Advances in Biological Sciences Research, volume 19

Proceedings of the 2nd International Conference on Smart and Innovative Agriculture (ICoSIA 2021)

Genetic Diversity of the Prolactin Gene in Three

Indonesian Ducks
Aprilianna Putri Zahara Nafsina Luvita Sari1, Akhmad Fathoni1, Heru Sasongko1,
Dwi Nur Happy Hariyono2, Dewi Sari Kumalawati1, Dyah Maharani1*
1
Faculty of Animal Science, Universitas Gadjah Mada, Yogyakarta 55281, Indonesia
2
Faculty of Agriculture, Universitas Khairun, Ternate 97719, Indonesia
*
Corresponding author. Email: d.maharani@ugm.ac.id

ABSTRACT
The Prolactin gene is a candidate gene associated with egg production due to its crucial role in the production and
reproduction of poultry. This study aimed to identify the polymorphisms of the prolactin gene in Indonesian local
duck breeds. For that purpose, three duck breeds, namely Bayang (n= 25), Turi (n= 26), and Magelang (n= 14), were
used for genotyping of the prolactin gene using polymerase chain reaction (PCR) amplification and direct sequencing
method. The primers used were primer forward: 5’- TGCAAACCATAAAAGAAAAGA–3’ and reverse: 5’–
CAATGAAAAGTGGCAAAGCAA–3’. Two single nucleotide polymorphisms (SNPs) in intron 4 of the prolactin
gene were detected: C5796A and T5817C. The frequencies of the 5796C (0.85) and 5817T (0.85) alleles were highest
in the total population. For the C5796A locus, the CC genotype had the highest frequency (0.69), followed by CA
(0.31), without AA genotype. For the T5817C, the TT genotype had the highest frequency (0.69), followed by TC
(0.31), without CC genotype. The genotype frequency distributions in all breeds at every locus were in Hardy-
Weinberg equilibrium (P > 0.05). Future studies could further expand the effect of the SNPs in the prolactin gene on
economically essential traits, especially egg production in ducks.

Keywords: Prolactin gene; Genetic; Polymorphism; Indonesian; Ducks

1. INTRODUCTION gene (PRL) [4]. The PRL gene is synthesized mainly in

the anterior pituitary in all vertebrates [5]. The PRL
Local duck is one of Indonesia's germplasm, and gene is one of the growth hormone gene families that
most of them are raised as egg producers [1]. The control variations in egg production by reducing egg
population of local ducks in Indonesia currently reaches biosynthesis during the brooding period [6]. This gene
58.2 million heads. In Indonesia, the egg production rate consists of 5 exons and 4 introns, encoding 229 amino
has increased from 2019 by 328.686 tons to 332.907 acids [4].
tons in 2020 [2]. The increased number of duck egg
production indicated that the community and the food Several studies have been focused on the association
industry's use and consumption of local duck eggs have of PRL gene polymorphisms and economical traits.
increased. Ducks contribute 13.4% to the total poultry Previously, studies on the PRL gene had been widely
egg production in Indonesia. It shows that ducks play an carried out in Chinese duck, Khaki Campbell Ducks,
essential role as part of protein sources. Hence, it is and Italian duck [5,7,8]. In addition, the study of the
necessary to increase duck' egg production. PRL gene was also conducted in several breeds of
Indonesian local duck, i.e., Bayang, Tegal, Magelang
The production and quality of duck eggs are strongly ducks [9,10]. Li et al. [11] reported mutation T1326C in
influenced by the maintenance system carried out by the intron 1 region had a positive association with egg
breeders. Besides, genetic factors are one of the factors weight in Gayou duck. Wang et al. [5] found SNP C-
that affect egg production and egg quality. Nowadays, 5961T polymorphism at exon 5 was significantly
genetic selection using molecular markers of a gene has associated with egg production and egg weight in local
been widely used [3]. One candidate gene that affects ducks in China. Chang et al. [12] found six SNPs in
egg production and poultry reproduction is the prolactin

Copyright © 2022 The Authors. Published by Atlantis Press International B.V.

