Biochemical and Biophysical Research Communications 310 (2003) 464–469

BBRC
www.elsevier.com/locate/ybbrc

Hepatocyte nuclear factor 1 negatively regulates amylin

gene expression
Janelle Green,a,* Dorit Naot,b and Garth Cooperb,c
a
M.E. M u€ller-Institute for Structural Biology, Biozentrum, University of Basel, Klingelbergstrasse 70, 4056 Basel, Switzerland
b
Department of Medicine, School of Medicine, University of Auckland, Private Bag 92019, Auckland, New Zealand
c
School of Biological Sciences, University of Auckland, Private Bag 92019, Auckland, New Zealand

Received 9 August 2003

Abstract

Maturity-onset diabetes of the young (MODY) is a monogenic subtype of Type 2 diabetes, defined as having an early age of
onset, with a dominant inheritance pattern. Hepatocyte nuclear factor 1 (HNF1), which is encoded by the MODY3 gene, has been
shown to bind the insulin promoter. Since the promoters of three pancreas-specific genes involved in glucose homeostasis-insulin,
glucokinase, and amylin bind similar transcription factors, we were interested in whether HNF1 could also regulate amylin ex-
pression. In the present study, we used the electrophoretic mobility shift assay, to demonstrate that the HNF1 transcription factor
can specifically bind to the amylin promoter. Moreover, co-transfection of an HNF1 expression vector with an amylin-CAT reporter
plasmid decreased the activity of the amylin promoter by 85%. These data support the hypothesis that the amylin gene is regulated
by HNF1 in a negative manner and may explain partially how HNF1 mutations result in diabetes.
Ó 2003 Elsevier Inc. All rights reserved.

Keywords: Amylin; Islet amyloid polypeptide; Maturity-onset diabetes of the young; Maturity-onset diabetes of the young 3; Type 2 diabetes;
Hepatocyte nuclear factor 1; Transcriptional regulation

Type 2 diabetes is associated with amyloid deposits acid transcription factor that binds to a palindromic
in the pancreatic islet cells and it has been suggested consensus sequence (gGTTAATnaTTancn) located in
that this amyloid is the underlying cause of the disease the promoter and enhancer regions [13]. HNF1 func-
[1]. The amyloid deposits are made up of amylin [2], a tions as a homodimer or as a heterodimer with the
non-competitive antagonist of insulin action in pe- vHNF1 [14] and is expressed in the liver, pancreas,
ripheral tissues, that is co-secreted with insulin from kidney, and digestive tract [13].
islet b-cells [3]. To date it is unknown how HNF1 mutations result in
Maturity-onset diabetes of the young (MODY) is a MODY3. However, it appears from MODY3 patients
monogenic subtype of Type 2 diabetes, defined as hav- and HNF1-null mice that the primary pathophysiologi-
ing an early age of onset, with a dominant inheritance cal defect lies in b-cell glucose sensing [15,16]. Studies in
pattern [4]. There are six subtypes of MODY known at HNF1-null mice indicate that the defect results at least
present, MODY1-6 encoded by hepatocyte nuclear in part from reduced aerobic glycolysis and possibly
factor 4 (HNF4), glucokinase, hepatocyte nuclear factor mitochondrial metabolism [17,18]. It is likely that HNF1
1 (HNF1), insulin promoter factor 1 (IPF1), variant mutations result in aberrant transcriptional regulation
hepatocyte nuclear factor 1 (vHNF1), and neuroD1, of important genes in the glucose-sensing pathway and
respectively [5–11]. b-cell growth [19–25]. Interestingly, five out of the six
MODY3, caused by mutations in HNFI, is the most genes mutated in the MODY syndromes are transcrip-
common subtype of MODY [12]. HNF1 is a 628 amino tion factors and therefore aberrant transcriptional
control could be the common mechanism of disease in
*
Corresponding author. Fax +41-61-267-21-09. the MODY syndrome [26]. The MODY transcription
E-mail address: janelle.green@unibas.ch (J. Green). factors also control each other’s transcription [27–31].

