0% found this document useful (0 votes)
7 views22 pages

Catena ZZ It Tito 2016

Download as pdf or txt
Download as pdf or txt
Download as pdf or txt
You are on page 1/ 22

A new species of Psychrophrynella

(Amphibia, Anura, Craugastoridae) from


the humid montane forests of Cusco,
eastern slopes of the Peruvian Andes
Alessandro Catenazzi1 ,2 and Alex Ttito3
1
Department of Zoology, Southern Illinois University Carbondale, Carbondale IL, United States
2
Centro de Ornitología y Biodiversidad, Lima, Peru
3
Museo de Historia Natural, Universidad Nacional de San Antonio Abad, Cusco, Peru

ABSTRACT
We describe a new species of Psychrophrynella from the humid montane forest of the
Department Cusco in Peru. Specimens were collected at 2,670–3,165 m elevation in
the Área de Conservación Privada Ukumari Llakta, Japumayo valley, near Comunidad
Campesina de Japu, in the province of Paucartambo. The new species is readily
distinguished from all other species of Psychrophrynella but P. bagrecito and P. usurpator
by possessing a tubercle on the inner edge of the tarsus, and from these two species by
its yellow ventral coloration on abdomen and limbs. Furthermore, the new species is
like P. bagrecito and P. usurpator in having an advertisement call composed of multiple
notes, whereas other species of Psychrophrynella whose calls are known have a pulsed call
(P. teqta) or a short, tonal call composed of a single note. The new species has a snout-
vent length of 16.1–24.1 mm in males and 23.3–27.7 mm in females. Like other recently
described species in the genus, this new Psychrophrynella inhabits high-elevation forests
in the tropical Andes and likely has a restricted geographic distribution.

Subjects Biodiversity, Conservation Biology, Evolutionary Studies, Taxonomy, Zoology


Keywords Cloud forest, Psychrophrynella chirihampatu, Chytrid fungus, Bioacoustics, Frog,
Submitted 17 January 2016
Accepted 23 February 2016 Leaf litter amphibian, Paucartambo
Published 14 March 2016
Corresponding author INTRODUCTION
Alessandro Catenazzi,
acatenazzi@gmail.com The frog genus Psychrophrynella currently includes 21 species distributed across the
Academic editor humid grasslands and forests from 1830 to 4190 m.a.s.l. in the Amazonian slopes of
Jane Hughes the Andes in southern Peru and Bolivia (De la Riva & Burrowes, 2014; Duellman &
Additional Information and Lehr, 2009, Frost, 2015). The genus was placed within the Holoadeninae in the family
Declarations can be found on
page 18
Strabomantidae by Hedges, Duellman & Heinicke (2008), but Pyron & Wiens (2011)
synonymized Strabomantidae with Craugastoridae. Only three species are currently
DOI 10.7717/peerj.1807
known from Peru, but most of the eastern valleys of the Andes in the southern Peruvian
Copyright regions of Cusco and Puno have been poorly explored and are likely to contain many
2016 Catenazzi and Ttito
undescribed species (Catenazzi & Von May, 2014).
Distributed under The phylogenetic relationships among the Holoadeninae genera Noblella and Psy-
Creative Commons CC-BY 4.0
chrophrynella are not fully resolved. The type species of Psychrophrynella, P. bagrecito
OPEN ACCESS (Lynch, 1986) is found in the upper watershed of the Araza river in the Peruvian region

How to cite this article Catenazzi and Ttito (2016), A new species of Psychrophrynella (Amphibia, Anura, Craugastoridae) from the hu-
mid montane forests of Cusco, eastern slopes of the Peruvian Andes. PeerJ 4:e1807; DOI 10.7717/peerj.1807
of Cusco (Lynch, 1986). Despite having been chosen as the type species for the genus by
Hedges, Duellman & Heinicke (2008), P. bagrecito possess several morphological traits that
are shared with some species of Noblella, rather than with species of Psychrophrynella (De
la Riva, Chaparro & Padial, 2008a; Lehr, 2006). Furthermore, the type species of Noblella,
N. peruviana (Noble, 1921) is only known from three type specimens collected from 1899
to 1900 at a Peruvian locality in Region Puno (Noble, 1921), and some distinctive traits
such as the presence of tubercles might be difficult to discern in long preserved specimens
(De la Riva, Chaparro & Padial, 2008b). Finally, P. bagrecito, P. usurpator, N. lochites,
and possibly N. peruviana, according to the original description (Noble, 1921), share the
unique trait among congeneric species of possessing an elongated tarsal fold.
Surveys in the humid montane forests of the Japumayo Valley in the Region of Cusco,
Peru, recently revealed the existence of a species of Psychrophrynella with an elongated
tarsal fold, yellow ventral coloration and a long advertisement call composed of multiple
notes, unlike known congeneric species. Here we describe this new species, and we report
on surveys of infection with the pathogenic fungus Batrachochytrium dendrobatidis in
populations of the new species and of sympatric amphibians. This fungus has caused the
collapse of amphibian biodiversity in humid montane forests of the Tropical Andes (Cate-
nazzi et al., 2011; Catenazzi, Lehr & Vredenburg, 2014), and could threaten amphibians at
the type locality of the new species.

METHODS
The format of the diagnosis and description follows Duellman & Lehr (2009) and Lynch
& Duellman (1997), except that the term dentigerous processes of vomers is used instead
of vomerine odontophores (Duellman, Lehr & Venegas, 2006). Taxonomy follows Hedges,
Duellman & Heinicke (2008) except for family placement (Pyron & Wiens, 2011). Meristic
traits of similar species were derived from specimens examined, published photographs,
or species descriptions (Table 1).
Specimens were preserved in 70% ethanol. Sex and maturity of specimens were
determined by observing sexual characters and gonads through dissections. We measured
the following variables (Table 2) to the nearest 0.1 mm with digital calipers under a
stereomicroscope: snout–vent length (SVL), tibia length (TL), foot length (FL, distance
from proximal margin of inner metatarsal tubercle to tip of Toe IV), head length (HL,
from angle of jaw to tip of snout), head width (HW, at level of angle of jaw), eye diameter
(ED), tympanum diameter (TY), interorbital distance (IOD), upper eyelid width (EW),
internarial distance (IND), and eye–nostril distance (E–N, straight line distance between
anterior corner of orbit and posterior margin of external nares). Fingers and toes are
numbered preaxially to postaxially from I–IV and I–V respectively. We determined
comparative lengths of toes III and V by adpressing both toes against Toe IV; lengths of
fingers I and II were determined by adpressing these fingers against each other.
We performed Principal Component Analysis on morphological measurements for
the new species and for the morphologically similar Psychrophrynella usurpator (Table 3).
We retained five variables to maximize sample size of n = 17 for the new species and

Catenazzi and Ttito (2016), PeerJ, DOI 10.7717/peerj.1807 2/22


Table 1 Selected characters and character conditions in species of Psychrophrynella. Selected characters (+ = character present; − = character
absent) and character conditions among Bolivian (first column) and Peruvian (all other columns) species of Psychrophrynella.

