See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/354878620

Phylogeny of Dorstenia (Moraceae) reveals the polyphyletic nature of its

neotropical sections

Article  in  Rodriguesia · September 2021

DOI: 10.1590/2175-7860202172087

CITATION READS

1 313

5 authors, including:

Leandro Cardoso Pederneiras Vitor Hugo Maia

Instituto de Pesquisas Jardim Botânico do Rio de Janeiro Pontifícia Universidade Católica do Rio de Janeiro
78 PUBLICATIONS   512 CITATIONS    15 PUBLICATIONS   860 CITATIONS   

SEE PROFILE SEE PROFILE

Andrea Ferreira da Costa

Federal University of Rio de Janeiro/Museu Nacional
111 PUBLICATIONS   2,234 CITATIONS   

SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Systematic and Biogeographic studies of Bromeliads in Amazon View project

Erythrina L. (Leguminosae, Papilionoideae): taxonomy, phylogeny and biogeography View project

All content following this page was uploaded by Leandro Cardoso Pederneiras on 06 October 2021.

The user has requested enhancement of the downloaded file.

Rodriguésia 72: e00402020. 2021
http://rodriguesia.jbrj.gov.br
DOI: http://dx.doi.org/10.1590/2175-7860202172087

Original Paper
Phylogeny of Dorstenia (Moraceae) reveals the polyphyletic nature
of its neotropical sections

Marcelo Dias Machado Vianna-Filho1,2,3,8, Leandro Cardoso Pederneiras1,2,5,8, Vitor Hugo Maia4,
Andrea Ferreira da Costa2,6 & Vidal de Freitas Mansano1,7,9

Abstract
Dorstenia, the second largest genus of Moraceae, comprises nine sections that are mainly found in Africa
and America. Two of them are woody macrospermous, and the other seven are herbaceous microspermous.
There are three sections in the Neotropics, all of which are herbaceous and taxonomically complex owing
to their great morphological similarity. The most recent molecular phylogenetic studies of Dorstenia
suggested that the neotropical sections are polyphyletic. These studies also showed that the neotropical
species represent a sister group to an African woody macrospermous grade rather than African herbaceous
microspermous plants. We have now expanded the number of taxa sampled and included other molecular
markers to determine whether the previous phylogeny are to be corroborated or whether new taxonomic
interpretations are to be followed. This study inferred the phylogeny of the group based on ITS, ETS,
and trnL-F regions from 40 of the 58 neotropical species and added a new African taxon, thus including
17 of the 60 known species. Our results reaffirmed the polyphyletic nature of the neotropical sections.
Dorstenia sect. Acauloma emerged within the main clade of D. sect. Kosaria (both African species), a
result that confirms the affinity of these taxa already observed in previous morphological studies. We
suggest Dorstenia sect. Dorstenia as the only neotropical section.
Key words: molecular markers, neotropics, phylogeny, plant evolution, rosids.
Resumo
Dorstenia, o segundo maior gênero de Moraceae, compreende nove seções encontradas principalmente na
África e na América. Duas delas são macrospermas lenhosas e os outros sete são microspermas herbáceas.
Existem três seções na região Neotropical, todas herbáceas e taxonomicamente complexas devido à sua
grande semelhança morfológica. Os estudos filogenéticos moleculares mais recentes sugerem que as seções
neotropicais são polifiléticas. Esses estudos também mostraram que as espécies neotropicais representam
um grupo irmão de um grado de macrospermas lenhosos africanos, em vez de microspermas herbáceos. No
presente trabalho, expandimos o número de taxa amostrados e incluímos outros marcadores moleculares
para determinar se a filogenia anterior deve ser corroborada e se novas interpretações taxonômicas devem
ser seguidas. Este estudo inferiu a filogenia do grupo com base nas regiões ITS, ETS e trnL-F de 40 das
58 espécies neotropicais e adicionou um novo táxon africano, incluindo 17 das 60 espécies conhecidas.
Nossos resultados reafirmaram a natureza polifilética das seções neotropicais. Dorstenia sect. Acauloma

See supplementary material at <https://doi.org/10.6084/m9.figshare.16569552.v1>

1
Instituto de Pesquisas Jardim Botânico do Rio de Janeiro, DIPEQ, Jardim Botânico, Rio de Janeiro, RJ, Brazil.
2
Universidade Federal do Rio de Janeiro, Museu Nacional, Prog. Pós-graduação em Ciências Biológicas (Botânica), Quinta da Boa Vista, São Cristóvão, Rio de
Janeiro, RJ, Brazil.
3
Universidade de Coimbra, Instituto do Ambiente, Tecnologia e Vida/ Jardim Botânico da Universidade de Coimbra, Calçada Martim de Freita, Pólo, Coimbra,
Portugal. ORCID:<0000-0002-9806-1455>.
4
Pontifícia Universidade Católica do Rio de Janeiro, Centro de Ciências Biológicas e da Saúde, Depto. Biologia, Gávea, Rio de Janeiro, RJ, Brasil. ORCID:
<https://orcid.org/0000-0003-2135-7650>.
5
ORCID: <https://orcid.org/0000-0003-1822-227X>. 6 ORCID: <https://orcid.org/0000-0002-9200-4222>. 7 ORCID: <https://orcid.org/0000-0002-7204-0744>.
8
The first two authors contributed equaly to this work.
9
Author for correspondence: vidalmansano@gmail.com
2 de 13 Vianna-Filho MDM et al.

surgiu dentro do clado principal de D. sect. Kosaria (ambas espécies africanas), resultado que confirma a
afinidade desses táxons já observada em estudos morfológicos anteriores. Nós sugerimos Dorstenia sect.
Dorstenia com a única seção neotropical, porém maiores estudos moleculares são necessários.
Palavras-chave: marcadores moleculares, Neotrópico, filogenia, evolução das plantas, Rosídeas.