0006-291X/$ - see front matter Ó 2003 Elsevier Inc. All rights reserved.
doi:10.1016/j.bbrc.2003.09.046
 J. Green et al. / Biochemical and Biophysical Research Communications 310 (2003) 464–469 465

For example, the pancreatic promoter for HNF4 has electrophoresis in 1
TBE at 200 V for 2–3 h. The gel was then dried
(DrygelSr. Hoefer Scientific Instruments) and developed on a Kodak
functional binding sites for HNF1, vHNF1, and IPF1
X-OMAT AR film.
[31–34]. Although MODY2 (encoding glucokinase) does Construction of the amylin promoter reporter plasmid (pAP). The
not encode a transcription factor, its expression is reg- reporter plasmid pAP, which contained 1893 bp of the 50 flanking se-
ulated by one of the other MODY transcription factors quence of the human amylin gene, was produced by PCR amplification
[35]. This could explain why the MODY2 phenotype is from human genomic DNA with APF and APR primers. These primers
included BglII and BstXI restriction enzyme sites to provide cohesive
not as severe as the phenotypes of the other forms of
ends for subsequent ligation to the BstXI and BglII pre-digested
MODY. pOP13CAT (Stratagene, Cedar Creek, TX). Sequence analyses were
The transcription factors involved in MODY have performed to exclude PCR artefacts. APF ¼ TGTAT CCACCGCG/
several common gene targets. IPF1 (MODY4) binds the ATGGTAACCCATATGCAGAGA and APR ¼ CG CGGCAGATC/
promoters of insulin, glucokinase, and amylin [35–37], TATTTGCTAACTAGTAATCCAGC (BstXI and BglII recognition
sites are underlined, respectively. The restriction enzyme sites are
three pancreas-specific genes that are involved in glucose
represented by /). The pBJHNF1 plasmid was a generous gift from
homeostasis, while HNF1 has also been shown to bind Dr. G.R. Crabtree (University of Stanford).
the insulin promoter [19,20]. In the present study, we Co-transfection and detection of the promoter activity. COS7 cells
tested whether HNF1 could also be involved in the were transfected with 1 lg purified pAP, and 1 lg pSV-b-galactosidase
regulation of amylin and glucokinase expression in the plasmid (Promega, Pittsburg, PA), with or without 1 lg pBJ-HNF1
using the transfection system Fugene6 (Boehringer, Mannheim, Ger-
pancreas [35–42].
many). After transfection the cells were allowed to grow for 48 h in
nDMEM before being harvested for the chloroamphenicol acetyl-
transferase (CAT) and b-galactosidase ELISA assays (Roche, Mann-
heim, Germany). Cell extracts (100–200 lg) were incubated in the
Methods microtitre plates for 2 h and the rest of the procedures was performed
following the manufacturer’s protocols.
Materials. Restriction enzymes, DNA polymerases, and other
modification enzymes were purchased from GIBCO BRL (Carlsbad,
CA) and radioisotopes were from Amersham Biosciences (Auckland,
New Zealand). Tissue culture media and fetal bovine serum were Results
purchased from GIBCO BRL (Carlsbad, CA). The antibodies used
were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). EMSA analysis was used to determine whether
Design of the DNA probe. The MatInspector computer program
was used to screen promoter sequences for consensus binding sites
HNF1 can bind the human amylin promoter and could
[43]. Oligonucleotides designed for EMSA had 50 overhang for ra- therefore be a regulator of amylin gene expression. The
