KAGARAMA SECONDARY SCHOOL

Biology Question and answers

SCHOOL YEAR 20202

TEACHER: CONSTANTIN HABUKUBAHO

Page 1
Biology questions and answers collected from different biology books especially: Biology
coursebook, 4th and Biology in context for
nd
Cambridge international AS & A LEVEL, 2 edition, 2014 by Glenn and Susan TOOLE, and
other questions from many sources.

Note:This document contains more than700 questions and answers. Most of the questions
are followed by their answers.

1. The electron micrograph shown below shows part of a secretory cell from the pancreas.
The secretory vesicles are Golgi vesicles and appear as dark round structures. The
magnification is X8000.
a) Copy and complete the table. Use a ruler to help you find the actual sizes of the
structures. Give your answers in micrometers.
Structure Observed diameter Actual size
(measured with a ruler)
Maximum diameter of a Golgi
vesicle
Maximum diameter of nucleus
Maximum length of the labeled
mitochondrion
b) The mitochondria in pancreatic cells are mostly sausage-shaped in three dimensions.
Explain why some of the mitochondria in the electron micrograph below appear
roughly circular.

c) The figure below shows a diagram based on an electron micrograph of a secretory

cell from the pancreas. This type of cell is specialized for secreting (exporting)
proteins. Some of the proteins are digestive enzymes of the pancreatic juice. The cell
is very active, requiring a lot of energy. The arrows show the route taken by the
protein molecules.

Page 2
 i. Describe what is happening at each of the stages A, B, C and D.
ii. Name one molecule or structure which leaves the nucleus by route E.
iii. Through which structure must the molecule or structure you named in ii pass
to get through the nuclear envelope?
iv. Name the molecule which leaves the mitochondrion in order to provide
energy for this cell.
2.
a) 1 mark for each accurately measured ‘observed size’ (to within ±2 mm) and 1 mark for
each accurately calculated ‘actual size’; 1 mark for applying the formula; 1 mark for
measuring in mm and converting mm to μm for each calculation; 1 mark for rounding up
actual size to no more than one decimal place.
b) mitochondria will appear circular if they are cut, in transverse section / across (the long
axis);
c)
i. A protein made on the ribosome is moving into the rough ER; B rough ER buds
off small vesicles; vesicles fuse to form the Golgi body; (therefore) protein moves
into Golgi body; protein may be modified / processed inside Golgi body; C Golgi
body buds off Golgi vesicles; D Golgi vesicles travel to cell surface membrane;
Golgi vesicle(s) fuses with cell surface membrane; protein / enzyme leaves cell;
exocytosis / secretion.
ii. Ribosome / messenger RNA.
iii. Nuclear pore.
iv. ATP.
3. State the property of water that allows each of the following to take place and, in each
case, explain its importance.
a) The cooling of skin during sweating
b) The transport of glucose and ions in a mammal
c) Much smaller temperature fluctuations in lakes and oceans than in terrestrial (land-
based) habitats.

4.
Property Importance
a) Cooling of Water requires a Heat energy which is transferred to

Page 3
 skin during relatively large amount water molecules in sweat allows
sweating. of heat energy to them to evaporate from the skin,
evaporate – that is, water which cools down, helping to
has a high latent heat of prevent the body from overheating.
vaporization. A relatively large amount of heat
can be lost with minimal loss of
water from the body.
b) The transport Water is a good solvent. Needed for transport by diffusion or
of glucose active transport into, out of and
and ions in a within cells. Also for circulation in
mammal. blood so that nutrients can reach the
sites where they are needed.
Chemical reactions take place in
aqueous solution.
c) Much smaller Water has a high A more constant environment
fluctuations (specific) heat capacity. results, protecting organisms from
in lakes and extremes of temperature which
oceans than could be harmful.
in terrestrial
habitats.

5. The diagram below shows a dissacharide called lactose. The carbon atoms are numbered.
You are not expected to have seen this structure before. Lactose is a reducing sugar found
in milk. It is made from a reaction between glucose and galactose.

a) Suggest two functions that lactose could have.

b) What is the name given to the reaction referred to above that results in the formation
of lactose.
c) Identify the bond X in the diagram.
d) Draw diagrams to show the structures of separate molecules of glucose and galactose.
e) Using information in the diagram, is the alpha or beta form of glucose used to make
lactose? Explain your answer.
f) Like lactose, sucrose is a disaccharide. If you were given a solution of lactose and a
solution of sucrose, state briefly how you could distinguish between them.
6.
a) Lactose could be a source of energy; it could be digested to, monosaccharides / glucose
and galactose, which could then be used as building blocks for larger molecules;

Page 4
 b) Condensation
c) Glycosidic bond
d) Glucose correctly drawn; galactose correctly drawn;Carbon atoms need not be
numbered. Note that galactose will probably be drawn ‘upside down’ as in the
disaccharide – the conventional way of drawing it is also shown in the diagram above.
The form used to make the disaccharide is the beta form of galactose, but students will
not need to know this, other than for interest.

e) Alpha glucose / α-glucose; the –OH group on carbon atom 1 is below the ring
f) Carry out a Benedict’s test on both solutions; lactose would give a brick-red / brown
precipitate, sucrose would not; accept positive result for lactose, negative result for
sucrose.
7. The diagram below shows the structures of three amino acids

a) Draw a diagram to show the structure of the tripeptide with the following sequence:
Alanine-glycine-serine
b) What is the name given to the sequence of amino acids in a protein?
c) What substance, apart from the tripeptide, would be formed when the three amino
acids combine?
d) Draw a ring around an atom or group of atoms making up an R group that could
hydrogen bond with a neighbouring R group.
e) Draw a ring around and label the peptide bond (s) you have drawn in the diagram.
8.
a)

Page 5
 b) Primary structure
c) Water
d) Ring drawn around –OH or whole R group (–CH2OH) of serine
e) Rings drawn around two peptide bonds and bonds labeled appropriately
9. Copy and complete the table below, which summarizes some of the functional categories
into which proteins can be placed.
Category Example
Structural
Enzyme
Insulin
Hemoglobin and myoglobin
Defensive
Actin and myosin
Storage

10.
Category Example
Structural Collagen; keratin; elastin
Enzyme Amylase, catalase…
Hormone Insulin
Transport of respiratory gases Hemoglobin and myoglobin
Defensive Antibodies, fibrinogen
Contractile Actin and myosin
Storage casein / ovalbumin

11. The diagram below shows an enzyme and two inhibitors of the enzyme, X and Y. Which
of the following describes the two inhibitors?

Page 6
 X and Y are competitive inhibitors.
X and Y are non-competitive inhibitors.
X is a competitive inhibitor and Y is a non-competitive inhibitor.
X is a non-competitive inhibitor and Y is a competitive inhibitor.
12. X and Y are non-competitive inhibitors.
13. The diagram shows part of a membrane containing a channel protein. Part of the protein
molecule is shaded.

a) Identify the parts labeled A, B and C.

b) Explain how ions would move through the channel protein.
c) State two features that the channel proteins and carrier proteins of membranes have in
common.
d) State one structural difference between channel and carrier proteins.
e) Calculate the magnification of the drawing.
14.
a) A phosphate head (of phospholipid); B fatty acid tail(s) (of phospholipid); C
phospholipid bilayer / membrane;
b) Ions move by diffusion; channel has shape which is specific for particular ion; channel is
hydrophilic / water-filled / allows movement of polar substance; ions move down
concentration gradient;
c) Both intrinsic proteins; both have specific shape;
d) Channel proteins have a fixed shape / carrier proteins have a variable shape;
e) Width of C measured in mm; mm converted to μm and μm converted to nm; correct
formula used magnification: M = I/A = width of C /7 accept mm, μm or nm; correct
answer in nm.
15. Copy the table below and place a tick or cross in each box as appropriate.
Process Uses energy in Uses proteins Specific Controllable
the form of ATP by cell
Diffusion
Osmosis
Facilitated diffusion
Active transport
Endocytosis and
exocytosis

16.

Page 7
 17. Copy and complete the table below to compare cell walls and cell membranes.
Feature Cell wall Cell
membrane
Is the thickness normally measured in nm or µm?
Location
Chemical composition
Permeability
Function
Fluid or rigid
18.
Feature Cell wall Cell membrane
Is the thickness μm nm
normally measured
in nm or µm?
Location surround some cells / not animal surround all cells / may be
cells / only outside found inside cells
/ surrounding cells
Chemical contains cellulose in plants, phospholipids, protein,
composition peptidoglycans / murein in (sometimes) cholesterol
prokaryotes, (chitin in fungi) /
contains a strengthening
material / contains a
polysaccharide
Permeability freely permeable Partiallypermeable
Function Mechanical strength Selective barrier
Fluid or rigid rigid fluid
19. In the mitotic cell cycle of a human cell:

Page 8
 a) How many chromatids are present as the cell enters mitosis?
b) How many DNA molecules are present?
c) How many kinetochores are present?
d) How many chromatids are present in the nucleus of each daughter cell after mitosis
and cell division?
e) How many chromatids are present in the nucleus of a cell after replication of DNA?
20.
a) 92 chromatids
b) 92 DNA molecules (each chromatid contains one DNA molecule)
c) 92 kinetochores
d) 46 chromatids
e) 92 chromatids
21. Distinguish between the following terms: centrosome, centriole and centromere.
22. The centrosome is a microtubule organizing centre; makes spindle during mitosis;
contains two centrioles; located just outside nucleus; centriole has 9 triplets of
microtubules; centromere is region of a chromosome that holds two 2 chromatids
together; point of attachment for microtubules during mitosis; point of attachment of
chromatids to spindle.
23. There are 20 different amino acids which cells use for making proteins.
a) How many different amino acids could be coded for by the triplet code? (Remember
that there are 4 possible bases, and that the code is always read in just one direction
on the DNA strand.)
b) uggest how the spare triplets might be used
c) Explain why the code could not be a two-letter code.
24.
a) 64
b) For ‘punctuation marks’ – that is, for starting or stopping the synthesis of a
polypeptide chain. Also, some amino acids could be coded for by two or three
different base triplets.
c) A two-letter code could only code for 16 amino acids.
25. Copy and complete the following table to distinguish between the processes of
transcription and translation.
Transcription Translation