This is an open access article distributed under the CC BY-NC 4.0 license -http://creativecommons.org/licenses/by-nc/4.0/. 350
 Advances in Biological Sciences Research, volume 19

Brown Tsaiya ducks (T233C, T295CG, G309T, C381A, electrophoresis gel stained with ethidium bromide
G3941T, A 3957C) located in the non-coding region, (EtBr).
and all those SNPs were associated with egg weight at
40 weeks of age and fertility rate except for SNP 2.2.3. DNA Sequencing
T295C. However, the analyses of the prolactin gene in
Indonesian local duck breeds (Bayang, Turi, and Using an automated DNA sequencer, the 20 µL
Magelang) were not much reported. Therefore, the PCR products were sent to UGM's Central
objective of this study was to investigate the
Laboratory for one-direction (forward) sequencing.
polymorphisms of the prolactin gene in three local
Indonesian duck breeds.
The sequencing results were then analyzed using
Clustal Omega and BioEdit ver 7.0 program to
2. MATERIAL AND METHODS identify the prolactin gene's polymorphism and
genotyping each sample. Manual detection of the
2.1. Material electropherogram was used to confirm the SNP.
Double peaks or different nucleotide peaks
The material used in this study was blood samples detected were detected as the SNP.
of female Indonesian local duck breeds. A total 65
individuals consist of three duck population, 2.2.4. Data Analysis
namely Bayang (n = 25), Turi (n = 26), Magelang
(n = 14) ducks. Based on the genotype from each SNP C5796A
and T5817C, the genotype and allele frequencies,
2.2. Methods and χ2 test for Hardy-Weinberg equilibrium were
calculated following Antonius et al. [14]
Finding of polymorphisms in the prolactin gene instructions using PopGen ver 3.2.
was conducted in three steps: DNA extraction,
amplification, and direct-sequencing. The BioEdit 3. RESULT AND DISCUSSIONS
program ver. 7 was used to analyze the
sequencing's result and genotyping. The genetic 3.1. Results
diversity's parameters were calculated by PopGen
program ver. 3.2. Two SNPs, namely SNP C5796A and T5817C
found using the sample's sequence alignment (Fig
2.2.1. DNA Extraction 1). Both SNPs were located in the fourth intron of
the prolactin gene. Based on the electropherogram,
The DNA was extracted following the standard the CC and CA genotypes (SNP C5796A) and the
protocols of gSYNCTM DNA extraction Kit TT and TC genotypes (SNP T5817C) showed clear
(Geneaid, Taiwan). peaks (Fig 2 and 3). The result of genetic diversity
analysis (allele and genotype frequencies, and chi-
2.2.2. Amplification square test value) of SNPs C5796A and T5817C in
Four hundred bp PCR products were amplified in Bayang, Turi, Magelang, and total populations are
Thermo Cycler following Damayanti et al. [13] shown in Table 1. The frequencies of the 5796C
procedure. Twenty-five microlitre of mixture (0.85) and 5817T (0.85) alleles were highest in the
reaction comprising 9.5 µL double-distilled water total population. For the C5796A locus, the CC
(DDW), 12.5 µL MyTaq HS Red Mix (Bioline, genotype had the highest frequency (0.69),
UK), 0.5 µL of each primer (forward: 5’- followed by CA (0.31), without AA genotype. For
TTCGTTTGGGGCAAGTCAAG-3' and reverse: the T5817C, the TT genotype had the highest
5’-GGAAACGCTCACCAACATGT-3'), and 2 µL frequency (0.69), followed by TC (0.31), without
of DNA. The amplification conditions were started CC genotype. The genotype frequency
with an initial denaturation at 95 ˚C for 5 min, distributions in all breeds at every locus were all in
followed by 35 cycles of denaturation at 94 ˚C for Hardy-Weinberg equilibrium (P > 0.05) in all the
30 s, annealing at 52 ˚C for 30 s, extension at 72 ˚C breeds.
for 30 s, and the final extension at 72 ˚C for 10
min. The PCR products were then visualized in 2%

351
 Advances in Biological Sciences Research, volume 19

Figure 1 SNP identification by sample's sequence

alignment in Clustal Omega program
TT

TC

CC Figure 3 Visualization of TT and TC genotypes of SNP

T5817C in the electropherogram.