Introduction Africa). Carauta (1978), Berg (2001), Vianna-Filho

The mulberry family, Moraceae, contains (2012), and Santos et al. (2016) pointed out that the
39 genera and approximately 1,100 species that circumscription of the three neotropical sections is
are globally distributed throughout tropical and problematic (D. sect. Dorstenia, D. sect. Emygdioa,
temperate regions (Berg 2001; Zerega & Gardner and D. sect. Lecania) because there are no clear
2019). Dorstenia L. is the second largest genus morphological character states to segregate them.
of Moraceae, with approximately 115 species Although the last taxonomic revisions (Berg
(Berg & Hijman 1999; Vianna-Filho et al. 2016). & Hijman 1999; Berg 2001) have proposed a
Clement & Weiblen (2009), Gardner et al. (2017), sectional classification and discussed the closest
and Zerega & Gardner (2019) suggested that this phylogenetic relationships between these groups
genus together with Brosimum, Trymatococcus, and species, there are few studies based on the
Helianthostylis and others comprise the tribe molecular phylogeny of Dorstenia. The two
Dorstenieae. The species are distributed in tropical best-sampled phylogenetic analyses of Dorstenia
America (ca. 45 species), Africa (ca. 60 species), (Misiewicz & Zerega 2012; Zhang et al. 2019)
India, and Sri Lanka (1 species; Carauta 1978; Berg considered the genus to be monophyletic and
& Hijman 1999; Berg 2001) where they inhabit suggested that the previous taxonomical sections
the undergrowth of lowland rainforests, slopes were polyphyletic. An interesting finding was
near streams, and rocky areas (Carauta 1978; Berg the position of D. elliptica Bureau, a woody
2001). macrospermous plant, as a sister of all neotropical
The genus Dorstenia is morphologically species (Misiewicz & Zerega 2012; Zhang et al.
characterized by its herbaceous habit, but there are 2019).
a few succulent and woody species (Fig. 1). Their New possibilities have emerged after
inflorescences are primarily monoecious, with a fundamental analyses by two molecular studies on
flattened, expanded receptacle (the coenanthium) Dorstenia, which mainly focused on biogeography
with minute both staminate and pistillate flowers and character evolution (Misiewicz & Zerega 2012;
that are often tightly packed together; drupaceous Zhang et al. 2019). In the Neotropics, for example,
fruits with an explosive dehiscence; and seeds that it was necessary to sample a larger number of taxa
are either macrospermous or microspermous (Berg in order to determine the degree of monophyletic
2001; De Granville 1971; Misiewicz & Zerega or polyphyletic sections/species evidenced by the
2012; Vianna-Filho et al. 2016). first phylogenies. Misiewicz & Zerega (2012)
Berg & Hijman (1999) and Berg (2001) analyzed 15 neotropical (27% of the total) and
subdivided the genus into nine sections: Dorstenia 18 African (30% of the total) species, and Zhang
sect. Nothodorstenia Engl. (five woody species et al. (2019) analyzed 25 neotropical (55% of
in Africa), D. sect. Xylodorstenia Hijman (six the total), 29 African (48% of the total), and one
woody species in Africa), D. sect. Lecania Carauta Asian (100% of the total) species. By increasing
(ca. 25 herbaceous species in the Neotropics and the set of neotropical taxa analyzed and using three
two in Africa), D. sect. Lomatophora Hijman (26 molecular markers for the analysis, we can improve
herbaceous species in Africa), D. sect. Dorstenia our understanding on the neotropical evolutionary
(12 herbaceous species in the Neotropics, sensu history and make better decisions about the
Carauta 1978), D. sect. Kosaria (Forssk.) Fisch. taxonomic subdivisions (sections).
& C.A. Mey. (ca. 20 caulescent species in Our objectives were to determine whether the
Africa and Asia), D. sect. Bazzemia Hijman (one genus Dorstenia is monophyletic and if the sections
acaulescent species in Mozambique), D. sect. remain polyphyletic after with the increase of taxa
Emygdioa Carauta (ca. 20 acaulescent species in sampled in the phylogeny. We also discuss the
the Neotropics), and D. sect. Acauloma Hijman phylogenetic groupings based on morphological
(three succulent acaulescent tubiferous species in data, and propose further taxonomic changes.

Rodriguésia 72: e00402020. 2021

Phylogeny of Dorstenia 3 de 13

Material & Methods Carauta 1978; Berg & Hijman 1999; Berg 2001;
Taxon sampling Castro & Rappini 2010; McCoy & Massara 2008;
Our sampling included 57 species of ca. Santos & Romaniuc 2012; Santos et al. 2013;
115 Dorstenia species currently recognized (e.g., Machado & Vianna-Filho 2012; Chase et al. 2013;