diolabelling with [a-32 P]CTP by the Klenow fragment. Oligonucle- amylin promoter sequence (NCBI GenBank Accession
otides were purchased from Custom Primers-Life Technologies No.: L08226) was screened for HNF1 consensus binding
(Auckland, New Zealand) and annealed prior to radiolabelling. sites using the computer program MatInspector [43].
AMYBS4F ¼ GGCTACGTTAATATTTACTGATGAGTTAATG
TAATAA
The two strongest consensus binding sites are separated
AMYBS4R ¼ GGTCATTATTACATTAACTCATCAGTAAATA by only 7 bp and are situated 173–161 and 154–140 bp
TTAACG upstream of the transcriptional start site. The AMYBS4
GSGCKF ¼ GGCTGAACAGGTGGCAAAGGCTTAACAGG oligonucleotide that incorporates these two sites was
GSGCKR ¼ CGGCCAGCCTGTTAAGCCTTTGCCACCTGTT designed and used for the EMSA study.
(putative binding sites for HNF1 are underlined).
Nuclear extracts isolated from RINm5F, COS7, and
Cell culture and electrophoretic mobility shift assays. COS7 and rat
insulinoma cell line (RINm5F) cells were grown in nDMEM and
COS7 cells transfected with the HNF1 expression plas-
RPMI 1640 medium supplemented with 10% fetal calf serum, 290 mg/ mid (pBJ-HNF1) were used to evaluate whether HNF1
mL L -glutamine, 100 U/mL penicillin, and 100 lg/mL streptomycin. binds the synthetic oligonucleotide derived from the
Cells were grown as monolayers at 37 °C in a humidified incubator amylin promoter region. The results reveal that several
containing 5% CO2 in air. Nuclear proteins were prepared as described nuclear factors contained in the RINm5F extract bind
[44]. Cellular proteins were extracted from COS7 and transfected
COS7 cells using the cell lysis buffer from the CAT Elisa Kit (Roche,
the amylin promoter (Fig. 1). All bands were competed
Mannheim, Germany). Protein concentrations were determined using out only by the specific DNA competitor, indicating
the BCA Protein Assay (Pierce, Rockford, IL). The electrophoretic specific binding of all these protein complexes to the
mobility shift assays (EMSA) was performed as described [44]. Binding probe (Fig. 1, HNF1 arrow). As shown in Fig. 1B, in
reactions were performed by mixing the RINm5F nuclear extract COS7 cells transfected with pBJ-HNF1 there is a strong
(8 lg) or COS7 cellular extracts (15 lg) with 30,000 cpm of labelled
oligonucleotide and incubating for 1 h at room temperature with or
band that does not appear in the non-transfected cells
without competitors. For competition studies 100-fold excess of un- and could therefore be a complex of HNF1 with the
labelled self- or non-specific NFjB consensus binding site oligonu- probe. A similar size band was evident in the extract
cleotide (Santa Cruz Biotechnology) was added to binding reactions. from the RINm5F cells. Specific antibodies were used to
For supershift assays, 3 lg of specific (goat anti-HNF1 or goat anti- determine whether these bands represent HNF1 bound
vHNF1) or control antibody (goat anti-HNF4) was added to binding
reactions and the mixtures were incubated for 1 h prior to the addition
to the labelled DNA probe. On the addition of HNF1
of the radiolabelled doublestranded oligonucleotide. DNA–protein antibody, in contrast to the HNF4 antibody, a single
complexes were resolved by 4% non-denaturing polyacrylamide gel band from both the RINm5F and COS7 pBJ-HNF1
466 J. Green et al. / Biochemical and Biophysical Research Communications 310 (2003) 464–469

