <0.01) increased BC gene expres-
the correlations between the key synthesis genes and the sion, while AC alone treatment had no significant effect.
FA accumulation to target rate-limiting genes in the Multiple comparison analysis indicated that the gene
microalgal FA synthesis pathway, and iii) to target the expression of BC induced by Fe, AC, and Fe + AC were
key gene(s) responsible for high FA accumulation and significantly different between the single and combined
evaluate these candidate genes for metabolic engineering salinity treatment (data not shown).
for more biofuel production with high quality and less ACP is an important component in both FA and poly-
production cost. ketide biosynthesis with the growing chain bound during
synthesis as a thiol ester at the distal thiol of a 4’-phos-
Results phopantethiene moiety (Figure 1). Similar to BC gene,
Cloning of algal FA synthesis genes ACP mRNA was shown to react differently under differ-
Using degenerated primers (Table 1) and normal RT- ent conditions (Figure 2b). The most significant up-regu-
PCR, five genes were successfully cloned, verified and lation of ACP gene expression was observed under HT
submitted to NCBI GenBank. The nucleotide sequences with a 8.7 fold rise, while LT induced only 2.6 fold. Fe +
of cDNAs of 3-keto acyl-acyl carrier protein synthase AC salinity treatment induced 9 fold of ACP expression,
gene (KAS), acyl-acyl carrier protein thioesterase while separately salinity treatment increased less, at 1
(FATA), ω-3 fatty acid desaturase (FAD), ACP and and 0.4 fold under Fe and AC, respectively. Obviously,
Lei et al. Biotechnology for Biofuels 2012, 5:18 Page 3 of 11
http://www.biotechnologyforbiofuels.com/content/5/1/18

Acetyl-CoA
BC
Malonyl-CoA
ony
ACP, MCTK
Malonyl-ACP
ony
KAS
FATA
ee FA
Free F

8:0-A
C18:0-ACP
FAD SAD
C18:1-ACP
SQDG(18:3/16:0)
FAD FAD

DGDG(18:3/16:0) MGDG(18:3/16:3)
Figure 1 Pathways of lipid biosynthesis and acyl chain desaturation which are known or hypothesized to occur in green microalgae.
The assignment of candidate genes encoding enzymes catalyzing the reactions were also shown in the diagramm in this study Abbreviations:
ACP, acyl carrier protein; CoA, coenzyme A; DGDG, digalactosyldiacylglycerol; FA, fatty acid; MGDG, monogalactosyldiacylglycerol; SQDG,
sulfoquinovosyldiacylglycerol.

the combined salinity condition (Fe + AC) had higher

impacts on ACP gene expression than separately treat-
Table 1 Primers for real time RT-PCR in this study ments (Fe, or AC), implying a synergistic effect of Fe and
Gene name Primers for real time PCR (5’–3’) Product length (bp) AC on FA synthesis in H. pluvialis. LT treatment
BC F CAAGAAGGTGATGATCGCCA 120 induced ACP gene expression at 3.6 fold, only 37.6% for
R GACGTGCAGCGAGTTCTTGTC the effect of HT treatment, suggesting that ACP gene
ACP F CAGCTCGGCACTGACCTTG 120 may also be less sensitive to LT. The other conditions did
R CAAGGGTCAGCTCGAACTTCTC not induce ACP gene expression significantly.
The initiation of the FA elongation step, which
MCTK F GGTGAGGACAAGGCGGTG 120
extends the length of the growing acyl chain by two car-
R TCATCCTGGCCTTGAAGCTC
bons, requires MCTK to transfer malonyl moiety from
KAS F CACCCCACTCTGAACCAGGA 120
malonyl-CoA onto the acyl carrier protein (Figure 1).
R GACCTCCAAACCCGAAGGAG Very high induction of MCTK gene expression (2,261
FATA F AGACTCGTTCAGCGAGGAGC 120 fold) was observed under HT and LT caused about 1
R CATGCCCACAGCATGGTTC fold up-regulation, while NL and AC conditions did not
SAD F CCGAGCCCAAGCTTCTAGTG 120 cause significant change to its expression (Figure 2c). Fe
R TTTGCCTCCATGTAATCCCC treatment enhanced MCTK gene expression about 2
FAD F GTAGGTCACCACGTCCAGCC 120 fold, and combined salinity Fe + AC treatment induced
R CTTGATAGGCATGCTGGGTGT
about 5.4 fold. Multiple comparison analysis indicated
that there was significantly different between the single
ACT F ACCTCAGCGTTCAGCCTTGT 120
(Fe or AC alone) and combined salinity treatment (Fe +
R TGGTCCACGACACCATCAAC
AC) (data not shown).
Lei et al. Biotechnology for Biofuels 2012, 5:18 Page 4 of 11
http://www.biotechnologyforbiofuels.com/content/5/1/18

2000
1800 3200
1600
1400
BC **
14
ACP 2800
MCTK
2400 **
1200
1000
12 2000
800 1600

Relative expression level

Relative expression level

Relative expression level

600 10 * 1200
400 **
800
200
8 400
14
12 ** 6 10
10
8 8
4 **
6 ** 6
**
4 2 4
* **
2 *
2
0 0
control NL Fe AC Fe+AC LT HT 0
control NL Fe AC Fe+AC LT HT
Treatment control NL Fe AC Fe+AC LT HT
Treatment Treatment
5 700
KAS * 25
FATA 600
SAD
**

500
4
Relative expression level

400
*
Relative expression level

20

Relative expression level

300
200
3
* 15 ** 100
**
*
2
* 9
10 8
7
6
5
1
5 ** 4 * * *
*
* 3 **
2
0 1
0 0
control NL Fe AC Fe+AC LT HT
control NL Fe AC Fe+AC LT HT control NL Fe AC Fe+AC LT HT
Treatment Treatment 7000
Treatment **
6000
5000 FAD
4000
3000

Relative expression level

2000
1000

45
40 **
35
30
25
20 **
15 **
10 **
*
5
0
control NL Fe AC Fe+AC LT HT
Treatment

Figure 2 Gene expression detected by real time RT-PCR in control and stress treatment conditions. BC: Biotin carboxylase; ACP: Acyl
carrier protein; MCTK: Malonyl-CoA:ACP transacylase; KAS: 3-ketoacyl- ACP synthase; FATA: Acyl-ACP thioesterase; SAD: Stearoyl-ACP-desaturase;
FAD: ω-3 fatty acid desaturase.