e d
Figure 1 – a-e. Examples of Dorstenia’s diversity – a-d. Neotropical species – a. D. elata, a well-known D. sect.
Lecania with long stems; b. D. cayapia, a geophyte species within D. sect. Emygdioa; c-d. D. arifolia and D. ramosa,
respectively, two closely related species within D. sect. Dorstenia, which differ in their inflorescence; e. D. foetida,
a Paleotropical succulent species of D. sect. Kosaria.
Rodriguésia 72: e00402020. 2021
4 de 13 Vianna-Filho MDM et al.
Leal 2014; Machado et al. 2014; Rzepecky 2016), Moraceae genera (e.g., Weiblen 2000; Datwyler
encompassing 72% of the neotropical species (40 & Weiblen 2004; Weiguo et al. 2005; Rønsted et
species out of ca. 55) and 28% (17 species out of al. 2008; Clement & Weiblen 2009; Pederneiras
ca. 60) of the African species. In some cases, two or et al. 2015).
more individuals per species were analyzed, a total The polymerase chain reaction (PCR)
of 92 terminals (88 Dorstenia plus four outgroup preparations contained 25 ng of DNA template, 1
terminals; see Table 1 for a list of sequences and × reaction buffer (10 × 10 mM Tris-HCl, pH 8.5,
their provenance). The phylogeny was rooted 50 mM KCl, 1.5 mM MgCl2, 0.01% gelatin), 0.2
in Helianthostylis sprucei Baill., Brosimum mM dNTPs, 10 pmol of each primer, and 2.5 units
guianense (Aubl.) Huber, B. alicastrum Sw., and of Taq DNA polymerase, which resulted in a final
Trymatococcus amazonicus Poepp. & Endl. volume of 50 µL. The ITS and ETS primers made
The relationships among neotropical up 4% of the DMSO total reaction volume. The
Dorstenia species were analyzed by sampling BSA was added to a final concentration of 0.5 µg/
taxa from different sections, including samples µL. The following PCR profiles were used: trnL-F:
from the type localities. Dorstenia sect. Dorstenia 94 °C for 2 min, 35 cycles: 94 °C for 1 min, 48 °C
was represented by 14 species (including the for 1 min, 72 °C for 1 min, and 72 °C for 7 min;
type species), D. sect. Lecania was represented ITS: 94 °C for 5 min, 30 cycles: 94 °C for 1 min,
by 14 species out of ca. 25 species (including the 50 °C for 1 min, 72 °C for 1 min, and 72 °C for 7
type species), and D. sect. sect. Emygdioa was min; ETS: 94 °C for 1 min, 40 cycles: 94 °C for
represented by 12 out of 20 species (including the 30 sec, 55 °C for 30 sec, 72 °C for 30 min, and
type species). 72 °C for 5 min.
We did not use the HQ214090, HQ214096, The PCR products were purified and
and HQ214105 samples, which represent, according sequenced at Macrogen Inc., Seoul, South Korea.
to Misiewicz & Zerega (2012), the African taxa The sequencing was conducted under the BigDyeTM
Dorstenia variifolia Engl., D. tayloriana Rend., Terminator v3.1 cycling conditions. Then, the PCR
and D. cuspidata Hochst. ex A. Rich., respectively, products were purified using ethanol precipitation
despite the fact that they seem to have emerged and run using an ABI3730XL automatic sequencer.
from within the neotropical clade. However, All sequences generated for this study were
this was a very doubtful result due to the strong deposited in GenBank (Tab. 1).
morphological dissimilarity between the African The sequences were assembled and edited
and neotropical species. The study by Zhang et al. with Geneious Pro 5.0.4 software (Biomatters Ltd.).
(2019) confirmed that these taxa were not part of Prior to assembly, the sequences were trimmed
the neotropical clade and, therefore, we have not based on the quality values of the traces using
included them in our data matrix. the Modified-Mott algorithm, which is part of the
software. The contig quality was assessed using
DNA extraction and sequencing the confidence mean value, which is the mean of
Genomic DNA was extracted from leaf the confidence scores for the contig base calls.
material that had been dried in silica gel according Sequence alignments were conducted by Muscle
to the CTAB protocol of Doyle & Doyle (1987). 3.7 (Edgar 2004) using the default parameters, and
The plant material was ground in Eppendorf tubes subsequently checked by visual inspection.
containing metal beads, and the DNA samples were
stored in the Brazilian Flora DNA Bank of the Rio Phylogenetic analyses
de Janeiro Botanical Garden. Our study included two phylogenetic
The phylogenetic relationships among the approaches (maximum likelihood [ML] and
neotropical species were inferred using three Bayesian inference [BI]) for each of the four
molecular markers: ITS4/ITS5 for the internal datasets (ETS, ITS, trnL-F, and all together), and
transcribed spacer region (ITS; White et al. 1990) there was total of eight phylogenetic trees (strict
of nuclear ribosomal DNA, the trnL-F region consensus tree in ML; 50% majority consensus
(including the trnL intron and the trnL-F spacer; in BI). The best-fit model was estimated for
Taberlet et al. 1991), and the external transcribed nucleotide substitution by AIC, which is part of
spacer regions (ETS-Hel-1/18S-ETS; Baldwin & the jModeltest (version 0.0.1) package, and the
Markos 1998) (Tab. 2). These regions can be used model selected was GTR+G. In the ML analysis,
to resolve relationships among and/or within the RAxML 8.2.12 (Stamatakis 2014) was used for

Rodriguésia 72: e00402020. 2021

Phylogeny of Dorstenia 5 de 13

Table 1 – Voucher information and Genbank accession numbers of the plant material included in this study. GenBank
codes in bold are the new molecular sequences generated by this article. The number next to the species name is the
laboratory number.
Name Voucher Origin ETS ITS trnL-F
Brosimum alicastrum 70 Moreira (RB 422381) Brazil, Amazonas MT726149 MT726054 MT726106
Brosimum guianense 69 Rodarte A.T.A. 163 (R) Brazil, Rio de Janeiro MT726150 MT726055 MT726107
Dorstenia acangatara 73 Machado 875 et al. Brazil, Espírito Santo MT726151 MT726056 MT726108
(HUEFS)
Dorstenia africana Carvalho 5308 HQ214078
Dorstenia africana van der Burgt et al. 527 HQ214077
Dorstenia albertorum 43 Vianna-Filho 2003 (RB) Brazil, Espírito Santo MT726152 MT726057 MT726109
Dorstenia albertorum 52 Vianna-Filho 2004 (RB) Brazil, Espírito Santo MT726153 MT726058 MT726110
Dorstenia alta Ntemi Sallu 638 HQ214081
Dorstenia alta Ndangalasi & Rajabu HQ214082
Dorstenia arifolia Carvalho 7169 HQ214101
Dorstenia arifolia 22 Pederneiras & Vianna- Brazil, Rio de Janeiro MT726154 MT726059 MT726111
Filho 472 (R)
Dorstenia asaroides 35 Carvalho (RB 488301) Brazil, Minas Gerais MT726155 MT726060 MT726112
Dorstenia asaroides Nee 42307 HQ214107
Dorstenia bahiensis 5 Vianna-Filho 2510 (RB) Brazil, Bahia MT726156 MT726062 MT726113
Dorstenia bahiensis 41 Vianna-Filho 2501 (RB) Brazil, Bahia MT726061
Dorstenia barnimiana 29 Vianna-Filho 2511 (RB) Ethiopia, cultivated MT726063 MT726114
Dorstenia benguellensis Mkeya et al. 1109 HQ214102
Dorstenia bonijesu 21 Machado (RB 488318) Brazil, Espírito Santo MT726157 MT726064 MT726115
Dorstenia bonijesu 30 Fraga 2504 (RB) Brazil, Espírito Santo MT726065
Dorstenia bowmaniana 50 Vianna-Filho 2024 (RB) Brazil, São Paulo MT726158 MT726066 MT726116
Dorstenia brasiliensis 38 Hatschbach 11356 (RB) Brazil, Paraná MT726159 MT726067 MT726117
Dorstenia brasiliensis Heringer et al. 735 HQ214110
Dorstenia brasiliensis Jansen-Jacobs et al. 4436 HQ214111
Dorstenia brownii Mwangoka et al. 3606 HQ214094
Dorstenia caatingae 65 Melo 8433 (HUEFS) Brazil, Bahia MT726160 MT726068 MT726118
Dorstenia caatingae 66 Melo 5921 (HUEFS) Brazil, Bahia MT726069
Dorstenia capricorniana Monteiro et al. 500 Brazil, Minas Gerais MT726161 MT726070 MT726119
45 (CESJ)
Dorstenia carautae 10 Silva 1953 (RB) Brazil, Paraná MT726162 MT726071 MT726120
Dorstenia cayapia 3 Vianna-Filho (RB Brazil, Rio de Janeiro MT726163 MT726072 MT726121
488317)
Dorstenia cayapia Prance et al. 19219 HQ214109
Dorstenia choconiana R. Aguilar 11753 FJ916995
(NY1096054)