Site in cell where process occurs

Molecule used as a template in process
Molecule produced by the process
Component molecule (monomers) used
in process
One other molecule that is essential for
the process to occur

Page 9
 26.
Transcription Translation

Site in cell where process occurs nucleus ribosome (in cytoplasm)

Molecule used as a template in DNA (in cytoplasm) Molecule used as a
process template in the process is mRNA
Molecule produced by the process mRNA polypeptide / protein
Component molecule (monomers) RNA Amino acids
used in process nucleotides
One other molecule that is RNA tRNAs / enzymes
essential for the process to occur polymerase / ribosomal RNA (rRNA)
/ ribosomal protein

27. The drawing shows a polyribosome

a) Name X, Y and Z.
b) In which direction are the ribosomes moving? Explain how you were able to decide
on their direction of movement.
28.
a) X is mRNA; Y is the ribosome; Z is the (poly)peptide chain / chain of amino
acids.
b) From left to right; increasing length of polypeptide chain.
29. In the 1940s, Chargaff and his co-workers analyzed the base composition of the DNA of
various organisms. The relative numbers of the bases adenine (A), cytosine (C), guanine
(G) and thymine (T) of three of these organisms are shown in the table.
Relative numbers of bases
A C G T
Ox (spleen) 27.9 20.8 22.7 27.3
Ox (thymus) 28.2 21.2 21.5 27.8
Yeast 31.3 17.1 18.7 32.9
Virus with single-stranded 24.3 18.2 24.5 32.3
DNA
Explain why:
a. The relative numbers of each base in ox spleen and thymus are the same, within
experimental error.
b. The relative numbers of each base in yeast are different from those in ox spleen or
thymus.
c. The relative numbers of each base A and T, or C and G, are similar in ox and yeast.

Page 10
 d. In the virus, the relative numbers of each base A and T, or C and G, are not similar.
30.
a) The DNA in the spleen and thymus of the same organism is the same; the same
genes are present in both organs;
b) The DNA in different species is different; different genes are present;
c) DNA has double helix / is double stranded; the numbers of A and T, and of C and
G, are similar because A pairs with T and C pairs with G.
d) The DNA is single stranded; no base pairing occurs.
31. Arrange the following in order of water potential. Use the symbol to mean greater than
Dry atmospheric air; mesophyll cell; root hair cell; soil solution; xylem vessel contents.
32. Soil solution > root hair cell > xylem vessel contents > mesophyll cell > dry atmospheric
air.
33. The graph below shows the relationship between the rate of transpiration and the rate of
water uptake for a particular plant.

a) Define the term transpiration.

b) State two environmental factors which are most likely to be responsible for the
changes in transpiration rate shown in the graph above.
c) Describe the relationship between the rate of transpiration and the rate of water
uptake shown in the graph above.
d) Explain the relationship.
34.
a) The loss of water vaporfrom the leaves / from the surface of a plant.
b) Light intensity; temperature.
c) Rate of water uptake shows the same pattern as rate of transpiration; but there is a
time delay, with changes in rate of transpiration occurring before changes in water
uptake.
d) Transpiration causes water uptake; loss of water (by transpiration) sets up a water
potential gradient in the plant; water potential in roots is lower than water potential in
soil; therefore water enters plant through roots; time delay between rate of
transpiration and rate of water uptake is due to time taken for effect of transpiration to
be transmitted through the plant.
35. Translocation of organic solutes takes place between sources and sinks.
a) Briefly explain under what circumstances:

Page 11
 i. A seed could be a sink
ii. A seed could be a source
iii. A leaf could be a sink
iv. A leaf could be a source
v. A storage organ could be a sink
vi. A storage organ could be a source
b) Suggest two possible roles for glucose in each of the following sinks:
i. A storage organ
ii. A growing bud.
36.
a)
i. When seed is forming / just after fertilisation;
ii. Germination;
iii. Young immature leaf / leaf that is still growing;
iv. Mature photosynthesising leaf;
v. When food is being accumulated / when storage organ is growing (in size) /
developing / end of plant’s growing season / just before winter;
vi. When plant starts to grow (using food from the storage organ);
b)
i. To make starch; respiration;
ii. To make cellulose; respiration;

37. Use the dissociation curve on the figure below to answer these questions.

a) The partial pressure of oxygen in the alveoli of the lungs is about 12 KPa. What is the
percentage saturation of hemoglobin in the capillaries in the lungs?
b) If 1g of fully saturated hemoglobin is combined with 1.3 cm3 of oxygen, how much
oxygen will 1g of hemoglobin in the capillaries in the lungs combine with?
c) The partial pressure of oxygen in an actively respiring muscle is about 2kpa. What is
the percentage saturation of hemoglobin in the capillaries of such a muscle?
d) How much oxygen will 1g of hemoglobin in the capillaries of this muscle be
combined with?
38.

Page 12
 a) 96.5%
b) 1.25 cm3
c) 24.0%
d) 0.31 cm3
39. In a healthy adult human, the amount of hemoglobin in 1dm3 of blood is about 150g.
a) Given that 1g of pure hemoglobin can combine with 1.3 cm3 of oxygen at body
temperature, how much oxygen can be carried in 1 dm3 of blood?
b) At body temperature, the solubility of oxygen in water is approximately 0.025 cm3 of
oxygen per cm3 of water. Assuming that blood is mostly water, how much oxygen
could be carried in 1 dm3 of blood if there if there was no hemoglobin?
40.
a) 195 cm3
b) 25 cm3
41. The figure below shows the general layout of the circulatory system of a fish.

a) How does this differ from the circulatory system of a mammal?

b) Suggest the possible advantages of the design of the mammalian circulatory system
over that of a fish.
42.
a) The fish has a single circulatory system, whereas the mammal has a double
circulatory system. In the fish, blood leaves the heart and travels to the gills,
where it picks up oxygen, before continuing around the body. In the mammal, the
blood returns to the heart after picking up oxygen at the lungs, and is then pumped
around the body.
b) Oxygenated blood can be pumped around the body at a higher pressure, and
therefore faster, in a mammal than in a fish, because pressure is lost in the
capillaries in the gills. This can provide a more efficient oxygen supply to
mammalian cells than to fish cells.
43. Which of the following could, or could not, be carried out by a red blood cell? In each
case, briefly justify your answer.
a) Protein synthesis
b) Lipid synthesis

Page 13
 c) Cell division
d) Active transport
44.
a) Protein synthesis – no. There is no DNA, so no mRNA can be transcribed.
b) Cell division – no. There are no chromosomes, so mitosis cannot occur, nor are
there centrosomes for spindle formation.
c) Lipid synthesis – no. This occurs on the smooth endoplasmic reticulum, and there
is none.
d) Active transport – yes. This occurs across the cell surface membrane, and can be
fuelled by ATP produced by anaerobic respiration.
45.
a) We have seen that capillary walls are not very permeable to plasma proteins. Suggest
where the protein in tissue fluid has come from.
b) The disease kwashiorkor is caused by a diet which is very low in protein. The
concentration of proteins in blood plasma becomes much lower than usual. One of the
symptoms of kwashiorkor is edema. Suggest why this is so.
46.
a) Protein in tissue fluid comes from the cells making up the tissues, many of which
secrete proteins.
b) If plasma protein concentrations are low, water will not be drawn back into
capillaries from tissue fluid. Albumin in the blood plasma raises its solute
concentration (lowers its water potential), thus helping to draw water back from
the tissue fluid into capillaries. If albumin could diffuse out of capillaries into
tissue fluid, more water would accumulate in the tissue fluid. (This is called
oedema.)
47. Mount Everest is nearly 9000 m high. The partial pressure of oxygen in the alveoli at this
height is only about 2.5 KPa. Explain what effect this would have on the supply of
oxygen to body cells if a person climbs to the top of Mount Everest without a
supplementary oxygen supply.
48. Less oxygen would enter the blood by diffusion, and therefore less oxygen would be
carried to the body cells. The percentage saturation of hemoglobin will be only about
30%.
49. Explain how an increase in the number of red blood cells can help to compensate for the
lack of oxygen in the air at high altitude.
50. At high altitude, the percentage saturation of the hemoglobin is relatively low. If the
number of red blood cells is increased, then the number of hemoglobin molecules is also
increased. Even though the percentage saturation of the hemoglobin is low, the fact that
there is more of it can increase the actual quantity of oxygen carried in the blood.
51. Athletes often prepare themselves for important competitions by spending several months
training at high altitude. Explain how this could improve their performance.
52. Spending a length of time at high altitude stimulates the body to produce more red blood
cells When the athlete returns to sea level, these ‘extra’ red blood cells remain in the
body for some time and can supply extra oxygen to muscles, enabling them to work
harder and for longer than they would otherwise be able to do.
53. Carbon dioxide is transported in the blood in various forms.
a) Describe how carbon dioxide molecules reach blood cells from respiring cells. The
diagram below shows part of a capillary network and some cells of the surrounding
tissue.

Page 14
 b) State three ways in which the blood at Y differs from the blood at X other than in the
concentration of carbon dioxide.
c) An enzyme in red blood cells catalyzes the reaction between carbon dioxide and
water as blood flows through respiring tissues.

i. Name the enzyme that catalyzes this reaction.

ii. Explain the significance of this reaction in the transport of carbon dioxide.
d) The graph below shows the effect of increasing the carbon dioxide concentration on
the oxygen dissociation curve for hemoglobin.

i. State the percentage saturation of hemoglobin with oxygen at a partial

pressure of 5 kpa when the partial pressure of carbon dioxide is 1.0 kpa.
ii. The percentage saturation of hemoglobin with oxygen decreases as the partial
pressure of carbon dioxide increases. Explain how this happens.
iii. Name the effect of increasing carbon dioxide concentration on the oxygen
dissociation curve.
iv. Explain the importance of the effect of carbon dioxide on hemoglobin as
shown in the graph above.