KAS catalyzes the initial condensing reaction in FA AC combined treatment was less than that under Fe or
biosynthesis (Figure 1). Consistent with BC, ACP, and AC treatment alone. This indicated that for FATA, Fe +
MCTK, KAS gene expression was promoted by Fe + AC AC combined treatment had no synergistic but antago-
for about 3.5 fold, while Fe and AC separated treat- nistic effect.
ments induced its gene expression as 81% and 42% of SAD functions to position a single double bond into
that of control, respectively (Figure 2d). Under NL treat- an acyl-ACP substrate and is best represented by the
ment, 1.7 fold of KAS gene expression increase was also ubiquitous Δ9 18:0-ACP desaturase (Figure 1). Similar
observed. HT and LT treatments up-regulated KAS to FATA, SAD gene expression was significantly or very
mRNA levels at about 1.1 fold and 20% only, significantly induced by all treatments (Figure 2f). In
respectively. details, HT induced SAD mRNA levels about 625.0 fold,
FATA is the chain-length-determining enzyme in de while LT induced only for 2.5 fold as only 1/180 of that
novo biosynthesis of plant FAs (Figure 1). FATA mRNA under HT. Fe or AC treatment alone enhanced SAD
levels were up-regulated significantly or very signifi- gene expression 2.4 and 1.4 fold, respectively, compared
cantly under all treatments in this study, with 2.0 (NL), with 8.6 fold of up-regulation under combined treat-
2.9 (Fe + AC combined), 3 (LT), 9.9 (Fe), 13.8 (HT), ment Fe + AC. NL also increased SAD mRNA level at
and 18.8 fold changes (AC), respectively (Figure 2e). about 2.4 fold.
Interestingly, different from BC, ACP, MCTK, and KAS, The enzyme of FAD converts linoleic to alpha-linole-
the fold change of FATA gene expression under Fe + nic acid (C18:3n3) (Figure 1). It seemed that FAD was
Lei et al. Biotechnology for Biofuels 2012, 5:18 Page 5 of 11
http://www.biotechnologyforbiofuels.com/content/5/1/18

the most sensitive among all FA biosynthesis genes NL, AC and HT, the total FA (TFA) content was, 77.2,
selected in this study, since each treatment highly 71.39, and 72.04 mg g-1, respectively, which were con-
increased FAD gene expression in our study (Figure 2g). siderably higher than that observed under control condi-
HT treatment still had the highest enhance (5,947 fold), tions (58.4) (Table 2). Moreover, no significant
and NL had the lowest impact with 5.0 fold of up-regu- differences were found under the other stress treat-
lation. Fe up regulated SAD gene for 35.5 fold and AC ments. The percentage of saturated fatty acids (SFA)
enhanced 17.9 fold of FAD mRNA level. Interestingly, was significantly higher in cultures grown under NL
Fe + AC combined treatment only caused 12.8 fold (23.99%) and AC (31.06%) conditions compared to the
increase (p < 0.01), as only 36% and 71.5% of those control (20.2%).
under Fe or AC separately treatment, respectively. LT The total monounsaturated fatty acid (MUFA) content
treatment increased FAD mRNA levels at 8.90 fold. showed no significant differences between control and
stress conditions, except that contents of most MUFA
FA content and composition were significantly or very significantly increased under
With internal standard, our FA extraction efficiency was NL (C15:1, C16:1, C20:1, and C22:1) and HT (C16:1,
87.5% (data now shown). The FA profiles under treat- C18:1, C20:1, C22:1 and C24:1). Similarly, percentage of
ments were listed on Table 2. We detected 24 individual MUFA in total FA indicated no significant differences
FAs in H. pluvialis under different treatments. The between control and stress conditions, except for a
overall FA profile in H. pluvialis was similar under con- lower percentage in algae grown under AC condition
trol and stress conditions, and palmitic, stearic, oleic, (Table 2). Regarding polyunsaturated fatty acids (PUFA),
linoleic acids were the major components (Table 2), there were significant alternation (increase or reduction)
among which linoleic acid (C18:2n6) had the highest under stress conditions compared to the control (Table
content under most conditions in H. pluvialis. Under 2). For example, most PUFAs were significantly or very

