Original Article | Iran J Pathol.

2016; 11(1): 47 - 47
53

http://www.ijp.iranpath.org/

Relation between Resistance to Antipseudomonal β-Lactams and

ampC and mexC Genes of Pseudomonas aeruginosa
Fatemeh Rezaei1, Horieh Saderi1,2, Shahram Boroumandi3,4, Soghrat Faghihzadeh5
1. Dept. of Microbiology, School of Medicine, Shahed University, Tehran, Iran
2. Molecular Microbiology Research Center, Shahed University, Tehran, Iran
3. Pars Advanced and Minimally Invasive Research Center, Iran University of Medical Sciences, Tehran, Iran
4. Islamic Azad University, Tehran Medical Sciences Branch, Tehran, Iran
5. Dept. of Biostatistics and Epidemiology, Zanjan University of Medical Science, Zanjan, Iran

KEY WORDS ABSTRACT

Pseudomonas aeruginosa Background: In order to select a better antibiotic choice for treatment of
β-lactams Pseudomonas aeruginosa infections, this study was conducted to determine the
mexC frequency of resistance to some antipseudomonal β-lactams in P. aeruginosa isolates
from patients in Tehran, Iran. In addition, the relation between presence of genes
ampC
known to be responsible for resistance to β-lactams (ampC, mexC1,2, and mexC3,4
genes) and resistance phenotype among P. aeroginosa isolates was evaluated.
Methods: P. aeruginosa strains were isolated and identified by routine methods
and PCR for oprL gene. Disk diffusion method was employed to determine the
antimicrobial susceptibility pattern according to CLSI recommendations. PCR was
A RT I C L E I N F O
used to detect the resistance genes.
Results: Among 100 isolates of P. aeruginosa, 82% had ampC, 86% mexC1,2 and
Received 30 Dec 2014;
89% mexC3,4 genes and combinations of these genes were seen in most of isolates
Accepted 05 Jan 2015;
and only 3% of isolates had none of these genes. Resistance to mezlocillin, cefepime,
ceftazidime and piperacillin/ tazobactam was seen in 46%, 41%, 36% and 29% of
isolates, respectively. Significant relation (P value ≤0.05 by Chi-square or Fisher Exact
test) was observed between the presence of ampC gene and resistance to all the studied
β-lactams in this study. No relation was observed for mexC genes, although many of
isolates containing these two genes were phenotypically resistant.
Discussion: This study had shown for the first time, the presence of ampC and
mexC genes in significant percent of clinical isolates of P. aeruginosa in Tehran,
Iran, and relation between presence of ampC gene and resistance to β-lactams.
©Iran J Pathol. All rights reserved.
Corresponding Information: Horieh Saderi, PhD, Address: No. 31, Abdollahzadeh Str, Keshavarz Blvd., School of Medicine, Shahed University, P.O.
Box: 14155-7435, Tehran, Iran. Tel: 00982188964792, Mobile: 0098-9123278569, Fax: 0098-2188966310. E-mail: saderih@yahoo.com
Copyright © 2016, IRANIAN JOURNAL OF PATHOLOGY. This is an open-access article distributed under the terms of the Creative Commons Attribution-noncommercial 4.0 International License which
permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Introduction as a major nosocomial pathogen in immune-

compromised patients as a result of burns or
Pseudomonas aeruginosa is a member of other severe trauma, and underlying diseases
skin normal flora in humans but has emerged including cancer, diabetes and cystic fibrosis (1).