Rodriguésia 72: e00402020. 2021

6 de 13 Vianna-Filho MDM et al.

Name Voucher Origin ETS ITS trnL-F

Dorstenia choconiana G.Weiblen 1417 (MIN) HQ214085
Dorstenia conceptionis 19 Carvalho (RB 58223) Brazil, Minas Gerais MT726164 MT726073 MT726122
Dorstenia contrajerva 6 Vianna-Filho 2502 (RB) Without provenance, MT726165 MT726074 MT726123
cult.
Dorstenia contrajerva Martinez et al. 28913 HQ214100
Dorstenia contrajerva Chavarria 809 HQ214099
Dorstenia djettii Amponsah et al. 1413 HQ214076
Dorstenia dolichocaula 47 Vianna-Filho 2020 (RB) Brazil, Rio de Janeiro MT726166 MT726075 MT726124
Dorstenia drakena Koch et al. 87195 HQ214097
Dorstenia drakena Salas et al. 2105 HQ214098
Dorstenia elata 42 Carrijo 936 et al. (R) Brazil, Rio de Janeiro MT726167 MT726076 MT726125
Dorstenia elata Mello-Silva et al. 1563 HQ214087
Dorstenia elliptica Nning 20 HQ214075
Dorstenia elliptica Thomas et al. 6990 HQ214074
Dorstenia excentrica Nee 22374 HQ214113
Dorstenia excentrica Misiewicz & Zerega, HQ214112
unvouchered
Dorstenia fawcettii Crosby et al. 770 HQ214114
Dorstenia fischerii 20 Hottz (RB 488302) Brazil, Rio de Janeiro MT726168 MT726077 MT726126
Dorstenia foetida 34 Vianna-Filho (RB Ethiopia, cultivated MT726078 MT726127
488307)
Dorstenia foetida Zerega 312 HQ214104
Dorstenia gracilis 23 Vianna-Filho (R 216119) Brazil, Espírito Santo MT726169 MT726079 MT726128
Dorstenia grazielae 17 Vianna-Filho 2019 (RB) Brazil, Rio de Janeiro MT726170 MT726080 MT726129
Dorstenia hildebrandtii 26 Vianna-Filho (RB488304) Without provenance, MT726171 MT726081 MT726130
cult.
Dorstenia hildebrandtii Zerega 311 HQ214103
Dorstenia hildegardis 44 Vianna-Filho 2004 (RB) Brazil, Espírito Santo MT726172 MT726082 MT726131
Dorstenia hirta 11 Vianna-Filho 2015 (RB) Brazil, Rio de Janeiro MT726173 MT726083 MT726132
Dorstenia hirta Souza et al. 21 HQ214088
Dorstenia holstii Ntemi Sallu 645 HQ214091
Dorstenia kameruniana Kibure & Bofu 1045 HQ214079
Dorstenia lindeniana 55 Gerrit 36958 (MO) Belize, Toledo MT726084 MT726133
Dorstenia lindeniana Alvarez 2721 HQ214083
Dorstenia mannii 56 Walthers 612 (MO) MT726085
Dorstenia mannii Gereau 5593 HQ214095
Dorstenia mariae 31 Fraga 2474 (RB) Brazil, Espírito Santo MT726174 MT726086 MT726134
Dorstenia maris 53 Vianna-Filho 2014 (RB) Brazil, São Paulo MT726176 MT726088 MT726136