Table 2 Fatty acid profile (mg/g dry weight) in control (C) and stress conditions (NL, Fe, AC, Fe + AC, LT and HT)
Fatty acids C NL Fe AC Fe + AC LT HT
C12:0 0.28 ± 0.04 0.33 ± 0.03 0.51 ± 0.04* 0.38 ± 0.04 0.41 ± 0.02* 0.17 ± 0.02 0.55 ± 0.04**
C14:0 0.65 ± 0.04 0.98 ± 0.05** 0.65 ± 0.02 0.82 ± 0.02 0.57 ± 0.02 0.59 ± 0.02 0.79 ± 0.02*
C15:1 0.60 ± 0.18 1.56 ± 0.07* 0.26 ± 0.01 0.38 ± 0.04 0.28 ± 0.07 0.19 ± 0.01 1.89 ± 0.31
C15:0 0.25 ± 0.02 0.31 ± 0.02 0.27 ± 0.02 0.25 ± 0.02 0.18 ± 0.01* 0.23 ± 0.01 0.24 ± 0.02
C16:1 0.70 ± 0.07 1.04 ± 0.11* 0.73 ± 0.06 1.02 ± 0.09 0.84 ± 0.03 0.65 ± 0.08 1.06 ± 0.09*
C16:0 12.71 ± 0.76 14.82 ± 0.96 13.45 ± 0.54 16.74 ± 0.28* 12.53 ± 0.32 11.84 ± 0.19 14.31 ± 0.39
C17:1 0.00 0.26 ± 0.02** 0.00 0.00 0.00 0.00 0.00
C17:0 0.23 ± 0.02 0.34 ± 0.03** 0.21 ± 0.01 0.27 ± 0.01 0.19 ± 0.02* 0.20 ± 0.01 0.31 ± 0.01*
C18:3n6 1.83 ± 0.12 2.57 ± 0.11* 0.99 ± 0.08* 1.05 ± 0.04* 0.67 ± 0.06** 2.66 ± 0.10** 1.38 ± 0.03*
C18:3n3 2.84 ± 0.51 0.34 ± 0.04* 3.84 ± 0.06 4.62 ± 0.85* 5.70 ± 0.45* 2.58 ± 0.31 3.86 ± 0.26*
C18:2n6 13.00 ± 1.02 22.45 ± 0.94** 10.85 ± 0.55 19.93 ± 0.42* 12.23 ± 0.83 11.05 ± 1.05 16.01 ± 0.14*
C18:1n9 11.18 ± 0.44 9.21 ± 1.62 13.21 ± 0.80 3.93 ± 0.53* 12.51 ± 0.67 12.19 ± 0.68 12.67 ± 0.32*
C18:0 4.79 ± 0.36 6.14 ± 0.25* 6.28 ± 0.26 9.71 ± 0.59** 7.23 ± 0.36* 4.07 ± 0.23 6.55 ± 0.26*
C20:4n6 1.77 ± 0.11 2.24 ± 0.09* 1.56 ± 0.08 1.24 ± 0.02* 0.78 ± 0.04** 2.27 ± 0.05* 1.49 ± 0.03
C20:5n3 0.99 ± 0.06 2.04 ± 0.06** 1.46 ± 0.07* 1.17 ± 0.03 0.50 ± 0.03** 1.28 ± 0.03* 0.74 ± 0.02**
C20:3n6 0.18 ± 0.02 0.23 ± 0.02 0.27 ± 0.06 0.35 ± 0.01** 0.24 ± 0.02* 0.22 ± 0.01 0.30 ± 0.07
C20:2 0.87 ± 0.09 1.18 ± 0.03* 1.24 ± 0.07 0.40 ± 0.01* 1.32 ± 0.08* 0.80 ± 0.07 1.32 ± 0.06*
C20:1 1.30 ± 0.10 1.56 ± 0.03* 1.91 ± 0.10 2.2 ± 0.04** 1.91 ± 0.14 1.24 ± 0.10 1.90 ± 0.09*
C20:0 0.35 ± 0.03 0.53 ± 0.03* 0.50 ± 0.02* 1.62 ± 0.15** 0.86 ± 0.04** 0.28 ± 0.03 0.61 ± 0.02**
C22:6n3 0.00 4.39 ± 0.42** 0.00 0.00 0.83 ± 0.02** 2.35 ± 0.24** 0.56 ± 0.02**
C22:1n9 3.19 ± 0.19 3.67 ± 0.09* 4.23 ± 0.26 3.69 ± 0.16 3.78 ± 0.33 3.19 ± 0.35 4.10 ± 0.04*
C22:0 0.16 ± 0.02 0.26 ± 0.00* 0.20 ± 0.02 0.73 ± 0.04** 0.39 ± 0.02** 0.12 ± 0.01 0.28 ± 0.02*
C24:1 0.14 ± 0.02 0.25 ± 0.05 0.46 ± 0.03** 0.13 ± 0.01 0.35 ± 0.07 0.16 ± 0.00 0.34 ± 0.05**
C24:0 0.40 ± 0.13 0.54 ± 0.19 0.45 ± 0.12 0.76 ± 0.21 0.67 ± 0.13 0.47 ± 0.06 0.78 ± 0.10*
TFA 58.41 ± 4.35 77.24 ± 5.26* 63.53 ± 3.28 71.39 ± 3.61* 64.97 ± 3.78 58.87 ± 3.66 72.04 ± 2.41*
Lei et al. Biotechnology for Biofuels 2012, 5:18 Page 6 of 11
http://www.biotechnologyforbiofuels.com/content/5/1/18