Vol.11 No.1, Winter 2016 IRANIAN JOURNAL OF PATHOLOGY

48 β-lactams resistance & ampC and mexC genes

This bacterium is associated with different kinds information about distribution of these genes in
of infections such as otitis externa, burn wounds, Iran, this study was performed to determine the
urinary tract infections, ventilator associated frequency of these genes among P. aeruginosa
pneumonia and septicemia (2). It is responsible isolated from patients in Tehran, Iran. This study
for about 10% of nosocomial infections and is has shown for the first time, the presence of
considered as a major cause of mortality and ampC and mexC genes in significant percent of
morbidity in these patients (3). clinical isolates of P. aeruginosa in Tehran, Iran,
P. aeruginosa has different mechanisms of and relation between presence of ampC gene and
resistance against antimicrobial agents; therefore, resistance to β-lactams.
it is an important problem in clinical centers (1). It
uses special outer membrane porins to restrict the Materials and Methods
uptake of antibiotics and the secondary resistance
mechanisms such as energy-dependent multidrug Bacterial isolates
efflux and chromosomally producing β-lactamase
(4). A major component of bacterial resistance to P. aeruginosa isolated from patients in three
many classes of antibiotics is expelling them out hospital laboratories (Pars and Milad hospitals
of bacteria cells that occur due to the activity of and Motahari Burn Center) in Tehran, Iran, in
membrane transporter proteins called drug efflux 2013 were collected and 100 of them selected
pumps (5). Extrusion of antibiotics and restricted randomly and used in this study. Identification
uptake through porins of outer membrane can of isolates as P. aeruginosa was done based on
cause a decrease in intracellular concentration of general phenotypic methods including colony
antibiotics (6). There are many genes that encode pigmentation, Gram staining, oxidase test,
putative efflux pumps. One of the important oxidative/fermentative (OF) test for carbohydrate
families of chromosomally encoded bacterial utilization, growth at 42˚C and growth on
efflux pumps is the resistance nodulation division cetrimide agar (13).
(RND) family. This kind of pumps has three
components: a membrane fusion protein that is PCR for detection of genes
associated with the cytoplasmic membrane, a
periplasmic accessory protein (such as MexA, Genomic DNA was extracted based on the
MexC, MexE and MexX), and an outer membrane Ozer et al. method (12) with some modifications.
protein (OMP) (such as OprM, OprJ and OprN) The isolates were screened for presence of
(7-11). As a result of synergy between outer resistance genes ampC, mexC1,2 and mexC3,4
membrane impermeability and chromosomally genes according to PCR method of Ozer et al.
encoded efflux pumps, P. aeruginosa shows (12). Molecular identification of P. aeruginosa
a remarkable intrinsic resistance to various was performed with PCR using oprL gene
antibiotic families (9). This antibiotic resistance primers (14). Primers used in this study are
is mediated by several resistance genes using shown in Table 1.
multiple mechanisms resulting in making the We performed Duplex PCR assay for the
treatment of many Pseudomonal infections more detection of studied genes in a thermal cycler
complicated. (Techne, UK). This Duplex PCR reaction
The existence of three resistance genes (ampC, were carried out in a final volume of 25µl
mexC1,2 and mexC3,4) are related to resistance containing 12.5µl Master Mix (Amplicon
to antipseudomonal β-lactams in clinical isolates Taq DNA Polymerase 2x Master Mix Red,
of P. aeruginosa (12). Due to the absence of ViraGene Company, Iran), 9.5µl DDW, 1µl of

IRANIAN JOURNAL OF PATHOLOGY Vol.11 No.1, Winter 2016

 F. Rezaei et al. 49

Table 1
Primers used in this study

Product length
Gene Forward and Reverse Primers Sequences (5ʹ to 3ʹ) Reference
(bp)
CGGCTCGGTGAGCAAGACCTTC
ampC 218 (12)
AGTCGCGGATCTGTGCCTGGTC
ATCCGGCACCGCTGAAGGCTGCG
mexC1,2 344 (12)
CGGATCGAGCTGCTGGATGCGCG
GTACCGGCGTCATGCAGGGTCC
mexC3,4 164 (12)
TTACTGTTGCGGCGCAGGTGACT
ATGGAAATGCTGAAATTCGGC
oprL 504 (14)
CTTCTTCAGCTCGACGCGACG