Page 15
 54.
a) Reference to diffusion; down concentration gradient; through the wall of a capillary.
b) Lower pressure; lower concentration of oxygen; lower concentration of glucose; lower
water potential; lower concentration of proteins / amino acids / fatty acids / other named
nutrient; higher concentration of urea.
c)
i. Carbonic anhydrase.
ii. Hydrogencarbonate ions diffuse out of red blood cells; (hydrogencarbonate ions)
are transported in solution in blood plasma; conversion of CO2 to
hydrogencarbonate reduces concentration of CO2 in the blood; which maintains
diffusion gradient for CO2 to diffuse into the blood from respiring tissues.
d)
i. 73%.
ii. Presence of carbon dioxide causes affinity of hemoglobin for oxygen to decrease;
hydrogen ions (from the dissociation of H2CO3) bind with hemoglobin; cause
change in shape of Hb molecule.
iii. Bohr effect
iv. Causes more release of oxygen (than if this effect did not occur); in respiring
tissues; where demand for oxygen is high / where production of carbon dioxide is
high.
55. Mammals have a closed, double circulation.
a) State what is meant by the term double circulation.
The figure below shows part of the circulation in a mammalian tissue. The central
part is enlarged to show a capillary, a cell supplied by the capillary, and vessel Z.

b) Explain why the wall of the artery is thicker than the wall of a vein.
c) Suggest one role for the pre-capillary sphincter muscle shown in the figure.
d) With reference to the figure, describe the role of capillaries in forming tissue fluid.
e) Describe three ways in which plasma differs from tissue fluid.
f) Name the fluid in vessel Z.
56.

Page 16
 a) Blood goes through the heart twice on one complete circuit of the body.
b) Has more smooth muscle / elastic tissue; to withstand higher (blood) pressure; to
withstand fluctuating (blood) pressure;
c) To prevent blood flowing into the capillary bed / to divert blood to other capillary
beds;
d) Permeable walls / reference to pores in walls; allow water / dissolved ions / dissolved
substances (from plasma) to pass out; do not allow large protein molecules / cells to
pass out; reference to greater hydrostatic pressure inside capillary than in tissue fluid.
e) (plasma contains) more proteins; has lower water potential; has lower, carbon
dioxide / HCO3- concentration; has greater glucose concentration; has greater oxygen
concentration.
f) Lymph.
57. The figure below shows the pressure changes in the left atrium, left ventricle and aorta
throughout two cardiac cycles.

a) How long does one heart beat (one cardiac cycle) last?
b) What is the heart rate represented on this graph, in beats per minute?
c) The contraction of muscles in the ventricle wall causes the pressure inside the
ventricle to rise. When the muscles relax, the pressure drops again. Make a copy of
the diagram and mark the following periods.
i. The time when the ventricle is contracting (ventricular systole)
ii. The time when the ventricle is relaxing (ventricular diastole).
d) The contraction of muscles in the wall of the atrium raises the pressure inside it. This
pressure is also raised when blood flows into the atrium from the veins, while the
atrial walls are relaxed. On your copy of the diagram, mark the following periods:
i. The time when the atrium is contracting (atrial systole)
ii. The time when the atrium is relaxing (atrial diastole)
e) The atrioventricular valves open when the pressure of the blood in the atria is greater
than in the ventricles. They snup shut when the pressure of the blood in the ventricles

Page 17
 is greater than in the atria. On your diagram, mark the pints at which these valves will
open and close.
f) The opening and closing of the semilunar valves in the aorta depends in a similar way
on the relative pressures in the aorta and ventricles. On your diagram, mark the points
at which these valves will open and close.
g) The right ventricle has much less muscle in its walls than the left ventricle, and only
develops about one-quarter of the pressure developed on the left side of the heart. On
your diagram, draw a line to represent the probable pressure inside the right ventricle
over the 1.3 seconds shown.
58.
a) About 0.75 seconds;
b) 60 ÷ 0.75 = 80 beats per minute
c) Forc, d, e, fand g, see figure below.

59. The diagram below shows a cross-section of the heart at the level of the valves.

a) Copy and complete the following flowchart to show the pathway of blood through the
heart.

Page 18
 b) Explain how the valves P and Q ensure one-way flow of blood through the heart.
60.
a) Right ventricle; pulmonary vein
b) They open to allow blood to flow from atria to ventricles; they close during
ventricular systole / when ventricles contract; reference to closure being caused
by differences in pressure in atria and ventricles.
61. The figure shows photomicrographs of alveoli from 1 a non smoker (x200) and 2 a
smoker (x50).

a) Use the photomicrographs to describe how the lungs of this smoker differ from the
lungs of the non-smoker
b) Smokers whose lungs contain alveoli similar to those shown in photomicrograph 2
have poor health.
i. Describe the symptoms that these people may have.
ii. Explain how the structure of the lungs is responsible for this poor health.
62.
a) Fewer alveoli; larger air spaces; fewer capillaries; scar tissue in, bronchioles / bronchi;
few / no, cilia; few / no, goblet cells; enlarged mucous glands; enlarged smooth muscle;
may be pre-cancerous / cancerous cells; tumor / bronchial carcinoma;
b)
i. Difficulty breathing / breathlessness; wheezing; tiredness; not able to do (much)
exercise.
ii. Small(er) surface area for gas exchange; less oxygen absorbed; poor oxygenation of
the blood; bronchi / bronchioles / airways, blocked by mucus; increased resistance to
flow of air.
63. The diagram below shows two cells from the lining of the trachea.

Page 19
 a) Name the cells P and R.
b) The structures S, T, U and W
c) Explain why cell P contains many of the structures labeled T
d) Explain the role of structure U in cell R.
e) Calculate the actual length of cell P. Show your working.
f) Describe the roles of cell P and cell R in the gas exchange system.
64.
P – ciliated epithelial cell; R – goblet cell.
a)
S – Cilium / cilia; T – mitochondrion; U – Golgi body; W – nucleolus.
b)
c)
T / mitochondria, provide, energy / ATP; for movement of cilia;
d)
U / Golgi apparatus, packages proteins into vesicles; for secretion.
e)
Award 2 marks for the correct answer. If answer is incorrect, award 1 mark for
the correct working. Length of cell P on page = 73 mm = 73 000 μm
Magnification = ×750
Actual length = 73 000 ‚ 750 = 97 μm
f) Cell P – cilia beat / move back and forth; move mucus; upwards / towards throat;
cell R – secretes mucus; mucus traps, dust / bacteria / viruses / pollen; prevents
entry to, alveoli / gas exchange surface.
65. The composition of alveolar air remains fairly constant even though gases are exchanged
with the blood in the capillaries that surround the alveoli.
a) Describe the process of exchange between alveolar air and blood.
b) Explain why the composition of alveolar air remains fairly constant.
c) Suggest three ways in which the gas exchange system responds to the demands of
oxygen.
66.

Page 20
 a) Oxygen diffuses down its concentration gradient; from alveolar air into red blood
cells; carbon dioxide diffuses down its concentration gradient; from, red blood cells /
plasma, to alveolar air; across epithelial cells of alveolus and endothelium of
capillary;
b) Breathing / ventilation; introduces, fresh air / atmospheric air; removes, stale air / air
rich in carbon dioxide;
c) Increase depth of breathing; rate of breathing; expansion of alveoli to give a larger
surface area; diameter of airways.
67. Cigarette smoke contains tar, nicotine and carbon monoxide. Tar contains carcinogens.
a) Describe the effect of tar on the lining of the bronchi in the lungs.
b) Describe the effects of nicotine and carbon monoxide on the cardiovascular system.
68.
a) Tar stimulates, goblet cells / mucous glands, to secrete more mucus; paralyses /
destroys, cilia; mucus not moved up the, bronchioles / bronchi / trachea / airways;
mucus accumulates in the airways; bacteria multiply within the airways; (leads
to) chronic bronchitis; tar contains, carcinogens / named carcinogen; e.g.
benzpyrene (tar) settles on bronchial, epithelial cells / epithelium; mutation(s) /
change to DNA; growth of tumor; bronchial carcinoma / lung cancer;
b) Nicotine: increases heart rate; increases blood pressure; increases chance of blood
clotting / promotes thrombosis; decreased flow of blood to, extremities / fingers /
toes.
Carbon monoxide: combines (irreversibly) with hemoglobin; forms
carboxyhemoglobin; reduces oxygen carrying capacity of, hemoglobin / blood;
damages lining of arteries; promotes atherosclerosis.
69. Explain the meaning of the term autoimmune disease.
70. Autoimmune diseases are caused by the immune system producing antibodies against
self-antigens.
71. Copy and complete the table below to show how much ATP is used and produced for
each molecule of glucose respired in the various stages of respiration.
ATP used ATP Net gain in
produced ATP
Glycolysis
Link reaction
Krebs cycle
Oxidative phosphorylation
Total
72.
ATP used ATP Net gain in
produced ATP
Glycolysis -2 +4 +2
Link reaction 0 0 0
Krebs cycle 0 +2 +2
Oxidative phosphorylation 0 +34 +34
Total -2 +40 +38

73.
a) Explain why the energy value of lipid is more than twice that of carbohydrate.
b) Explain what is meant by respiratory quotient (RQ).