significantly increased under NL condition. This Discussion

increase may be attributed to higher proportions of lino- Extreme environmental conditions, such as nitrogen
leic (C18:2n6), eicosapentaenoic acid (EPA, C20:5n3) depletion [11,19], high salinity [23], high light intensity
and docosahexanoic acid (DHA, C22:6n3). Similar [19,24] as well as extreme temperatures [25], were
increase of EPA was observed under Fe + AC, LT and intensively reported to induce the FA accumulation in
HT conditions. several microalgae. Thus, we were interested in evaluat-
ing the correlations between FA accumulation and these
Fatty acid methyl esters (FAME) quality for biodiesel stress conditions in H. pluvialis cultures.
FAs are precursors for biodiesel production. According Our results indicated that all treatments selected in this
to recent studies [22], the FA profile of microalgae has a study increased FA contents in H. pluvialis, which is
significant influence on the fuel properties of biodiesel, highly consistent with previous reports [23,26]. The ana-
such as cetane number (CN), iodine number (IN) and lysis of FA profile suggested that saturated FAs in H. plu-
saponification number (SN). Our analysis indicated that vialis mainly included C16:0 and C18:0, content
conditions selected in this study had no significant percentage of TFA was 19.2-23.5% and 6.9-13.6%, respec-
impact on SN, IN and CN (Figure 3). tively. Unsaturated FAs were C18:1n9, C18:2n6, C18:3n3,
As shown in Figure 3, the SN changes were slight C18:3n6, C20:4n6 and C20:5n3, with content percentage
under different conditions with a range of 201.9-205.7 of 35.5-52.9%, which was in accordance with what [27]
(Figure 3a), while little reduction of IN was observed reported. Previous study indicated that NL could increase
under Fe, AC, Fe + AC and HT, and little increase both TFA and the proportion of unsaturated FAs, our
under NL and LT around 120.5-121.5 (Figure 3b). The study once again verified this conclusion. What’s more,
CN of the FAME under different conditions were calcu- we noticed that DHA content was increased from 0 to
lated and compared (Figure 3c). The CN values under 4.4% (dry weight of algal cells), indicating that DHA
different conditions were relatively high, ranging from could be highly induced by NL. Fe treatment increased
45.9 to 51.6. However, little difference of CN values was EPA content of algal by 48%, and the proportion of other
observed under different conditions, with a minimum PUFAs was also significantly increased, indicating that Fe
CN values under NL condition. Based on SN and IN also could increase the content of unsaturated FAs [28].
analysis, the increase of MUFA and PUFA was the key Many previous studies pointed out that temperature
to the reduction of CN under NL condition. could affect the FA content, with higher TFA content
under lower temperature [29] and low temperature
Correlations between gene expression and FA profile induced the accumulation of PUFAs [30]. In this study,
We determined both expression of key FA biosynthesis we found that high temperature was more inductive for
genes and FA profile under different treatments. To accumulation of FAs, with 24% more of TFA than that at
study the relationship between gene expression and FA low temperature, which is different from previous find-
profile, Pearson Correlation analysis (SPSS13.0) was car- ings [29]. Treating cells with the maximum temperature
ried out and specific results were summarized in Table of 28°C may have not stressed microalgae cells enough in
3. that report [31]. Our HT treatment was under 42°C,
Based on the summary on Table 3, the correlations under this condition growth of algal cells was signifi-
between different FAs and gene expression were differ- cantly inhibited. However, consistent with the previous
ent. ACP, KAS, and FATA shared close correlations report [31], we detected that HT treatment decreased
with FAs, while the other did not. For instance, C12:0 unsaturated FA content and increased significantly satu-
had significant positive correlations with all selected rated FA content, such as C18:3n6, C20:4n6, C20:5n3,
genes (Table 3). ACP gene expression shared negative C22:6n3 under HT were only 51.9%, 65.6%, 57.8%, 23.8%
correlations with C15:0, C17:1, C18:3n6, C18:2n6, of low-temperature treatment.
C20:4n6, C20:5n3, and positive correlation with In this study, the highest FA content was obtained in
C18:1n9, C20:2, C20:1, C22:1n9, and C24:1. KAS gene H. pluvialis growing under NL. Whereas the FA profile
expression had negative correlations with C15:0, was qualitatively similar in NL, AC, and HT stress con-
C18:3n6 and C20:4n6, while it shared positive correla- ditions tested in H. pluvialis, some quantitative differ-
tions with C18:3n3, C18:0, C20:2, C20:1, C22:1n9, and ences should be highlighted: i) a significant increase of
C24:1. FATA gene expression was observed negatively C18:3n6 and a decline of C18:3n3 content were
correlated with synthesis of C17:1, C18:3n6, C20:4n6 observed in the microalgae cultured with NL, while
and C22:6n3, while it positively correlated with synthesis opposite observations were revealed under AC and HT;
of C18:3n3, C18:0, C20:1, C20:0, C22:1n9 and C24:1. ii) The percentage of cis-10heptadecenoic acid (C17:1)
The correlations between other genes and FA synthesis was only detectable in cultures growing under NL con-
were found not significant. ditions, and it was not detected or detected as trace in
Lei et al. Biotechnology for Biofuels 2012, 5:18 Page 7 of 11
http://www.biotechnologyforbiofuels.com/content/5/1/18

a 240
230
220
SN values 210
200
190
180
C NL Fe AC Fe+AC LT HT

b 140
120
100
IN value

80
60
40
20
0
C NL Fe AC Fe+AC LT HT

c 60
50
40
CN values

30
20
10
0
C NL Fe AC Fe+AC LT HT
Figure 3 The biodiesel quality of Haematococcus. a-c, SN, IN and CN values under different treatments, respectively. Error bars represent
standard error (n = 4).

previous studies of H. pluvialis [19]. The FA content H. pluvialis FA was proposed compatible with the
was high under stress conditions tested in our study, engines used today [19]. The most important properties
but not high enough to meet the reported amounts (30- of biofuel, such as SN, IN, CN were evaluated in this
40% dry weight) in other cysts [19]. Using the internal study. Usually, SN and IN could be used to characterize
FAME standards, the percentage of recovery in our FA FA or FAME quality for biodiesel. SN has a negative
analysis was 85%, indicating that it will be necessary to correlation with the FA chain length while IN is positive
further optimize our culture conditions for higher FA to the extent of unsaturation in FA, while CN is a prime
accumulation in this organism. For example, either indicator presenting the biodiesel quality. It could be
using CO2 supplementation [32] or a two-phase culture used to justify the biodiesel ignition quality which has
strategy could be implemented to obtain high biomass an effect on the startability and combustion process of
productivity and FA content. the diesel engine [33]. According to the FA profile
Lei et al. Biotechnology for Biofuels 2012, 5:18 Page 8 of 11
http://www.biotechnologyforbiofuels.com/content/5/1/18