Characters Bolivian spp. P. bagrecitoa P. boettgerib P. chirihampatu P. usurpator c


Maximum SVL (mm) 19.0–30.9 19.0 18.4 27.7 30.5
Tympanic membrane Not differentiated Not differentiated Distinct Not differentiated Not differentiated
Vomerine teeth – – – – –
Dorsolateral folds Variable Weak, anterior only + Weak, anterior only Weak, anterior only
Vocal sac Variable + ? + +
Vocal slits Variable + – + +
Nuptial pads – – – – –
Finger I vs. II Variable Shorter Shorter Shorter Slightly shorter or equal
Inner tarsal tubercle – Sickle-shaped – Elongated Elongated
Ventral coloration Variable White, brown marks Brown and cream Yellow, brown flecks Brown or tan, cream flecks
Call Single noted Multiple notese ? Multiple notes Multiple notese
Notes.
a
Sample size for SVL is 17 individuals measured from 1999 to 2009 (unpublished data).
b
Source: Lehr (2006).
c
Sample size for SVL is 811 individuals measured from 1996 to 2015 (unpublished data).
d
Except for P. saltator and P. taqta.
e
Unpublished data.

Table 2 Measurements of type series of Psychrophrynella chirihampatu. Range and average (± stan-
dard deviation) measurements (in mm) of type series of Psychrophrynella chirihampatu sp. n.

Characters Females (n = 10) Males (n = 17)


SVL 23.9–25.8 (25.0 ± 0.6) 16.1–21.7 (19.3 ± 1.6)
TL 10.2–11.0 (10.8 ± 0.2) 8.0–10.1 (9.0 ± 0.6)
FL 10.3–11.5 (11.0 ± 0.4) 7.1–10.4 (9.3 ± 0.8)
HL 8.0–9.0 (8.5 ± 0.3) 6.3–8.1 (7.3 ± 0.5)
HW 7.4–7.8 (7.6 ± 0.4) 5.6–7.9 (6.8 ± 0.6)
ED 2.5–2.8 (2.7 ± 0.1) 2.0–2.5 (2.2 ± 0.2)
IOD 2.5–2.8 (2.7 ± 0.1) 1.8–2.4 (2.1 ± 0.2)
EW 1.6–2.0 (1.8 ± 0.1) 1.2–1.8 (1.4 ± 0.2)
IND 2.3–2.7 (2.5 ± 0.1) 1.8–2.2 (2.0 ± 0.1)
E–N 2.0–2.3 (2.1 ± 0.1) 1.5–2.0 (1.7 ± 0.1)
TL/SVL 0.42–0.44 0.43–0.52
FL/SVL 0.42–0.46 0.39–0.54
HL/SVL 0.35–0.38 0.34–0.40
HW/SVL 0.32–0.36 0.33–0.38
HW/HL 0.91–0.98 0.88–1.07
E–N/ED 0.71–0.85 0.68–0.90
EW/IOD 0.64–0.71 0.58–0.75

of n = 42 for P. usurpator. Morphometric data (non-transformed, after checking for


normality) were analyzed with the princomp function using eigen on the correlation
matrix in the ‘stats’ package in R 3.1.3 (The R Foundation for Statistical Computing; http:
//www.R-project.org). Principal Components 1 and 2 (representing 87% of variation)

Catenazzi and Ttito (2016), PeerJ, DOI 10.7717/peerj.1807 3/22


Table 3 Results from the Principal Component Analysis of 5 meristic characters (SVL, head length,
head width, tibia length, foot length) of male adults of two populations of Psychrophrynella. The high-
est loading for each component is in boldface.

Component PC1 PC2 PC3 PC4 PC5


Loadings
Snout–vent length 0.49 −0.22 −0.01 0.00 −0.84
Tibia length 0.46 0.38 −0.05 −0.79 0.17
Foot length 0.44 0.45 −0.54 0.53 0.15
Head length 0.45 0.09 0.80 0.31 0.23
Head width 0.39 −0.77 −0.25 −0.03 0.43
Importance of components
Standard deviation 1.93 0.81 0.57 0.45 0.32
Proportion of variance 0.74 0.13 0.07 0.04 0.02
Cumulative proportion 0.74 0.87 0.94 0.98 1.00

were used to produce a scatter plot. Proportion data were arcsine square root transformed
for univariate comparisons. Variation in coloration was described on the basis of field
notes and photographs of live frogs. Photographs taken by A. Catenazzi of live specimens,
including types and non-collected specimens, and of preserved types have been deposited
at the Calphoto online database (http://calphotos.berkeley.edu).
We recorded advertisement calls of male CORBIDI 16495 at the type locality on 21
June 2015 and recorded air temperature with a quick reading thermometer (recording
#9843 deposited at the Fonoteca Zoológica, Museo Nacional de Ciencias Naturales,
Madrid, www.fonozoo.org). We used a digital recorder (Zoom H2, recording at 48 kHz,
24-bit, WAV format) for field recording, and Raven Pro version 1.4 (Cornell Laboratory
of Ornithology, Ithaca, NY) to analyze call variables. We analyzed a total of 26 calls.
The following variables were measured from oscillograms: note and duration and rate,
interval between notes or calls, number of pulses, and presence of amplitude modulation.
Variables measured from spectrograms included dominant frequency, and presence of
frequency modulation or harmonics. Spectral parameters were calculated through fast
Fourier transform (FFT) set at a length of 512 points (Hann window, 50% overlap).
Averages are reported ± SD.
We estimated genetic distances to confirm generic placement of the new species
within Psychrophrynella through analysis of the non-coding 16S rRNA mitochondrial
fragment. We used tissues from the holotype, CORBIDI 16495, and from paratopotype
MHNC 14664, to obtain DNA sequences for the new species (deposited in GenBank;
Appendix 1). We downloaded sequences of congeneric species and of Holoadeninae
species in related genera (Barycholos, Bryophryne, Holoaden and Noblella) from GenBank
(Appendix 1). Extraction, amplification, and sequencing of DNA followed standard
protocols (Hedges, Duellman & Heinicke, 2008). We used the 16Sar (forward) primer
(50 –30 sequence: CGCCTGTTTATCAAAAACAT) and the 16Sbr (reverse) primer (50 –
30 sequence: CCGGTCTGAACTCAGATCACGT) (Palumbi et al., 2002). We employed
the following thermocycling conditions during the polymerase chain reaction (PCR)