Rodriguésia 72: e00402020. 2021

Phylogeny of Dorstenia 7 de 13

Name Voucher Origin ETS ITS trnL-F

Dorstenia maris 16 Vianna-Filho 2011 (RB) Brazil, Mangaratiba MT726175 MT726087 MT726135
Dorstenia milaneziana 46 Machado (R 691404) Brazil, Espírito Santo MT726177 MT726089 MT726137
Dorstenia milaneziana Thomas et al. 11078 HQ214086
Dorstenia nummularia Acevedo-Rodriguez et al. HQ214115
6439
Dorstenia paraguariensis Ortiz 218 HQ214108
Dorstenia peruviana 54 Fuentes 4353 (MO) Bolivia, without locality MT726090 MT726138
Dorstenia peruviana Plowman 5904 HQ214084
Dorstenia picta Gereau et al. 5189 HQ214089
Dorstenia psilurus W.R.Q.Luke 10351Z Congo, Lokutu
(MO)
Dorstenia ramosa 12 Vianna-Filho (RB Brazil, Rio de Janeiro MT726178 MT726091 MT726139
482511)
Dorstenia roigii E.L. Eckman 17973 (F) HQ214116
Dorstenia romaniucii 67 Machado 893 et al. Brazil, Espírito Santo MT726092
(HUEFS)
Dorstenia romaniucii 68 Machado 900 et al. Brazil, Espírito Santo MT726179 MT726093 MT726140
(HUEFS)
Dorstenia sucrei 51 Carrijo 1359 (R) Brazil, Espírito Santo MT726180 MT726094
Dorstenia tenuis 33 Vianna-Filho (RB Brazil, Paraná MT726181 MT726095 MT726141
488315)
Dorstenia tenuis 39 Vianna-Filho 2515 (RB) Brazil, Paraná MT726096
Dorstenia turbinata Cheek 11086 HQ214080
Dorstenia turnerifolia 27 Carauta 1687 (RB) Brazil, Rio de Janeiro MT726182 MT726097 MT726142
Dorstenia urceolata 8 Andrade (RB 450982) Brazil, Rio de Janeiro MT726183 MT726098 MT726143
Dorstenia urceolata 28 Lima 6418 (RB) Brazil, Rio de Janeiro MT726099
Dorstenia vitifolia 18 Carvalho (RB 488319) Brazil, Minas Gerais MT726100
Dorstenia vitifolia Vieira et al. 554 HQ214106
Dorstenia vitifolia 2 Vianna-Filho (RB Brazil, Minas Gerais MT726184 MT726101 MT726144
488316)
Dorstenia warneckei 37 Vianna-Filho (RB Without provenance, MT726102 MT726145
488308) cult.
Dorstenia zanzibarica 59 Vianna-Filho (RB Without provenance, MT726103 MT726146
488303) cult.
Helianthostylis sprucei 61 Ribeiro 1531 (INPA) Brazil, Amazonas MT726185 MT726104 MT726147
Trymatococcus Ribeiro 1931 (INPA) Brazil, Reserva Florestal MT726186 MT726105 MT726148
amazonicum 72 Adolpho Ducke, Manaus

Rodriguésia 72: e00402020. 2021

8 de 13 Vianna-Filho MDM et al.

Table 2 – Primers and DNA regions analyzed in the present study.

Primers Sequence (5’ → 3’) Region Reference
ETS-Hel-1 GCTCTTTGCTTGCGCAACAACT
ETS Baldwin & Markos 1998
18SETS ACTTACACATGCATGGCTTAATCT
ITS4 CATCGATGAAGAACGTAGC
ITS/5.8S Baldwin 1992
ITS5 GGAAGGAGAAGTCGTAACAAGG
C GGTTCAAGTCCCTCTATCCC
trnL-F Taberlet et al. 1991
F ATTTGAACTGGTGACACGAG

phylogeny estimation with the default settings, Among the paleotropical taxa, the Dorstenia
and the data partitioned by the alignment region. sect. Xylodorstenia (BS 100%, PP 1.0) formed a
The BI analysis was performed using MrBayes monophyletic group and D. sect. Nothodorstenia
3.2.7 (Ronquist et al. 2012). Two separate runs of formed a polyphyletic group with a solitary branch
four concurrent runs (one cold and three heated) (D. elliptica) sister to all neotropical species, but
over 30,000,000 generations were employed with this was inconclusive because of low support
sampling at every 3,000 generations. The sampled (BS 50%, PP < 0.5). Dorstenia sect. Kosaria
trees were summarized and those saved prior to formed a paraphyletic group because it included
the stationarity of the likelihood (burn-in) were D. barnimiana Schweinf. (D. sect. Acauloma;
excluded. CIPRES Science Gateway (Miller et al. BS 100%, PP 1.0). Dorstenia sect. Lomatophora
2010) was used for the ML and BI analyses. The formed a monophyletic group sister to D. sect.
ASTRAL (Mirarab et al. 2014) package was used Kosaria and D. sect. Acauloma with moderate to
to perform an ML analysis of the three independent high support (BS 79%; PP 1.0).
molecular markers and to analyze the disagreement The three groups among the predominantly
between the regions. neotropical sections (Dorstenia sect. Dorstenia,
D. sect. Lecania, and D. sect. Emygdioa) were
Results polyphyletic with high support (BS = 100%, PP =
This study generated 133 new DNA 1.0) in most of the deep branches. Only D. picta
sequences: 52 from ITS, 43 from trnL-F, and Bureau (one of the two African species of D. sect.
38 from ETS. The analysis with the ITS marker Lecania) emerged, along with the paleotropical
produced the same groups as the ETS and trnL-F species, next to the main clade of D. sect. Kosaria
analyses, but there was a larger set of species (92 and D. sect. Acauloma, but had low support
terminals). The combined analysis of the markers (BS 27%; PP 0.56). Within the predominantly
(ETS, ITS, and trnL-F) produced a tree that was neotropical clade, two branches emerged from the
similar to that obtained using the ITS marker deepest node of the tree. One contained the South
alone, but with better resolution in some terminal American species (BS 44%, PP 0.93) and the other
branches (e.g., Dorstenia carautae C.C. Berg and contained the Central American species (BS 98%,
D. milaneziana Carauta, C. Valente & Sucre). The PP 1.0).
proportion of input quartet trees satisfied by the
final ASTRAL species tree was 0.98. According Discussion
to Mirarab et al. (2014), the higher this value, the The analysis undertaken in this study
less disagreement the gene trees have. On this basis, suggested that Dorstenia forms a monophyletic
we opted to discuss the phylogenetic hypothesis group with both bootstrap and posterior probability
based on the combined analysis of the markers. values higher than 90% for the first and 0.9 for
We chose to use ML out of the two analyses the second one. According to studies by Carauta
(ML and BI) because there were no polytomic (1978) and Berg & Hijman (1999), Dorstenia
branches (Fig. 2 and Appendix S1, available on differs from other genera of Moraceae because it
supplementary material <https://doi.org/10.6084/ mainly consists of herbaceous plants (except for
m9.figshare.16569552.v1>). 11 African species), with bisexual inflorescences