each primers (0.5 µl Forward primer and 0.5µl frequencies were computed by Statistical
Reverse primer) and 1µl DNA template. Master Package for Social Sciences version 20 (SSPS
Mix1 contained ampC and mexC1,2 primers, Inc, Chicago, IL, USA). The relation between
and Master Mix2 contained mexC3,4 and oprL antibiotic resistance and the presence of the
primers. Program of amplification process was as resistance genes is determined by Chi-square
follows: Initial denaturation at 93˚C for 5 min, or Fisher Exact test and P value ≤0.05 was
30 cycles of initiation at 93˚C, annealing at 55˚C considered statistically significant.
and extension at 72˚C; each 1 min; and final
extension at 72˚C for 5 min. The PCR products Results
and 100bp DNA ladder were visualized under
gel documentation system (UVItec, UK) after From 100 collected P. aeruginosa isolates
electrophoresis on a 1% agarose gel and staining 67, 25 and 8 were isolated from patients in Pars
by Ethidium Bromide. Hospital, Milad Hospital, and Motahari Burn
Center, respectively, which were isolated from
Antimicrobial susceptibility testing sputum (50%), urine (35%), wound (13%), CSF
(1%), and blood (1%). Characteristics of patients
Disk diffusion method was used for detection showed that 51 of them were male and 49 female,
of antimicrobial susceptibility pattern in 62 were outpatient and 38 inpatients, and mean
clinical isolates of P. aeruginosa according to age was 52.57 ± 27.15 (12 cases had below 15,
the Clinical and Laboratory Standards Institute 20 cases 15-44, 23 cases 45-64 and 45 cases 65-
(CLSI) guidelines (15). The following antibiotic 94 years old.
disks from MAST Group Ltd. (Merseyside, UK), In all isolates identified by phenotypically
were used: Mezlocillin (MEZ; 75µg), cefepime methods as P. aeruginosa, the oprL gene was
(CPM; 30µg), ceftazidime (CAZ; 30µg) and also detected by PCR method. Altogether, ampC,
piperacillin/ tazobactam (PTZ; 100/10µg). mexC1,2 and mexC3,4 genes were detected in
Control strains used for piperacillin/ tazobactam 82%, 86%, and 89% of isolates, respectively, and
was E. coli ATCC35218, and for other antibiotics combination of genes were also seen in many
was P. aeruginosa ATCC27853. of isolates and only three isolates had neither of
these genes (table 2).
Data analysis Antibiotic susceptibility of studied isolates
had shown in Fig. 1. Resistance to mezlocillin,
All collected data were analyzed and cefepime, ceftazidime and piperacillin/

Vol.11 No.1, Winter 2016 IRANIAN JOURNAL OF PATHOLOGY

50 β-lactams resistance & ampC and mexC genes

Table 2
Frequency of studied genes in Iranian P. aeruginosa isolates

Gene (s) Percent

ampC 82
mexC1,2 86
mexC3,4 89
ampC & mexC1,2 75
ampC & mexC3,4 75
mexC1,2 & mexC3,4 80 Fig. 1
Results of susceptibility test for Iranian P. aeruginosa
ampC & mexC1,2 & mexC3,4 70
isolates
Without ampC & mexC1,2 & mexC3,4 3

tazobactam was seen in 46%, 41%, 36% and 29% other studies in Iran, which were 57.5% to 89.5%
of studied P. aeruginosa isolates, respectively. (17, 23-26). In our study, resistance to cefepime
Relation between resistance to theses was 41% that was almost similar to a report with
antipseudomonal β-lactams and the presence the result of 39%, but much less than other study
of ampC, mexC1,2 and mexC3,4 genes among which was 91.7% (17, 25). Furthermore we
studied P. aeruginosa isolates were also studied found that resistance to piperacillin/ tazobactam
by statistical methods. Significant relation (P was 29% which showed similarity to study of
value ≤ 0.001) was shown between the resistance Shahcheraghi et al. (28%), and a little higher
to each studied antibiotic and presence of ampC than the result of Salimi et al. (19.1%), however,
gene. This relation was not found for mexC genes, it was reported 87.2% resistance that was
although a high number of resistant isolates had much higher than our study (17, 24, 26). The
these genes. rates of resistance to ceftazidime, piperacillin/
tazobactam and mezlocillin in this study were
Discussion 36%, 29%, and 46%, respectively, similar to a
report (12) from Turkey, our neighbor country,
Because of the importance of P. aeruginosa in which were reported respectively 30%, 24%, and
human infections, many studies are undertaken 50%, but the resistance to cefepime in this study
in the world about resistance to different was higher than mentioned report (41% versus
antibiotics in clinical isolates of this bacterium. 18%). searching in studies of other countries, the
Many reports were published in Iran about rates of resistance to mezlocillin were reported
frequency of resistance to different antibiotics 48% that shows higher rate in comparison with
in P. aeruginosa isolated from patients (16- our findings (19, 20). Geographic differences in
23); although there is no report of resistance antimicrobial resistance were also shown in other
to mezlocillin. In this study we focused on studies, and some of the variables explaining
determination of the frequency of resistance to these differences in population demographics,
four extended expectrum penicillins which are access to medical care and illicit drug use (27,
used in treatment of P. aeruginosa infections. 28).
Among clinical isolates of P. aeruginosa P. aeruginosa use several genes to mediate
collected in three Tehran hospitals, resistance resistance to β-lactam antibiotics including
to ceftazidime was 36%, which was higher than ampC, mexC1,2 and mexC3,4 genes (12, 29). The
Shahcheraghi et al. report (25%) and lower than ampC gene encodes an inducible chromosomal