Catenazzi and Ttito (2016), PeerJ, DOI 10.7717/peerj.1807 4/22


with a Veriti thermal cycler (Applied Biosystems, Foster City, CA, USA): 1 cycle of
96 ◦ C/3 min; 35 cycles of 95 ◦ C/30 s, 55 ◦ C/45 s, 72 ◦ C/1.5 min; 1 cycle 72 ◦ C/7 min.
PCR products were purified with Exosap-IT (Affymetrix, Santa Clara, CA, USA) and
shipped to MCLAB (San Francisco, CA) for sequencing. We used Geneious R8, version
8.1.6 (Biomatters, http://www.geneious.com/) to align the sequences with the MAFFT,
version 7.017 alignment program (Katoh & Standley, 2013). We estimated uncorrected p-
distances (i.e., the proportion of nucleotide sites at which any two sequences are different)
with the R package ‘‘ape’’ (Paradis, Claude & Strimmer, 2004).
We swabbed specimens in the field to quantify infection by Batrachochytrium den-
drobatidis (Bd). Each animal was swabbed with a synthetic dry swab (Medical Wire
& Equipment, #113) using a standardized swabbing protocol. In post-metamorphic
stages, swabs were stroked across the skin a total of 30 times: 5 strokes on each side of
the abdominal midline, 5 strokes on the inner thighs of each hind leg, and 5 strokes
on the foot webbing of each hind leg (total of 30 strokes/frog). We used a real-time
Polymerase Chain Reaction (PCR) assay on material collected on swabs to quantify the
level of infection (Boyle et al., 2004). DNA was extracted from swabs using PrepMan
Ultra and extracts were analyzed in a Life Technologies StepOne Plus qPCR instrument
following the protocol outlined in Hyatt et al. (2007) and Boyle et al. (2004), except that
extracts were analyzed once (Kriger, Hero & Ashton, 2006). We calculated ZE, the genomic
equivalent for Bd zoospores by comparing the qPCR results to a set of standards, and
considered any sample with ZE >1 to be infected or Bd-positive.
Specimens examined are listed in Appendix 2; codes of collections are: CORBIDI =
Herpetology Collection, Centro de Ornitología y Biodiversidad, Lima, Peru; MHNC
= Museo de Historia Natural del Cusco; KU = Natural History Museum, University
of Kansas, Lawrence, Kansas, USA; MUSM = Museo de Historia Natural Universidad
Nacional Mayor de San Marcos, Lima, Peru; and MHNG = Muséum d’Histoire Naturelle,
Genève, Switzerland.
Research was approved by Institutional Animal Care and Use Committees of Southern
Illinois University Carbondale (protocols #13-027). Permit to carry on this research
has been issued by the Peruvian Ministry of Agriculture (permit #292-2014-MINAGRI-
DGFFS-DGEFFS). The Comunidad Campesina Japu Q’eros authorized work on their
land.
The electronic version of this article in Portable Document Format (PDF) will represent
a published work according to the International Commission on Zoological Nomenclature
(ICZN), and hence the new names contained in the electronic version are effectively
published under that Code from the electronic edition alone. This published work
and the nomenclatural acts it contains have been registered in ZooBank, the online
registration system for the ICZN. The ZooBank LSIDs (Life Science Identifiers) can be
resolved and the associated information viewed through any standard web browser by
appending the LSID to the prefix http://zoobank.org/. The LSID for this publication is:
urn:lsid:zoobank.org:pub:34FC0393-6723-4554-912A-AEA7ED811589. The online version
of this work is archived and available from the following digital repositories: PeerJ, PubMed
Central and CLOCKSS.

Catenazzi and Ttito (2016), PeerJ, DOI 10.7717/peerj.1807 5/22


RESULTS
Psychrophrynella chirihampatu sp. n. urn:lsid:zoobank.org:pub:34FC0393-6723-4554-
912A-AEA7ED811589.
http://zoobank.org/34FC0393-6723-4554-912A-AEA7ED811589.
Holotype (Figures 1–3, Table 2). CORBIDI 16495, an adult male (Figs. 2 and 3) from
00 00
13 260 44.92 S; 71◦ 00 12.35 W (WGS84), 2,730 m.a.s.l., Área de Conservación Privada

(ACP) Ukumari Llaqta, Comunidad Campesina de Japu, Distrito Paucartambo, Provincia


Paucartambo, Región Cusco, Peru, collected by A. Catenazzi and A. Ttito on 21 June 2015.
Paratopotypes (Figure 4, Table 2) Ten total: five adult males, CORBIDI 16496 and 16497
and MHNC 14658, 14664 and 14666 (Figs. 2 and 3), and five adult females, CORBIDI
16498–16499, 16696 and MHNC 14661–14662, collected at the type locality by A. Catenazzi
and A. Ttito on 21 June 2015.
Paratypes (Figure 4). 16 total, all from ACP Ukumari Llakta: nine adult males, CORBIDI
16505–16509 and MHNC 14656 and 14670–14672, and one adult female, CORBIDI
00 00
16504, collected near Tambo, 13◦ 270 0.14 S; 71◦ 020 11.40 W (WGS84), 3160 m.a.s.l., by
A. Catenazzi and A. Ttito on 18 June 2015; two adult males, CORBIDI 16503 and MHNC
14667, and four adult females, CORBIDI 16501–2 and MHNC 14668–69, collected at Playa
00 00
camp site, 13◦ 260 53.52 S; 71◦ 00 38.38 W (WGS84), 2780 m.a.s.l., by A. Catenazzi and A.
Ttito on 18 June 2015.
Generic placement. A new species of Psychrophrynella as defined by (Duellman &
Lehr, 2009; Hedges, Duellman & Heinicke, 2008). Frogs of the genus Psychrophrynella are
morphologically similar and closely related to Barycholos, Bryophryne, Holoaden and
Noblella (Hedges, Duellman & Heinicke, 2008; Heinicke, Duellman & Hedges, 2007; Padial,
Grant & Frost, 2014). The new species is assigned to Psychrophrynella rather than any
of the other genera on the basis of molecular data (Table 4) and overall morphological
resemblance with the type species P. bagrecito (see Table 1), including presence of an
elongated fold-like tubercle on the inner edge of tarsus. Genetic data confirm generic
placement of the new species within Psychrophrynella. We found substantial genetic
distances (uncorrected p-distances from 7.2–19.3%; Table 4) between P. chirihampatu and
congeneric species for which mitochondrial sequence data were available. The most closely
related species is P. usurpator (16S uncorrected p-distance: 7.2%), followed by P. guillei and
P. wettsteini which had much higher distances of 17.8–19.3%. Species from other genera
(with the exception of B. cophites) had genetic distances above 20%.
Diagnosis. A species of Psychrophrynella characterized by (1) skin on dorsum finely
shagreen with some small warts forming linear ridges at mid dorsum; skin on venter
smooth, discoidal fold not visible, thin dorsolateral folds visible on anterior half part
of body; (2) tympanic membrane not differentiated, tympanic annulus barely visible
below skin; (3) snout short, bluntly rounded in dorsal view and in profile; (4) upper
eyelid lacking tubercles, narrower than IOD; cranial crests absent; (5) dentigerous process
of vomers absent; (6) vocal slits present; nuptial pads absent; (7) Finger I shorter than
Finger II; tips of digits bulbous, not expanded laterally; (8) fingers lacking lateral fringes;
(9) ulnar tubercles absent; (10) heel lacking tubercles; inner edge of tarsus bearing an

Catenazzi and Ttito (2016), PeerJ, DOI 10.7717/peerj.1807 6/22


Figure 4 Dorsolateral and ventral views of four paratypes of Psychrophrynella chirihampatu sp. n.
showing variation in dorsal and ventral coloration. Male MHNC 14656 (A, B), Tambo Japu. Male
MHNC 14667 (C, D), type locality. Female CORBIDI 16502 (E, F), Playa camp site. Female CORBIDI
16499 (G, H), type locality. Photographs by A. Catenazzi.

Catenazzi and Ttito (2016), PeerJ, DOI 10.7717/peerj.1807 7/22


Bolivia
Peru

Puerto
Maldonado
#
Cusco k

Elevation ^
<500 m
501-1000 m
1001-2000 m _
2001-3000 m
3001-4000 m
Puno
>4000 m

Arequipa
La Paz

0 30 60 120 km
Tacna

Figure 1 Map of Peru indicating the type localities of Peruvian and western Bolivian species
of Psychrophrynella. P. bagrecito (black square), P. boettgeri (black star), P. chirihampatu sp. n.
(asterisk), P. guillei and P. saltator (white circle), P. kallawaya (white star), P. katantika (circle), and
P. usurpator(triangle).

