Food Microbiology 109 (2023) 104147

Contents lists available at ScienceDirect

Food Microbiology
journal homepage: www.elsevier.com/locate/fm

Cold-tolerant microorganisms causing spoilage of vacuum-packed beef

under time-temperature abuse determined by culture and qPCR
Samart Dorn-In a, b, *, Laura Führer a, Manfred Gareis a, Karin Schwaiger b
a
Chair of Food Safety and Analytics, Faculty of Veterinary Medicine, LMU Munich, Schoenleutnerstr. 8, 85764, Oberschleissheim, Germany
b
Unit of Food Hygiene and Technology, Institute of Food Safety, Food Technology and Veterinary Public Health, University of Veterinary Medicine, Vienna,
Veterinaerplatz 1, 1210, Vienna, Austria

A R T I C L E I N F O A B S T R A C T

Keywords: Vacuum packaging and storage conditions at chilled temperatures are commonly used in order to prolong the
Spoilage microorganisms shelf life of meat. Under these conditions and time-temperature abuse, cold-tolerant (facultatively) anaerobic
Spoilage parameter spoilage microorganisms can continue growing. This study investigated growth of six relevant spoilage micro­
Drip loss
organisms in vacuum-packed beef (n = 12, 72 subsamples, stored at 10 ◦ C for 28 days) using culture and qPCR
Gas production
Odor
methods. Correspondingly, six qPCRs were newly developed/modified (for total bacteria, lactic acid bacteria
qPCR (LAB), Enterobacterales, total fungi, Kazachstania psychrophila, and cold-tolerant Clostridium spp.). Besides mi­
crobial quantification, four spoilage appearances of meat (gas production, spoilage odor, % drip loss, and meat
color) were observed. Results obtained from culture and qPCR show that total bacteria, LAB, and Enter­
obacterales reached their stationary phase at day 7 when spoilage parameters such as gas production were
statistically increased and a deviation of odor was detected. Fastidious cold-tolerant Clostridium spp. and
K. psychrophila could be detected from day 7. Based on microbiological and sensory analysis results, the
maximum shelf life of vacuum-packed beef stored at 10 ◦ C is 7 days. The developed qPCR has the potential to be
used as an alternative method to culturing for determination of microbial growth.

1. Introduction produce proteases (Savijoki et al., 2006; Signorini et al., 2003; Yuan
et al., 2018) which can break down the myosin at the surface of meat or
Beef is commonly vacuum-packed and stored at chilled temperatures even connective tissue between muscle fibers, allowing the bacteria to
in order to prolong its shelf life (Borch et al., 1996). Under these con­ penetrate the meat (Gill and Penney, 1977). Meat proteins are further
ditions, the growth of aerobic spoilage microorganisms such as Pseu­ broken down into polypeptides or amino acids, which are essential for
domonas spp. is inhibited. However, the facultatively anaerobic spoilage bacterial growth and also contribute significantly to the flavor com­
microorganisms (e.g., lactic acid bacteria (LAB), Enterobacterales, and pounds of the end-product (Rogers and Overall, 2013; Signorini et al.,
yeasts) and strictly anaerobic spoilage bacteria (e.g., cold-tolerant 2003; Toledano et al., 2011). However, meat spoilage can also be the
Clostridium spp.) are able to keep growing, subsequently causing meat result of extensive proteolysis and subsequent peptide degradation and
spoilage (Borch et al., 1996; Ercolini et al., 2011; Mang et al., 2021; decarboxylation promoting biogenic amine production. These com­
Seideman and Durland, 1983). Additionally, temperature abuse condi­ pounds are responsible for the putrid odor of meat (Signorini et al.,
tions contribute to the acceleration of this spoilage process. 2003).
Growth of meat microbiota has been linked to the development of For vacuum-packed meat, one of the most important spoilage in­
spoilage appearance of vacuum-packed meat such as spoilage odor, gas dicators is a high level of gas production. Carbon dioxide (CO2) is a
production, drip loss, and discoloration. Odor deviation resulting from common by-product resulting from the metabolisms of microorganisms
proteolytic activity of food microorganisms is one of the earliest signs of (Dixon and Kell, 1989). Additionally, some cold-tolerant Clostridium spp.
meat spoilage that can be perceived by the consumer. Many cold- such as C. estertheticum and C. gasigenes can produce a high amount of
tolerant bacterial species belonging to LAB and Enterobacteriaceae can gas that is a mixture of CO2 and H2, resulting in a so-called blown pack

* Corresponding author. Chair of Food Safety and Analytics, Faculty of Veterinary Medicine, LMU Munich, Schoenleutnerstr. 8, 85764, Oberschleissheim,
Germany.
E-mail address: Samart.Dorn-In@vetmeduni.ac.at (S. Dorn-In).

https://doi.org/10.1016/j.fm.2022.104147
Received 16 May 2022; Received in revised form 14 September 2022; Accepted 14 September 2022
Available online 21 September 2022
0740-0020/© 2022 Elsevier Ltd. All rights reserved.
S. Dorn-In et al. Food Microbiology 109 (2023) 104147