Page 21
 c) Copy and complete the table to show the respiratory substrates with each of the given
RQs.
Respiratory substrate RQ
1.0
0.7
0.9

d) Measurements of oxygen uptake and carbon dioxide production by germinating seeds

in a respirometer showed that 25cm3 of oxygen was used and 17.5cm3 of carbon
dioxide was produced over the same time period.
i. Calculate the RQ for these seeds.
ii. Identify the respiratory substrate used by the seeds.
74.
a) Lipid has more hydrogen atoms per molecule than does a carbohydrate; most energy
liberated in aerobic respiration comes from the oxidation of hydrogen to water.

75.
a) Explain what is meant by a limiting factor.
b) List four factors that may be rate-limiting in photosynthesis.
c) At low light intensities, increasing the temperature has little effect on the rate of
photosynthesis. At high light intensities, increasing the temperature increases the rate
of photosynthesis. Explain these observations.
76.
a) Limiting factor: one factor, of many affecting a process, that is nearest its lowest value
and hence is rate-limiting.
b) Light intensity; light wavelength; concentration of carbon dioxide; temperature.

Page 22
 c) Shows that there are two sets of reactions in photosynthesis; a light dependent
photochemical stage; a light independent temperature-dependent stage; photochemical
reactions are not affected by temperature; at low light intensities, light intensity is the
rate-limiting factor; at high light intensities and low temperatures, temperature is the rate
limiting factor.
77. The control of blood glucose concentration involves a negative feedback mechanism.
a) What are the stimuli, receptors and effectors in this control mechanism?
b) Explain how negative feedback is involved in this homeostatic mechanism.
78.
a) Stimuli: changes in concentration of blood glucose above and below the set point;
receptors: the α and β cells in the islets of Langerhans in the pancreas; effectors: the
cells that change the glucose concentration in the blood by absorbing it from the
blood or release it into the blood; these are liver and muscle cells.
b) The blood glucose concentration fluctuates about a set point. In negative feedback, a
change stimulates a response that brings things back to normal. In the homeostatic
control of blood glucose, an increase in the concentration stimulates mechanisms that
reduce the concentration, and a decrease in the concentration stimulates mechanisms
that increase it. These corrective actions restore the blood glucose concentration to its
set point.
79. The control of the water content of the blood is an example of homeostasis.
a) Name the part of the body that monitors the water potential of the blood.
In an investigation of the factors that influence urine production, a person drank one
liter of water The person’s urine was collected at half-hourly intervals for four hours
after drinking. The results are shown as line A on the figure. On the following day,
the same person drank one liter of a dilute salt solution and the urine was collected in
the same way (line B). Dilute salt solution has about the same water potential as
blood plasma.

Page 23
 b) Calculate how much urine was produced in the two hours after drinking the liter of
water.
c) Explain why the person produced so much urine after drinking the liter of water.
d) Suggest why the results during the second day were so different from those on the
first day.
e) Explain why negative feedback, and not positive feedback, is involved in homeostatic
mechanisms.
80.
a) Hypothalamus
b) 1555 cm3 (or any answer within the range 1150 to 1160 cm3 or equivalent in dm3).
c) Any four from: water was absorbed into the blood; water increases the water potential of
the plasma; any effect of an increase in water potential of the plasma on, cells / tissues,
e.g. water enters cells by osmosis / cells will swell / decreases efficiency of reactions
inside cells / cells may burst; osmoreceptors detect increase in water potential; do not,
secrete / release, ADH; collecting ducts remain impermeable to water; excess water lost
in urine; until water potential returns to, normal / set point.
d) (after absorption of dilute salt solution) no change in water potential of blood plasma;
water and salt are not lost in the urine, so must remain in the body; giving an increase in
volume, of blood or body fluids; body tolerates changes in blood volume, but not its
water potential.
e) Homeostasis is the maintenance of, (near) constant internal conditions / internal
conditions within narrow limits. Negative feedback: a deviation from the set point; is
detected by a receptor; a control center instructs effector to carry out a corrective action;
to reverse the change / return factor to set point. Positive feedback: any (small) deviation
in a factor leads to an increase in the change (not a reversal).
81. An investigation was carried out to determine the response of pancreatic cells to an
increase in the glucose concentration of the blood. A person who had been told not to eat
or drink anything other than water for 12 hours then took a drink of a glucose solution.
Blood samples were taken from the person at one hour intervals for five hours, and the
concentration of glucose, insulin and glucagon in the blood were determined. The results
are shown in the graph below:

Page 24
 a) Explain why the person was told not to eat or drink anything other than water for 12
hours before having the glucose drink.
b) Use the information in the figure to describe the response of the pancreatic cells to an
increase in the glucose concentration.
c) Outline the role of insulin when the glucose concentration in the blood increases.
d) Suggest how the results will change if the investigation continued longer than five
hours without the person taking any food.
e) Outline the sequence of events that follows the binding of glucagon to its membrane
receptor on a liver cell.
82.
a) Glucose concentration may already be high; if person had eaten within 12 hours; effect of
sudden increase would not be seen / so there was a sudden increase; may already be a
high concentration of insulin.
b) β cells secrete insulin; concentration of insulin increases over first hour after taking the
glucose solution; insulin concentration increases from 60 to 300 pmol dm−3; α cells do
not secrete glucagon; glucagon concentration, remains constant / decreases; from 42 to
36 pmol dm−3;
c) Insulin: stimulates, liver / muscle, cells; increase in uptake of glucose from the blood;
more glucose transporter molecules insert into the cell surface membrane of muscle cells
(not liver cells); stimulates enzymes; to increase conversion of glucose to glycogen;
brings about a decrease in the blood glucose concentration.
d) Blood glucose concentration decreases (below 4 mmol dm–3); insulin concentration,
remains constant (at 60 pmol dm–3) / decreases (below 60 pmol dm–3); glucagon
concentration increases (above 60 pmol dm–3); glucose concentration then increases.

Page 25
 e) Membrane receptor activates the conversion of ATP to cyclic AMP; cyclic AMP
activates glycogen phosphorylase enzymes; glycogen phosphorylase catalyses the
breakdown of glycogen to glucose; glucose diffuses out of the (liver) cell into the blood.
83. The figure below shows the changes in potential difference across the membrane of a
neuron over a period of time. The membrane was stimulated at time A and time B with
stimuli of different intensities.

a) Stimulus b resulted in an action potential. Describe what is occurring at C, D and E.

b) Suggest why stimulus A did not result in an action potential being produced whereas
stimulus b did.
84.
a) C: sodium ions, diffuse in / enter (the neuron); either depolarization / described as the
inside of the membrane becoming more positive or less negative; D: potassium ions,
diffuse out (from the neuron); either depolarization / described as the inside of the
membrane becoming more negative or less positive; E: refractory period;
hyperpolarization occurs / inside of the membrane is more negative than resting potential.
b) The generator (or receptor) potential in A was not above the threshold (potential); in B it
was above the threshold (potential).
85. The electron micrograph shows parts of some myofibrils in a striated muscle that is in a
relaxed state.

Page 26
 a) Name the parts labeled K, L and M.
b) How many myofibrils are visible in the electron micrograph?
c) There are many glycogen granules and mitochondria visible in the electron
micrograph. Explain why there are both there.
d) Describe how you can tell that this electron micrograph is from a relaxed muscle and
not a contracted muscle.
e) The electron micrograph is magnified 20,000 times. Calculate the actual length of the
sarcomere which includes the region labeled K. Give your answer in micrometers
(µm).
86.
a) K: A band; L: I band; M: Z line / disc.
b) 5; the myofibrils are separated from each other by mitochondria.
c) Glycogen granules are broken down to provide glucose for respiration; mitochondria,
carry out aerobic respiration / provide much ATP (for muscle contraction).
d) There is a very wide I band; in the I band there is no overlap between thick and thin
filaments; in contracted muscle the thin filaments would be closer together giving a thin I
band.
e) Distance = 54 mm (accept 53 mm) = 54,000 µm

87. The diagrams show a sarcomere in different states of contraction.

Page 27
 a) Name the parts labeled P, Q and R.
b) Explain why there are no actin-myosin cross-bridges visible in diagram A.
c) Muscle fibers are able to contract with more force in some stages of contraction than
others. Suggest which of the diagrams shows the state that can develop the greatest
force, and explain the reasons for your answer.
d) Explain why the muscle shown in diagram D would not be able to contract any
further.
e) A muscle can contract with force, but it cannot pull itself back to its original relaxed
length.
i. With reference to the mechanism of muscle contraction, explain why this is so.
ii. Suggest how the muscle in diagram D could be returned to the state shown in
diagram A.
88.
a) P: myosin / thick filament; R: actin / thin filament; Q: Z line / disc.
b) The muscle is relaxed; the troponin and tropomyosin molecules are covering the myosin-
binding sites on the actin / thin filaments; myosin cannot bind to actin to form
crossbridges.
c) Diagram C; greatest overlap between thick and thin filaments; maximum number of
cross-bridges can form between thick and thin filaments; greatest force applied by
movement of myosin heads; in the state shown in diagram D the sarcomere cannot
shorten any more.
d) The sarcomere cannot shorten any more, without crumpling the thick and thin filaments;
the thin filaments cannot move any closer together / thick filament has reached the Z line.
e)
i. The myosin heads can only tilt in one direction. They are arranged so that when
they do this they pull on the thin filaments in such a way that the sarcomere is
shortened; they cannot pull (or push) the thin filaments the other way.
ii. Most skeletal muscles are arranged in antagonistic pairs; contraction of an
antagonist pulls on the muscle so sarcomeres lengthen; thin filaments slide past
thick filaments to give, less overlap between them / wider I band; for example
when the biceps is contracted and shortened it can be pulled back into its longer
state by contraction of the triceps muscle.