Catenazzi and Ttito (2016), PeerJ, DOI 10.7717/peerj.1807 8/22


Figure 2 Photographs of live and preserved specimen of the holotype of Psychrophrynella chiriham-
patu. Live (A, C, E) and preserved (B, D, F) specimen of the holotype of Psychrophrynella chirihampatu
sp. n., male CORBIDI 16495 (SVL 18.8 mm) in dorsolateral (A, B), dorsal (C, D) and ventral (E, F) views.
Photographs by A. Catenazzi.

elongate, obliquous fold-like tubercle; (11) inner metatarsal tubercle prominent, elliptical,
of higher relief and about one and a half times the size of ovoid, outer metatarsal tubercle;
supernumerary plantar tubercles absent; (12) toes lacking lateral fringes; webbing absent;
Toe V slightly shorter than or about the same length as Toe III; tips of digits not expanded,
weakly pointed; (13) dorsum tan to brown and gray with dark brown markings; some
individuals with a yellow or orange middorsal line extending from tip of snout to cloaca
and to posterior surface of thighs; interorbital bar present; chest, venter and ventral parts
of arms and legs yellow with brown flecks; throat and palmar and plantar surfaces brown
or reddish-brown; (14) SVL 16.1–24.1 in males (n = 34), 23.3–27.7 in females (n = 12).

Catenazzi and Ttito (2016), PeerJ, DOI 10.7717/peerj.1807 9/22


Figure 3 Palmar and plantar surfaces of the holotype of Psychrophrynella chirihampatu. Ventral views
of hand (A) and foot (B) of holotype, CORBIDI 16495 (hand length 4.6 mm, foot length 8.7 mm) of Psy-
chrophrynella chirihampatu sp. n. Photographs by A. Catenazzi.

Comparisons. The new species differs from most described species in the genus by
possessing an elongate fold-like tubercle on the inner edge of tarsus. Among currently
known species in the genus, only the two Peruvian, and geographically closest species
P. bagrecito and P. usurpator possess such a tubercle, which is similarly shaped (obliquous)
in the latter but sickle-shaped in P. bagrecito. The other Peruvian species, P. boettgeri,
and all species described from Bolivia (including P. guillei, P. katantika, P. kallawaya
and P. saltator known from the Cordillera de Aplobamba near the border with Peru;
Fig. 1) lack a tubercle or fold on the inner edge of tarsus. Furthermore, among species
whose advertisement calls is known, P. chirihampatu shares with P. bagrecito, P. saltator
and P. usurpator the characteristic of having a call composed of multiple notes (Table 1;
unpublished data for calls of P. bagrecito and P. usurpator), whereas the call is pulsed in
P. teqta or composed of short, single notes in other congeneric species (De la Riva, 2007;
De la Riva & Burrowes, 2014).
Morphologically, the new species is most similar to P. usurpator (characters in
parentheses; Table 1), from which it differs by having yellow ventral coloration with
reddish-brown or grey flecks (dull brown, gray or black with cream flecks), Finger I shorter
than Finger II (slightly shorter or same length), smaller SVL reaching 27.5 mm in females
(SVL up to 30.5 mm), slender head (wider and shorter head), and inner metatarsal tubercle
at least three times the size of outer metatarsal tubercle (about same size). The scatterplot

Catenazzi and Ttito (2016), PeerJ, DOI 10.7717/peerj.1807 10/22


Table 4 Genetic distances from 16S data. Genetic distances (uncorrected p-distances) estimated from the non-coding 16S rRNA mitochondrial
fragment between Psychrophrynella chirihampatu and related taxa (in boldface the most closely related species) of the subfamily Holadeninae (Crau-
gastoridae).

P. chirihampatu

P. chirihampatu
MHNC14664
myrmecoides
luederwaldti
bustamantei

P. usurpator

P. wettsteini
Bryophryne

Bryophryne

Bryophryne

Barycholos
bakersfield

(holotype)
P.a guillei
Holoaden

Noblella

Noblella
cophites

lochites
pulcher
Bryophryne bakersfield 0
Bryophryne bustamantei 0.06 0
Bryophryne cophites 0.04 0.17 0
Barycholos pulcher 0.21 0.30 0.29 0
Holoaden luederwaldti 0.19 0.26 0.24 0.30 0
Noblella lochites 0.23 0.29 0.26 0.27 0.25 0
Noblella myrmecoides 0.17 0.30 0.28 0.27 0.29 0.22 0
P. guillei 0.18 0.15 0.26 0.29 0.24 0.29 0.30 0
P. usurpator 0.21 0.26 0.28 0.31 0.25 0.31 0.29 0.23 0
P. wettsteini 0.20 0.23 0.24 0.31 0.23 0.29 0.28 0.14 0.23 0
P. chirihampatu MHNC14664 0.20 0.22 0.19 0.25 0.20 0.21 0.18 0.18 0.07 0.19 0
P. chirihampatu (holotype) 0.20 0.22 0.19 0.25 0.20 0.22 0.18 0.18 0.07 0.19 0.00 0

of the first two Principal Components axes reveal that these two species occupy distinct
regions of morphospace (Fig. 5A). Snout-vent length and tibia length load strongly on the
first Principal Component axis PC1, whereas head width and foot length load strongly on
the second Principal Component, PC2 (Table 3). Univariate comparisons of measurements
of male P. chirihampatu and P. usurpator reveal that male P. chirihampatu have narrower
heads, averaging 35.4% of SVL (HW 38.0% of SVL in P. usurpator; t57 = −5.12, p < 0.001;
Fig. 5B), and longer tibia length, averaging 46.7% of SVL (TL 45.2% of SVL, t57 = 2.24,
p = 0.01), but no difference in foot length (t57 = 1.44, p = 0.08).
We also compared the new species with the type species of Psychrophrynella, P. bagrecito
(Lynch, 1986). Psychrophrynella chirihampatu differs from P. bagrecito (characters in
parentheses; Table 1) in having an elongated and oblique fold-like tarsal tubercle (short
and sickle-shaped), broad dark markings on dorsum (longitudinal stripes), venter yellow
with dark flecks (venter orange brown with light gray flecks) and larger size of females up
to 27.5 mm in SVL (SVL of females up to 19.0 mm).
Ten other small species of craugastorid frogs of the subfamily Holoadeninae are known
to occur in montane forests and high Andean grasslands south of the Apurimac canyon in
Peru: Bryophryne abramalagae, B. bustamantei, B. cophites, B. flammiventris, B. gymnotis,
B. hanssaueri, B. nubilosus, B. zonalis, Noblella madreselva and N. pygmaea. None of these
species has the unique ventral coloration of P. chirihampatu, and all but B. gymnotis and the
two species of Noblella (which are much smaller in size) lack a visible tympanic annulus.
Description of holotype. Adult male (18.8 mm SVL); head narrower than body, its
length 39.9% of SVL; head slightly longer than wide, head length 110.3% of head width;
head width 36.2% of SVL; snout short, bluntly rounded in dorsal and lateral views (Fig. 2),