IRANIAN JOURNAL OF PATHOLOGY Vol.11 No.1, Winter 2016

 F. Rezaei et al. 51

β-lactamase. The mexC genes are related to that most of these isolates had ampC and mexC
MexCD-OprJ efflux system and are belonging to genes and there was significant relation between
the RND family (30, 31). In the genetic map of resistant to used antipseudomonal β-lactams and
this bacterium, ampC is located beside the genes presence of ampC gene.
of the MexCD-OprJ efflux system (30). Besides,
it is shown that this efflux system is an inducible Acknowledgement
pump, which expression could be induced
after more using of some inducer antibiotics, Many thanks to Elham Faghihzadeh, Seyede
pressure of antibiotics and following mutation in Marzieh Mosavi, Rahim Nosrati and especially
mexR gene that control the expression of genes to microbiology laboratory staff of Pars ,Milad,
belonging to MexCD-OprJ efflux system (32, and Motahari hospitals for collaboration in this
33). Only a few reports were published about study .This survey was an MSc student thesis
presence of ampC gene in clinical isolates of P. and financially supported by Research Council
aeruginosa in Iran, such as study of Aghazadeh of Shahed University.
et al. (34), and presence of mexC genes have
not be done before this study. The studied genes Conflict of interest
(ampC, mexC1,2 and mexC3,4) were detected in
most of P. aeruginosa isolated from patients in The authors declare that there is no conflict of
Tehran, Iran. Unfortunately, we could not found interests.
any report about the rate of mexC genes in clinical
isolates of P. aeruginosa in other countries for
comparison, except the study of Ozer et al. in References
Turkey ,)12( which reported lower rates for these
genes. 1. Morales E, Cots F, Sala M, Comas M, Belvis
F, Riu M, et al. Hospital costs of nosocomial multi-drug
In this study ,relation between the resistance
resistant Pseudomonas aeruginosa acquisition. BMC
to mezlocillin ,cefepime ,ceftazidime and Health Serv Res 2012; 12(1): 122.
piperacillin /tazobactam and presence of ampC 2. Satti L, Abbasi S, Qumar TA, Khan MS, Hashmi
gene in P. aeruginosa isolated from patients in ZA. In Vitro Efficacy of Cefepime Against Multi-Drug
Iran were seen same to the Ozer et al. study in Resistant Pseudomonas aeruginosa- An Alarming
Turkey (12) but reported relation between the Situation in our Setup. Open Drug Resist J 2011; 1(1): 12-
resistance to these antibiotics and presence of 6.
3. Tohidpour A, Najar Peerayeh S, Mehrabadi
mexC genes was not shown in this study, although
JF, Rezaei Yazdi H. Determination of the Efflux Pump-
mexC genes were found in a high number of Mediated Resistance Prevalence in Pseudomonas
resistant isolates. aeruginosa, Using an Efflux Pump Inhibitor. Curr
Microbiol 2009; 59(3): 352-5.
Conclusion 4. Hancock REW, Speert DP. Antibiotic resistance
in Pseudomonas aeruginosa: mechanisms and impact on
The study presented high frequency of treatment. Drug Resist Updates 2000; 3(4): 247-55.
5. Zaman GJR, Flens MJ, Van Leusden MR, De Haas
resistance to mezlocillin, cefepime, ceftazidime,
M, Mulder HS, Lankelma J, et al. The human multidrug
and piperacillin/ tazobactam in P. aeruginosa resistance-associated protein MRP is a plasma membrane
isolated from patient in Tehran, Iran, which drug-efflux pump. Proc Natl Acad Sci 1994; 91(19): 8822-
could help in selection of the best antibiotic 6.
for empirical therapy in treatment of severe 6. Lee A, Mao W, Warren MS, Mistry A, Hoshino
pseudomonal infections. Moreover, it was shown K, Okumura R, et al. Interplay between Efflux Pumps May
Provide Either Additive or Multiplicative Effects on Drug