Page 28
 89. A biopsy was taken from a leg muscle of a healthy racehorse. The muscle fibers were
teased apart and cross-sections were taken from one of the muscle fibers. These cross-
sections were examined with a transmission electron microscope. The figure below
shows drawings made from three different cross-sections of a myofibril from the muscle
fiber.

a) Explain the difference from the sections X, Y and Z. You may draw a labelled
diagram to illustrate your answer.
b) The sections were taken from a relaxed muscle fiber. Suggest how the sections would
appear if taken from a fiber that had contracted to its maximum extent. Explain your
answer.
c) Muscle weakness in racehorses may sometimes be related to a deficiency of calcium.
Outline the roles of calcium ions in the coordination of muscle contraction.
90.
a) The diagram shows (TS) of sarcomere / myofibril / thick and thin filaments; X shows,
actin / thin filaments alone; see diagram below. Y shows myosin / thick filaments alone;
see diagram below. Z is overlap between thick and thin filaments; see diagram below. X
is I band; Z is (overlap region of) A band; Y is H zone; each thick filament is surrounded
by six thin filaments. The thick filaments form crossbridges with all of them.

b) If contracted muscle, then, no / little, I band and H zone; so there would be no section
like X and no section like Y; thin filaments are brought closer together by action of
myosin heads; thick and thin filaments slide over each other during contraction.
c) Role of calcium ions at the end of a motor neuron: at, neuromuscular junction / motor end
plate; voltage-gated channel proteins for calcium ions open when impulse arrives;
calcium ions enter / AW, when action potential arrives; stimulates vesicles to move
towards / fuse with pre-synaptic membrane; role of calcium ions in muscle: impulse /
action potential in sarcolemma / T-tubules, stimulates release of calcium ions from

Page 29
 sarcoplasmic reticulum; calcium ions bind to troponin; stimulates movement of
tropomyosin; myosin binding sites on thin filaments exposed; cross-bridges form; when
no action potential calcium ions pumped back into sarcoplasmic reticulum.
91. Copy and complete the table to show, for each hormone, the precise site of its secretion,
and its effects on the ovary or on the endometrium of the uterus.

Hormone Site of Effect(s) of hormone

secretion Ovary Endometrium
FSH None
LH None
Estrogens None
Progesterone None

92.

Page 30
 93. Diagram 1 shows the chromosomes in the nucleus of a diploid cell.

a) Draw the nucleus of a gamete produced from this cell.

b) What type of nuclear division would be used in the production of the gamete?
c) Draw a diagram to show what the nucleus would look like in anaphase of mitosis.
Diagram 2 and 3 below show the same diploid nucleus as in diagram 1. However, the
chromosomes have been shaded.

d) State what the different types of shading represent in each nucleus.

94.
a) One long, one short and one hooked chromosome present inside a circle (nucleus).
b) Meiosis
c) Six chromatids about half-way between equator and each pole (12 chromatids in all);
two long, two short, two hooked in each direction; centromere leading for each
chromatid.
d) In diagram 2, shading represent sets of chromosomes / one type of shading represents set
of chromosomes from mother, other type of shading represents set of chromosomes from
father; in diagram 3, shading represent homologous pairs of chromosomes / differently
numbered chromosomes.
95. In sweet-pea plants, the gene A/a controls flower colour. The dominant allele gives
purple flowers and the recessive allele red flowers. A second gen, B/b, controls the shape
of pollen grains. The dominant allele gives elongated grains and the recessive allele
spherical grains. A plant with the genotype AaBb was test-crossed by interbreeding it
with a plant with red flowers and spherical pollen grains. With a Punnet square, show the
expected ratio of phenotypes of the offspring of this cross.

Page 31
 96.

97.
a) Name the causative agent of tuberculosis.
b) Explain how tuberculosis is transmitted.
c) State the regions of the world with the highest number of cases of tuberculosis.
d) Suggest reasons for the high number of tuberculosis in some parts of the world.
98.
a) Mycobacterium tuberculosis; accept Mycobacterium bovis.
b) Infected person, coughs / sneezes / spits; aerosol / droplets, containing bacteria, breathed
in by uninfected person.
c) Sub-Saharan Africa; South-East Asia; countries of India / Pakistan / Afghanistan; South
America / Bolivia; Papua New Guinea.
d) TB linked with HIV infection; HIV weakens immune system; TB is an opportunistic
disease; as many people are infected although show no symptoms; transmission where
there is, overcrowding / poor housing; poverty; poor ventilation of housing; poor
nutrition; poor access to health care; poorly organized treatment for people with TB.
99. The table shows the number of cases of cholera and deaths from the disease for the five
countries with the greatest outbreaks as reported to the WHO in 2010.
Country Region Total number Number Case fatality
of cases of deaths rate %
Haiti Caribbean 179 379 3 990
Cameroon West Africa 10 759 657 6.10
Nigeria 44 455 1 712 3.85
Democratic 13 884 182 1.31
Republic of Congo
Papua New Guinea Australasia 8 997 95 1.06
Total All regions of 317 534 7 543 2.38
the world
a) Describe how cholera is transmitted.
b) With reference to the table:
i. Calculate the case fatality rate for Haiti in 2010.

Page 32
 ii. Suggest why the case of fatality rate varies between countries.
iii. Explain why it is important that the WHO collects data on outbreaks of
cholera.
c) Explain why there no epidemics of cholera in highly economically developed
countries such as Australia, Malaysia and USA.
100.
a) Bacteria pass out in feces of infected person; carried in, water / food, consumed by
uninfected person.
b)
i. 2.22
ii. Treatment for cholera involves supply of oral rehydration therapy (ORT); and
provision of safe drinking water; better response to emergencies (in some countries);
effectiveness of response may depend on number of cases; ref to very high number of
cases in Haiti; may depend on remoteness of regions affected by cholera; or ways in
which, emergency supplies / personnel, can reach affected areas; ref to high case
fatality rates in, Nigeria / Cameroon; use of data to compare case fatality rates in
individual country with global rate.
iii. Cholera is a serious disease; death can occur very quickly after infection; spreads
quickly in population (especially after a disaster); deaths are avoidable; if ORT is
available immediately; data is useful to predict, situations / places, where cholera may
occur; WHO can coordinate responses to outbreaks.
c) Water supply is not contaminated with (human), sewage / feces; piped water / water
supply is treated to kill bacteria; V. cholera destroyed in sewage treatment.
101. Explain the difference between artificial active immunization (vaccination) and
artificial passive immunization.
102. Artificial active: antigens are introduced into the body by injection or by mouth, and
stimulate an immune response by B and T cells. This provides long-term immunity but is
not immediate, as the immune response takes several weeks to become effective.
Artificial passive: antibodies are injected into the body to give immediate protection
against a pathogen or toxin. Antibodies are soon removed from circulation and no
immune response has occurred, so this is a temporary form of immunity.
103. Explain the difference between natural immunity and artificial immunity.
104. Natural immunity is immunity gained by being infected (active) or by receiving
antibodies from the mother across the placenta or in breast milk (passive). Artificial
immunity is gained either by vaccination (active) or by injecting an immune serum
containing antibodies (passive).
105. Which eukaryotic kingdoms contain:
a) Autotrophic organisms
b) Heterotrophic organisms
c) Make a table to compare the features of the four kingdoms of eukaryotes.
106.
a) Protoctista and Plantae
b) Protoctista, Fungi and Animalia
c)

Page 33
 107. List five ways in which the molecular structure of glycogen and amylopectin are
similar.
108.
 Macromolecules/polymers
 Polysaccharides
 Made from α-glucose
 Glucose units held together by 1,4 links (glycosidic bonds formed by condensation)
 Branches formed by 1,6 links.
109. Make a table to show three ways in which the molecular structure of amylose and
cellulose differ.
110.

Page 34
 111. In peas, the allele for colored seed (C) is dominant over the allele for colorless seed
(c). The allele for starchy endosperm (W) is dominant over the allele for waxy endosperm
(w). Pure breeding plants with colored seeds and starchy endosperm were crossed with
pure breeding plants with colorless seeds and waxy endosperm.
a) State the genotype and the phenotype of the F1 individuals as a result of this cross.
b) The F1 plants were crossed with plants that had the genotype ccww. Calculate the
expected ratio of phenotypes in the F2 generation, assuming that there is independent
assortment.
c) The observed percentages of phenotypes in the F2 generation are shown below:
Colored starchy 37 % Colorless starchy 14 %
Colored waxy 16 % Colorless waxy 33%
Explain the reasons for the observed results of the cross differing significantly
from the expected results.
112.
a) CcWw; all are colored starchy.
b) CcWw x ccww
Gametes are CW, Cw, cW, cw and cw.
Gametes CW Cw cW cw
cw CcWw Ccww ccWw ccww
Genotypes are CcWw, Ccww, ccWw and ccww; 1 colored starchy: 1 colored
waxy: 1 colorless starchy: 1 colorless waxy.
c) Linkage / genes are on the same chromosome / genes do not assort independently;
colored starchy and colorless waxy are parentals.
113. Using the CR and CW alleles for codominance in snapdragon flower color, show
how two plants could have some white flowered offspring, some pink-flowered
offspring and some red-flowered offspring within one generation.
114. CRCW x CRCW
Gametes CR , CW andCR , CW
Punnet square
Gametes CR CW
R R
C R
C C CRCW
CW CRCW CWCW
Phenotypes: 25 % white-flowered plants; 25 % red-flowered plants and 50 % pink-
flowered plants.
115. The diagram below shows the pedigree of a family with red-green color blindness,
a sex linked condition.