Catenazzi and Ttito (2016), PeerJ, DOI 10.7717/peerj.1807 11/22


Figure 5 Morphometric comparisons between Psychrophrynella chirihampatu and P. usurpator. (A)
Principal components analysis of 5 meristic characters, and (B) relationship between head width and
snout-vent length of 17 adult males of Psychrophrynella chirihampatu from the type locality and of 44
males P. usurpator from Abra Acjanaco, Manu National Park, Peru.

eye diameter 26.7% of head length, its diameter 1.1 times as large as its distance from the
nostril; nostrils not protuberant, close to snout, directed laterally; canthus rostralis slightly
concave in dorsal view, convex in profile; loreal region flat; lips rounded; upper eyelids
without tubercles; upper eyelid width 59.1% of interorbital distance; interorbital region flat,
lacking cranial crests; eye-nostril distance 90% of eye diameter; supratympanic fold weak;
tympanic membrane not differentiated, tympanic annulus visible below skin; two small
postrictal ridges on each side of head. Vocal sac and vocal slits present. Choanae round,
small, positioned far anterior and laterally, widely separated from each other; dentigerous
processes of vomers and vomerine teeth absent; tongue large, ovoid, not notched.
Skin on dorsum smooth with minute, scattered tubercles, denser posteriorly; barely
visible dorsolateral folds anteriorly; skin on flanks and venter smooth; no pectoral fold,
barely visible discoidal fold; cloaca not protuberant, cloacal region without tubercles.
Ulnar tubercles and folds absent; palmar tubercle flat and oval, approximately same length
but twice the width of elongate, thenar tubercle; supernumerary palmar tubercles absent;
subarticular tubercles prominent, ovoid in ventral view, rounded in lateral view, largest at
base of fingers; fingers lacking lateral fringes; relative lengths of fingers 3 >4 >2 >1 (Fig. 3);
tips of digits bulbous, not expanded laterally (Fig. 3); forearm lacking tubercles.
Hindlimbs moderately long, tibia length 46.8% of SVL; foot length 46.3% of SVL; upper
and posterior surfaces of hindlimbs smooth with scattered, minute tubercles; heel without
tubercles; inner edge of tarsus bearing an elongated, oblique fold-like tubercle, outer edge
of tarsus lacking tubercles; inner metatarsal tubercle, oval, high, and at least three times
the size of conical, rounded outer metatarsal tubercle; few, minute plantar supernumerary
tubercles weakly defined; subarticular tubercles rounded, ovoid in ventral view; toes lacking
lateral fringes, not webbed; toe tips weakly pointed, not expanded laterally; relative lengths
of toes 4 >3 >5 >2 >1 (Fig. 3); foot length 46.3% of SVL.
Measurements of holotype (in mm): SVL 18.8, TL 8.8, FL 8.7, HL 7.5, HW 6.8, ED 2.0,
IOD 2.2, EW 1.3, IND 1.8, E–N 1.8.

Catenazzi and Ttito (2016), PeerJ, DOI 10.7717/peerj.1807 12/22


Coloration of holotype in alcohol. Dorsal surfaces of head, body, and limbs grayish
tan, with a dark brown X-shaped middorsal mark. The interorbital bar is a narrow dark
stripe and is bordered anteriorly by a cream stripe. There is a dark brown subocular mark
bordered by a thin cream line. A dark brown stripe, outlined below by a thin cream line
extends from the tip of the snout to above the insertion of forelimb; from that point, a
discontinuous dark line runs dorsolaterally separating dorsum from flank to the point
of hind limb insertion. The iris is dark gray. The throat has brown coloration anteriorly,
fading into pale grey with brown flecks posteriorly. This pale grey coloration extends from
chest to belly, but turns to yellow posteriorly and on the ventral parts of hind and forelimbs.
The posterior surfaces of thighs are dark brown with a narrow, pale gray stripe running
diagonally from cloaca to inside of knee; the plantar and palmar surfaces are brown, but
fingers and toes are cream. The dorsal surfaces of hind limbs have transverse dark bars.
Coloration of holotype in life. Similar to coloration in preservative, with the difference
that the dorsal coloration is beige with red flecks, the cream stripes and lines on the
head are bronze, the throat is reddish-brown with yellow flecks, the chest is yellow with
reddish-brown flecks, the belly and ventral surfaces of hind and forelimbs are yellow, and
the fingers and toes are reddish-brown at the base and yellow at the tip.
Variation. Coloration in life is based on field notes and photographs taken by A.
Catenazzi of 23 collected and 21 uncollected specimens found at and near the type locality
(Fig. 4, see Appendix S1 for codes and photographsof uncollected specimens). There is
substantial variation in dorsal coloration, which varies from beige to grayish-tan and dark
brown, and while most individuals have the X-shaped dorsal mark (barely noticeable in
individuals with dark coloration), several individuals have additional dark marks. The dark
stripe extending dorsolaterally between the points of insertion of limbs is discontinuous in
most individuals (including the holotype) and absent in at least three specimens (CORBIDI
16496, 16504, and MHNC 14658), but at least ten specimens (CORBIDI 16497, 16499,
16506, MHNC 14668, 14671–72, and uncollected 639.15, 640.15, 1019.15, 10676.15) have
a continuous stripe separating the lighter dorsal coloration from the darker coloration on
the flanks. Sixteen individuals (36%; including paratypes CORBIDI 16496–98, 16503–06,
16993–94, MHNC 14667, 14670, 14672; and uncollected individuals 640.15, 1005.15,
1006.15, 1065.15) have a yellow or orange middorsal line extending in most individuals
from the interorbital bar (but from tip of snout in CORBIDI 16496, 16993–94, and
uncollected 1065.15) to the cloaca, and from the cloaca along the posterior side of thighs
to the knee. The throat is generally reddish-brown with yellow or orange flecks; CORBIDI
16992, 16496 and uncollected 1065.15 have a yellow or orange line running midventrally
from the tip of snout to the cloaca. Chest and ventral surfaces of abdomen and limbs are
yellow or orange with variable amounts of reddish-brown, brown or grey flecks, especially
on the chest. In some individuals (e.g., CORBIDI16504–06, 16994, and uncollected 1018.15)
background coloration on chest and belly is brown or gray with yellow flecks.
The summary of measurements of all types is reported in Table 2. A histogram of the
frequency distribution of SVL for all captured specimens (types and uncollected specimens)
suggests modes of 20.0–21.9 mm for males and 24.0–25.9 mm for females (Fig. 6).

Catenazzi and Ttito (2016), PeerJ, DOI 10.7717/peerj.1807 13/22


Figure 6 Frequency distribution of snout-vent lengths of Psychrophrynella chirihampatu. Sample size
is 23 types and 21 uncollected individuals of Psychrophrynella chirihampatu sp. n.

Figure 7 Advertisement call of Psychrophrynella chirihampatu. Advertisement call of male CORBIDI


16495 (SVL 18.8 mm), holotype of Psychrophrynella chirihampatu sp. n., recorded at the type locality on
21 June 2015 (Tair = 11.6 ◦ C).