Rodriguésia 72: e00402020. 2021

Phylogeny of Dorstenia 9 de 13

Figure 2 – Maximum Likelihood tree for combined molecular data (ETS + ITS + trnL-F) of 57 Dorstenia species (+
four outgroup species), representing eight sections. The length of the branches represents the genetic distance of each
taxon. Pa = Paleotropical species; Ne = Neotropical species; SA = South American species; CA = Central American
species. Branches in red indicate posterior probability < 0.9 or bootstrap < 90% (from the Bayesian Inference analysis,
appendix). ** = a single woody macrospermous plant within the clade of herbaceous microspermous plants.
Rodriguésia 72: e00402020. 2021
10 de 13 Vianna-Filho MDM et al.
(except Dorstenia cayapia Vell.) that are discoid morphological data. These groups are composed of
(saucer-shaped to cup-shaped), with pistillate succulent plants and, on the basis of the molecular
flowers immersed in the receptacle, and bracts data presented here, we infer that they should be
on the outer surface. All these synapomorphies treated within a single section. This should be
are key evolutionary traits in the evolution of the better elucidated when the three species of D. sect.
group (Misiewicz & Zerega 2012) that support and Acauloma and other species of D. sect. Kosaria
identify the species within this clade. are sampled.
Almost all paleotropical woody Dorstenia picta, one of the two species of
macrospermous plants emerged on the deepest D. sect. Lecania in Africa, emerged from a deep
nodes of the Dorstenia phylogenetic tree. Dorstenia node of the clade D. sect. Lomatophora + D. sect.
sect. Xylodorstenia formed a monophyletic group, Kosaria + D. sect. Acauloma and has a very long
and D. sect. Nothodorstenia was a polyphyletic branch showing high evolutionary divergence. This
group. This early divergent position was expected raises the hypothesis that the African species of D.
because almost 90% of the Moraceae species sect. Lecania can be considered a lineage that is
are woody plants (only Dorstenia and Fatoua parallel to neotropical D. sect. Lecania. Previous
Gaudich. contain herbaceous species). The molecular studies also reported the same results
polyphyly of D. sect. Nothodorstenia section is (Misiewicz & Zerega 2012; Zhang et al. 2019).
an intriguing result. This section, together with Thus, we conclude that these two species (D. picta
D. sect. Xylodorstenia, only contains woody and D. Subdentata Hijman & C.C.Berg) should be
macrospermous plants. However, according to included in another section. Taxonomic studies that
our results, D. elliptica emerges within the set of focus on African taxa are needed to confirm this.
herbaceous microspermous plants. According to the phylogenetic hypothesis
The results suggested the validity of the presented in this study, the neotropical species
hypothesis that Dorstenia sect. Nothodorstenia is (herbaceous microspermous plants) form a clade
phylogenetically closer to the neotropical clade (D. nested within the paleotropical species and are
sect. Dorstenia, D. sect. Emygdioa, and D. sect. sisters, in part, to D. sect. Nothodorstenia (D.
Lecania) rather than to the paleotropical sections. elliptica). According to Berg & Hijman (1999),
Berg & Hijman (1999) mentioned that retainment the neotropical species diverged from paleotropical
of bracts (Dorstenia sect. Nothodorstenia, D. sect. herbaceous plants, event makes by the presence of
Dorstenia, D. sect. Emygdioa, and D. sect. Lecania) a bracteate receptacle, being closer to the African
indicated the existence of a more recent common D. sect. Nothodorstenia (woody macrospermous
ancestor for these two groups compared to any plants) than to the other herbaceous sections
other group, including D. sect. Xylodorstenia. The (paleotropical). Therefore, reproductive traits,
results indicated that this theory appears to be at such as the presence and absence of bracts in the
least partially correct since D. elliptica (D. sect. inflorescence, may play a key role in the evolution
Nothodorstenia) may be sister to all neotropical of the group, and morphological and anatomical
plants (Fig. 2). studies focusing on this aspect may help to elucidate
Dorstenia sect. Lomatophora and D. sect. the systematics of the group.
Kosaria form a monophyletic group along with Within the neotropical sections (Dorstenia
the only species of D. sect. Acauloma sampled sect. Dorstenia, D. sect. Emygdioa, and D. sect.
(D. barnimiana Schweinf.) and the only African Lecania), the present analysis indicated that
D. sect. Lecania sampled (D. picta). All these taxa the three sections are polyphyletic and that the
are herbaceous or succulent microspermous plants, neotropical clade can be subdivided into a Central
paleotropical, and usually have seven or more American group and a South American group. Berg
pistillate flowers per receptacle. According to Berg (2001) stated that it was very difficult to precisely
& Hijman (1999), D. sect. Lomatophora and D. delineate the three neotropical sections. Carauta
sect. Kosaria are close for being caulescent plants (1978) used habit, leaf, stipules, and inflorescence
with scattered leaves and a mostly supraterraneous shape to subdivide the sections, but molecular
stem. biology is questioning whether these characters
Dorstenia barnimiana, the only species clearly unify the neotropical monophyletic groups.
sampled from D. sect. Acauloma (out of three) Thus, in view of the lack of a reliable morphological
emerged among the species of D. sect. Kosaria, distinction and the polyphyletic relationships
exactly as Berg & Hijman (1999: 120) inferred from among the species of D. sect. Dorstenia, D. sect.