Page 35
 a) Define the term sex linkage.
b) Deduce, with a reason, whether the allele producing the condition is dominant or
recessive.
c) Determine all the possible genotypes of the individual (2nd generation-1) using
appropriate symbols.
d) Determine all the possible genotypes of the individual (3rd generation-4) using
appropriate symbols.
116.
a) A gene / trait / allele carried on a sex chromosome / X or Y.
b) Recessive. Evidence from the pedigree (e.g. 2nd generation-2 and -3 do not have
the condition but have one child who does).
c) XaY (where a = condition)
d) XAXa or XAXA where A = normal and a = condition.
117. In most people, the first amino acids in their β-globin polypeptide chains are:

Page 36
 The DNA triplet for the sixth amino acid (Glu) in most people is CTT. In some people
this DNA triplet is CAT.
a) What type of mutation is the change from CTT to CAT?
b) Use the genetic code below to identify the amino acid in the β-globin polypeptide
chains of people with this mutation.
c) State the consequences for a person of having two copies of the mutated gene.
118.
a) gene mutation / substitution
b) Val / valine;
c) Sickle cell anemia.
119. Suggest why:
a) A mutation in which one nucleotide of a triplet code is altered often makes no
difference to the protein molecule coded by the DNA.
b) The addition or deletion of three nucleotides in the DNA sequence of a gene often
has less effect on the encoded protein than the addition or deletion of a single
nucleotide.
120.
a) Many amino acids have more than one triplet code; so sequence of amino acids is
unchanged;
b) Adding or deleting three nucleotides may add or remove the coding for one amino
acid; this may not affect the final shape of the protein; adding or deleting one
nucleotide affects the arrangement of all subsequent triplets; this ‘frameshift’ may
alter the coding of all amino acids following the addition or deletion; a triplet may
be altered to a stop signal;

121. The diagram summarizes how glucose can be used to produce ATP, without the
use of oxygen

Which compounds are represented by the letters X, Y and Z?

122. X is pyruvate; Y is lactate and Z is ethanol (or ethyl alcohol).
123. Can a man with haemophilia pass on the disease to:
a) His son?
b) His grandson?
124.
a) No. The son will receive a Y chromosome from his father, which cannot carry a
hemophilia allele.
b) Yes. The man could pass on his hemophilia allele to a daughter, who could then
pass it on to a son.

Page 37
 125. One of the genes for color vision in humans is found on the X chromosome but not
on the Y chromosome. The dominant allele of this gene gives normal color vision,
whereas a recessive allele produces red-green colorblindness.
a) Choose suitable symbols for these alleles, and then write down all the possible
genotypes for a man and a woman.
b) A couple who both have normal color vision have a child with colorblindness.
Explain how this can happen, and state what the sex of the colorblind child must
be.
c) Is it possible for a color-blind girl to be born? Explain your answer.
126.
a) Suitable symbols could be: N allele for normal color vision; n allele for red-green
color blindness; XNXNnormal female; XNXncarrier (normal) female; XNY normal
male; XnY male with color blindness.
b) XNXn and XNY
Gametes are XN; Xn and XN; Y
Gametes XN Y
XN XNXN XNY
Xn XNXn XnY
1 Normal female: 1 normal (carrier) female: 1 normal male: 1 male with
colorblindness.
This can happen if the woman is heterozygous. The affected child will be male.
c) Yes, if the mother has at least one allele for color blindness, and the father has
colorblindness.
127. One of the genes for color vision in cats is sex-linked. The allele A gives orange
fur, whereas the allele B gives black. The two alleles are codominant, and when both
are present the cat has patches of orange and black, which is known as tortoiseshell.
a) Explain why male cats cannot be tortoiseshell.
b) Draw a genetic diagram to show the expected genotypes and phenotypes of the
offspring from a cross between an orange male and a tortoiseshell female cat.
128.
a) Male cats cannot be tortoiseshell, because a tortoiseshell cat has two alleles of this
gene. As the gene is on the X chromosome, and male cats have one X chromosome
and one Y chromosome, then they can only have one allele of the gene.
b) Let A be the allele of orange and B the allele of black fur.
An orange male will have a genotype of XAY whereas a female tortoiseshell has a
genotype of XAXB
The gametes are XA; XB and XA; Y
The punnet square is shown below
Gametes XA Y
A A A
X X X XAY
XB XAXB XBY
Phenotypic ratio: 1 Orange female: 1 tortoiseshell female: 1 orange male: 1 black
female.

Page 38
 129. Explain the contribution made to the variation among the offspring of this cross
AaDd x aadd by:
a) Independent assortment
b) Random fertilization
130.
a) Independent assortment results from the random alignment of the pairs of
homologous chromosomes on the equator during metaphase I. It ensures that the
chromosomes carrying the A or a alleles behave quite independently from those
carrying the D or d alleles. This means that allele A can end up in a gamete with
either D or d, and allele a can also end up in a gamete with either D or d. Thus
independent assortment is responsible for the fact that each parent can produce
four different types of gamete, AD, Ad, aD and ad.
b) Random fertilization means that it is equally likely that any one male gamete will
fuse with any female gamete. This results in the 16 genotypes shown in the square.
Thus random fertilization is responsible for the different genotypes of the offspring
and the ratios in which they are found.
131. In a species of plant, the allele for tall stem is dominant to short. The two alleles
for leaf color, giving green or white in the homozygous condition, are codominant,
producing variegated leaves in the heterozygote.
A plant with tall stems and green leaves was crossed with short stems and variegated
leaves. The offspring from this cross consisted of plants with tall stems and green
leaves and plants with tall stems and variegated leaves in the ratio 1:1. Construct a
genetic diagram to explain this cross.
132. Let T represent the allele for tall stem, t the allele for short stem, G the allele for
green leaves and W the allele for white leaves.
The Parental genotype at TTGG and ttGW
Gametes are TG and tG; tW
tG tW
TG TtGG TtGW
Phenotypic ratio: 1 plant with tall stems and green leaves: 1 plant with tall stems and
variegated leaves.
133. In a species of animal, it is known that the allele for black eyes is dominant to the
allele for red eyes, and that the allele for long fur is dominant to the allele of short fur.
a) What are the possible genotypes for an animal with black eyes and long fur?
b) How could you find out which genotype this animal had?
134.
a) Let B represents the allele for black eyes and b represents the allele for red eyes, L
represents the allele for long fur and l represents the allele for short fur, then the four
possible genotypes of an animal with black eyes and long fur are: BBLL, BbLL,
BBLl and BbLl.
b) Perform a test cross – that is, breed the animal with an animal showing both recessive
characteristics. If the offspring show one of the recessive characteristics, then the
‘unknown’ genotype must be heterozygous for that characteristic

Page 39
 135. Pure-breeding Drosophila with straight wings and grey bodies were crossed with
pure-breeding curled-wing, ebony bodied flies. All of the offspring were straight-
winged and grey-bodied. Female offspring were then test-crossed with curled-wing,
ebony-bodied males, giving the following results.
Straight-wing, grey body 113
Straight-wing, ebony body 30
Curled-wing, grey body 29
Curled-wing, ebony body 115
a) State the ratio of phenotypes expected in a dihybrid test cross such as this.
b) Explain the discrepancy between the expected result and the results given.
c) Calculate the crossover value.
136.
a) 1 : 1 : 1 : 1
b) Linkage; that is the two loci are on the same chromosome. The alleles for grey
body and straight wings are on one homologous chromosome in the heterozygote
and the alleles for ebony body and curled wings are on the other homologous
chromosome. There is linkage with crossing over.
c)
137.
a) State three variables that must be controlled as far as possible if comparing
transpiration rates from two different plants.
b) Suggest how you could measure the volume of water lost from the leaves during
an experiment to measure the rate of transpiration.
138.
a) Possible variables are: total leaf area; temperature; light intensity; air movement;
humidity.
b) The reservoir could be calibrated so that the volume could be measured when re-
setting the meniscus at the end of the experiment. The reservoir could be
substituted with a graduated syringe to make this easier. Alternatively the diameter
of the capillary tube opening could be measured and the volume calculated from
the distance travelled by the meniscus.
139. Suggest why:
a) Impulses travel in only one direction ay synapses
b) If action potentials arrive repeatedly at a synapse, the synapse eventually becomes
unable to transmit the impulse to the next neuron.
140.
a) At the synapse, vesicles of transmitter substance are only present in the
presynaptic neuron, not in the postsynaptic neuron.
b) Repeated action potentials may cause the release of transmitter substance into the
cleft at a greater rate than it can be replaced in the presynaptic neuron. Effectively,
the neuron has no more transmitter substance until enough is resynthesized.
141. Explain why variation caused by the environment cannot be passed from an
organism to its offspring.
Page 40
 142. Characteristics are passed from parents to offspring in their genes. Variation
caused by the environment does not change the DNA of an organism.
143.
a) Distinguish between continuous and discontinuous variation.
b) Explain the genetic basis of continuous variation.
144.
a) Continuous variation is quantitative and there are no distinguishable classes of, say,
height or mass. There is a range of height or mass between two extremes.
Discontinuous variation is qualitative and falls into clearly distinguishable classes,
with no intermediates.
b) In continuous variation, different alleles of a gene have small effects on the phenotypic
characteristic, different genes may have the same, often additive effect and many
genes may be involved (polygenes). In discontinuous variation, different alleles of a
gene have large effects and different genes have quite different effects on the
phenotypic characteristic.
145.
a) State and explain the second law of Mendel.
b) Manx cats do not have tails. When a Manx cat is mated with a normal long tailed
cat, approximately half the offspring are long tailed and approximately half are
Manx. When two Manx cats are mated, the ratio of phenotypes of the offspring is 2
Manx to 1 long tailed cat.
i. What does this suggest of the Manx condition in cats?
ii. Show the inheritance of Manx condition when two Manx cats are mated.
146.
a) Mendel’s second law is the law of independent assortment The law of independent
assortment states that: anyone of a pair of characteristics may combine with either
one of another pair.
b)
i. The Manx condition suggests that it is a lethal allele. Lethal alleles are
alleles that cause an organism to die only when present in homozygous
condition.
ii. Let M be the allele of the Manx condition and m be the allele of normal
long tail.
The genotype of a Manx cat will be Mm
Parents Mm x Mm
Gametes M, m and M, m
Punnet Square

Offspring phenotypes: 2 Manx: 1 long tailed cat.