Vol.11 No.1, Winter 2016 IRANIAN JOURNAL OF PATHOLOGY

52 β-lactams resistance & ampC and mexC genes

Resistance. J Bacteriol 2000; 182(11): 3142-50. M, Farshad S. Susceptibility patterns and cross-resistance
7. Piddock LJ. Clinically Relevant Chromosomally of antibiotics against Pseudomonas aeruginosa isolated
Encoded Multidrug Resistance Efflux Pumps in Bacteria. from burn patients in the South of Iran. Burns 2006; 32(3):
Clin Microbiol Rev 2006; 19(2): 382-402. 343-7.
8. Ma D, Cook DN, Hearst JE, Nikaido H. Efflux 19. Yetkin G, Otlu B, Cicek A, Kuzucu C, Duramaz R.
pumps and drug resistance in gram-negative bacteria. Clinical, microbiologic, and epidemiologic characteristics
Trends Microbiol 1994; 2(12): 489-93. of Pseudomonas aeruginosa infections in a Urinary
9. Poole K. Multidrug Efflux Pumps and Hospital, Malatya, Turkey. Am J Infect Control 2006;
Antimicrobial Resistance in Pseudomonas aeruginosa and 34(4): 188-92.
related organisms. J Mol Microbiol Biotechnol 2001; 3(2): 20. Ojeda Vargas MM, Alonso R, Vindel A, Monzon-
255-64. Moreno C. Epidemiological considerations of infections
10. Lomovskaya O, Warren MS, Lee A, Galazzo J, caused by Pseudomonas aeruginosa in a Canary Islands
Fronko R, Lee M, et al. Identification and Characterization hospitals. Med Mal Infect 1993: 434-7.
of Inhibitors of Multidrug Resistance Efflux Pumps in 21. Alaghehbandan R, Azimi L, Rastegar Lari A.
Pseudomonas aeruginosa: Novel Agents for Combination Nosocomial infections among burn patients in Tehran,
Therapy. Antimicrob Agents Chemother 2001; 45(1): 105- Iran: a decade later. Ann Burns Fire Disasters 2012; 25(1):
16. 3-7.
11. Johnson JM, Church GM. Alignment and structure 22. Saderi H, Karimi Z, Owlia P, Bahar MA, Akhavi
prediction of divergent protein families: periplasmic and Rad SMB. Phenotypic detection of Metalo-beta-Lactamase
outer membrane proteins of bacterial efflux pumps. J Mol producing Pseudomonas aeruginosa strains isolated from
Biol 1999; 287(3): 695-715. burn patients. Iran J Pathol 2008; 3(1): 20-4.
12. Ozer B, Duran N, Onlen Y, Savas L. Efflux 23. Ranjbar R, Owlia P, Saderi H, Mansouri S.
pump genes and antimicrobial resistance of Pseudomonas Characterization of Pseudomonas aeruginosa strains
aeruginosa strains isolated from lower respiratory tract isolated from burned patients hospitalized in a major burn
infections acquired in an intensive care unit. J Antibiot center in Tehran, Iran. Acta Medica Iranica 2011; 49(10):
2012; 65(1): 9-13. 675-9.
13. Phillips I. Identification Of Pseudomonas 24. Shahcheraghi F, Badmasti F, Feizabadi MM.
aeruginosa in the clinical laboratory. J Med Microbiol Molecular characterization of class 1 integrons in MDR
1969; 2: 9-16. Pseudomonas aeruginosa isolated from clinical settings in
14. De Vos D, Lim Jr A, Pirnay JP, Struelens M, Iran, Tehran. FEMS Immunol Med Microb 2010; 58: 421-
Vandenvelde C, Duinslaeger L, et al. Direct detection 5.
and identification of Pseudomonas aeruginosa in clinical 25. Hosseini Jazani N, Zahedi A, Garebagi N.
samples such as skin biopsy specimens and expectorations Phenotipic detection of methalo-β-lactamase producing
by multiplex PCR based on two outer membrane lipoprotein Pseudomonas aeruginosa isolated from Urmia hospitals.
genes, oprI and oprL. J Clin Microbiol 1997; 35(6): 1295- Afr J Microbiol Res 2012; 6(7): 1387-92.
9. 26. Salimi H., Yakhchali B, Owlia P, Lari AR.
15. Clinical and Laboratory Standards Institute. Molecular Epidemiology and Drug Susceptibility of
Performance Standards for Antimicrobial Susceptibility Pseudomonas aeruginosa Strains Isolated From Burn
Testing; Twenty-third Informational Supplement. CLSI Patients. Lab Medicine 2010; 41(9): 540-4.
document M100-S23. Clinical and Laboratory Standards 27. Hirsch EB, Tam VH. Impact of multidrug-
Institute, 950 West Valley Road, Suite 2500, Wayne, resistant Pseudomonas aeruginosa infection on patient
Pennsylvania 19087 USA, 2013. outcomes. Expert Rev Pharmacoecon Outcomes Res 2010;
16. Owlia P, Saderi H, Mansouri S, Salemi S, Ameli 10(4): 441-51.
H. Drug resistance of isolated strains of Pseudomonas 28. Croft AC, D'Antoni AV, Terzulli SL. Update on
aeruginosa from burn wound infections to selected the antibacterial resistance crisis. Med Sci Monit 2007; 13
antibiotics and disinfectants. Iran J Pathol 2006; 1(2): 64-9. (6): RA103-18.
17. Moazami Goudarzi S, Eftekhar F. Assesment 29. Conejo MC, Martinez-Martinez L, Garcia
of carbapenem susceptibility and multidrug-resistance I, Picabea L, Pascual A. Effect of siliconized latex
in Pseudomonas aeruginosa burn isolates in Tehran. urinary catheters on the activity of carbapenems against
Jondishapour J Microbiol 2013; 6(2): 162-5. Pseudomonas aeruginosa strains with defined mutations
18. Japoni A, Alborzi A, Kalani M, Nasiri J, Hayati in ampC, oprD, and genes coding for efflux systems. Int J