spoilage (BPS, Broda et al., 2000; Collins et al., 1992). Hydrogen can other hand, the overestimation of total (viable) bacteria quantified by
further combine with sulfur, a component of some amino acids, resulting qPCR resulting from the detection of DNA of dead or inactivated bac­
in a hydrogen-sulfide odor (Broda et al., 2000; EFSA, 2016). terial cells. Therefore, both quantification methods were applied in this
Similar to gas production, drip loss can be observed in vacuum- study, targeting the indicator/spoilage microorganisms of meat.
packed meat. Drip loss refers to the unattractive, bloody exudate that This study presents the results of comprehensive investigations using
is released from meat. It can be influenced by many factors such as age, conventional culture methods and state-of-the-art techniques - universal
sex, diet, pre-slaughter stress, slaughter method, storage time and tem­ and multiplex qPCRs, species specific qPCRs with probes and MALDI-
perature, and meat properties such as pH, intramuscular moisture, and TOF MS. The objectives were to investigate the growth rates and to
fat content (Mosimanyana, 2016). Drip loss of meat can commonly occur identify species of spoilage microorganisms, to compare qPCR
due to the leakage of myofibers during the transition of muscle to meat enumeration with traditional culture-based methods, to analyze the
(Ponsuksili et al., 2008) and the endogenous proteolysis during the meat development of spoilage appearances of vacuum-packed beef during
aging process, which results in an increasing tenderness of meat (Hor­ storage at 10 ◦ C, and to determine whether the amount of target mi­
bańczuk et al., 2021; Kaur et al., 2021). Additionally, drip loss can in­ croorganisms correlates with the spoilage appearances of vacuum-
crease when meat is exposed to pressure conditions such as during packed beef.
vacuum packaging or a high tension in the package due to accumulation
of gas (CO2 and H2) (Payne et al., 1998; Seideman and Durland, 1983; 2. Material and methods
Stasiewicz et al., 2014). Meat drip contains components such as water,
the protein myoglobin, and other nutrients such as glucose and lactate, 2.1. Reference microbial strains and inocula preparation
which are useful for growth of indigenous meat microbiota (Fischer,
2007; Rocha et al., 2015). Sixty strains representing different species (LAB: n = 19; Enter­
Unlike odor, gas production, and drip loss, the change of meat color obacterales: n = 19; Pseudomonas: n = 5; Brochothrix thermosphacta: n =
can be a normal process. Meat discoloration is mainly due to myoglobin, 2; other bacterial strains: n = 10; yeasts: n = 5, see Supplementary data
the primary protein responsible for meat color. Fresh meat in presence of Table S1) were used to test the specificity and sensitivity of the qPCR
oxygen has a bright red color, which turns to purple when oxygen is primers and universal probes for bacteria and LAB. Additionally, 31
depleted such as in vacuum-packaging (Ramanathan et al., 2020). yeast and 10 mold strains (see Table S2) were included in the specificity
However, meat can be considered as spoiled when a certain discolor­ test of primers and probes for fungi and the psychrophilic yeast
ation is developed such as hydrogen peroxide greening caused by K. psychrophila. Strains with DSM numbers were obtained from the
Enterococcus spp. and hydrogen sulfide greening caused by Clostridium German Collection of Microorganisms and Cell Cultures (DSMZ,
spp. (EFSA, 2016). The reduction of pH such as due to the presence of Braunschweig, Germany). The other strains (also in Table S1 and
CO2 and acidic substances produced by meat microbiota also contributes Table S2) were isolated from meat samples and were identified by
to discoloration of meat (EFSA, 2016; Ramanathan et al., 2020). Ac­ MALDI-TOF MS and/or gene sequencing at the Chair of Food Safety and
cording to Renerre (1990), low pH reduces the stability constant for the Analytics, LMU (Munich), as previously described by Bahlinger et al.
haem-globin linkages and myoglobin denatures at pH values below 5. (2021) and Paniora (2014).
Important meat spoilage parameters are sensory deviations All reference bacterial stains used to test the specificity and sensi­
perceived by the consumer such as those described in the previous tivity of the qPCR systems were subcultured on Columbia blood agar
paragraphs (Nychas et al., 2008). However, in terms of microbiological (CBA, Oxoid, Germany), while fungi were subcultured on Malt-Extract
quality of meat and according to food acts in some countries (e.g., Agar with Novobiocin (MEA+, Merck, Roth, Germany). Plates were
German Society for Hygiene and Microbiology, DGHM), fresh meat incubated anaerobically (for LAB) and aerobically (for other bacterial
containing a high amount of indigenous microbiota are not allowed to and fungal strains) at 30 ◦ C for 48 h. For Clostridium spp. and
be commercially sold to the consumer. This is, for example, the case K. psychrophila, the plates were incubated anaerobically at 10 ◦ C for
when the contamination level is higher than 6.5, 6.0, and 5.0 log10 cfu/g 7–10 days. The grown colonies were suspended in McFarland suspension
for aerobic mesophilic bacteria, Pseudomonas spp., and Enterobacteri­ and adjusted to 1.0 McFarland turbidity (Densimat Densitometer, Bio­
aceae, respectively (DGHM, 2018). Similar to the European Union mérieux, France), corresponding to about 3.0 × 108 cfu/ml (Seeley
regulation, meat contaminated with aerobic mesophilic bacteria ≥6.5 et al., 1991), then diluted to 1.0 × 106 cfu/ml of 0.85% NaCl and further
log10 cfu/g, sampled at the end of the processing steps (such as at the proceeded to DNA extraction (see section 2.5).
packing site) are not allowed to be distributed to retail (Commission For the quantification using qPCR, four standards containing mix­
Regulation (EC) No 2073/2005). As a further microbial spoilage indi­ tures of bacteria/fungi were established. The standards for LAB and
cator, it is stated by the European Food Safety Authority (EFSA) that universal qPCR for total bacteria contained five LAB and three other
meat containing ≥7.0 log10 cfu/cm2 LAB is considered to be spoiled bacterial strains, namely Carnobacterium maltaromaticum, Leuconostoc
(EFSA, 2016). Moreover, Pennacchia et al. (2011) found that gelidum, Enterococcus faecalis (DSM 2570), Pediococcus pentosaceus,
vacuum-packed beef containing LAB >8.0 log10 cfu/g meat exhibits Streptococcus sanguinis, Pseudomonas fragi (DSM 3456), Hafnia alvei, and
unacceptable odor and appearance. Cold-tolerant yeasts such as the Brochothrix thermosphacta (DSM, 20171). Standard for Enterobacterales
species Kazachstania (K.) psychrophila have been described as potential contained Citrobacter freundii (DSM 30039), Hafnia alvei (DSM 30079),
spoilage organisms of meat (Kabisch et al., 2016; Paniora, 2014). and Proteus mirabilis (DSM 788). Standard for the quantification of fungi
However, there are only a few investigations and data regarding these contained Candida sakei (DSM 70763) and K. psychrophila (DSM 26230).
microorganisms in vacuum-packed fresh meat. According to the Standard for cold-tolerant Clostridium spp. contained C. estertheticum
recommendation of DGHM (Germany), contamination with yeasts in (DSM 8809) and C. algidicarnis (DSM 15099). Grown colonies of these
processed meat products, e.g., cooked sausage and aspic must not exceed bacterial strains on CBA were suspended to a McFarland turbidity of 4.0
4.0 log10 cfu/g (DGHM, 2018). (approximately 1.2 × 109 cfu/ml), then diluted 10-fold in 0.85% NaCl
The time-intensive culture-based methods are considered the gold up to 10− 9. The last five dilutions of bacterial strains belonging to LAB,
standard for determining the microbiological quality of meat. For a Enterobacterales and Brochothrix thermosphacta were spread on Plate
rapid detection and quantification of specific microorganisms, a number Count Agar (PCA, Merck, Germany) and incubated as described in the
of qPCRs have subsequently been developed. However, there is the risk previous paragraph, before the cfu/ml was determined. For Clostridium
of biased results and a subsequent misinterpretation when using only a spp. and yeasts, their cells in the suspensions were enumerated using
single detection method, such as the underestimation of fastidious or microscope and Thoma chamber. The artificial contamination of these
non-culturable bacteria when using culture-based methods or, on the microbial strains in meat homogenate is described in section 2.2.1.