3.2. Discussions
In Indonesia, duck's egg contributed to fulfilling
protein needs in any level of society. Egg production
depends on reproduction performance which is
categorized as a low-heritable trait. Therefore, studying
a candidate gene for reproduction is a vital to
understanding the mechanisms to improve egg-laying
performance. The prolactin gene is one of the genes
associated with egg production in ducks. Two SNPs
(C5796A and T5817C) were found in the intron 4 of
prolactin gene in the studied Indonesian local duck
breeds (Bayang, Turi, and Magelang). Some SNPs in
coding and non-coding region within the prolactin gene
CA were reported in the previous study. The SNP T-1326C
and A-412G in intron 1 were reported significantly
Figure 2 Visualization of CC and CA genotypes of SNP associated with egg production and egg weight [15]. In
C5796A in the electropherogram. 5’-proximal, also a non-coding region, three SNPs (A-
410G, G-268A, and T-226A) have a positive association
with egg production in geese [16]. These results
indicated that even though the mutations were in the
non-coding region, they could still affect the phenotype.
Chorev et al. [17] stated that intron is part of the gene

352
 Advances in Biological Sciences Research, volume 19

that does not code the amino acids. However, the intron (0.82 – 0.86) alleles had the highest frequencies than
is involved in each step of mRNA processing, such as 5796A (0.14 – 0.18) and 5817C (0.14 – 0.18) in
transcription initiator, transcription terminator, time Bayang, Turi, and Magelang ducks. This result was in
delays in a transcribed intron, transcription regulation, line with Wang et al. [5] that found C and T alleles were
alternative splicing, and RNA stabilizer. SNPs in non- dominant in the F1 stock of China native ducks.
coding regions affect gene expression by affecting Yurnalis et al. [9] reported in different SNP, PRL|DraI
regulatory elements, and some intronic SNPs activate mutation, the C allele (0.80) was higher than the T allele
cryptic splice sites, leading to alternative splicing [18]. (0.20) in female Bayang ducks. In an enormous
Thus, further study is needed to explore the functions of population, a polymorphic site is considered an SNP if it
these non-coding SNPs. has less than 99 percent allele frequency or less than 95
percent in the small population [19]. According to the
The CC genotype had the highest frequency (0.69)
χ2 test value, the sample population (Bayang, Turi, and
in this study, followed by CA (0.31) for the C5796A
Magelang) was in agreement with Hardy- Weinberg's
locus. The TT genotype had the highest frequency
equilibrium (χ2<5.59). The genetic diversity based on
(0.69), followed by TC (0.31) for the T5817C locus.
SNPs within-population will be constant between
The 5796-AA and 5817-CC genotypes were absent in
generations as long as there is no mutation, migration,
all studied samples. The 5796C (0.82 – 0.86) and 5817T
selection, and controlled mating.

Table 1. Allele and genotype frequencies and chi-square test's value of SNP C-5796A and T-5817C in
Bayang, Turi, and Magelang ducks.

Breed SNP Genotype Frequency Allele Frequency χ2

Bayang C-5796A AA 0.00 A 0.14 0.56
CC 0.72 C 0.86
AC 0.28
T-5817C CC 0.00 C 0.14 0.56
TT 0.72 T 0.86
CT 0.28
Turi C-5796A AA 0.00 A 0.15 0.74
CC 0.69 C 0.85
AC 0.31
T-5817C CC 0.00 C 0.15 0.74
TT 0.69 T 0.85
CT 0.31
Magelang C-5796A AA 0.00 A 0.18 0.51
CC 0.64 C 0.82
AC 0.36
T-5817C CC 0.00 C 0.18 0.51
TT 0.64 T 0.82
CT 0.36
Total population C-5796A AA 0.00 A 0.15 2.03
CC 0.69 C 0.85
AC 0.31
T-5817C CC 0.00 C 0.15 2.03
TT 0.69 T 0.85
CT 0.31