IRANIAN JOURNAL OF PATHOLOGY Vol.11 No.1, Winter 2016

 F. Rezaei et al. 53

Antimicrob Agents 2003; 22(2): 122-7. aeruginosa. Biochem Biophys Res Commun 2003; 308(4):
30. Lambert PA. Mechanisms of antibiotic resistance 922-6.
in Pseudomonas aeruginosa. J R Soc Med 2002; 95(41): 34. Aghazadeh M, Hojabri Z, Mahdian R, Nahaei
22-6. MR, Rahmati M, Hojabri T, Pirzadeh T, Pajand O. Role
31. Strateva T, Yordanov D. Pseudomonas aeruginosa of efflux pumps: MexAB-OprM and MexXY-OprA),
a phenomenon of bacteria resistance. J Med Microb 2009; AmpC cephalosporinase and OprD porin in non-metallo-
58: 1133-48. β-lactamase producing Pseudomonas aeruginosa isolated
32. Morita Y, Komori Y, Mima T, Kuroda T, from cystic fibrosis and burn patients. Infect Genet Evol
Mizushima T, Tsuchiya T. Construction of a series of 2014; 24: 187-92.
mutants lacking all of the four major mex operons for
multidrug efflux pumps or possessing each one of the
How to cite this article:
operons from Pseudomonas aeruginosa PAO1: MexCD-
Rezaei F, Saderi H, Boroumandi S, Faghihzadeh S. Rela-
OprJ is an inducible pump. FEMS Microbiol Lett 2001;
202; 139-43. tion between Resistance to Antipseudomonal β-Lactams
33. Narita ShI, Eda Sh, Yoshihara E, Nakae T. Linkage and ampC and mexC Genes of Pseudomonas aeruginosa.
of the efflux-pump expression level with substrate extrusion Iran J Pathol. 2016; 11(1): 47 - 53.
rate in the MexAB-OprM efflux pump of Pseudomonas

Vol.11 No.1, Winter 2016 IRANIAN JOURNAL OF PATHOLOGY