Page 41
 147.
a) Draw a simple flow diagram of the Calvin cycle to show the relative positions in
the cycle of the following molecules:
CO2
Phosphoglycerate/PGA
G3P/PGAL/Triose phosphate
RuBP
b) Show the point at which the enzyme rubisco is active.
148. A and b

149. Name any five differences between the nervous system and the endocrine system.
150.
Feature Nervous system Endocrine
system
Method of Electrical hormones
communication impulses
Pathway neurons (direct to target cells) in blood (plasma) throughout the
whole body
Speed of Fast slow
communication
Duration of short (e.g. muscle contracts for a long (e.g. minutes, hours or
effects short time) days)
Response Muscle contraction or release of many responses such as
a secretion conversion of glucose to glycogen,
protein synthesis,
increase in rate of respiration

Target area localized – only the area whole tissue or organ; some
immediately at the end of a hormones affect
neuron the whole body

151.

Page 42
 a) Name the process by which vesicles release their contents at the presynaptic
membrane.
b) Describe the role of acetylcholinesterase.
152.
a) Exocytosis
b) Acetylcholinesterase catalyzes the hydrolysis of acetylcholine so it does not
remain in the synaptic cleft continuously stimulating the postsynaptic neuron. If it
did, muscle cells would be continuously stimulated to contract – a condition
known as tetany.
153. Name the three subclasses of mammals. Give the subclasses of each of the
subclasses.
154. The subclass monotremes which include the egg-laying mammals, the subclass
marsupials which include mammals with a pouch and placental mammals which give
rise to fully formed offspring.
155. Explain why the phylum arthropoda is the most successful among all groups of
animals.
156. The arthropods have the following characteristics which help them to be
successful:
 They have an exoskeleton which helps to reduce the water loss.
 The exoskeleton also protects them against the predators because it is hard.
 The exoskeleton helps them in camouflage.
 The arthropods are able to live in water (crustaceans), on land (arachnids,
centipedes and millipedes) and in air (insects).
 Most undergo metamorphosis (in complete metamorphosis, adults and larvae
do not compete for food and space).
157. List any three differences between the light dependent reactions and the light
independent reactions of photosynthesis.
158.
Light dependent reactions Light independent reactions
Occur in the thylakoid membrane of the Occur in the stroma of the chloroplast
chloroplast
Use light energy to form ATP and Use ATP and NADPH to form the sugar
NADPH
Splits water in photolysis to provide Return ADP, inorganic phosphate and
replacement of electrons and to release NADP to the light dependent reactions.
oxygen in the atmosphere.
Include two electron transport chains and Involves the Calvin cycle
photosystem I and II.

159.

Page 43
 a) Copy and complete the table to show the differences between mesophyll and
bundle sheath cells in C4 plants. Insert a tick when an item is present in the cell
and a cross when it is not
Item Mesophyll cell Bundle sheath cell
PEP carboxylase
Rubisco
RuBP
Enzymes of Calvin cycle
High concentration of oxygen
Light dependent reactions
Contact with air spaces
b) Explain what is meant by photorespiration.
160.
a)

b) Photorespiration: rubisco catalyzes the combination of RuBP and oxygen; the

result is an overall intake of oxygen and loss of carbon dioxide. There is no
production of ATP and no production of food.
161. Distinguish between:
a) Cyclic and non cyclic photophosphorylation
b) Photophosphorylation and oxidative phosphorylation
c) The roles of NAD and NADP in a plant.
162.
a) Cyclic photophosphorylation: electron emitted by chlorophyll of photosystem I
returns to chlorophyll by a series of carriers;

Page 44
 Non cyclic photophosphorylation: electron emitted by chlorophyll of photosystem
II does not return to that chlorophyll (but is absorbed by photosystem I and
electron emitted by photosystem I is absorbed by NADP).The electron lost by
chlorophyll is replaced by the electron from the photolysis of water.
b) Photophosphorylation: synthesis of ATP using light energy in photosynthesis in a
chloroplast; oxidative phosphorylation: synthesis of ATP using energy released
from the electron transport chain in aerobic respiration in a mitochondrion.
c) NAD: hydrogen carrier in respiration; NADP: hydrogen carrier in photosynthesis.
163. State the roles in respiration of:
a) NAD
b) Coenzyme A
c) Oxygen
164.
a) NAD: a hydrogen carrier molecule: it accepts a hydrogen from one reaction and
donates it to another.
b) Coenzyme A: a carrier of an acetyl group from the link reaction to the Krebs
cycle.
c) Oxygen: the final electron acceptor and hydrogen ion acceptor in oxidative
phosphorylation: the oxygen is reduced to water.
165. Using ideal ATP numbers, how many ATPs would an individual generate if they
consumed only pyruvate and carried one pyruvate molecule through cellular
respiration?
166. 12 ATP are generated by the Krebs cycle and the electron transport chain. A further
3 ATP are generated from the NADH formed in the link reaction. So a total of 15 ATP
would be produced.
167. How are the products of the light-dependent reactions important to the light-
independent reaction?
168. ATP and NADPH are produced in the light-dependent reactions. In order for the
Calvin cycle of the light-independent reaction to occur, both of these products are
essential. ATP provides energy, while NADPH allows for the reduction of various
compounds.
169. Explain the final products of the two photosystems involved in the light dependent
reactions of photosynthesis.
170. Photosystem II results in the production of ATP. Photosystem I results in the
production of NADPH. Photolysis of water is associated with photosystem II thus
providing electrons to this photosystem and allowing the release of oxygen to the
atmosphere.
171. The energy flow diagram below for a temperate ecosystem has been divided into
two parts. One part shows autotrophic use of energy and the other shows heterotrophic
use of energy. All values are in KJ m-2 yr-1.

Page 45
 a) Calculate the net production of the autotrophs.
b)
i. Compare the percentage of heat lost through respiration by the autotrophs
with that of heterotrophs.
ii. Most of the heterotrophs are animals. Suggest one reason for the difference
in heat losses between the autotrophs and animal heterotrophs.
The heterotrophic community can be divided into food webs based upon
decomposers and food webs based upon herbivores. It has been shown that of the
energy consumed by the heterotrophs 99% is consumed by the decomposers.
c) State the importance of decomposers in an ecosystem.
d) Deduce the long term effect of sustained pollution which kills decomposers on
autotrophic activity.
172.
a) 19 580 KJ m-2 yr-1 (units required).
b)
i. Autotrophs lose 55 % of their gross production to heat compared with the
heterotrophs which lose 96 % of their food energy / 41 % more of food
energy is lost by heterotrophs. (Numerical comparison required).
ii. Animals use a lot of energy to move / for maintenance of body temperature
/ other valid reasons.
c) Decomposers are responsible for the recycling of (inorganic) nutrients / breakdown
of organic molecules to inorganic compounds.
d) Autotrophs need nutrients (from soil). Decomposers release these nutrients. Fewer
decomposers will lead to slower/less recycling of nutrients.
Limits growth of autotrophs.
Limits (net/gross) productivity of autotrophs.

173. The weight of the fruit in a certain variety of squash is determined by allelic pairs
for two loci: AABB produces fruits that average 2 kg each, and aabb produces fruits
that are 1 kg each. Each allele represented by a capital letter adds 0.25 kg. When a
plant that produces 2 kg fruits is crossed with a plant that produces 1 kg fruits, all of
the offspring produce fruits that that are 1.5 kg each. What would be the weights of the
fruits produced by the F2 plants if two of these F1 plants were crossed?
174. The expected types of F2 plants are:
1/16 of the plants produce 2 kg fruits.
1/4 of the plants produce 1.75 kg fruits.

Page 46
 3/8 of the plants produce 1.5 kg fruits.
1/4 of the plants produce 1.25 kg fruits.
1/16 of the plants produce 1 kg fruits.
175. A walnut-combed rooster is mated to three hens. Hen A, which is walnut-combed,
has offspring in the ratio 3 walnut: 1 rose. Hen B, which is pea-combed, has offspring
in the ratio of 3 walnut: 3 pea: 1 rose: 1 single. Hen C, which is walnut-combed, has
only walnut-combed offspring. What are the genotypes of the rooster and the three
hens?
176. The rooster is PpRr; hen A is PpRr, hen B is Pprr and hen C is PPRR.
177. The X-linked barred locus in chickens controls the pattern of feathers, with the
alleles B for barred pattern and b for no bars. If a barred female (XBY) is mated to a
non-barred male (XbXb), what will be the appearance of the male and female progeny?
(Recall that in birds males are homogametic and females are heterogametic).
Do you see any usefulness for this result? It is notoriously difficult to determine the
sex of newly hatched chicks.
178. All male offspring of this cross are barred and all females are non-barred, thus
allowing the see the genotype of the chicks to be determined by their phenotypes.
179. The diagram shows some of the processes that occur within a mitochondrion and
some of the substances that enter and leave it.

a) Name the process that:

i. Produces pyruvate in the cytoplasm
ii. Produces reduced NAD and carbon dioxide in the matrix of the
mitochondrion.
b) Describe how ATP is produced from reduced NAD within the mitochondrion.
180. The diagram summarizes the light independent reactions of photosynthesis

Page 47
 a) Copy the diagram and complete the four boxes to show the number of carbon
atoms in a molecule of each substance.
b) Where in the chloroplast does the light independent reactions take place?
c) Explain why the amount of GP increases after a photosynthesizing plant has been
in darkness for a short time.
d) Describe the role of water in the light dependent reactions of photosynthesis.
181.
a) RuBP: 5C; GP: 3C; Triose phosphate: 3C; Hexose: 6C
b) Stroma of the chloroplast
c) Store of RuBP converted to GP; no further ATP / NADPH arriving from the
light-dependent stage, so GP cannot be converted to triose phosphate.
d) Photolysis of water provides electrons to replace electrons emitted by
chlorophyll molecules when light absorbed; provides protons, which, with
electrons, reduce NADP; provides oxygen released as a waste product / used in
respiration.
182. The diagram shows chemical pathways involved in respiration and photosynthesis.

a) Name the process that produces pyruvate from glucose.

b) Name the compounds X and Y.
c) In which part of a chloroplast is glycerate-3-phosphate converted into ribulose
biphosphate?
d) Describe the role of ribulose biphosphate in photosynthesis.
183. The diagram shows the blood vessels which supply blood to and remove blood
from the liver.

a) Explain why the blood glucose concentration fluctuates more in the hepatic portal
vein than in the hepatic vein.
b) Which blood vessel has the lowest concentrations of hydrogencarbonate ions?
Give a reason for your answer.
c) Give the name of one excretory product found in bile.
184. In tomatoes, the allele for red fruit, R, is dominant to that for yellow fruit, r. The
allele for tall plant, T, is dominant to that for short plant, t. The two genes concerned
are on different chromosomes.