2
S. Dorn-In et al. Food Microbiology 109 (2023) 104147

2.2. Meat samples preparation odor scores were inspired by five descriptions of a 9-point hedonic scale
method (neutral, slightly, moderately, very much, and extremely: Lim
2.2.1. Artificially inoculated meat homogenate et al., 2009), i.e., 1: fresh, almost odorless; 2: slight deviation; 3: distinct
This step was performed to establish a standard for each qPCR (see deviation, still acceptable; 4: spoilage odor (unpleasant and repellent);
section 2.6). Since the meat matrix can influence the efficiency of DNA 5: distinct spoilage odor. Then, meat drip was drawn using a 5 ml pipette
extraction and qPCR, microbial suspensions were spiked in a meat ho­ and filled in a 15 ml Falcon® tube (VWR, Germany). The weight of drip
mogenate to achieve similar matrix conditions as meat samples. To was measured and then related to the weight of meat, giving the results
prepare a meat homogenate for this purpose, fresh beef brisket from a of drip loss in percent (Stella et al., 2019).
butcher (n = 1, about 1.5 kg) was disinfected by spraying with 70%
ethanol and subsequent short flaming in the laboratory. About 0.3 cm of 2.4. Microbial analysis by culture methods
the outer part of the beef was cut away with a sterile scalpel. Ten grams
of this beef sample were homogenized with 90 ml of peptone water for 2.4.1. Plate counts
60 s in a stomacher. The meat homogenate was used as a matrix for Sample preparation and culture methods followed International
artificial contamination with bacteria if its Cq-value obtained from Organization of Standardization (ISO, mesophilic bacteria: ISO
universal qPCR for bacteria was >35 PCR cycles and no PCR amplifi­ 4833–2:2013–12; Enterobacterales; ISO 21528–2:2004; LAB: ISO
cation was obtained from universal qPCR for fungi. After that, sub­ 15214:1998; fungi: ISO 10186:2005–10). Ten grams of surface of each
samples of the meat homogenate were spiked independently with each beef brisket (from day 0, 3, 7, 14, 21, and 28) were cut using a sterile
microbial strain to the concentration of 1 × 108 cfu/ml. Then, 200 μl of scalpel, mixed with 90 ml of peptone water for 60 s in a stomacher. The
each spiked homogenate were taken to prepare the mixture of bacteria/ homogenates were serially diluted in a 0.85% NaCl solution up to 10− 7
fungi for DNA extraction. for stored meat samples. Then, 100 μl of three appropriate dilutions
were spread on two agar plates each, specific for each target microor­
2.2.2. Naturally contaminated meat ganism. PCA was used for anaerobic mesophilic bacteria, De Man-,
Fresh beef briskets (n = 12 biological samples) from nine butchers Rogosa- and Sharpe Agar (MRS, Sifin, Germany) for LAB, Violet-Red-
(located in the region Upper Bavaria, Germany) were used for the Bile-Dextrose Agar (VRBD; Merck, Germany) for Enterobacterales, and
investigation. Meat was delivered to retail within three to five days after MEA+ for fungi. The agar plates were anaerobically incubated (Anae­
slaughter. Each beef brisket (about 3 kg) was portioned into six pieces/ rocult® A; VWR, Germany) as follows: 30 ◦ C, 72 h for PCA, 30 ◦ C, 48 h
subsamples (400–500 g each) at the day of purchase (day 0). Therefore, for VRBD, and 25 ◦ C, 72 h for MRS and MEA+ plates. The colony forming
the total number of subsamples obtained from 12 beef briskets were 72. units per gram (cfu/g) were reported. Since K. psychrophila and cold-
The first subsample of each beef brisket (n = 12) proceeded to cultural tolerant Clostridium spp. are fastidious (Kabisch et al., 2016; Moscho­
and molecular investigation at day 0. The other 60 subsamples were nas et al., 2009), plate counting for these microorganisms was not per­
individually vacuum-packed using a vacuum skin packing machine formed. Instead, their loads in meat samples were determined using
(− 0.9 bar, 25 s, Boss, model Z2000) and commercially available vacuum qPCR. The dilution 10− 1 of meat homogenate obtained from this step
bags (megoBayreuth, Germany). When vacuum leak was observed was further used for DNA extraction.
during storage, samples were excluded from investigation since
permeability of oxygen would lead to biased results. The chosen storage 2.4.2. Identification of isolates by MALDI-TOF MS
temperature of 10 ◦ C was higher than generally recommended for fresh Colonies grown on MRS, VRBD, PCA, and MEA+ were identified
meat (1–8 ◦ C) to imitate the condition of time-temperature abuse of using the Matrix Assisted Laser Desorption Ionization - Time of Flight
chilled vacuum-packed beef. Mass Spectrometry (MALDI-TOF MS). Approximately five colonies with
Then, at each time point (day 3, 7, 14, 21, and 28) a total of 12 different morphologies from each medium of each sample were picked
vacuum-packed meat subsamples (biological replicates) were asepti­ and proceeded to the species identification.
cally unpacked and further proceeded to cultural and qPCR investiga­ The colonies grown on MRS, PC Agar and MEA+ plates were
tion. Each biological replication comprised a single technical extracted using formic acid extraction method according to the in­
replication. Directly after sampling, each piece of beef was disposed. struction manual (Bruker Daltonik GmbH, Bremen, Germany). Three
replicates of 1.0 μl of the resuspended pellet were spotted on a polished
2.3. Spoilage parameters steel target (Bruker Daltonik GmbH). For Enterobacterales, the purple-
red colonies from VRBD agar were primarily subcultured on CBA
Four spoilage parameters of vacuum-packed meat were evaluated at plates, aerobically incubated at 30 ◦ C for 24–48 h, then the colonies
day 3, 7, 14, 21, and 28 of storage, in following order: level of gas were picked from the plates using toothpicks and then spotted and
production (BPS score), color, spoilage odor, and % drip loss. The smeared on a polished steel plate in triplicate (direct transfer method).
investigation was performed by three persons for each sample, with the Further steps were carried out as described in the instruction manual.
exception that drip loss was collected and analyzed by one person. These The MALDI-TOF MS measurements were performed using a Microflex LT
persons were not experienced in sensory investigation of meat; however, and the protein spectra were identified using the Biotyper OC-Software
they were internally trained for this purpose using the scale and scores as 3.0 reference spectra database (Bruker Daltonik GmbH, Germany).
described below.
Before the vacuum-packed beef sample was opened, BPS score was 2.5. DNA extraction
evaluated as described by Boerema et al. (2007). Score 0: no gas pro­
duction, score 1: small bubbles in drip, package intact, score 2: loss of A total of 173 samples comprising bacterial (n = 55) and fungal (n =
vacuum through gas production, score 3: blown, puffy packs, score 4: 41) isolates in 0.85% NaCl, mixtures of bacterial/fungal strains in meat
fully distended, without tightly stretching the pack, score 5: overblown, homogenate (n = 4), meat homogenate (dilution 10− 1) without spiking
tightly stretched packs/packs leaking. Then, the color was scaled ac­ (n = 1), and homogenates of naturally contaminated meat (n = 72) were
cording to a 9-point hedonic scale (1: extremely pale, 2: very pale, 3: subjected to DNA extraction using the High Pure PCR Template Prepa­
pale, 4: slightly pale, 5: bright red, 6: slightly dark, 7: dark, 8: very dark ration Kit (Roche Life Science, Germany). The DNA extraction of the last
and 9: extremely dark) as described by Bağdatli and Kayaardi (2015). three sample types was performed in duplicate. For all sample types, a
Spoilage odor of meat was evaluated within 10 min after the samples 200 μl sample suspension was mixed with 10 μl of lysozyme (20 mg/ml
were opened. The specific confinement and persistent odor (such as in 10 mM Tris-HCl; pH 8.0; final concentration = 1 mg/ml) and incu­
described by Reis et al., 2016) were not determined. The used spoilage bated at 37 ◦ C for 30 min. Further steps from mixing with binding buffer

3
S. Dorn-In et al. Food Microbiology 109 (2023) 104147

and with proteinase K until elution of the extracted DNA followed the species K. psychrophila was newly developed. Target sequence of both
instruction manual of the DNA extraction kit. qPCRs was the region internal transcribed spacer I (ITS1) of fungal DNA.
Specificity test of both qPCRs for fungi was performed using the DNA
extracts from strains representing 31 yeast and 10 mold species (see
2.6. qPCR Table S2).

2.6.1. Primer design 2.6.2. qPCR reaction

Six qPCRs were developed/modified for six microbial groups, i.e., All PCR amplifications were carried out in a BioRad CFX96 Touch™
total bacteria, Enterobacterales, LAB, cold-tolerant Clostridium spp., thermocycler (BioRad, United States). A SYBR-qPCR was applied for
total fungi, and a psychrophilic yeast, K. psychrophila. Table 1 shows the Clostridium spp. (primer pair Cl93F & Cl642R) and K. psychrophila. A 20
sequences of primers and TaqMan-probes, the target microorganisms, μl reaction mixture contained 0.2 μM of each primer, 10 μl of Sensi­
and references. Primers and probes for LAB were designed using an FAST™ SYBR No-ROX Kit (Bioline, United Kingdom), and 2 μl of DNA,
online software provided by NCBI (https://www.ncbi.nlm.nih.gov/ the remaining of the mixture was comprised with nuclease-free water.
tools/primer-blast). The 16S rRNA gene of Lactobacillus sakei (NCBI The qPCR amplification started with initial denaturation at 95 ◦ C for 5
accession no. CP020459) was used as a template to design primers and min followed by 40 cycles of 95 ◦ C for 5 s, 60 ◦ C for Clostridium spp./
probes. The primarily selected sequences were individually compared 58 ◦ C for K. psychrophila for 5 s and elongation at 72 ◦ C for 15 s. A melt
with the 16S rRNA genes of about 205 bacterial strains provided in curve analysis was subsequently carried out. Samples considered posi­
Genbank (NCBI, https://www.ncbi.nlm.nih.gov/genome, data not tive for Clostridium spp. were proceeded to a multiplex qPCR with probes
shown), to ensure that there are at least 2–3 mismatching base pairs with specific for four Clostridium spp.
other bacterial groups. These 205 bacterial strains included LAB (n = For qPCRs with TaqMan-probes, each reaction tube contained a 20 μl
54), Enterobacterales (n = 34), Pseudomonas spp. (n = 7), Clostridium mixture that included 0.20 μM of each primer and 0.10 μM of each
spp. (n = 30), Brochothrix thermosphacta (n = 3 strains), and other probe, 10 μl of SensiFAST™ Probe No-ROX Kit and 2 μl of DNA template,
bacteria (n = 78). After that, the developed qPCRs to detect the LAB filled up with nuclease-free water. The PCR amplification started with
were tested for their specificity and sensitivity by testing with DNA of all initial denaturation at 95 ◦ C for 5 min, followed by 40 cycles (45 cycles
bacteria mentioned in section 2.1 and Table S1. for LAB) of denaturation at 95 ◦ C for 10 s and annealing and elongation
Primers and probes targeting the 16S rRNA gene of the other bac­ at 60 ◦ C (62 ◦ C for LAB) for 30 s (20 s for universal qPCR for bacteria).
terial groups were modified from our previous studies, namely for total The standard dilutions of total bacteria were 1.0 × 109–1.0 × 101
bacteria (Dorn-In et al., 2015), for Enterobacterales (Bahlinger et al., cfu/g and of LAB, 6.2 × 108–6.2 × 101 cfu/g. For Enterobacterales,
2021), and for Clostridium spp. (Dorn-In et al., 2018; Mang et al., 2021). Clostridium spp., total fungi, and K. psychrophila, the standard dilutions
The specificity of the qPCR for the total bacteria was additionally tested were 1.0 × 108–1.0 × 101 cfu/g (see section 2.1).
using the bacterial and fungal DNA (see Table S1) as performed for the
qPCR for LAB.
The universal qPCR for fungi was modified from Dorn-In et al.
(2013). Additionally, a primer pair specific for a psychrophilic yeast