Advertisement call. The call of the holotype was recorded shortly before capture at
13h45 on 21 June 2015 (Fig. 7). At a Tair = 11.6 ◦ C, the advertisement call averaged 3,212
± 1,005 ms in duration (range 1,140–4.524 ms) and consisted of 47.9 ±16.1 single-pulsed
notes (range 10–68) produced at a rate of 14.7 ±1.8 notes/s (range 8.77–16.55). Peak
frequency averaged 2,712 ± 33 Hz (range 2,584–2,885 Hz) and increased during calls
(t1,78 = −6.53, p < 0.01): peak frequency averaged 2,702 ± 38 Hz for the first three notes,
and 2,748 ± 50 Hz for the last three notes of each call. Amplitude also increased during

Catenazzi and Ttito (2016), PeerJ, DOI 10.7717/peerj.1807 14/22


Figure 8 Habitat and egg nest of Psychrophrynella chirihampatu. Collection localities of
Psychrophrynella chirihampatu sp. n. in the upper Japumayo valley (A; view from lookout at 3,000 m):
frogs were found under mosses and rocks along the trail at 3,160 m (B), and under rocks in a natural
landslide at the type locality at 2,700 m (C), including an unattended nest under a rock (D; 10¢ coin is
20.5 mm in diameter). Photographs by A. Catenazzi.

each call, and the three final notes had amplitude ∼400% higher than the amplitude of
the three initial notes. Average note duration was 5.4 ± 1.2 ms (range 1–12 ms), but note
duration increased from 2.6 ± 0.7 ms in the first three notes to 7.8 ± 1.3 ms in the last
three notes of each call. Furthermore, call structure varied during a sequence of 26 calls
produced at a rate of 9.43 calls/minute: the number of notes increased from 57 notes in the
first two calls to 68 notes in the 5th call, and then progressively declined to 10 notes in the
26th call.
Etymology. The name of the new species is a combination of Quechua words used in
apposition meaning ‘‘toad’’ (‘‘hampa’tu’’) that lives in the ‘‘cold’’ (‘‘chiri’’). The name is
a wordplay built upon the genus and species names sharing the same meaning of ‘‘frog
inhabiting cold environments,’’ because the generic name Psychrophrynella derives from
the Greek psychros (cold) and phrynos (toad).
Distribution, natural history and threats. The new species was found during amphibian
surveys in the Japumato valley (Fig. 8A) conducted from 17 to 24 June 2015. We searched
for frogs under rocks, logs, in the leaf litter and the understory along the transition
from montane forest to high-Andean grassland (wet puna) from 2,650 to 4,600 m.
Specimens of P. chirihampatu were only found at elevations from 2,650 to 3,180 m. Most
specimens were found under rocks (many males were calling) during the day in areas of
disturbed montane forest vegetation, such as the sides of the trail near the Tambo camp site

Catenazzi and Ttito (2016), PeerJ, DOI 10.7717/peerj.1807 15/22


(Fig. 8B), and natural landslides at the type locality (Fig. 8C) and at the Playa campsite. Field
notes indicate that males were heard calling in similarly disturbed areas of the montane
forest and along the edges of forest bordering landslides and other open areas.
We found an unattended nest of 11 eggs (Fig. 8D), diameter 4.5 mm on average, under
a rock at the type locality. Ten female paratypes had 9.6 ± 1.5 eggs (range 7–12 eggs) at
different stages of maturation; of these, one had 10 mature eggs averaging 3.9 ± 0.4 mm in
diameter (range 3.5–4.6 mm).
None of the 45 specimens of P. chirihampatu tested for Bd were infected. Similarly, two
sympatric species, Bryophryne zonalis (n = 6) and Gastrotheca cf. excubitor (n = 10) were
Bd-negative, as were Bryophryne sp. (n = 4) from 3,820–3,050 m and an individual of
Pleurodema marmoratum from 4,600 m.
The upper Japumayo valley is part of the Área de Conservación Privada Ukumari
Llaqta, a protected area recognized by Peruvian environmental ministerial decree (No
301-2011-MINAM) in December 2011, and owned by the Comunidad Campesina Japu
Q’eros. Therefore, the known distribution range of the species is protected. Although the
valley is used for agricultural purposes, current land use appears to be sustainable and is
unlikely to negatively affect populations of P. chirihampatu. Given this species’ affinity for
disturbed areas, it is even possible that the current anthropogenic use of the montane forest
might enhance the distribution of P. chirihampatu.
The current conservation status of P. chirihampatu is unknown. The populations we
surveyed in the Japumayo valley were relatively large: for example at the type locality we
found 25 frogs in 7 person-hours. We did not observe any direct threat to these populations
during our visit. In absence of more detailed data regarding its extent of occurrence, and
according to the IUCN Red List criteria and categories (IUCN, 2013), this species can
provisionally be considered for the ‘‘Data Deficient’’ category of the Red List.

DISCUSSION
The new species is yet another addition to the ever growing list of small craugastorid
frogs (genera Bryophryne, Noblella and Psychrophrynella) from the eastern slopes of the
Peruvian and Bolivian Andes (Catenazzi, Uscapi & Von May, 2015; De la Riva, 2007; De
la Riva & Burrowes, 2014; De la Riva, Chaparro & Padial, 2008a; Harvey et al., 2013; Lehr
& Catenazzi, 2008; Lehr & Catenazzi, 2009a; Lehr & Catenazzi, 2009b; Lehr & Catenazzi,
2010). Most if not all of these species have narrow distribution ranges often restricted to
the type locality and surrounding mountaintop region, although large areas in between
the type localities of these species remain unexplored. It is remarkable however that
mountain passes separated by less than 50 km in airline distance do not share any species
of Bryophryne, Noblella or Psychrophrynella. Such high levels of observed beta diversity,
and the presence of unexplored regions suggest that more species remain to be discovered.
We assign the new species to Psychrophrynella on the basis of shared meristic traits,
general body shape and appearance, and overall similarity with the type species P. bagrecito
and with P. usurpator. Interestingly, these two species shares with P. chirihampatu characters
that are absent in other congeneric forms, such as the presence of an elongated tubercle

Catenazzi and Ttito (2016), PeerJ, DOI 10.7717/peerj.1807 16/22


on the inner edge of the tarsus, and an advertisement call composed of multiple notes.
Further work is needed to document variation in meristic traits and acoustic properties of
advertisement calls in species of Psychrophrynella, as well as molecular analyses aimed at
determining the phylogenetic relationships of these species.
Although we did not detect the presence of Bd in the Japumayo valley, this fungus has
been reported from the nearby region of Abra Huallahualla and Coline (approximately
15–20 km SW by airline from the type locality of P. chirihampatu), where infected
species included terrestrial-breeding B. zonalis, and aquatic-breeding P. marmoratum
and Telmatobius marmoratus (Catenazzi et al., 2011). Furthermore, members of the Japu
Q’eros Community who guided us to the type locality confirmed that T. marmoratus, a
species known to be susceptible to chytridiomycosis (Catenazzi & Von May, 2014; Warne
et al., 2016), was previously abundant in the upper reach of the Japumayo valley, but had
disappeared sometime during the last decade. Therefore, it is likely that Bd has already
reached, and possibly caused declines of other amphibian populations in the Japumayo
valley. In the montane forests of Manu NP (70 km NW of Japumayo), Bd has caused the
local extinction of many stream-breeding species, but not of terrestrial-breeding frogs such
as Psychrophrynella species (Catenazzi et al., 2011). These findings suggest that Bd might
not be as much of a threat for P. chirihampatu as it is for aquatic-breeding frogs.
Species with narrow geographic distributions are intrinsically threatened, and they
are less likely to be included in nationally protected areas, as previously shown for
Peru (Catenazzi & Von May, 2014; Von May et al., 2008). Smaller areas, but more widely
dispersed in the landscaspe, are needed to protect amphibian biodiversity in regions of
high beta diversity such as tropical Andean mountaintops. The introduction of new legal
forms of protected areas in Peru, such as conservation concessions, private and communal
reserves, could greatly benefit amphibian conservation. Discovery of endemic species
provides justification for these reserves; for example, the description of P. chirihampatu for
the Área de Conservación Privada Ukumari Llakta means that this reserve now protects
at least one species of amphibian not found anywhere else. Exploration of other private
protected areas and conservation concessions will generate similarly beneficial outcomes
and will advance our knowledge of amphibian biodiversity.