Table 3 The correlations between gene expression and between gene expression in FA synthesis pathway and
fatty acid synthesis (cofactors, Pearson Correlation in FA profiling were often reported in higher plants
SPSS13 [34-37]. The FA profile under different treatments in
Fatty BC ACP MCTK KAS FATA SAD FAD microalgae were reported but without investigating
acids detailed connection with FA synthesis genes [19,26,38].
C12:0 0.524** 0.694** 0.522* 0.557* 0.766** 0.528* 0.525* In this study, under our stress conditions, all selected
C14:0 0.049 -0.472 0.052 -0.323 -0.130 0.046 0.051 genes were up-regulated with differeces in the extent for
C15:1 0.677** 0.167 0.678** -0.044 0.098 0.676 0.676 different stresses, however, the extent of upregulation is
C15:0 -0.207 -0.696** -0.207 -0.538* -0.447 -0.212 -0.206 not reflected in the FA profile. This indicates that the
C16:1 0.277 0.144 0.279 0.144 0.266 0.278 0.278 FA biosynthesis regulation occurs at different levels in
C16:0 0.044 -0.324 0.045 -0.259 0.177 0.042 0.046 the cell. Some further studies on regulatory aspects
could throw light on regulatory mechanism of FA
C17:1 -0.285 -0.634* -0.283 -0.374 -0.665** -0.289 -0.286
syntheis in H. pluvialis. The present study evaluated
C17:0 0.214 -0.257 0.216 -0.229 -0.078 0.211 0.215
both FA profile and expression patterns of genes
C18:3n6 -0.181 -0.534* -0.179 -0.545* -0.593* -0.185 0.182
involved in FA biosynthesis, and their correlation analy-
C18:3n3 0.291 0.695** 0.287 0.590* 0.703** 0.296 0.290 sis indicated that there were different correlations
C18:2n6 -0.079 -0.576* -0.076 -0.404 -0.311 -0.082 -0.079 between different FAs and genes. Our gene expression
C18:1n9 0.292 0.620* 0.290 0.459 0.121 0.295 0.291 analysis showed that all treatments could alter mRNA
C18:0 0.211 0.490 0.209 0.573* 0.858** -0.216 0.212 levels of all seven selected key genes. It was found that
C20:4n6 -0.229 -0.638* -0.227 -0.656** -0.612* -0.235 -0.229 under LT treatment, FAD gene expression was 8.87 fold
C20:5n3 -0.349 -0.681** -0.347 -0.49 -0.429 -0.353 -0.347 up-regulated, with higher content of C18:3n6 content
C20:3n6 0.215 -0.134 0.216 -0.267 0.381 0.214 0.218
(1.45 fold of the control), indicating that LT could
induce unsaturated FAD gene expression and improve
C20:2 0.367 0.717** 0.364 0.643** 0.301 0.372 0.366
the content of linolenic acid, which was consistent with
C20:1 0.329 0.620* 0.327 0.619* 0.880** 0.334 0.331
[35]. Results from further analysis showed that C12:0
C20:0 0.035 0.162 0.035 0.292 0.691** 0.038 0.037 had a significant or very significant positive correlation
C22:6n3 -0.241 -0.408 -0.240 -0.177 -0.635* -0.242 -0.243 with all selected genes, indicating that induced expres-
C22:1n9 0.375 0.693** 0.373 0.640* 0.751** 0.380 0.376 sion of FA synthesis genes could significantly affect
C22:0 -0.059 -0.106 -0.059 0.055 0.362 -0.058 -0.058 C12:0 levels. Since C12:0 is the shortest carbon chain
C24:1 0.346 0.730** 0.343 0.700** 0.597* 0.352 0.347 FAs and other longer-chain FAs are synthesized from
C24:0 0.116 -0.252 0.117 -0.296 -0.185 0.113 0.115 C12:0 as the backbone, the changes of expression of FA
TFA 0.287 0.002 0.287 0.117 0.227 0.288 0.287 synthesis genes could be very crucial.
Our detailed analysis of correlations between genes
and individual FAs provided some interesting hints for
observed in H. pluvialis, we could infer some of the fea- metabolic engineering of microalgal biofuel. For
tures of the biodiesel that we would obtain from this instance, One of particular notes is SAD gene expres-
alga. Since the standard ASTM D6751 for biodiesel sion and its relation with contents of C18:0 and
requires a minimum CN of 47, below which it will C18:1n9. SAD gene expression shared a certain degree
cause a delay, incomplete combustion and followed low of negative correlation with C18:0 (correlation coeffi-
engine power. In comparison, CN values under NL and cient -0.216), and had a positive correlation with
LT were slightly lower than those in the control, and C18:1n9 (correlation coefficient 0.295). This finding ver-
other treatment presented slightly higher CN values ified the function of this gene. Similarly, FAD gene was
compared to the control (48.3). The calculated CN proved a negative correlation with C18:2n6 (-0.079) and
values under different conditions were relatively high, a positive correlation with C18:3n3 (0.290). Thus, using
ranging from 45.9 to 51.6, suggesting FAME derived correlation analysis between FA profile and gene expres-
from H. pluvialis may be satisfactory as biodiesel. sion may detect some new important genes. According
Because of the high potential of microalgae as a bio- to this, we may further use DNA recombination techni-
diesel feedstock, detailed characterization of genes cru- ques to identify these potential genes associated with
cial in FA biosynthesis is of particular importance (for enhanced quality and production of desired FAs (i.e.,
further information refer to [16]). In this study, we EPA and DHA) and total FA in green microalgae.
cloned five key genes involved in FA biosynthesis and
investigated their gene expression pattern under differ- Conclusions
ent stress treatments, and evaluated their relationship In this study, we successfully cloned five key genes of
with the FA profile under treatments. The correlations FA synthesis in a green microalga H. pluvialis and
Lei et al. Biotechnology for Biofuels 2012, 5:18 Page 9 of 11
http://www.biotechnologyforbiofuels.com/content/5/1/18