Table 1
qPCR primers and TaqMan-probes of each qPCR system used for quantification of meat microbiota.
qPCR Primer & Sequence (5’ - 3′ ) and dyes Specificity Fragment References
probe size

1 Uni104F GGCGGACGGGTGAGTAA Universal bacteria 836 bp modified from Dorn-In et al. (2015)
Uni923R CTTGTGCGGGCCCCCGT
Uni 799 Cy5.5-AACAGGATTAGATACCCTGGTAGTC-BBQ-650

2 Lab178F TGGAAACAGGTGCTAATACCG LABa 422 bp this study

Car178F CGGAAACGGATGCTAATACCG Carnobacterium spp.
Stre178F TGGAAACGATAGCTAATACCG Streptococcus spp.
Lab587R CTCGCTTTACGCCGTATAAATCCG All LAB
BrLa363-1 Hex-CAGTAGGGAATCTTCCRCAATGG-BHQ-1 LABb
BrLa363-2 Hex-CAGTAGGGAATCTTCGGCAATGG-BHQ-1 Streptococcus spp., Enterococcus
spp.

3 Eb707F ATCTGGAGGAATACCGGTGG Enterobacterales 379 bp Bahlinger et al. (2021)

Eb1066R CAACATTTCACAACACGAGCTG
Eb848 Cy5-CGTGGCTTCCGGAGCTAACGCGT-BHQ-2

4 Cl93F (TMF) CGGCGGACGGGTGAGTAAC Clostridium spp. 566 bp Dorn-In et al. (2018) & Mang et al.
Cl642R CCTCTCCTGCACTCTAGA Clostridium spp. (2021)
Cest Hex-CAAAGGAATTTTTCGGAATTTCACTTTGAG-BHQ- C. estertheticum
1
Cfgrpl Cy3.5-CAAAGGAATAGTCTTCGGATTATTTCACT-BHQ- C. frigoriphilum
2
Cpal-168 Cy5-ACCCCATAACATAGCATTATCGCATG-BHQ-2 C. putrefaciens & C. algidicarnis
Ctag-like Cy5.5-CAAAGGATTTTTCTTCGGAAAATTCCAC-BBQ- C. tagluense-like
650

5 ITS1 (F) TCCGTAGGTGAACCTGCGG Universal fungi 180-240 bp modified from Dorn-In et al. (2013)
ITS2 (R) TCGCTGCGTTCTTCATCGATG
ITS5.8 FAM-AACTTTCAACAAYGGATCTCTTGG-BHQ-1

6 Kaz-ITS1-F GAGGGAGCTTAGTGAATGTAGA K. psychrophila 244 bp this study

Kaz-ITS1-R TCTGTAATAAAACAGTTGCATGAC
a
All LAB, except Carnobacterium spp. and Streptococcus spp.
b
All LAB, except Streptococcus spp. and Enterococcus spp.

4
S. Dorn-In et al. Food Microbiology 109 (2023) 104147

2.7. Statistical analysis g). According to this limitation, the limit of detection (LOD) of universal
qPCR for bacteria was set to 103 cfu/g. However, the results in section
A two-tailed t-test analysis (Microsoft Excel, 2016) was used to 3.2 show that the lowest contamination level of universal bacteria in
evaluate the differences between: 1) amounts of microorganisms (total fresh meat was 4.8 log10 cfu/g (quantified by qPCR). Therefore, the
bacteria, LAB, Enterobacterales, and fungi) quantified by plate counting limitation of this qPCR has no influence on the quantification of total
and qPCR, 2) spoilage parameters and day of storage, and 3) amounts of bacteria in fresh and spoiled meat samples in this study.
target microorganisms and spoilage parameters. The qPCR system for Enterobacterales and Clostridium spp. and qPCR
Then, the Pearson correlation coefficient (r, Microsoft Excel, 2016) to detect four Clostridium spp. (C. estertheticum, C. frigoriphilum,
was used to determine the correlation between amounts of target mi­ C. algidicarnis/C. putrefaciens, and C. tagluense-like) were already tested
croorganisms (from plate counting and from qPCR) and spoilage pa­ in the previous studies (Bahlinger et al., 2021; Dorn-In et al., 2018;
rameters (BPS score, odor, % drip loss, and meat color). The strength of Mang et al., 2021), and were therefore applied without additional
the correlation was interpreted as follows: r = 0–0.19 is regarded as very testing in this study. The universal qPCR for fungi and the qPCR for
weak, 0.20–0.39 as weak, 0.40–0.59 as moderate, 0.60–0.79 as strong, K. psychrophila were specific only to fungi and to K. psychrophila,
and 0.8–1.0 as a very strong correlation (Evans, 1996). Additionally, the respectively. For these qPCRs, no unspecific PCR products were detec­
p-value was calculated based on two-tailed t-test analysis to evaluate ted. The last signal was obtained from the meat homogenate spiked with
whether the correlation was statistically significant (p < 0.05). To 102 cfu/g, while there was no PCR amplification from meat without
calculate the p-value, two values were required, specifically, the degree spiking, meat containing bacteria/fungi at 10 cfu/g, and from the no
of freedom (df) and the t-value, which were calculated as below: template control sample. Therefore, the LOD of LAB, Enterobacterales,
total fungi, K. psychrophila, and Clostridium spp. was set to 102 cfu/g. The
df = n – 2 → n = number of samples LOD of all target microorganisms was lower than the microbiological
√̅̅̅̅̅̅̅̅̅̅̅ critical value of specific spoilage microorganisms for fresh meat and
r n− 2
t = √̅̅̅̅̅̅̅̅̅̅̅̅̅ → t = t − value, r = correlation value, n = number of samples meat products, i.e. 6.5 log10 for mesophilic bacteria, 6.0 log10 for
1 − r2
Pseudomonas spp., 5.0 log10 for Enterobacteriaceae, 4.0 log10 for yeasts,
Using Microsoft Excel, the p-value was calculated using following and 7.0 log10 for LAB (Commission Regulation (EC) No 2073/2005;
formula: DGHM, 2018; EFSA, 2016).
p-value = T.VERT.2S(t;df) → T.VERT.2S = two-tailed t-test, t = t-value, df
= degree of freedom 3.2. Growth of cold-tolerant meat microbiota