Rodriguésia 72: e00402020. 2021

Phylogeny of Dorstenia 11 de 13

Emygdioa, and D. sect. Lecania, we propose the D. jamaicensis Britton, D. lindeniana Bureau,
later two as synonymous of D. sect. Dorstenia. D. maris C.Valente & Carauta, D. milaneziana,
D. nummularia Urb. & Ekman, D. panamensis
Taxonomic treatment C.C.Berg, D. peltata Engl., D. peruviana C.C.Berg,
Dorstenia sect. Dorstenia L., Sp. Pl. 121. D. petraea C.Wright ex Griseb., D. ramosa (Desv.)
1753. Type species. Dorstenia contrajerva L. = Carauta, C.Valente & Sucre, D. rocana Britton,
Sychinium Desv., Mém Soc. Linn. Paris 4: 216. D. roigii Britton, D. romaniucii A.F.P.Machado
1826. Dorstenia sect. Sychinia (Desv.) Carauta, & M.D.M.Vianna, D. setosa Moric., D. stellaris
Bradea 2(21): 151. 1976. Type species. Sychinium Al. Santos & Romaniuc, D. strangii Carauta, D.
ramosum Desvaux, syn. nov. tentaculata Fisch. & C.A.Mey., D. tenuis Bonpl.
= Dorstenia sect. Lecania Carauta, Bradea 2(21): ex Bureau, D. tuberosa C.Wright ex Griseb., D.
151. 1976. Type species. Dorstenia turnerifolia turnerifolia, D. umbricola A.C.Sm., D. urceolata
Fisch. & C.A. Mey., syn. nov. Schott, D. uxpanapana C.C.Berg & T.Wendt, D.
= Dorstenia sect. Emygdioa Carauta, Bradea 2(21): vitifolia Gardner.
151. 1976. Carauta, Rodriguésia 29(44): 105. 1978. Excluded taxa: Dorstenia picta and D.
Type species. Dorstenia brasiliensis Lam., syn. nov. subdentata.
Herbs to subshrubs, monoecious; non Dorstenia picta (African species) was
cactiform; stems supraterranean to entirely excluded from the D. sect. Dorstenia (neotropical
subterranean; internodes elongate or short. Leaves taxon) because it does not share the most recent
spirally alternate, stipules present, subfoliaceous common ancestor with the taxa included in this
to subulate. Inflorescences usually bisexual and section. This species emerged from within the
axillary, mostly bracteate, fringe present; flowers clade D. sect. Lomatophora + D. sect. Kosaria +
connate; interfloral bracts lacking (occasionally D. sect. Acauloma according to our results. Based
rudimentary); staminate flowers among pistillate on the morphological analysis, we concluded that
ones or at the periphery of the flowering face; it is a member of the section D. sect. Lomatophora,
pedicellate; tepals 2–3(–4), stamens 2–3, inflexed mainly because it has an herbaceous habit with
in the bud, pistillode occasionally present; creeping to ascending leafy stems and a partly
pistillate flowers sessile, perianth tubular, free or subterraneous stem, which is very similar to D.
sessile, stigma 2, usually unequal. Fruit dehiscent psilurus Welw. Dorstenia subdentata was not
drupelet, exocarp white and fleshy, turgid, ejecting sampled in the phylogenetic analysis, but after
the endocarp when mature (dry); seed small, undertaking a morphological study of the species,
endosperm present. because it is an ebracteate species, we predicted
The species are distributed in North America that it should also be treated as a member of the
(Mexico) to South America (Argentina), with D. sect. Lomatophora.
fewer species in the Amazon basin. Fifty six
species are listed in D. sect. Dorstenia. Included Acknowledgements
species: D. albertorum Carauta, D. appendiculata We a r e g r a t e f u l t o P a u l o F e r r e i r a
Miq., D. arifolia Lam., D. aristeguietae Cuatrec., (Universidade Federal do Rio de Janeiro, in
D. asaroides Gardner, D. bahiensis Klotzsch ex memorian) and Luciana Franco (Instituto de
Fisch. & C.A.Mey., D. belizensis C.C.Berg, D. Pesquisas Jardim Botânico do Rio de Janeiro),
bonijesu Carauta & C.Valente, D. bowmaniana for providing laboratory facilities; and to Claudio
Baker, D. brasiliensis, D. brevipetiolata C.C.Berg, Nicoletti, Deborah Hottz (Instituto de Pesquisas
D. caimitensis Urb., D. carautae, D. cayapia, D. Jardim Botânico do Rio de Janeiro), Jim Solomon
choconiana S.Watson, D. colombiana Cuatrec., (Missouri Botanical Garden), Anderson Machado
D. conceptionis Cuatrec., D. contensis Carauta & (Universidade Estadual de Feira de Santana), and
C.C.Berg, D. contrajerva, D. crenulata C.Wright Welma Souza (Universidade Federal do Amazonas,
ex Griseb., D. dolichocaula Pilg., D. drakena L., D. Brazil), for providing samples of Dorstenieae. We
elata Gardner, D. erythandra C.Wright ex Griseb., also thank Marcelo Vianna Senior, for helping us
D. excentrica Moric., D. fawcetii Urb., D. fischeri format the images. This study was financed in part
Bureau, D. flagellifera Urb. & Ekman, D. gracilis by Coordenação de Aperfeiçoamento de Pessoal
Carauta, C.Valente & D.S.D.Araujo, D. grazielae de Nível Superior - Brasil (CAPES - Finance
Carauta, C.Valente & Sucre, D. hildegardis Code 001). MDMVF was the recipient of grants
Carauta, C.Valente & O.M.Barth, D. hirta Desv., from CAPES and CNPq (Conselho Nacional