correlations of gene expression and FA composition and synthesis was carried out using the Taqman Reverse
production were investigated under different environ- Transcription system according to manufacturer’s
mental stressors. These results expand our understand- instruction (Applied Biosystems, USA) and the protocol
ing of the genes and underlying molecular mechanisms previously described [39]. The RT-PCR amplicons with
that are involved in FA accumulation and response to the expected sizes were purified with the Wizard™ PCR
the multiple stresses. According to our results, we pro- Preps DNA Purification System (Promega, USA). In
posed that the key rate-limiting genes of FA synthesis addition to the five genes successfully cloned in this
may include ACP, KAS and FATA because their expres- study, another two genes available in Genbank, BC and
sion showed linear relationships with synthesis of FAs in SAD, were also employed for gene expression test.
H. pluvialis. These genes could be potential candidates TA Cloning Kit with One Shot TOP chemically com-
for better quality and higher production of FAs for petent E. coli (Invitrogen, USA) was used for cloning of
value-added products and biofuel using metabolic engi- PCR products. For sequence verification, both strands
neering techniques. were sequenced with an overlapping scheme throughout
the whole cDNA fragment. Sequences were analyzed
Methods using DNAclub (Xiongfong Chen, Cornell Univ., Ithaca),
Organism, growth medium and culture conditions and homology searching was carried out with the trans-
H. pluvialis strain 797 was obtained from Freshwater lated query against protein database (BlastX) and
Algae Culture Collection of the Institute of Hydrobiol- Nucleotide-nucleotide BLAST (BlastN) in GenBank
ogy and maintained at the College of Life Sciences, database.
Shenzhen University, China. Algae were incubated in
250 mL flasks, each containing 100 mL BBM [31], at Gene expression profiling: Real-time RT-PCR
light density of 20 μmol m -2 s-1 with a diurnal cycle of Real-time RT-PCR analysis was performed on an ABI
12 h light and 12 h dark at temperature of 22 ± 1°C. Prism 7900 Sequence Detection System (Applied Biosys-
Cultures were continuously aerated with 0.2 μm filtered tems, USA) following the protocol previously described
air through a mechanical pump. [12] using actin gene as the internal control.
The exponentially growing cultures (cell density
approximately 5 × 105 cells ml-1) were treated with var- Fatty acid methyl esters (FAME) transformation and FAME
ious stress conditions, such as high salinity, 450 μM analysis
FeSO4 (Fe) and 45 mM NaAC (AC), separately (Fe, AC) Total lipid extraction was performed as described by Lu
or combined (Fe + AC), high temperature (HT) (42°C), et al. [40] with slightly modifications. Briefly, 20 mg lyo-
low temperature (LT) (4°C), and nitrogen depletion philized cell was suspended in 1 mL 2 M NaOH-
(NL) for four days. Nitrogen depletion was achieved as CH3OH solution and shaken (100 rpm) for 1 h at room
harvesting and transferring cells to nitrogen depletion temperature (RT) and incubated at 75°C for 15 min.
medium. Collected algal cells were rinsed with PBS and After cooled down, the mixture was spiked with 1 mL 4
divided into replicate parts, one for RNA analysis and M HCl-CH3OH and pH was adjusted to below 2.0 with
gene cloning, and the other for FA profiling, stored at HCl, followed by incubation at 75°C for 15 min. After
-80°C if not immediately used. All experimental chemi- that, FAMEs were extracted with 1 mL hexane, shaking
cals and reagents were analytical grade. by hand for 30s and then centrifuged at 4,000 g for 2
min. The hexane phase was collected and stored at -20°
RNA isolation and cloning of FA synthesis pathway genes C for further GC-MS analysis. 100 μg of C19 FA was
RNA was isolated according to the miniprep RNA added before extraction to estimate the recovery rate.
extraction procedure [39] with minor modifications. Qualification and quantification of FAMEs were per-
Briefly, only 25 mL of cells were applied as the starters formed on a Thermo Trace GC Ultra gas chromato-
with 10 μL DEPC treated water as the RNA solution in graph coupled to Thermo Polaris Q mass spectrometry
this sduty. Nuclear acids were quantified by Nano-Drop which was equipped with a HP-5MS column (30 m ×
3.0 (Coleman Technologies Inc., USA). Both DNA and 0.25-mm id, film thickness 0.25 μm). The temperature
RNA solutions were aliquoted and stored at -80°C, if of the injector was maintained at 250°C. Helium was
not immediately used. used as the carrier gas and ions were generated by a 70
Using gene sequences retrieved from NCBI databases, eV electron beam and the mass range scanned was 50
such as those from green microalgae (i.e., Chlamydomo- to 650 m/z at a rate of 2 scan s-1. The oven temperature
nas reinhardtii), higher plants (i.e., Arabidopsis, cabbage, for FAME analysis was initially maintained at 70°C for 5
and cotton) and other organisms, degenerated primers min followed by a temperature rate of 5°C min-1 to 200°
(Additional file 1: Table S1) were designed and used for C and then held for 5 min, followed 5°C min-1 to 204°C
FA synthesis gene cloning. The first-strand cDNA and then held for 2 min, 5°C min-1 to 220°C and then
Lei et al. Biotechnology for Biofuels 2012, 5:18 Page 10 of 11
http://www.biotechnologyforbiofuels.com/content/5/1/18

held for 3 min, and 5°C min-1 to 255°C and then held Control; Fe: Addition of 450 μM FeSO4; Fe + AC: Addition of 450 μM FeSO4
and AC: 45 mM NaAC; HT: High temperature 42°C; LT: Low temperature 4°C;
for 5 min. Peak identification was performed by match- NL: Nitrogen depletion; SD: Standard deviation
ing the mass spectra of each compound with the
National Institute of Standards and Technology mass Acknowledgements
This research was supported by the National Basic Research Program of
spectral library. Automatic peak deconvolution was pro- China (National “973” program, project No. 2011CBA00803 and No.
cessed with Masslynx software (V4.1, Waters Corp., 2012CB721101), and the National Natural Science Foundation of China (Nos.
USA) [41]. The datasets of FAME profiling for further 31170491, 30770393, 31070323, 31000162).
analysis were obtained by normalized with the internal Author details
standards in the same chromatograms, respectively. 1
Shenzhen Key Laboratory for Marine Bio-resource and Eco-environment,
College of Life Sciences, Shenzhen University, Shenzhen 518060, P. R. China.
2
School of Food Science and Biotechnology, Zhejiang Gongshang University,
The analysis of microalgae biofuel quality Hangzhou 310012, P. R. China. 3School of Chemical Engineering and
The saponification number (SN), iodine number (IN) Technology, Tianjin University, Tianjin, People’s Republic of China. 4Center for
and cetane number (CN) were estimated by empirical Biosignature Discovery Automation, Biodesign Institute, Arizona State
University, Tempe AZ 85287, USA.
equations according to [42,43]. Those index factors were
predicted according to equations (1-3). Authors’ contributions
LAP, CH, SGM, CL and WJX participated in the design of experiments,
SN = (560 × Pi)/MWi (1) collected the data and drafted the manuscript. CH, SGM and HZL
participated in data collection. LAP, CH, SGM, HZL and WJX participated in
the design of experiments and helped write the manuscript. LAP, CH, CL
IN = (254 × D × Pi)/MWi (2) and WJX coordinated the research and helped to finalize the manuscript. All
authors read and approved the final manuscript.