The growth of meat microbiota was determined using cultural

methods and qPCRs. Fig. 1 shows the results of total plate count (total
3. Results and discussion bacteria), LAB, Enterobacterales, and fungi. The initial microbiota (at
day 0) were variable among samples with standard deviations of ±2.33
Beef is often vacuum-packed to prolong its shelf life during extended and ± 0.76 for total bacteria, ±2.47 and ± 1.26 for LAB, ±1.67 and ±
periods of shipment and storage (Seideman and Durland, 1983). Addi­ 2.51 for Enterobacterales, and ±1.43 and ± 1.22 log10 cfu/g for fungi,
tionally, to slow down growth rates of facultatively anaerobic spoilage quantified by cultural methods and qPCR, respectively.
microorganisms, meat is stored at refrigerated temperatures (e.g., ≤8 ◦ C, Meat microbiota primarily take the nutrients (such as glucose and
Ndraha et al., 2018). However, time-temperature abuse of chilled meat amino acids) available in the meat drip and on the surface of meat. By
and food has received more attention in recent years, focusing on food increasing the availability of glucose in meat, proteolytic activities of
quality, food safety and food waste (EFSA, 2016; Ndraha et al., 2018). In Pseudomonas spp. (Koutsoumanis et al., 2006) and anaerobic bacteria
this study, a storage temperature of 10 ◦ C was applied to imitate a sit­ (Rood et al., 2022) can be postponed, resulting in an extended shelf-life
uation where the cold chain is not correctly maintained. of (vacuum-packed) meat. Since not all bacteria in meat possess pro­
teolytic activity, when freely available glucose is depleted, the growth of
3.1. Performance of applied qPCRs these bacteria could be stagnated or slowed down (Hernández-Macedo
et al., 2011). In this study, depletion of glucose and free amino acids
Initially, only primer pair Lab178F & Lab587R and probe BrLa363-1 apparently occurred on day 7 when vacuum-packed beef was stored at
were developed and tested for LAB strains. Since this combination could 10 ◦ C. At this day, meat microbiota reached their stationary phase. On
not amplify the 16S rRNA genes of Carnobacterium spp., Streptococcus average, 6.9 ± 1.3–7.3 ± 1.0 log10 for total bacteria, 7.4 ± 1.5–8.0 ±
spp., and Enterococcus spp., two additional forward primers (Car178F 1.1 for LAB, 3.8 ± 2.0–6.4 ± 1.4 for Enterobacterales, quantified by
and Stre178F) and one additional probe (BrLa363-2) were subsequently plate counting and qPCR, respectively. For two meat samples containing
developed and included into the qPCR reaction for LAB. The final a very low number of any microbiota at day 0 (<2.0 log10 cfu/g,
combination of probes and primers as shown in Table 1 was specific for determined by the culture method), total bacteria, LAB, and Enter­
all tested LAB species, but also for Brochothrix spp. and Bacillus spp. obacterales reached their stationary phase between day 7 and 14.
However, at concentrations of 1 × 106 cfu/ml NaCl (see section 2.1), the This study showed that the microbial load determined by qPCR is
Cq-values of both bacterial genera were between 33 and 35 PCR cycles, often higher than by culture, however, the difference was not statisti­
while Cq-values of the targeted LAB at the same concentrations were cally significant (p > 0.05) for total bacteria and LAB. For Enter­
between 19 and 21 PCR cycles. The difference of these Cq-values was obacterales and fungi, a statistically significant difference between both
correspondingly about 4–5 log10 cfu/ml (based on the calculation of methods was observed on some investigation days (see Fig. 1). In many
slope of standard = − 3.3 PCR cycles). Therefore, the presence of these meat samples, Enterobacterales and fungi could not be isolated, while in
two bacterial genera on meat should not influence the results of the almost all meat samples they were detected by qPCR. This may be due to
qPCR for LAB. the detection of DNA of dead cells and of fastidious microorganisms that
DNA of all tested bacteria could be detected by universal qPCR for could not be cultured. The applied incubation temperatures (25–30 ◦ C)
bacteria. However, meat without spiking, spiked meat homogenate could also have inhibited the growth of some psychrophilic microor­
(containing 103 to101 cfu/g equivalent) as well as the no template ganisms. For example, K. psychrophila can grow at 4–15 ◦ C (Kabisch
control showed a positive signal with Cq-values between 35 and 37 PCR et al., 2016), which is lower than the incubation temperature (25 ◦ C)
cycles. This indicated that the universal qPCR for bacteria was not applied for the cold-tolerant (mesophilic) fungi in this study. Out of 12
reliable for samples containing a very low amount of bacteria (<103 cfu/ fresh beef samples (day 0 and day 3), K. psychrophila was detected only

5
S. Dorn-In et al. Food Microbiology 109 (2023) 104147

Fig. 1. Growth of cold-tolerant meat microbiota in vacuum-packed beef (n = 12; 72 subsamples; stored at 10 ◦ C for 28 days), quantified using plate counting method
and qPCR. Days marked with (*) show the statistically significant difference (p < 0.05) between both quantification methods. Box whisker plots: lines above and
below the box plots are maximal and minimal values of the dataset. The boxes indicate ranges between the median of the lower and upper half of the dataset. The
bars within the boxes are the median values of all samples.

in one sample (2.4 log10; LOD = 2.0 log10 cfu/g), then increasing to three whole vacuum-packed meat samples are stored at optimal conditions for
samples on day 7 (3.0–5.3 log10) and day 14–28 (4.0–5.6 log10, see at least 7–21 days. Alternatively, drip/meat samples can be taken and
Fig. 2). The universal qPCR for fungi can also amplify DNA of enriched in liquid medium at optimal growth conditions (Mang et al.,
K. psychrophila, showing a much higher amount of total fungi in positive 2021).
samples than that enumerated by the culture method (see Fig. 1).
K. psychrophila is often isolated from chilled fresh and vacuum-packed
3.3. Correlation with spoilage parameters
beef sold in Germany (Paniora, 2014). The potential of K. psychrophila
to cause spoilage of vacuum-packed meat was described by Kabisch et al.
Results of sensory analysis from three people are shown in Fig. 3. The
(2016).
use of an untrained sensory panel to investigate spoilage parameters is a
Using SYBR-qPCR for Clostridium spp., two beef samples were found
limitation of this study, since parameters such as odor and color are very
positive. Clostridium spp. were not detected in samples until 7 days of
subjective. While meat microbiota reached their stationary phase at day
storage, reaching their peak growth of approximately 4.0 and 5.2 log10
7, the BPS scores and odor were also statistically significantly different
on day 28 (see Fig. 2).
from the previous testing days (day 0 and day 3). In terms of odor, the
Unlike LAB and Enterobacterales, meat is not always contaminated
heterofermentative LAB are responsible for undesirable sensory de­
with K. psychrophila and cold-tolerant Clostridium spp. And if so, the
viations due to a high production of biogenic amines such as γ-amino­
contamination level of these microorganisms in fresh meat is often very
butyric acid, tyramine, ornithine, and histamine (Geissler et al., 2016).
low, thus cannot be detected by qPCR (and probably not by culture).
Increasing BPS score indicates an increase of gas production, especially
Therefore, an enrichment procedure is recommended, in which the
CO2. Together with acidic substances produced by LAB, it can lead to pH

Fig. 2. Growth of K. psychrophila in three and psychrotolerant Clostridium spp. in two of 12 vacuum-packed beef samples (stored at 10 ◦ C for 28 days) determined
using qPCR. The lines below 2.0 log10 cfu/g (limit of detection) are samples with negative results.

6
S. Dorn-In et al. Food Microbiology 109 (2023) 104147

Fig. 3. Box whisker plots showing spoilage parameters of vacuum-packed beef stored at 10 ◦ C for 3, 7, 14, 21, and 28 days. The evaluation methods for blown pack
spoilage (BPS) score, spoilage odor, % drip loss, and color are described in section 2.3. Days marked with (*) show the statistically significant difference (p < 0.05)
compared to the previous investigation days. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of
this article.)

reduction of meat, which consequently leads to a denaturation of muscle day 3 were relatively high, a distinctly exponential growth to day 7 was
protein, a loss of water holding capacity and an increasing drip loss not as sharp as could be seen in the results obtained from culture (see
during storage of meat (Bağdatli and Kayaardi, 2015). Correspondingly, Fig. 1). Correspondingly, a correlation between spoilage parameters and
statistically significant increase/change of % drip loss (on day 14) and results from qPCR (for total bacteria and LAB) was not found.
meat color (day 21) was found after the growth of meat microbiota has Since the amounts of Enterobacterales and fungi, especially yeasts, in
been stagnated for 1 and for 2 weeks, respectively (see Fig. 3). meat samples were very variable (high standard deviation) throughout
It is known that total bacteria and LAB are associated with spoilage of the storage period, no correlation was found between the amounts of
meat (EFSA, 2016; Pennacchia et al., 2011). As mentioned in the these microorganisms and spoilage parameters. Enterobacterales,
introduction, besides sensory deviation, microbiological criteria are set especially cold-tolerant species, such as Hafnia alvei and Serratia spp. can
for fresh meat sold at retail. Table 2 shows the correlations (r) of four grow at temperatures below 10 ◦ C (Labadie, 1999; Ridell and Korkeala,
spoilage parameters and the amount of cold-tolerant meat microbiota 1997). However, their growth rates are rather slow compared to LAB. A
obtained from culture and qPCR. Although high amounts of total bac­ study by Merchán et al. (2022) shows that Hafnia alvei can produce
teria and LAB were found in stored meat, only a weak to moderate proteolytic enzymes only at temperatures above 15 ◦ C. Thus, they do not
correlation (statistically significant, p < 0.05, see Table 2) between three possess a high potential to cause spoilage of meat stored at sufficiently
spoilage parameters (gas production, spoilage odor, and % drip loss) and refrigerated temperatures (Brightwell et al., 2007).
amounts of these bacterial groups was mainly found for data obtained In the present study, meat color was determined before the vacuum-
from culture. Since amounts of these bacteria determined by qPCR on packs were opened, thus binding of meat myoglobin with oxygen to