region as HNF1 within the insulin promoter [20], we

also tested whether vHNF1 was one of the proteins
binding the amylin promoter sequence used in our
study. In contrast to the HNF1 antibodies, the vHNF1
antibodies did not produce a supershift, showing that
either the vHNF1 protein does not bind the amylin
promoter in this region or that the RINm5F cell line
does not express this protein (Fig. 2). There were several
nuclear proteins that bound the AMYBS4 oligonucleo-
tide but were not supershifted by the HNF1 antibody. It
is conceivable that one of these bands could be the IPF1
protein, which was previously observed to bind the
amylin promoter within this sequence [37].
We also tested the binding of HNF1 to the islet-
specific glucokinase promoter using EMSA, as analysis
by MatInspector found a weak putative binding site for
HNF1 215 bp from the transcriptional start site (NCBI
Fig. 1. Analysis of nuclear proteins binding to the human amylin
GenBank Accession No.: M90297). In contrast to the
promoter. EMSA analyses of protein extracts prepared from (A)
RINm5F cells, (B) COS7 cells transfected with an HNF1 expression amylin promoter region, the proteins that bound this
vector, and (C) COS7 cells, using AMYBS4 oligonucleotide as a probe. DNA sequence of the glucokinase promoter DNA se-
Where specified, a 100-fold excess of unlabeled competitors (SC, spe- quence were not supershifted by the HNF1 antibodies
cific competitor; NS, non-specific competitor) was also added to the (data not shown). Our observation that HNF1 does not
binding reactions. The putative DNA-HNF1 complex (arrow) is
bind the pancreatic glucokinase promoter is in agree-
identified.
ment with what has been recently reported [45].
To investigate whether the HNF1 transcription factor
can physiologically be involved in the regulation of the

Fig. 2. Analysis of HNF1 binding to the amylin gene promoter. EMSA

analyses were performed using the AMYBS4 probe and nuclear ex-
tracts from (A) RINm5F cells and (B) pBJ-HNF1 transfected COS7 Fig. 3. The regulation of the amylin promoter by the HNF1 tran-
cells. Before addition of the probe, HNF1 antibody (1), HNF4 anti- scription factor. The pAP plasmid, which contained the 1893 bp of the
body (4) or vHNF1 (v1) antibody was added to the binding reactions human amylin promoter, and the pSV-b-galactosidase vector (Pro-
as specified. The DNA–HNF1 complex (HNF1 arrow) and supershift mega) were co-transfected into COS7 cells with or without the pBJ-
(SS star) are identified. HNF1 expression plasmid. Forty-eight hours after the transfection
CAT activity was measured and normalised with respect to the
transfection efficiency evaluated by b-galactosidase expression. The
transfected cell extracts was eliminated and a band with results are expressed as relative CAT activity normalised by b-galac-
lower mobility was produced (Fig. 2, SS star). Due to tosidase activity. All data are presented as means of four individual
the previous observation that vHNF1 binds the same transfection experiments.
 J. Green et al. / Biochemical and Biophysical Research Communications 310 (2003) 464–469 467