Rodriguésia 72: e00402020. 2021

12 de 13 Vianna-Filho MDM et al.
de Desenvolvimento Científico e Tecnológico). Leal ME (2014) Dorstenia luamensis (Moraceae), a
AFC and VFM were the recipients of grants new species from eastern Democratic Republic of
from CNPq and from Fundação de Amparo à Congo. PhytoKeys 42: 49-55.
Pesquisa do Estado do Rio de Janeiro (FAPERJ Machado AFP, Pereira JF & Carauta JPP (2014).
E_02/2017E_02/2017), and LCP received a grant Dorstenia triseriata (Moraceae) a new and
endangered species from Brazil. PhytoKeys 38:
from Fundação de Amparo à Pesquisa do Estado do
31-35.
Rio de Janeiro (FAPERJ, E-26/202.277/2019 and
Machado AFP & Vianna-Filho MDM (2012) Dorstenia
nº E-26/202.278/2019). The authors are grateful romaniucii (Moraceae), a new species from the
to the handling editor and the reviewers of this Brazilian Atlantic Rain Forest. Systematic Botany
manuscript. 37: 451-455.
McCoy TA & Massara M (2008) Dorstenia lavrani
References McCoy & Massara (family Moraceae). Cactus and
Baldwin BG (1992) Phylogenetic utility of the internal Succulent Journal 80: 79.
transcribed spacers of nuclear ribosomal DNA in Mirarab S, Reaz R, Bayzid MS, Zimmermann T,
plants: an example from the compositae. Molecular Swenson MS & Warnow T (2014) ASTRAL:
Phylogenetics and Evolution 1: 3-16. genome-scale coalescent-based species tree
Baldwin BG & Markos S (1998) Phylogenetic utility of the estimation. Bioinformatics 30: i541-i548.
external transcribed spacer (ETS) of 18S-26S rDNA: Misiewicz T & Zerega NJC (2012) Phylogeny,
congruence of ETS and ITS trees of Calycadenia biogeography and character evolution of Dorstenia
(Compositae). Molecular Phylogenetics (Moraceae). Edinburgh Journal of Botany 69:
and Evolution 10: 449-463. 413-440.
Berg CC & Hijman MEE (1999) The genus Dorstenia Pederneiras LC, Romaniuc-Neto S & Mansano VF
(Moraceae). Ilicifolia 2: 1-211. (2015) Molecular phylogenetics of Ficus sect.
Berg CC (2001) Moreae, Artocarpeae and Dorstenia Pharmacosycea and the description of Ficus subsect.
(Moraceae): with introductions to the family and Carautaea (Moraceae). Systematic Botany 40:
Ficus and with additions and corrections to Flora 504-509.
Neotropica 7. Flora Neotropica vol. 83. New York Ronquist F, Teslenko M, van der Mark P, Ayres DL,
Botanical Garden, New York. 346p. Darling A, Höhna S, Larget B, Liu L, Suchard MA
Carauta JPP (1978) Dorstenia L. (Moraceae) do Brasil e & Huelsenbeck JP  (2012) MrBayes 3.2: efficient
países limítrofes. Rodriguésia 29: 71-73. Bayesian phylogenetic inference and model choice
Castro RM & Rappini A (2010) Flora da Bahia - across a large model space. Systematic Biology 61:
Moraceae. Sitientibus ser. Ciências Biológicas 10: 539-542.
97-137. Rzepecky A (2016) Dorstenia horwoodii Rzepecky sp.
Chase MW, Thijs KW, Kamau P & Fay MF (2013) nov. from Nudum to Novum, a Fortyish Year Hiatus.
Dorstenia christenhuszii (Moraceae), a new species Cactus and Succulent Journal 88: 66-74.
from the Taita Hills, Kenya. Phytotaxa 81: 45-48. Santos A, José PAS, Vianna Filho MDM & Romaniu-
Clement WL & Weiblen GD (2009) Morphological Neto S (2016) Dorstenia (Moraceae) da região
evolution in the mulberry family (Moraceae). da Serra da Mantiqueira, Brasil.  Rodriguésia 67:
Systematic Botany 34: 530-552. 237-250.
Datwyler SL & Weiblen GD (2004) On the origin of the Santos A & Romaniuc-Neto S (2012) A new species of
fig: phylogenetic relationships of Moraceae from Dorstenia (Moraceae) from southeastern Brazil.
ndhF sequences. American Journal of Botany 91: Phytokeys 12: 47-51.
767-77. Stamatakis A (2014) RAxML Version 8: a tool for
De Granville JJ (1971) Notes sur la biologie florale de phylogenetic analysis and post-analysis of large
quelques espèces du genre Dorstenia (Moracées). phylogenies. Bioinformatics 30: 1312-1313.
Cahiers ORSTOM, Série Biologie 15: 61-97. Taberlet P, Gielly L, Pautou G & Bouvet J (1991)
Doyle JJ & Doyle JL (1987) A rapid DNA isolation Universal primers for amplification of three non-
procedure for small quantities of fresh leaf tissue. coding regions of chloroplast DNA. Plant Molecular
Phytochemistry 19: 11-15. Biology 17: 1105-1109.
Edgar RC (2004) MUSCLE: multiple sequence Vianna-Filho MDM (2012) Filogenia de Dorstenia sect.
alignment with high accuracy and high throughput. Dorstenia e revisão taxonômica do clado arifolia.
Nucleic Acids Research 32: 1792-1797. Tese de doutorado, Museu Nacional/Universidade
Gardner EM, Sarraf P, Williams EW & Zerega NJC Federal do Rio de Janeiro, Rio de Janeiro. 186p.
(2017) Phylogeny and biogeography of Maclura Vianna-Filho MDM, Maia VH, Mansano VF & Costa
(Moraceae) and the origin of an anachronistic fruit. AF (2016) Hijmania, a replacement name for Maria
Molecular Phylogenetics and Evolution 117: 49-59. (Moraceae). Phytotaxa 247: 97-98.

Rodriguésia 72: e00402020. 2021

 Phylogeny of Dorstenia 13 de 13

Weiblen GD (2000) Phylogenetic relationships of Sninsky JJ & White TJ (eds.) PCR Protocols: a guide
functionally dioecious Ficus (Moraceae) based to methods and applications. Academic Press, New
on ribosomal DNA sequences and morphology. York. Pp. 315-322.
American Journal of Botany 87: 1342-1357. Zerega NJC & Gardner EM (2019) Delimitation of the
Weiguo Z, Yile P, Shihai ZZJ, Xuexia M & Yongping H new tribe Parartocarpeae (Moraceae) is supported
(2005) Phylogeny of the genus Morus (Urticales: by a 333-gene phylogeny and resolves tribal level
Moraceae) inferred from ITS and trnL-F sequences. Moraceae taxonomy. Phytotaxa 388: 253-265.
African Journal of Biotechnology 4: 563-569. Zhang Q, Gardner E, Zerega N & Sauquet H (2019)
White TJ, Bruns T, Lee S & Taylor J (1990) Amplification Long-distance dispersal shaped the diversity of tribe
and direct sequencing of fungal ribosomal RNA Dorstenieae (Moraceae). BioRxiv 531855. DOI:
genes for phylogenetics. In: Innis MA, Gelfand DH, <http://dx.doi.org/10.1101/531855>

Area Editor: Dr. Marcelo Trovó

Received in March 28, 2020. Accepted in July 27, 2020.
This is an open-access article distributed under the terms of the Creative Commons Attribution License.

Rodriguésia 72: e00402020. 2021

View publication stats