ACKNOWLEDGEMENTS
We thank the Comunidad Campesina Japu Q’eros for their hospitability, granting us access
to and guiding us through the Japumayo valley; and the Asociación para la Conservación de
la Cuenca Amazónica for logistical support, and especially Marlene Mamani for introducing
us to the community and for coordinating our visit to Japu. We thank I. De la Riva and
M.P. Heinicke for comments on the manuscript.

Catenazzi and Ttito (2016), PeerJ, DOI 10.7717/peerj.1807 17/22


APPENDIX 1
Gene sequences for molecular analyses
Genbank accession numbers for the taxa and genes sampled in this study.

Taxon Voucher Nbr. 16S


Barycholos pulcher KU 217781 EU186709
Bryophryne bakersfield MHNC 5999 KT276289
Bryophryne bustamantei MHNC 6019 KT276293
Bryophryne cophites KU 173497 F493537
Holoaden luederwaldti MZUSP 131872 EU186710
Noblella lochites KU 177356 EU186699
Noblella myrmecoides QCAZ 40180 JX267542
Pyschrophrynella guillei AMNH-A 165108 AY843720
Pyschrophrynella usurpator KU 173495 F493714
Pyschrophrynella wettsteini KU 183049 EU186696
Psychrophrynella chirihampatu MHNC 14664 KU884560
Psychrophrynella chirihampatu CORBIDI 16495 KU884559

APPENDIX 2
Specimens examined
Noblella madreselva (2 specimens): PERU: Cusco: Provincia La Convención, Madre Selva
(Santa Ana), CORBIDI 15769–70.
Noblella pygmaea (15 specimens): PERU: Cusco: Provincia Paucartambo, Kosñipata,
MHNG 2725.29–30, MUSM 24535–36, 26306–7, 26318–20, 30423–24, 30453–54, MTD
47286–87.
Psychrophrynella bagrecito (14 specimens): PERU: Cusco: Quispicanchis: Marcapata, Río
Marcapata, below Marcapata, ca. 2740 m, KU 196512 (holotype), KU 196513–18, 196520–
21, 196523–25 (all paratypes); La Convención: Hacienda Huyro between Huayopata and
Quillabamba, 1830 m, KU 196527–28.
Psychrophrynella usurpator (78 specimens): PERU: Cusco: Provincia Paucartambo,
Kosñipata, MUSM 20011, 20873–81, 20896–20913, 20925–33, 20946–47, 20955–57,
21012–18, 26272–73, 26278–79, 26308, 27592, 27906, 27950, 28033–28047, 30303, 30305,
30396–30400, 30405–30409, 30471–30474.

ADDITIONAL INFORMATION AND DECLARATIONS

Funding
This research was supported by grants from the Mohamed bin Zayed Species Conservation
Fund, the Disney Worldwide Conservation Fund, the Rufford Small Grants Foundation
and Southern Illinois University startup funds to AC. The funders had no role in study
design, data collection and analysis, decision to publish, or preparation of the manuscript.

Catenazzi and Ttito (2016), PeerJ, DOI 10.7717/peerj.1807 18/22


Grant Disclosures
The following grant information was disclosed by the authors:
Mohamed bin Zayed Species Conservation Fund.
Disney Worldwide Conservation Fund.
Rufford Small Grants Foundation.
Southern Illinois University.

Competing Interests
The authors declare there are no competing interests.

Author Contributions
• Alessandro Catenazzi conceived and designed the experiments, performed the
experiments, analyzed the data, contributed reagents/materials/analysis tools, wrote
the paper, prepared figures and/or tables, reviewed drafts of the paper.
• Alex Ttito conceived and designed the experiments, performed the experiments,
contributed reagents/materials/analysis tools, reviewed drafts of the paper.

Animal Ethics
The following information was supplied relating to ethical approvals (i.e., approving body
and any reference numbers):
Institutional Animal Care and Use
Committees of Southern Illinois University Carbondale #13-027.

Field Study Permissions


The following information was supplied relating to field study approvals (i.e., approving
body and any reference numbers):
Peruvian Ministry of Agriculture #292-2014-MINAGRI-DGFFS-DGEFFS.

Data Availability
The following information was supplied regarding data availability:
Photographs: Calphotos (http://calphotos.berkeley.edu)—photos can be accessed
by searching the database with the species name, or by downloading Appendix S1
(Supplemental Information, see below).
Recording: FonoZoo (www.fonozoo.org)—recording can be accessed by searching the
database with the species name.

New Species Registration


The following information was supplied regarding the registration of a newly described
species:
Species LSID: http://zoobank.org/NomenclaturalActs/286E2FCE-4D10-4609-B295-
DD4FD1EBE691
Publication LSID: urn:lsid:zoobank.org:pub:34FC0393-6723-4554-912A-AEA7ED811589.

Supplemental Information
Supplemental information for this article can be found online at http://dx.doi.org/10.7717/
peerj.1807#supplemental-information.