amylin gene, an amylin promoter reporter vector (pAP) The regulation of the amylin gene has not been ex-
was co-transfected with or without the HNF1 expres- tensively investigated. To date, the transcription factors
sion vector (pBJ-HNF1) into COS7 cells (Fig. 3). The Pax4 and Isl-1 have been observed to negatively control
overexpression of HNF1 caused an 85% inhibition of amylin’s expression whilst IPF1 (mutated in MODY4)
amylin’s promoter activity, as judged by CAT expres- has a positive effect [37,52]. In addition, the insulin up-
sion, ((P < 0:0001), Student’s t test). stream factor 1 has also been shown to bind the amylin
promoter [41]. The mutations identified in MODY3
patients inactivate HNF1 by either relocating this
Discussion transcription factor to the cytoplasm or decreasing its
DNA binding or transactivation activity [18,20,49–51].
It is currently unknown how mutations in the HNF1 Therefore in light of the data presented here, it is fea-
gene result in the diabetic MODY3 syndrome or how sible that a mutation of the HNF1 gene would lead to a
HNF1 itself is involved in glucose metabolism. Studies decrease in HNF1’s inhibitory effect and therefore to
in MODY3 patients and HNF1-null mice indicated a over-expression of amylin. Since it has been suggested
defect in b-cell glucose sensing, which probably results that an increase in amylin production could lead to the
from the failure of the mutant HNF1 to regulate the formation of pancreatic amyloid [53,54], it would be of
expression of target genes accurately. Therefore, a study interest to investigate whether such pancreatic aggre-
of genes that are involved in glucose sensing and me- gates exist in MODY3 patients and to evaluate their
tabolism, and are likely to be regulated by HNF1 could contribution to the MODY3 pathological process. Evi-
lead to a better understanding of the pathological pro- dence suggests that over-expression of amylin also leads
cesses in MODY3. to insulin resistance, one of the primary defects cha-
The insulin, amylin, and glucokinase promoters have racterising diabetes. If this were the case, it may also
been observed to be bind similar transcription factors explain in part why HNF1 mutations, through its action
[36,38–40]. Because HNF1 binds to and regulates the on the amylin gene, result in diabetes.
expression of the insulin gene, we hypothesised that In conclusion, we have presented data supporting the
HNF1 also plays a role in the regulation of the amylin role of the HNF1 transcription factor in the negative
and glucokinase genes. Using EMSA with cell extracts regulation of the amylin gene. This new information
from the pancreatic cell line RINm5F and HNF1 may help explain further how mutations in the MODY3
transfected COS7 cells, we observed that a protein gene cause this subtype of diabetes.
which specifically bound the amylin promoter was su-
pershifted by an HNF1 specific antibody. In contrast,
we did not observe any supershift by HNF1 antibody of Acknowledgments
any of the proteins that bound to the glucokinase pro-
moter sequence. Therefore, we conclude that the amylin, We would like to acknowledge Dr. Shaoping Zhang, Dr. Junxi Liu,
but not the glucokinase promoter, is bound by the Cynthia Tse, and Nicola Poa for technical help. We also thank the
HNF1 transcription factor. Endocore Research Trust for financial support for this project.
The experiment in which COS7 cells were co-trans-
fected with an HNF1 expression plasmid and an am-
ylin promoter reporter construct provided evidence References
that HNF1 negatively regulates the amylin gene.
HNF1 has previously been shown to act either as a [1] A. Clark, E.J. de Koning, A.T. Hattersley, B.C. Hansen, C.S.
positive or a negative transcription regulator, depend- Yajnik, J. Poulton, Pancreatic pathology in non-insulin dependent
ing on the specific promoter studied. HNF1 has been diabetes (NIDDM), Diabetes Res. Clin. Pract. 28 (1995) S39–47.
[2] G.J. Cooper, A.C. Willis, A. Clark, R.C. Turner, R.B. Sim, K.B.
shown to inhibit transcription from the insulin pro- Reid, Purification and characterization of a peptide from amyloid-
moter [21]. It is also known that HNF1 negatively rich pancreases of type 2 diabetic patients, Proc. Natl. Acad. Sci.
regulates its own transcription and furthermore HNF1 USA 84 (1987) 8628–8632.
enhances insulin’s negative affect on the transcriptional [3] G.J. Cooper, Amylin compared with calcitonin gene-related
regulation of glucose-6-phosphatase [46,47]. In con- peptide: Structure, biology, and relevance to metabolic disease,
Endocr. Rev. 15 (1994) 163–201.
trast, HNF1 is known to act as an accessory factor to [4] S.S. Fajans, G.I. Bell, D.W. Bowden, MODY: a model for the
enhance the transcription stimulated by glucocorticoids study of the molecular genetics of NIDDM, J. Lab. Clin. Med.
and cAMP [48]. The expression of the insulin gene has 119 (1992) 206–210.
also been shown to be regulated by HNF1 [19,20]. [5] K. Yamagata, N. Oda, P.J. Kaisaki, S. Menzel, H. Furuta,
Interestingly, when the amylin and insulin promoters M. Vaxillaire, L. Southam, R.D. Cox, G.M. Lathrop, V.V.
Boriraj, X.N. Chen, N.J. Cox, Y. Oda, H. Yano, M.M. Lebeau, S.
are aligned [38], the HNF1 binding region within the Yamada, H. Nishigori, J. Takeda, S.S. Fajans, A.T. Hattersley,
amylin promoter corresponds to the insulin promoter N. Iwasaki, T. Hansen, O. Pedersen, K.S. Polonsky, R.C.
HNF1 binding site. Turner, G.I. Bell, et al., Mutations in the hepatocyte nuclear
468 J. Green et al. / Biochemical and Biophysical Research Communications 310 (2003) 464–469