Table 2
Correlation (r) between amounts of cold-tolerant meat microbiota and spoilage parameters. The r- and p-values were calculated based on 60 meat subsamples (n).
Parameter Statistic Total bacteria LAB Enterobacterales Fungi (yeast)

Culture PCR Culture PCR Culture PCR Culture PCR

a
BPS r 0.546 − 0.019 0.443 0.163 0.202 0.102 − 0.111 0.002
t-value 4.705 0.140 3.562 1.193 1.486 0.740 0.805 0.015
p-value 0.00002 0.889 0.001 0.238 0.143 0.462 0.424 0.988
Spoilage odor r 0.429 0.181 0.433 0.265 0.179 0.050 − 0.214 0.209
t-value 3.426 1.328 3.465 1.983 1.313 0.364 1.581 1.539
p-value 0.001 0.190 0.001 0.053 0.195 0.717 0.120 0.130
% Drip loss r 0.283 0.206 0.321 0.283 0.148 − 0.280 − 0.189 0.225
t-value 2.128 1.516 2.443 2.128 1.080 2.103 1.387 1.663
p-value 0.038 0.136 0.018 0.038 0.285 0.040 0.171 0.102
Color r 0.002 0.195 0.249 0.091 − 0.217 0.132 − 0.217 0.132
t-value 0.011 0.934 1.207 0.429 1.042 0.622 1.042 0.622
p-value 0.992 0.360 0.240 0.672 0.309 0.540 0.309 0.540
a
Blown pack spoilage; shaded in green: statistically significant difference (p < 0.05).

7
S. Dorn-In et al. Food Microbiology 109 (2023) 104147

form oxymyoglobin (resulting in a bright red color of meat, Ramanathan deviation of sensory parameters as shown in sections 3.2 and 3.3, it can
et al., 2020) can be excluded. The color of vacuum-packed beef from day be concluded that the shelf life of vacuum-packed beef stored at 10 ◦ C is
3 to day 7 remained purple red due to the absence of oxygen, changed to 7 days. In a previous study, Rogers et al. (2014) investigated
pale red after 3 weeks of storage and 2 weeks after the growth stagnation vacuum-packed ground beef stored at 0–2 ◦ C for five days and then at
of meat microbiota. Consequently, change of meat color in the present 10 ◦ C for five days. During storage at chilled temperatures (0–2 ◦ C),
study has no correlation with the amount of any meat microbiota. It is aerobic plate counts, Enterobacteriaceae, and LAB were lower than 3.5
also possible that pale color of meat during storage is a result of the loss log10 cfu/g determined by plate counting methods. These increased
of myoglobin from meat muscle into meat drip, since myoglobin is a significantly up to their stationary phase at day 8 to day 9 (four to five
water-soluble protein. Therefore, an increasing drip loss may indirectly days of temperature abuse) with about 9.0, 8.5, and 8.5 log10 cfu/g,
contribute to the discoloration of vacuum-packed meat. respectively. The authors suggested that the spoilage of a product cannot
In this study, the presence of K. psychrophila and/or cold-tolerant solely be judged by biochemical and microbiological evaluation, but
Clostridium spp. indicates that vacuum-packed meat was stored for a should be determined and assessed using visual, tactile, and olfactory
long time (at least 7 days), since they grow slowly. However, a different evaluations. A study of Silva et al. (2020) showed that, when
sensory deviation compared to other meat samples was not observed in vacuum-packed beef is correctly stored at 4 ◦ C and 1 ◦ C, the shelf life can
the contaminated vacuum-packed meat. The BPS scores 2 and 3 of two be extended to 16 days and to 21 days, respectively. However, the au­
meat samples contaminated with C. algidicarnis and C. frigoriphirum, thors mentioned that the days could be variable, depending on the
respectively, determined at day 28 is moderate, which complied with concentration and composition of the initial meat microbiota.
the conclusion in a previous study that these two Clostridium spp. do not
always produce a high amount of gas (Mang et al., 2021). 3.4. Identified microorganisms
According to the microbiological criteria set by authorities (Com­
mission Regulation (EC) No 2073/2005; DGHM, 2018) and the Out of 354 identified colonies (see Table 3), 165 (46.6%) colonies

Table 3
Species identification of colonies cultivated from meat (n = 354) using MALDI-TOF MS. From each day of incubation (D0 – D28), the colonies with different mor­
phologies from each medium of each sample were selected.
Microorganisms Species Number of identified colonies

D0 D3 D7 D14 D21 D28 Total

Lactic acid bacteria (LAB) Leuconostoc gelidum 2 3 9 3 17 17 51

Lactobacillus algidus 7 4 6 11 4 32
Lactobacillus sakei 2 5 2 4 4 12 29
Carnobacterium divergens 4 1 2 1 13 21
Lactobacillus fuchuensis 1 3 8 12
Lactobacillus satsumensis 1 2 3
Lactococcus piscium 3 3
Enterococcus malodoratus 2 2
Lactobacillus delbrueckii 1 1 2
Lactobacillus paracasei 1 1 2
Carnobacterium maltaromaticum 1 1
Lactobacillus amylolyticus 1 1
Lactobacillus coryniformis 1 1
Lactobacillus curvatus 1 1
Lactobacillus oligofermentans 1 1
Lactobacillus saerimneri 1 1
Streptococcus pneumoniae 1 1
Streptococcus sanguinis 1 1

Enterobacterales Hafnia alvei 5 5 8 20 17 24 79

Serratia proteamaculans 5 3 5 7 8 8 36
Serratia liquefaciens 4 7 10 5 2 4 32
Yersinia intermedia 1 1 1 1 4
Rahnella aquatilis 2 2
Rhizobium radiobacter 1 1 2
Serratia quinivorans 1 1 2
Ewingella americana 1 1

Other bacteria Pseudomonas tolaasii 3 1 4

Pseudomonas fragi 2 2
Aeromonas salmonicida 1 1
Agromyces bracchium 1 1
Arthrobacter gandavensis 1 1
Burkholderia xenovorans 1 1
Pseudomonas libanensis 1 1
Pseudomonas taetrolens 1 1
Staphylococcus haemolyticus 1 1

Fungi Cryptococcus curvatus 2 1 1 1 5

Candida famata 1 3 4
Trichosporon cutaneum 2 2
Trichosporon montevidense 1 1 2
Candida oleophila 1 1
Candida zeylanoides 1 1
Penicillium camemberti 1 1
Penicillium nalgiovense 1 1
Trichosporon ovoides 1 1