CN = 46.3 + 5458/SN − 0.225 × IN (3) Competing interests

The authors declare that they have no competing interests.
Where SN is saponification number, IN is iodine Received: 30 December 2011 Accepted: 26 March 2012
number, CN is cetane number, Pi is the weight percen- Published: 26 March 2012
tage of each FAME, MWi is the molecular mass of indi-
vidual FAME, D is the number of the double bonds in References
1. BP statistical review of world energy 2010. [http://www.bp.com/liveassets/
each FAME. bp_internet/globalbp/].
2. Vicente G, Martínez M, Aracil J: Optimization of integrated biodiesel
Statistical analysis production. Part I. A study of the biodiesel purity and yield. Bioresour Technol
2007, 98:1724-1733.
All exposure experiments were repeated three times 3. Srivastava A, Prasad R: Triglycerides-based diesel fuels. Renewable
independently, and data were recorded as the mean with Sustainable Energy Rev 2000, 4:111-133.
standard deviation (SD). For gene expression experi- 4. Williams PJ: Biofuel: microalgae cut the social and ecological costs.
Nature 2007, 450:478.
ments, quantitative real-time PCR analysis was per- 5. Li Y, Horsman M, Wu N, Lan CQ: Dubois-Calero N: Biofuels from
formed using the BioRAD iQ5 software. For each gene, microalgae. Biotechnol Progr 2008, 24:815-820.
the fold change expressed as the mean ± SD (% control) 6. Pereira H, Barreira L, Mozes A, Florindo C, Polo C, Duarte CV, Custodio L,
Varela J: Microplate-based high throughput screening procedure for the
was calculated using the (standard curve) approximation isolation of lipid-rich marine microalgae. Biotechnol Biofuels 2011, 4:61.
corrected for primer efficiency and normalized to house- 7. Yuan C, Liu J, Fan Y, Ren X, Hu GG, Li FL: Mychonastes afer HSO-3-1 as a
keeping gene actin expression values. Statistical analyses potential new source of biodiesel. Biotechnol Biofuels 2011, 4:47.
8. Lü J, Sheahanb C, Fu P: Metabolic engineering of algae for fourth
were performed using the Student’s t test and Pearson generation biofuels production. Energy Environ Sci 2011, 4:2451-2466.
Correlation correlation analysis (SPSS13.0). For all of 9. Sheehan J, Dunahay T, Benemann J, Roessler P: A look back at the U.S.
the data analysis, a p-value <0.05 was considered statis- Department of Energy’s Aquatic Species Program - biodiesel from algae.
National Renewable Energy Laboratory, Golden, CO 1998, Report NREL/TP-
tically significant. 580-24190.
10. Harwood JL, Guschina IA: The versatility of algae and their lipid
Additional material metabolism. Biochimie 2009, 91:679-684.
11. Rodolfi L, Chini Zittelli G, Bassi N, Padovani G, Biondi N, Bonini G,
Tredici MR: Microalgae for oil: strain selection, induction of lipid
Additional file 1: Table S1. Primers used for gene cloning in this study. synthesis and outdoor mass cultivation in a low-cost photobioreactor.
Biotechnol Bioeng 2009, 102:100-112.
12. Wang J, Sommerfeld M, Hu Q: Occurrence and environmental stress
responses of two plastid terminal oxidases in Haematococcus pluvialis
Abbreviations (Chlorophyceae). Planta 2009, 230:191-203.
FA: Fatty acid; FAME: Fatty acid methyl esters; TFA: Total fatty acid; ACP: Acyl 13. Mata TM, Martins AA, Caetano NS: Microalgae for biodiesel production
carrier protein; BC: Biotin carboxylase; FATA: Acyl-ACP thioesterase; KAS: 3- and other applications: a review. Renewable Sustainable Energy Rev 2010,
ketoacyl-ACP-synthase; MCTK: Malonyl-CoA; ACP: Transacylase; SAD: Stearoyl- 14:217-232.
ACP-desaturase; FAD: ω-3 fatty acid desaturase; CN: Cetane number; IN: 14. Moellering ER, Benning C: RNA interference silencing of a major lipid
Iodine number; SN: Saponification number; MUFA: Mono- unsaturated fatty droplet protein affects lipid droplet size in Chlamydomonas reinhardtii.
acid; PUFA: Polyunsaturated fatty acid; AC: Addition of 45 mM NaAC; C: Eukaryot Cell 2010, 9:97-106.
Lei et al. Biotechnology for Biofuels 2012, 5:18 Page 11 of 11
http://www.biotechnologyforbiofuels.com/content/5/1/18