factor-1-alpha gene in maturity-onset diabetes of the young a target gene of hepatocyte nuclear factor-1alpha (HNF-1alpha)
(Mody3), Nature 384 (1996) 455–458. and HNF-1beta, Biochem. Biophys. Res. Commun. 263 (1999)
[6] P. Froguel, M. Vaxillaire, F. Sun, G. Velho, H. Zouali, M.O. 566–569.
Butel, S. Lesage, N. Vionnet, K. Clement, F. Fougerousse, et al., [21] K. Yamakawa, H. Yamasaki, M. Ozaki, M.D. Yamauchi, N.
Close linkage of glucokinase locus on chromosome 7p to early- Fujita, T. Abe, H. Miyazoe, Y. Sera, S. Uotani, E. Kawasaki, H.
onset non-insulin-dependent diabetes mellitus, Nature 356 (1992) Takino, Y. Yamaguchi, K. Eguchi, Hepatocyte nuclear
162–164. factor-1alpha inhibits insulin promoter factor 1-dependent trans-
[7] A.T. Hattersley, R.C. Turner, M.A. Permutt, P. Patel, Y. activation of the human insulin gene, Endocr. Res. 27 (2001)
Tanizawa, K.C. Chiu, S. O’Rahilly, P.J. Watkins, J.S. Wainscoat, 63–74.
Linkage of type 2 diabetes to the glucokinase gene, Lancet 339 [22] L. Miquerol, S. Lopez, N. Cartier, M. Tulliez, M. Raymondjean,
(1992) 1307–1310. A. Kahn, Expression of the L -type pyruvate kinase gene and the
[8] K. Yamagata, H. Furuta, N. Oda, P.J. Kaisaki, S. Menzel, N.J. hepatocyte nuclear factor 4 transcription factor in exocrine and
Cox, S.S. Fajans, S. Signorini, M. Stoffel, G.I. Bell, Mutations in endocrine pancreas, J. Biol. Chem. 269 (1994) 8944–8951.
the hepatocyte nuclear factor-4alpha gene in maturity-onset [23] T. Noguchi, K. Yamada, K. Yamagata, M. Takenaka, H.
diabetes of the young (MODY1), Nature 384 (1996) 458–460. Nakajima, E. Imai, Z. Wang, T. Tanaka, Expression of liver type
[9] D.A. Stoffers, J. Ferrer, W.L. Clarke, J.F. Habener, Early-onset pyruvate kinase in insulinoma cells: involvement of LF-B1
type-II diabetes mellitus (MODY4) linked to IPF1, Nat. Genet. 17 (HNF1), Biochem. Biophys. Res. Commun. 181 (1991) 259–
(1997) 138–139. 264.
[10] Y. Horikawa, N. Iwasaki, M. Hara, H. Furuta, Y. Hinokio, B.N. [24] C. Gregori, A. Porteu, C. Mitchell, A. Kahn, A.L. Pichard, In
Cockburn, T. Lindner, K. Yamagata, M. Ogata, O. Tomonaga, vivo functional characterization of the aldolase B gene enhancer,
H. Kuroki, T. Kasahara, Y. Iwamoto, G.I. Bell, Mutation in J. Biol. Chem. 277 (2002) 28618–28623.
hepatocyte nuclear factor-1-beta gene (Tcf2) associated with [25] Q. Yang, K. Yamagata, K. Fukui, Y. Cao, T. Nammo, H.
mody, Nat. Genet. 17 (1997) 384–385. Iwahashi, H. Wang, I. Matsumura, T. Hanafusa, R. Bucala, C.B.
[11] S.Y. Kristinsson, E.T. Thorolfsdottir, B. Talseth, E. Steingrims- Wollheim, J. Miyagawa, Y. Matsuzawa, Hepatocyte nuclear
son, A.V. Thorsson, T. Helgason, A.B. Hreidarsson, R. Arn- factor-1alpha modulates pancreatic beta-cell growth by regulating
grimsson, MODY in Iceland is associated with mutations in the expression of insulin-like growth factor-1 in INS-1 cells,
HNF-1alpha and a novel mutation in NeuroD1, Diabetologia 44 Diabetes 51 (2002) 1785–1792.
(2001) 2098–2103. [26] S.M. Mitchell, M. Vaxillaire, H. Thomas, M. Parrizas, Y.
[12] M.J. Dronsfield, C.J.J. Tack, S.C. Bain, A.T. Hattersley, Benmezroua, A. Costa, T. Hansen, K.R. Owen, T. Tuomi, F.
Linkage of the gene for maturity-onset diabetes of the young Pirie, G.U. Ryffel, J. Ferrer, P. Froguel, A.T. Hattersley, T.M.
with markers on the long arm of chromosome 12, Diabetologia Frayling, Rare variants identified in the HNF-4 alpha beta-cell-
38 (1995) A60. specific promoter and alternative exon 1 lack biological signifi-
[13] F. Tronche, M. Yaniv, HNF1, a homeoprotein member of the cance in maturity onset diabetes of the young and young onset
hepatic transcription regulatory network, Bioessays 14 (1992) Type II diabetes, Diabetologia 45 (2002) 1344–1348.
579–587. [27] E. Ben-Shushan, S. Marshak, M. Shoshkes, E. Cerasi, D. Melloul,