8
S. Dorn-In et al. Food Microbiology 109 (2023) 104147

belonged to LAB, 158 (44.6%) to Enterobacterales, 18 (5.1%) to fungi, References

and 13 (3.7%) to other bacteria. Most frequently isolated LAB were
Leuconostoc gelidum (14.4% of all identified isolates), Lactobacillus algidis Andreevskaya, M., Jääskeläinen, E., Johansson, P., Ylinen, A., Paulin, L., Björkroth, J.,
Auvinen, P., 2018. Food spoilage-associated Leuconostoc, Lactococcus, and
(9.1%), Lactobacillus sakei (8.2%), Carnobacterium divergens (6.0%), and Lactobacillus species display different survival strategies in response to competition.
Lactobacillus fuchuensis (3.4%), while Hafnia alvei (22.3%), Serratia Appl. Environ. Microbiol. 84 https://doi.org/10.1128/AEM.00554-18.
proteamaculans (10.2%), and Serratia liquefaciens (9.0%) were most often Bağdatli, A., Kayaardi, S., 2015. Influence of storage period and packaging methods on
quality attributes of fresh beef steaks. CyTR J. Food 13, 124–133. https://doi.org/
found among the bacteria belonging to the order Enterobacterales. The 10.1080/19476337.2014.919029.
described species are supposed to play an important role in spoilage of Bahlinger, E., Dorn-In, S., Beindorf, P.-M., Mang, S., Kaltner, F., Gottschalk, C.,
vacuum-packed meat, similar to findings of other studies (e.g., Gareis, M., Schwaiger, K., 2021. Development of two specific multiplex qPCRs to
determine amounts of Pseudomonas, Enterobacteriaceae, Brochothrix
Andreevskaya et al., 2018; Chenoll et al., 2007; Hernández-Macedo thermosphacta and Staphylococcus in meat and heat-treated meat products. Int. J.
et al., 2011). As mentioned in section 3.2, by using qPCRs, two out of 12 Food Microbiol. 337 https://doi.org/10.1016/j.ijfoodmicro.2020.108932.
beef samples (17%) were found positive for Clostridium spp. (Clostridium Boerema, J.A., Broda, D.M., Penney, N., Brightwell, G., 2007. Influence of peroxyacetic
acid-based carcass rinse on the onset of “blown pack” spoilage in artificially
algidicarnis/C. putrefaciens and C. frigoriphilum), while K. psychrophila
inoculated vacuum-packed chilled beef. J. Food Protect. 70, 1434–1439.
was detected in three beef samples (25%). Further differentiation be­ Borch, E., Kant-Muermans, M.-L., Blixt, Y., 1996. Bacterial spoilage of meat and cured
tween C. algidicarnis and C. putrefaciens can be performed using a meat products. Int. J. Food Microbiol. 33, 103–120.
multiplex qPCR as previously described by Mang et al. (2021). There is Brightwell, G., Clemens, R., Urlich, S., Boerema, J., 2007. Possible involvement of
psychrotolerant Enterobacteriaceae in blown pack spoilage of vacuum-packaged raw
no information available about the relation between isolated/detected meat. Int. J. Food Microbiol. 119, 334–339.
species and the risk to human health, but almost all of them are involved Broda, D.M., Saul, D.J., Lawson, P.A., Bell, R.G., Musgrave, D.R., 2000. Clostridium
in spoilage processes of meat (EFSA, 2016). gasigenes sp. nov., a psychrophila causing spoilage of vacuum-packed meat. Int. J.
Syst. Evol. Microbiol. 50, 107–118.
Chenoll, E., Macián, M.C., Elizaquível, P., Aznar, R., 2007. Lactic acid bacteria associated
4. Conclusions with vacuum-packed cooked meat product spoilage: population analysis by rDNA-
based methods. J. Appl. Microbiol. 102, 498–508.
Collins, M.D., Rodrigues, U.M., Dainty, R.H., Edwards, R.A., Roberts, T.A., 1992.
Culture methods and qPCRs were applied to quantify total bacteria, Taxonomic studies on a psychrophilic Clostridium from vacuum-packed beef:
LAB, Enterobacterales, total fungi, psychrophilic Clostridium spp., and description of Clostridium estertheticum sp. nov. FEMS Microbiol. Lett. 96, 235–240.
the psychrophilic yeast K. psychrophila in vacuum-packed beef. The DGHM, 2018. Microbiological Guidelines for Food, a Recommendation from a
Professional Group for Food Microbiology and Hygiene. Beuth Verlag GmbH, Berlin,
developed/modified qPCRs gain similar results to culture (for total Germany. German Society for Hygiene and Microbiology (German: Mikrobiologische
bacteria, LAB, and Enterobacterales) and are optimal to be used to Richt- und Warnwerte zur Beurteilung von Lebensmitteln, eine Empfehlung der
quantify fastidious microorganisms (cold-tolerant Clostridium spp., total Fachgruppe Lebensmittelmikrobiologie und –hygiene, Deutschen Gesellschaft für
Hygiene und Mikrobiologie: DGHM).
fungi, and K. psychrophila). Compared to culture, qPCRs require less
Dixon, N.M., Kell, D.B., 1989. The control and measurement of ‘CO2’ during
time, material, and costs, especially when different microorganisms are fermentations. J. Microbiol. Methods 10, 155–176. https://doi.org/10.1016/0167-
investigated in parallel. The qPCRs developed in this study therefore 7012(89)90048-1.
have the potential to be used as alternative methods to culturing for Dorn-In, S., Bassitta, R., Schwaiger, K., Bauer, J., Hölzel, C.S., 2015. Specific
amplification of bacterial DNA by optimized so-called universal bacterial primers in
determination of microbial growth in meat during processing, transport, samples rich of plant DNA. J. Microbiol. Methods 113, 50–56. https://doi.org/
and storage. Despite the fact that qPCR detects DNA from dead and non- 10.1016/j.mimet.2015.04.001.
viable microorganisms, with a careful interpretation of results, the Dorn-In, S., Hölzel, C., Janke, T., Schwaiger, K., Balsliemke, J., Bauer, J., 2013. PCR-
SSCP-based reconstruction of the original fungal flora of heat-processed meat
technology proved useful in assessing the level of meat spoilage. In case products. Int. J. Food Microbiol. 162, 71–81. https://doi.org/10.1016/j.
of time-temperature abuse of refrigerated conditions (in this study at ijfoodmicro.2012.12.022.
10 ◦ C), the growth of bacteria in vacuum-packed meat above the critical Dorn-In, S., Schwaiger, K., Springer, C., Barta, L., Ulrich, S., Gareis, M., 2018.
Development of a multiplex qPCR for the species identification of Clostridium
values for fresh meat sold at retail occurred at day 7 of storage. At the estertheticum, C. frigoriphilum, C. bowmanii and C. tagluense-like from blown pack
same time, the spoilage parameters - BPS and odor - increased signifi­ spoilage (BPS) meats and from wild boars. Int. J. Food Microbiol. 286, 162–169.
cantly. Therefore, shelf life of vacuum-packed beef stored at 10 ◦ C can be https://doi.org/10.1016/j.ijfoodmicro.2018.08.020.
EFSA (European Food Safety Authority), 2016. Growth of spoilage bacteria during
defined as no longer than 7 days. storage and transport of meat. EFSA J. 14, e04523.
Ercolini, D., Ferrocino, I., Nasi, A., Ndagijimana, M., Vernocchi, P., La Storia, A.,
Declaration of competing interest Laghi, L., Mauriello, G., Guerzoni, M.E., Villani, F., 2011. Monitoring of microbial
metabolites and bacterial diversity in beef stored under different packaging
conditions. Appl. Environ. Microbiol. 77, 7372–7381.
The authors declare that they have no known competing financial Evans, J.D., 1996. Straightforward Statistics for the Behavioral Sciences. Brooks/Cole
interests or personal relationships that could have appeared to influence Publishing, Pacific Grove, CA.
the work reported in this paper. Fischer, K., 2007. Drip loss in pork: influencing factors and relation to further meat
quality traits. J. Anim. Breed. Genet. 124, 12–18.
Geissler, A.J., Behr, J., von Kamp, K., Vogel, R.F., 2016. Metabolic strategies of beer
Data availability spoilage lactic acid bacteria in beer. Int. J. Food Microbiol. 216, 60–68. https://doi.
org/10.1016/j.ijfoodmicro.2015.08.016.
Gill, C.O., Penney, N., 1977. Penetration of bacteria into meat. Appl. Environ. Microbiol.
Data will be made available on request. 33, 1284–1286. https://doi.org/10.1128/aem.33.6.1284-1286.1977.
Hernández-Macedo, M.L., Barancelli, G.V., Contreras-Castillo, C.J., 2011. Microbial
Acknowledgments deterioration of vacuum-packaged chilled beef cuts and techniques for microbiota
detection and characterization: a review. Braz. J. Microbiol. 42, 1–11. https://doi.
org/10.1590/S1517-83822011000100001.
We would like to thank all technical assistants, especially Erika Horbańczuk, O.K., Jóźwik, A., Wyrwisz, J., Marchewka, J., Wierzbicka, A., 2021.
Altgenug, Ilona Fitzek, Verena Hohenester, and Sebastian Schlef from Physical Characteristics and microbial quality of ostrich meat in relation to the type
of packaging and refrigerator storage time. Molecules 26, 3445. https://doi.org/
the Chair of Food Safety and -Analytics, LMU Munich (Germany) for 10.3390/molecules26113445.
their excellent laboratory work. Kabisch, J., Erl-Höning, C., Wenning, M., Böhnlein, C., Gareis, M., Pichner, R., 2016.
Spoilage of vacuum-packed beef by the yeast Kazachstania psychrophila. Food
Microbiol. 53, 15–23.
Appendix A. Supplementary data
Kaur, L., Hui, S.X., Morton, J.D., Kaur, R., Chian, F.M., Boland, M., 2021. Endogenous
proteolytic systems and meat tenderness: influence of post-mortem storage and
Supplementary data related to this article can be found at https://doi processing. Food Sci. Anim. Resour. 41, 589–607. https://doi.org/10.5851/
.org/10.1016/j.fm.2022.104147. kosfa.2021.e27.
Koutsoumanis, K., Stamatiou, A., Skandamis, P., Nychas, G.J., 2006. Development of a
microbial model for the combined effect of temperature and pH on spoilage of
ground meat, and validation of the model under dynamic temperature conditions.