15. Radakovits R, Jinkerson RE, Darzins A, Posewitz MC: Genetic engineering of 40. Lu S, Wang J, Niu Y, Yang J, Zhou J, Yuan Y: Metabolic profiling reveals
algae for enhanced biofuel production. Eukaryot Cell 2010, 9:486-501. growth related FAME productivity and quality of Chlorella sorokiniana
16. Khozin-Goldberg I, Cohen Z: Unraveling algal lipid metabolism: Recent with different inoculum sizes. Biotech Bioengin 2012, DOI: 10.1002/
advances in gene identification. Biochimie 2011, 93:91-100. bit.24447.
17. Mutanda T, Ramesh D, Karthikeyan S, Kumari S, Anandraj A, Bux F: 41. Han PP, Yuan YJ: Metabolic profiling as a tool for understanding defense
Bioprospecting for hyper-lipid producing microalgal strains for response of Taxus cuspidata cells to shear stress. Biotechnol Progr 2009,
sustainable biofuel production. Bioresour Technol 2011, 102:57-70. 25:1244-1253.
18. Riekhof WR, Sears BB, Benning C: Annotation of genes involved in 42. Krisnangkura K: A simple method for estimation of cetane index of
glycerolipid biosynthesis in Chlamydomonas reinhardtii:discovery of the vegetable oil methyl esters. J Am Oil Chem Soc 1986, 63:552-553.
betaine lipid synthase BTA1Cr. Eukaryot Cell 2005, 4:242-252. 43. Azam MM, Waris A, Nahar NM: Prospects and potential of fatty acid
19. Damiani MC, Popovich CA, Constenla D, Leonardi PI: Lipid analysis in methyl esters of some non-traditional seed oils for use as biodiesel in
Haematococcus pluvialis to assess its potential use as a biodiesel India. Biomass Bioen 2005, 29:293-302.
feedstock. Bioresour Technol 2010, 101:3801-3807.
20. Sun Z, Cunningham FX, Gantt E: Differential expression of two doi:10.1186/1754-6834-5-18
isopentenyl pyrophosphate isomerases and enhanced carotenoid Cite this article as: Lei et al.: Expression of fatty acid synthesis genes
accumulation in a unicellular chlorophyte. Proc Natl Acad Sci USA 1998, and fatty acid accumulation in Haematococcus pluvialis under different
95:11482-11488. stressors. Biotechnology for Biofuels 2012 5:18.
21. Steinbrenner J, Linden H: Regulation of two carotenoid biosynthesis
genes coding for phytoene synthase and carotenoid hydroxylase during
stress-induced astaxanthin formation in the green alga Haematococcus
pluvialis. Plant Physiol 2001, 125:810-817.
22. Ramos MJ, Fernández CM, Casas A, Rodríguez L, Pérez Á: Influence of fatty
acid composition of raw materials on biodiesel properties. Bioresour
Technol 2009, 100:261-268.
23. Roessler PG: Environmental control of glycerolipid metabolism in
microalgae: commercial implications and future research directions.
J Phycol 1990, 26:393-399.
24. Zhukova NV, Titlyanov EA: Effect of light intensity on the fatty acid
composition of dinoflagellates symbiotic with hermatypic corals. Bot Mar
2006, 49:339-346.
25. Norman HA, Thompson GA: Effects of low-temperature stress on the
metabolism of phosphatidylglycerol molecular species in Dunaliella
salina. Plant Physiol Biochem 1985, 242:168-175.
26. Thompson GA: Lipids and membrane function in green algae. Biochim
Biophys Acta 1996, 13:17-45.
27. Chen D, Zhang A, Lai J, Cai M, Cheng Y: Gas chromatographic analysis of
fatty acid in Haematococcus pluvialis. Ocean Technol 2004, 23:62-65.
28. Wei D, Zhang M: Effects of Salinity and Fe2+ on growth and fatty acid
composition of Nannochloropsis oculata. The 11th Conference on
Phycological Society of China, Kunming, P.R. China 2001.
29. Cao CH, Sun SC, Mai KS, Ling Y: Effect of temperature on the total lipid
contents and fatty acid composition of 4 strains of marine green algae.
Sea-lake Salt Chem Industry 2006, 35:16-18.
30. Jiang H, Zhai J, Zhang Y, Gu H, Gao K: Influence of temperature on the
growth fatty acid composition of marine microalgae. Food Res Develop
2005, 26:9-12.
31. Andersen R: Algal culturing techniques. Elsevier Academic Press,
London;578.
32. Huntley ME, Redalje DG: CO2 mitigation and renewable oil from
photosynthetic microbes: a new appraisal. Mitigation Adapt Strat Global
Change 2007, 12:573-608.
33. Bamgboye AI, Hansen AC: Prediction of cetane number of biodiesel fuel
from the fatty acid methyl ester (FAME) composition. Int Agrophys 2008,
22:21-29.
34. Cheesbrough TM: Changes in enzymes for fatty acid synthesis and
desaturation during acclimation of developing soybean seeds to altered
growth temperature. Plant Physiol 1989, 90:760-764.
35. Iba K: Acclimative response to temperature stress in higher plants:
approaches of gene engineering for temperature tolerance. Ann Rev Submit your next manuscript to BioMed Central
Plant Biol 2002, 53:225-245. and take full advantage of:
36. Vega SE, del Rio AH, Bamberg JB, Palta JP: Evidence for the up-regulation
of stearoyl-ACP (D9) desaturase gene expression during cold
• Convenient online submission
acclimation. Am J Potato Res 2004, 81:125-135.
37. Upchurch RG: Fatty acid unsaturation, mobilization, and regulation in the • Thorough peer review
response of plants to stress. Biotechnol Lett 2008, 30:967-977. • No space constraints or color figure charges
38. Griffiths MJ, van Hille RP, Harrison STL: Selection of direct
transesterification as the preferred method for assay of fatty acid • Immediate publication on acceptance
content of microalgae. Lipids 2010, 45:1053-1060. • Inclusion in PubMed, CAS, Scopus and Google Scholar
39. Wang J, Zhang X, Chen Y, Sommerfeld M, Hu Q: Toxicity assessment of
• Research which is freely available for redistribution
manufactured nanomaterials using the unicellular green alga
Chlamydomonas reinhardtii. Chemosphere 2008, 73:1121-1128.
Submit your manuscript at
www.biomedcentral.com/submit