[14] M. Pontoglio, J. Barra, M. Hadchouel, A. Doyen, C. Kress, J.P. A pancreatic beta-cell-specific enhancer in the human PDX-1 gene
Bach, C. Babinet, M. Yaniv, Hepatocyte nuclear factor 1 is regulated by hepatocyte nuclear factor 3beta (HNF-3beta ),
inactivation results in hepatic dysfunction, phenylketonuria, and HNF-1alpha, and SPs transcription factors, J. Biol. Chem. 276
renal Fanconi syndrome, Cell 84 (1996) 575–585. (2001) 17533–17540.
[15] M.M. Byrne, J. Sturis, S. Menzel, K. Yamagata, S.S. Fajans, M.J. [28] S.A. Duncan, M.A. Navas, D. Dufort, J. Rossant, M. Stoffel,
Dronsfield, S.C. Bain, A.T. Hattersley, G. Velho, P. Froguel, G.I. Regulation of a transcription factor network required for differ-
Bell, K.S. Polonsky, Altered insulin secretory responses to glucose entiation and metabolism, Science 281 (1998) 692–695.
in diabetic and nondiabetic subjects with mutations in the diabetes [29] K. Gerrish, M.A. Cissell, R. Stein, The role of hepatic nuclear
susceptibility gene MODY3 on chromosome 12, Diabetes 45 factor 1 alpha and PDX-1 in transcriptional regulation of the pdx-
(1996) 1503–1510. 1 gene, J. Biol. Chem. 276 (2001) 47775–47784.
[16] M. Pontoglio, S. Sreenan, M. Roe, W. Pugh, D. Ostrega, A. [30] C.J. Kuo, P.B. Conley, L. Chen, F.M. Sladek, J.E. Darnell Jr.,
Doyen, A.J. Pick, A. Baldwin, G. Velho, P. Froguel, M. Levisetti, G.R. Crabtree, A transcriptional hierarchy involved in mamma-
S. Bonnerweir, G.I. Bell, M. Yaniv, K.S. Polonsky, Defective lian cell-type specification, Nature 355 (1992) 457–461.
insulin secretion in hepatocyte nuclear factor 1-alpha-deficient [31] H. Thomas, K. Jaschkowitz, M. Bulman, T.M. Frayling, S.M.
mice, J. Clin. Invest. 101 (1998) 2215–2222. Mitchell, S. Roosen, A. Lingott-Frieg, C.J. Tack, S. Ellard, G.U.
[17] I.D. Dukes, S. Sreenan, M.W. Roe, M. Levisetti, Y.P. Zhou, D. Ryffel, A.T. Hattersley, A distant upstream promoter of the HNF-
Ostrega, G.I. Bell, M. Pontoglio, M. Yaniv, L. Philipson, K.S. 4alpha gene connects the transcription factors involved in
Polonsky, Defective pancreatic beta-cell glycolytic signaling in maturity-onset diabetes of the young, Hum. Mol. Genet. 10
hepatocyte nuclear factor-1-alpha-deficient mice, J. Biol. Chem. (2001) 2089–2097.
273 (1998) 24457–24464. [32] S.F. Boj, M. Parrizas, M.A. Maestro, J. Ferrer, A transcription
[18] H.Y. Wang, P. Maechler, K.A. Hagenfeldt, C.B. Wollheim, factor regulatory circuit in differentiated pancreatic cells, Proc.
Dominant-negative suppression of HNF-1 alpha function results Natl. Acad. Sci. USA 98 (2001) 14481–14486.
in defective insulin gene transcription and impaired metabolism- [33] S.K. Hansen, M. Parrizas, M.L. Jensen, S. Pruhova, J. Ek, S.F.
secretion coupling in a pancreatic beta-cell line, EMBO J. 17 Boj, A. Johansen, M.A. Maestro, F. Rivera, H. Eiberg, M. Andel,
(1998) 6701–6713. J. Lebl, O. Pedersen, J. Ferrer, T. Hansen, Genetic evidence that
[19] L.A. Emens, D.W. Landers, L.G. Moss, Hepatocyte nuclear HNF-1alpha-dependent transcriptional control of HNF-4alpha is
factor 1 alpha is expressed in a hamster insulinoma line and essential for human pancreatic beta cell function, J. Clin. Invest.
transactivates the rat insulin I gene, Proc. Natl. Acad. Sci. USA 89 110 (2002) 827–833.
(1992) 7300–7304. [34] H. Wang, K. Hagenfeldt-Johansson, L.A. Otten, B.R. Gauthier,
[20] K. Okita, Q. Yang, K. Yamagata, K.A. Hangenfeldt, J. P.L. Herrera, C.B. Wollheim, Experimental models of transcrip-
Miyagawa, Y. Kajimoto, H. Nakajima, M. Namba, C.B. tion factor-associated maturity-onset diabetes of the young,
Wollheim, T. Hanafusa, Y. Matsuzawa, Human insulin gene is Diabetes 51 (Suppl. 3) (2002) S333–342.
 J. Green et al. / Biochemical and Biophysical Research Communications 310 (2003) 464–469 469