353
 Advances in Biological Sciences Research, volume 19

Turkish J. Vet. Anim. Sci. 41 63–8 Chang MT,

4. CONCLUSION
Cheng YS H M 2012 South African J. Anim.
In conclusion, two new SNPs of prolactin gene were Sci. 135 91–6
detected in Indonesian local duck breeds. The SNP [12] Damayanti I, Maharani D and Sudaryati S 2019
C5796A and T5817C were located in intron 4 region. IOP Conf. Ser. Earth Environ. Sci. 387 0–4
The 5796C and 5817T alleles frequency was higher than [13] Antonius A, Ginting S P, Elieser S, Tarigan A,
the 5796A and 5817C alleles. The 5796-CC and 5817- Solehudin S, Budisatria I G S, Sari A P Z N L,
TT genotypes has the highest genotype frequency. The Hariyono D N H and Maharani D 2020 Iran. J.
distribution of allele and genotype frequencies were in Appl. Anim. Sci. 10
Hardy-Weinberg equilibrium in all tested population. [14] Bai DP, Hu YQ, Li YB, Huang ZB L A 2019 Br.
Poult. Sci. 60 125–9
ACKNOWLEDGMENTS [15] Jiang RS, Zhang LL, Geng ZY, Yang T Z S 2009
This research was financially supported by the South African J. Anim. Sci. 39 83–7
Directorate General of Higher Education of the [16] Chorev M and Carmel L 2012 Front. Genet. 3 1–
Republic of Indonesia (Grant No. 15
2195/UN1/DITLIT/DIT-LIT/PT/2021). We also thank [17] Goto Y, Yue L, Yokoi A, Nishimura R, Uehara T,
the Agricultural and Livestock Bureau of Magelang and Koizumi S Y S 2001 Clin. Cancer Res. 7
Pesisir Selatan for assisting in collecting blood samples 1952–6
from breeding flocks. [18] Allendorf F W, Luikart G and Aitken S N 2013
(UK: Wiley-Blackwell)
REFERENCES
[1] Ismoyowati, Suswoyo I, Sudewo A T A and
Santosa S A 2009 Anim. Prod. 11 183–8
[2] Directorate General of Livestock and Animal
Health Services M of A 2021
https://www.bps.go.id/indicator/24/479/1/pop
ulasi-itik-itik-manila-menurut-provinsi.html
[3] Kansaku N, Hiyama G, Sasanami T and
Zadworny D 2008 J. Poult. Sci. 45 1–6
[4] Kansaku N, Ohkubo T, Okabayashi H, Guémené
D, Kuhnlein U, Zadworny D and Shimada K
005 Gen. Comp. Endocrinol. 141 39–47
[5] Wang C, Liang Z, Yu W, Feng Y, Peng X, Gong
Y and Li S 2011 South African J. Anim. Sci.
41 63–9
[6] Chen C F, Shiue Y L, Yen C J, Tang P C, Chang
H C and Lee Y P 2007 Laying traits and
underlying transcripts, expressed in the
hypothalamus and pituitary gland, that were
associated with egg production variability in
chickens Theriogenology 68 1305–15
[7] Chuekwon, K. and S B 2016 Association of
Prolactin Gene with Egg Production in Khaki
Campbell Ducks Walailak J. Sci. Technol. 14
849–53
[8] Mazurowski A, Frieske A, Wilkanowska A,
Kokoszyński D, Mroczkowski S, Bernacki Z
and Maiorano G 2016 Ital. J. Anim. Sci. 15
200–6
[9] Yurnalis, Arnim, Kamsa Z and Putra D E 2019
IOP Conf. Ser. Earth Environ. Sci. 287 1-5
[10] Purwantini D, Santosa R S S, Santosa S A,
Susanto A, Candrasari D P and Ismoyowati I
2020 Vet. World 13 2301–11
[11] Li HF, Zhu WQ, Chen KW, Zhang TJ S W 2011

354