9
S. Dorn-In et al. Food Microbiology 109 (2023) 104147

Appl. Environ. Microbiol. 72, 124–134. https://doi.org/10.1128/AEM.72.1.124- Ridell, J., Korkeala, H., 1997. Minimum growth temperatures of Hafnia alvei and other
134.2006. Enterobacteriaceae isolated from refrigerated meat determined with a temperature
Labadie, J., 1999. Consequences of packaging on bacterial growth. Meat is an ecological gradient incubator. Int. J. Food Microbiol. 35, 287–292.
niche. Meat Sci. 52, 299–305. Rocha, L.M., Faucitano, L., Zagabe, F.K., Castro, A.C.D., Saucier, L., 2015. Composition of
Lim, J., Wood, A., Green, B.G., 2009. Derivation and evaluation of a labeled hedonic exudates from meat drip loss and microbial spoilage differences between various
scale. Chem. Senses 34, 739–751. https://doi.org/10.1093/chemse/bjp054. pork quality classes. In: 61st International Congress of Meat Science and Technology.
Mang, S., Schwaiger, K., Lindner, R., Gareis, M., Dorn-In, S., 2021. High incidence of Clermont-Ferrand, France.
cold-tolerant Clostridium frigoriphilum and C. algidicarnis in vacuum-packed beef Rogers, L.D., Overall, C.M., 2013. Proteolytic post-translational modification of proteins:
on retail sale in Germany. Int. J. Food Microbiol. 340 https://doi.org/10.1016/j. proteomic tools and methodology. Mol. Cell. Proteomics 12, 3532–3542. https://doi.
ijfoodmicro.2021.109053. org/10.1074/mcp.M113.031310.
Merchán, A.V., Ruiz-Moyano, S., Hernández, M.V., Martín, A., Lorenzo, M.J., Benito, M. Rogers, H.B., Brooks, J.C., Martin, J.N., Tittor, A., Miller, M.F., Brashears, M.M., 2014.
J., 2022. Characterization of autochthonal Hafnia spp. strains isolated from Spanish The impact of packaging system and temperature abuse on the shelf life
soft raw Ewe’s milk PDO cheeses to be used as adjunct culture. Int. J. Food characteristics of ground beef. Meat Sci. 97, 1–10. https://doi.org/10.1016/j.
Microbiol. 373, 109703 https://doi.org/10.1016/j.ijfoodmicro.2022.109703. meatsci.2013.11.020.
Moschonas, G., Bolton, D.J., Sheridan, J.J., McDowell, D.A., 2009. Isolation and sources Rood, L., Bowman, J.P., Ross, T., Corkrey, R., Pagnon, J., Yang, S.W.T.,
of blown pack spoilage clostridia in beef abattoirs. J. Appl. Microbiol. 7, 616–624. Kocharunchitt, C., 2022. The effects of glucose on microbial spoilage of vacuum-
Mosimanyana, K.G., 2016. The effect of freezing and post-mortem ageing on beef quality. packed lamb. Meat Sci. 188 https://doi.org/10.1016/j.meatsci.2022.108781.
Dissertation, University of Pretoria, South Africa. https://repository.up.ac.za/handl Savijoki, K., Ingmer, H., Varmanen, P., 2006. Proteolytic systems of lactic acid bacteria.
e/2263/60841?show=full. Appl. Microbiol. Biotechnol. 71, 394–406. https://doi.org/10.1007/s00253-006-
Ndraha, N., Hsiao, H.-I., Vlajic, J., Yang, M.-F., Lin, H.-T.V., 2018. Time-temperature 0427-1.
abuse in the food cold chain: review of issues, challenges, and recommendations. Seeley, H.W., Vandemark, P.J., Lee, J.J., 1991. Microbes in Action: A Laboratory Manual
Food Control 89, 12–21. https://doi.org/10.1016/j.foodcont.2018.01.027. of Microbiology, fourth ed. Freeman and Company, New York.
Nychas, G.-J.E., Skandamis, P.N., Tassou, C.C., Koutsoumanis, K.P., 2008. Meat spoilage Seideman, S.C., Durland, P.R., 1983. Vacuum packaging of fresh beef: a review. J. Food
during distribution. Meat Sci. 78, 77–89. Qual. 6, 29–47. https://doi.org/10.1111/j.1745-4557.1983.tb00755.x.
Payne, S.R., Durham, C.J., Scott, S.M., Devine, C.E., 1998. Effects of non-vacuum Signorini, M., Ponce-Alquicira, E., Guerrero-Legarreta, I., 2003. Proteolytic and lipolytic
packaging systems on drip loss from chilled beef. Meat Sci. 49, 277–287. https://doi. changes in beef inoculated with spoilage microorganisms and bioprotective lactic
org/10.1016/S0309-1740(97)00135-6. acid bacteria. Int. J. Food Prop. 6, 147–163. https://doi.org/10.1081/JFP-
Paniora, C., 2014. Untersuchungen zur psychrophilen Hefemikrobiota auf frischen, 120016631.
vakuumverpackten Fleischstücken aus dem globalen Handel. Dissertation. Faculty of Silva, J.L., Cadavez, V.A.P., Machado, M.A.M., Dias, B.C.L., Cunha-Neto, A., Gonzales-
Veterinary Medicine, Ludwig-Maximilian University of Munich, Germany. Barron, U., Figueiredo, E.E.S., 2020. Behavior of spoilage bacteria and Salmonella
Pennacchia, C., Ercolini, D., Villani, F., 2011. Spoilage-related microbiota associated enterica subspecies enterica O:4,5 in vacuum-packaged beef during refrigeration.
with chilled beef stored in air or vacuum pack. Food Microbiol. 28, 84–93. Ciência Rural. 50, 1–8. https://doi.org/10.1590/0103-8478cr20200090.
Ponsuksili, S., Muràni, E., Phatsara, C., Jonas, E., Walz, C., Schwerin, M., Schellander, K., Stasiewicz, M., Lipiński, K., Cierach, M., 2014. Quality of meat products packaged and
Wimmers, K., 2008. Expression profiling of muscle reveals transcripts differentially stored under vacuum and modified atmosphere conditions. J. Food Sci. Technol. 51,
expressed in muscle that affect water-holding capacity of pork. J. Agric. Food Chem. 1982–1989. https://doi.org/10.1007/s13197-012-0682-3.
56, 10311–10317. https://doi.org/10.1021/jf800881y. Stella, S., Garavaglia, D., Francini, G., Viganò, V., Bernardi, C., Tirloni, E., 2019.
Ramanathan, R., Hunt, M.C., Mancini, R., Nair, M.N., Denzer, M.L., Suman, S.P., Mafi, G. Evaluation of the weight loss of raw beef cuts vacuum packaged with two different
G., 2020. Recent updates in meat color research: integrating traditional and high- techniques. Ital. J. Food Saf. 8, 8111. https://doi.org/10.4081/ijfs.2019.8111.
throughput approaches. Meat Muscle Biol. 4, 1–24. https://doi.org/10.22175/ Toledano, A., Jordano, R., López, C., Medina, L.M., 2011. Proteolytic activity of lactic
mmb.9598. acid bacteria strains and fungal biota for potential use as starter cultures in dry-cured
Reis, M.M., Reis, M.G., Mills, J., Ross, C., Brightwell, G., 2016. Characterization of ham. J. Food Protect. 74, 826–829.
volatile metabolites associated with confinement odour during the shelf-life of Yuan, L., Sadiq, F.A., Liu, T.-J., Li, Y., Gu, J.-S., Yang, H.-Y., He, G.-Q., 2018. Spoilage
vacuum packed lamb meat under different storage conditions. Meat Sci. 113, 80–89. potential of psychrotrophic bacteria isolated from raw milk and the thermo-stability
https://doi.org/10.1016/j.meatsci.2015.11.017. of their enzymes. J. Zhejiang Univ. - Sci. B 19, 630–642. https://doi.org/10.1631/
Renerre, M., 1990. Review: factors involved in the discoloration of beef meat. Int. J. Food jzus.B1700352.
Sci. 25, 613–630. https://doi.org/10.1111/j.1365-2621.1990.tb01123.x.

10