[35] H. Watada, Y. Kajimoto, Y. Umayahara, T. Matsuoka, H. [45] J.Y. Cha, H.I. Kim, S.S. Im, T.Z. Li, Y.H. Ahn, HNF1 and/or
Kaneto, Y. Fujitani, T. Kamada, R. Kawamori, Y. Yamasaki, HNF3 may contribute to the tissue specific expression of
The human glucokinase gene beta-cell-type promoter—an essential glucokinase gene, Exp. Mol. Med. 33 (2001) 59–63.
role of insulin promoter factor 1/Pdx-1 in its activation in hit-T15 [46] E. Ktistaki, I. Talianidis, Modulation of hepatic gene expression
cells, Diabetes 45 (1996) 1478–1488. by hepatocyte nuclear factor 1, Science 277 (1997) 109–112.
[36] I.B. Leibiger, R. Walther, U. Pett, B. Leibiger, Positive [47] R.S. Streeper, E.M. Eaton, D.H. Ebert, S.C. Chapman, C.A.
and negative regulatory elements are involved in transcrip- Svitek, R.M. Obrien, Hepatocyte nuclear factor-1 acts as an
tional control of the rat glucokinase gene in the insulin accessory factor to enhance the inhibitory action of insulin on
producing cell line HIT M2.2.2, FEBS Lett. 337 (1994) mouse glucose-6-phosphatase gene transcription, Proc. Natl.
161–166. Acad. Sci. USA 95 (1998) 9208–9213.
[37] H. Watada, Y. Kajimoto, H. Kaneto, T. Matsuoka, Y. Fujitani, J. [48] D.S. Suh, Y.H. Zhou, G.T. Ooi, M.M. Rechler, Dexamethasone
Miyazaki, Y. Yamasaki, Involvement of the homeodomain- stimulation of rat insulin-like growth factor binding protein-1
containing transcription factor Pdx-1 in islet amyloid polypeptide promoter activity involves multiple Cis-elements, Mol. Endocri-
gene transcription, Biochem. Biophys. Res. Commun. 229 (1996) nol. 10 (1996) 1227–1237.
746–751. [49] S. Yamada, H. Tomura, H. Nishigori, K. Sho, H. Mabe, N.
[38] M.S. German, L.G. Moss, J. Wang, W.J. Rutter, The insulin and Iwatani, T. Takumi, Y. Kito, N. Moriya, K. Muroya, T. Ogata,
islet amyloid polypeptide genes contain similar cell-specific K. Onigata, A. Morikawa, I. Inoue, J. Takeda, Identification of
promoter elements that bind identical beta-cell nuclear complexes, mutations in the hepatocyte nuclear factor-1 alpha gene in
Mol. Cell. Biol. 12 (1992) 1777–1788. Japanese subjects with early-onset NIDDM and functional
[39] B. Leibiger, R. Walther, I.B. Leibiger, The role of the proximal analysis of the mutant proteins, Diabetes 48 (1999) 645–648.
CTAAT-box of the rat glucokinase upstream promoter in [50] K. Yamagata, Q. Yang, K. Yamamoto, H. Iwahashi, J. Miya-
transcriptional control in insulin-producing cells, Biol. Chem. gawa, K. Okita, I. Yoshiuchi, J. Miyazaki, T. Noguchi, H.
Hoppe-Seyler 375 (1994) 93–98. Nakajima, M. Namba, T. Hanafusa, Y. Matsuzawa, Mutation
[40] K.D. Shelton, A.J. Franklin, A. Khoor, J. Beechem, M.A. P291fsinsc in the transcription factor hepatocyte nuclear factor-1-
Magnuson, Multiple elements in the upstream glucokinase pro- alpha is dominant negative, Diabetes 47 (1998) 1231–1235.
moter contribute to transcription in insulinoma cells, Mol. Cell. [51] I. Yoshiuchi, K. Yamagata, M. Yoshimoto, Q. Zhu, Q. Yang, T.
Biol. 12 (1992) 4578–4589. Nammo, R. Uenaka, E. Kinoshita, T. Hanafusa, J. Miyagawa, Y.
[41] D. Brethertonwatt, N. Gore, D.S.W. Boam, Insulin upstream Matsuzawa, Analysis of a non-functional HNF-1alpha (TCF1)
factor 1 and a novel ubiquitous factor bind to the human islet mutation in Japanese subjects with familial type 1 diabetes, Hum.
amyloid polypeptide amylin gene promoter, Biochem. J. 313 Mutat. 18 (2001) 345–351.
(1996) 495–502. [52] S.C. Campbell, H. Cragg, L.J. Elrick, W.M. Macfarlane, K.I.
[42] M. Wang, D.J. Drucker, Activation of amylin gene transcription Shennan, K. Docherty, Inhibitory effect of pax4 on the human
by the lim domain homeobox gene Isl-1, Mol. Endocrinol. 10 insulin and islet amyloid polypeptide (IAPP) promoters, FEBS
(1996) 243–251. Lett. 463 (1999) 53–57.
[43] K. Quandt, K. Frech, H. Karas, E. Wingender, T. Werner, [53] B. Leighton, G.J. Cooper, The role of amylin in the insulin
Matind and matinspector—new fast and versatile tools for resistance of non-insulin-dependent diabetes mellitus, Trends
detection of consensus matches in nucleotide sequence data, Biochem. Sci. 15 (1990) 295–299.
Nucleic Acids Res. 23 (1995) 4878–4884. [54] G.J. Cooper, B. Leighton, G.D. Dimitriadis, M. Parry-Billings,
[44] S. Zhang, J. Liu, G. MacGibbon, M. Dragunow, G.J. Cooper, J.M. Kowalchuk, K. Howland, J.B. Rothbard, A.C. Willis, K.B.
Increased expression and activation of c-Jun contributes to human Reid, Amylin found in amyloid deposits in human type 2 diabetes
amylin-induced apoptosis in pancreatic islet beta-cells, J. Mol. mellitus may be a hormone that regulates glycogen metabolism in
Biol. 324 (2002) 271–285. skeletal muscle, Proc. Natl. Acad. Sci. USA 85 (1988) 7763–7766.