Catenazzi and Ttito (2016), PeerJ, DOI 10.7717/peerj.1807 19/22


REFERENCES
Boyle DG, Boyle DB, Olsen V, Morgan JAT, Hyatt AD. 2004. Rapid quantitative detec-
tion of chytridiomycosis (Batrachochytrium dendrobatidis) in amphibian samples
using real-time Taqman PCR assay. Diseases of Aquatic Organisms 60:141–148
DOI 10.3354/dao060141.
Catenazzi A, Lehr E, Rodriguez LO, Vredenburg VT. 2011. Batrachochytrium dendroba-
tidis and the collapse of anuran species richness and abundance in the upper Manu
National Park, southeastern Peru. Conservation Biology 25:382–391.
Catenazzi A, Lehr E, Vredenburg VT. 2014. Thermal physiology, disease and amphibian
declines in the eastern slopes of the Andes. Conservation Biology 28:509–517
DOI 10.1111/cobi.12194.
Catenazzi A, Uscapi V, Von May R. 2015. A new species of Noblella from the humid
montane forests of Cusco, Peru. Zookeys 516:71–84 DOI 10.3897/zookeys.516.9776.
Catenazzi A, Von May R. 2014. Conservation status of amphibians in Peru. Herpetologi-
cal Monographs 28:1–23 DOI 10.1655/HERPMONOGRAPHS-D-13-00003.
De la Riva I. 2007. Bolivian frogs of the genus Phrynopus, with the description of twelve
new species (Anura: Brachycephalidae). Herpetological Monographs 21:241–277
DOI 10.1655/07-011.1.
De la Riva I, Burrowes PA. 2014. A new species of Psychrophrynella (Anura: Craugastori-
dae) from the Cordillera Real, Department La Paz, Bolivia. Zootaxa 3887:459–470
DOI 10.11646/zootaxa.3887.4.4.
De la Riva I, Chaparro JC, Padial JM. 2008a. A new, long-standing misidentified species
of Psychrophrynella Hedges, Duellman & Heinicke from Departamento Cusco, Peru
(Anura : Strabomantidae). Zootaxa 1823:42–50.
De la Riva I, Chaparro JC, Padial JM. 2008b. The taxonomic status of Phyllonastes Heyer
and Phrynopus peruvianus (Noble) (Lissamphibia, Anura): resurrection of Noblella
Barbour. Zootaxa 1685:67–68.
Duellman WE, Lehr E. 2009. Terrestrial-breeding frogs (Strabomantidae) in Peru.
Münster: Natur und Tier Verlag, 382.
Duellman WE, Lehr E, Venegas PJ. 2006. Two new species of Eleutherodactylus (Anura:
Leptodactylidae) from the Andes of northern Peru. Zootaxa 1285:51–64.
Frost DR. 2015. Amphibian species of the World: an online reference. Version 6.0.
Available at http:// research.amnh.org/ herpetology/ amphibia/ index.html (accessed 28
November 2015).
Harvey MB, Almendáriz A, Brito MJ, Batallas RD. 2013. A new species of Noblella
(Anura: Craugastoridae) from the Amazonian slopes of the Ecuadorian Andes with
comments on Noblella lochites (Lynch). Zootaxa 3635:1–14
DOI 10.11646/zootaxa.3635.1.1.
Hedges SB, Duellman WE, Heinicke MP. 2008. New World direct-developing frogs
(Anura: Terrarana): molecular phylogeny, classification, biogeography, and conser-
vation. Zootaxa 1737:1–182.

Catenazzi and Ttito (2016), PeerJ, DOI 10.7717/peerj.1807 20/22


Heinicke MP, Duellman WE, Hedges SB. 2007. Major Caribbean and Central
American frog faunas originated by ancient oceanic dispersal. Proceedings of the
National Academy of Sciences of the United States of America 104:10092–10097
DOI 10.1073/pnas.0611051104.
Hyatt AD, Boyle DG, Olsen V, Boyle DB, Berger L, Obendorf D, Dalton A, Kriger
K, Hero M, Hines H, Phillott R, Campbell R, Marantelli G, Gleason F, Colling
A. 2007. Diagnostic assays and sampling protocols for the detection of Ba-
trachochytrium dendrobatidis. Diseases of Aquatic Organisms 73:175–192
DOI 10.3354/dao073175.
IUCN. 2013. Guidelines for using the IUCN Red List categories and criteria. Version 10.1.
Prepared by the Standards and Petitions Subcommittee. Gland: IUCN.
Katoh K, Standley DM. 2013. MAFFT multiple sequence alignment software version
7: improvements in performance and usability. Molecular Biology and Evolution
30:772–780 DOI 10.1093/molbev/mst010.
Kriger KM, Hero J-M, Ashton KJ. 2006. Cost efficiency in the detection of chytridiomy-
cosis using PCR assay. Diseases of Aquatic Organisms 71:149–154
DOI 10.3354/dao071149.
Lehr E. 2006. Taxonomic status of some species of Peruvian Phrynopus (Anura : Lepto-
dactylidae), with the description of a new species from the Andes of Southern Peru.
Herpetologica 62:331–347 DOI 10.1655/0018-0831(2006)62[331:TSOSSO]2.0.CO;2.
Lehr E, Catenazzi A. 2008. A new species of Bryophryne (Anura: Strabomantidae) from
southern Peru. Zootaxa 1784:1–10.
Lehr E, Catenazzi A. 2009a. A new species of minute Noblella (Anura: Strabomantidae)
from southern Peru: The smallest frog of the Andes. Copeia 2009:148–156
DOI 10.1643/ch-07-270.
Lehr E, Catenazzi A. 2009b. Three new species of Bryophryne (Anura: Strabomantidae)
from the Region of Cusco, Peru. South American Journal of Herpetology 4:125–138
DOI 10.2994/057.004.0204.
Lehr E, Catenazzi A. 2010. Two new species of Bryophryne (Anura: Strabomantidae)
from high elevations in southern Peru (Region of Cusco). Herpetologica 66:308–319
DOI 10.1655/09-038.1.
Lynch JD. 1986. New species of minute leptodactylid frogs from the Andes of Ecuador
and Peru. Journal of Herpetology 20:423–431 DOI 10.2307/1564505.
Lynch JD, Duellman WE. 1997. Frogs of the genus Eleutherodactylus in western Ecuador.
Systematics, ecology, and biogeography. The University of Kansas Special Publication
23:1–236.
Noble GK. 1921. Five new species of Salientia from South America. American Museum
Novitates 29:1–7.
Padial JM, Grant T, Frost DR. 2014. Molecular systematics of terraranas (Anura:
Brachycephaloidea) with an assessment of the effects of alignment and optimality
criteria. Zootaxa 3825:1–132 DOI 10.11646/zootaxa.3825.1.1.

Catenazzi and Ttito (2016), PeerJ, DOI 10.7717/peerj.1807 21/22


Palumbi SR, Martin A, Romano S, McMillan WO, Stice L, Grabawski G. 2002. The
Simple Fool’s Guide to PCR. Version 2.0. Honolulu: University of Hawaii Privately
published, compiled by S. Palumbi.
Paradis E, Claude J, Strimmer K. 2004. APE: analyses of phylogenetics and evolution in
R language. Bioinformatics 20:289–290 DOI 10.1093/bioinformatics/btg412.
Pyron RA, Wiens JJ. 2011. A large-scale phylogeny of Amphibia including over 2,800
species, and a revised classification of extant frogs, salamanders, and caecilians.
Molecular Phylogenetics and Evolution 61:543–583
DOI 10.1016/j.ympev.2011.06.012.
Von May R, Catenazzi A, Angulo A, Brown JL, Carrillo J, Chávez G, Córdova JH,
Curo A, Delgado A, Enciso MA, Gutiérrez R, Lehr E, Martínez JL, Medina-Müller
M, Miranda A, Neira DR, Ochoa JA, Quiroz AJ, Rodríguez DA, Rodríguez LO,
Salas AW, Seimon T, Seimon A, Siu-Ting K, Suárez J, Torres C, Twomey E. 2008.
Current state of conservation knowledge on threatened amphibian species in Peru.
Tropical Conservation Science 1:376–396.
Warne RW, LaBumbard B, LaGrange S, Vredenburg VT, Catenazzi A. 2016. Co-
Infection by chytrid fungus and Ranaviruses in wild and harvested frogs in the
Tropical Andes. PLoS ONE 11:e0145864 DOI 10.1371/journal.pone.0145864.

Catenazzi and Ttito (2016), PeerJ, DOI 10.7717/peerj.1807 22/22

You might also like