Page 48
 a) A tomato plant is homozygous for allele R. Giving a reason for your answer in
each case, how many copies of this allele would be found in:
i. A male gamete produced by this plant.
ii. A leaf cell from this plant.
b) A cross was made between two tomato plants.
i. The possible genotypes of the gametes of the plant chosen as the male
parent were RT, Rt, rT and rt. What was the genotype of this plant?
ii. The possible genotypes of the gametes of the plant chosen as the female
parent were rt and rT. What was the genotype of this plant?
iii. What proportion of the offspring of this cross would you expect to have red
fruit? Use a genetic diagram to explain your answer.
185.

186.

187. Consider the food chain in Kivu lake

Page 49
 Calculate the percentage efficiency of the transfer of energy between:
i. Primary consumers and secondary consumers
ii. Tertiary consumers and quaternary consumers
iii. Producers and quaternary consumers (6 marks)
188. The scatter graphs show values for x plotted against values for y.

State the letter of any graph or graphs that:

a) Indicate there could be a positive correlation.
b) Indicate that there is probably no correlation.
c) Indicate there is a linear correlation.
d) Indicate that pearman’s rank correlation could be used
e) Indicate that Pearson’s linear correlation could be used
189. Two neighbouring plant cells are shown below

Page 50
 a) In which direction would there be net movement of water molecules?
b) Explain what is meant by net movement.
c) Explain your answer to a.
d) Explain what would happen if both cells were placed in:
i. Pure water.
ii. A 1 mol.dm-3 sucrose solution with a water potential of -3510 KPa.
190.
a) From A to B
b) Water molecules can move from A to B and from B to A, but more move from A to B
in a given time period. Overall, therefore, A loses water and B gains water – the
overall movement is the net movement.
c) A has a higher water potential than B (−250 is less negative than −400) and water
always moves from regions of higher to lower water potential. Water crosses a
partially permeable cell surface membrane every time it enters or leaves a cell – this
process is called osmosis.
d)
i. Pure water has a water potential of zero, which is higher than that of cells A
and B. There is therefore a net movement of water into cells A and B by
osmosis through their partially permeable cell surface membranes. As
water enters, the volume of the protoplasts will increase, exerting pressure on
the cell walls and raising the pressure potential of the cells. This increases the
water potential of the cells. This will continue until an equilibrium is reached
when the contents of the cells reach the same water potential as the water,
namely zero. The cells will then be turgid.
ii. 1 mol.dm–3 sucrose solution has a lower water potential than that of cells A
and B. There is therefore a net movement of water out of cells A and B by
osmosis through their partially permeable cell surface membranes. As
water leaves the cells, the protoplasts shrink and the pressure they exert on the
cell walls drops; in other words, the pressure potential of the cells decreases.
This decreases the water potential of the cells. Eventually, the pressure
potential drops to zero and the cells are at incipient plasmolysis. As shrinkage
continues, the protoplasts pull away from the cell walls – this is
plasmolysis. The sucrose solution can pass freely through the permeable cell
walls and remains in contact with the protoplasts. As water leaves the cells, the
contents of the protoplasts get more and more concentrated and their water
potential gets lower and lower (more and more negative). Equilibrium is
reached when the water potential of the cells equals that of the sucrose
solution.
191. Trace the path of a protein from its site of synthesis to its final destination for the
following:
a) a secreted protein
b) a protein found inside a lysosome
c) a protein associated with the plasma membrane.

Page 51
 192. The table shows all the messenger RNA (mRNA) codons for the amino acid
leucine. Copy the table and write it in, for each codon, the transfer RNA (tRNA)
anticodon that would bind with it and the DNA triplet from which it was transcribed.
mRNA codon tRNA anticodon DNA triplet from which
mRNA was transcribed.
UUA
UUG
CUU
CUC
CUA
CUG
193.

194. An organelle is a discrete structure with a specific function within a cell. In the
table below, identify the missing organelles and outline the missing functions.
Name of Structure of organelle Function of
organelle organelle
Nucleus Region of the cell containing Storage and
chromosomes, surrounded by a double protection of
membrane, in which there are pores chromosomes.
Ribosome Small spherical structures consisting of
two subunits
Spherical organelles, surrounded by a Digestion of
single membrane and containing structures that are not
hydrolytic enzymes needed within cells
Organelles surrounded by two
membranes, the inner of which is folded
inwards
Page 52
 195.
Name of Structure of organelle Function of
organelle organelle
Nucleus Region of the cell containing Storage and
chromosomes, surrounded by a double protection of
membrane, in which there are pores chromosomes.
Ribosome Small spherical structures consisting of Protein synthesis
two subunits
Lysosomes Spherical organelles, surrounded by a Digestion of
single membrane and containing structures that are not
hydrolytic enzymes needed within cells
Mitochondria Organelles surrounded by two Cell respiration
membranes, the inner of which is folded
inwards

196. Complete the table below

DNA replication Transcription Translation
Location in the cell
Enzymes involved
End products

197.
DNA replication Transcription Translation
Location in Nucleus Nucleus In the cytoplasm on the
the cell ribosomes
Enzymes DNA polymerase RNA Aminoacyl-tRNA
involved polymerase synthetases
End products Two identical A strand of A polypeptide chain of
copies of DNA mRNA amino acids (a protein)

198. Fill in the following table

Animal Excretory organ Excretory substrate

Reptile
Paramecium
Earthworm
Cockroach

199.

Animal Excretory organ Excretory substrate

Reptile Kidneys Uric acid

Page 53
 Paramecium Cell membrane Ammonia
Earthworm Metanephridia Ammonia
Cockroach Malpighian tubules Uric acid

200.
a) Describe the immediate environment of a typical cell within the body of a
mammal.
b) Explain why it is important that the internal environment of a mammal is carefully
regulated.
c) Explain how the following are involved in maintaining the internal environment:
stimuli, receptors, central control, coordination systems and effectors.
d) Explain the meaning of the terms homeostasis and negative feedback.
e) Distinguish between the input and the output in a homeostatic control mechanism.
201.
a) The immediate surroundings of most cells in the body is tissue fluid. Blood cells,
however, are surrounded by plasma. The composition of tissue fluid is very similar
to that of blood plasma.
b) Cells function efficiently if they are kept in a constant environment. Maintaining
constant conditions, such as pH, temperature and water potential, ensures that
enzymes within cells may function at a constant rate.
c) Changes in physiological factors, such as temperature, are the stimuli that are
detected by receptors. Each homeostatic mechanism has a central control. The
hypothalamus is the central control for many homeostatic mechanisms.
Coordination systems transfer information from receptors to the central control and
from the central control to effectors. Information is transferred as nerve impulses
travelling along nerve cells and as hormones in the blood. Effectors are muscles and
glands that respond to information from the central control by changing the
physiological factor.
d) Homeostasis: the maintenance of (near) constant internal conditions or the
maintenance of internal conditions within narrow limits. Negative feedback: a
control process in which a change in a factor, such as body temperature, stimulates
corrective actions to return it to its normal value or its set point.
e) Input: sensory information from receptors about changes in physiological factors;
this information goes to a control center. Output: corrective actions carried out by
effectors that return the physiological factor to its normal value.
202.
a) Name the nitrogenous waste substances excreted by mammals.
b) Explain why it is important that carbon dioxide and nitrogenous wastes are
excreted and not allowed to accumulate in the body.
203.
a) Urea, uric acid, creatinine
b) Metabolic waste products are toxic (poisonous) and would damage the body if
they accumulated.

Page 54
 204.
a) Use the example of blood water content to explain the terms set point and
homeostasis.
b) Construct a flow diagram to show how the water potential of the blood is
controlled. In your diagram identify the following: receptor, input, effector and
output. Indicate clearly how different parts of the body are coordinated and show
how negative feedback is involved.
205.
a) The normal water potential of the blood is the set point; osmoreceptors compare the
water potential of the blood that flows through the hypothalamus with this set point. If
the water potential is less than the set point, then they secrete ADH to stimulate the
reabsorption of more water from collecting ducts in the kidney. This will help to
restore the water potential of the blood to normal. The water potential of the blood is
an internal condition that is kept constant. Keeping conditions like this constant is
homeostasis.
b) There are many possible ways in which this flow diagram could be constructed. It
should show input (change in water potential of the blood) to sensors (osmoreceptor
cells), resulting in secretion of ADH from posterior pituitary gland if water potential is
lower than the set point, thus producing output (change in rate of water reabsorption)
by the effectors (cells of the collecting ducts), and negative feedback to sensor.
206.
a) Name the process by which glucose enters and leaves cells.
b) Explain why:
i. Muscle cells do not have receptors for insulin.
ii. There are second messengers for insulin and glucagon.
iii. Insulin and glucagon have different second messengers.
207.
a) Facilitated diffusion
b)
i. Muscle cells need their glycogen stores to provide glucose for respiration; there is
no point in them releasing glucose into the circulation.
ii. Insulin and glucagon are proteins that cannot cross the cell surface membranes of
their target cells. There needs to be another substance (a second messenger) to
transmit their message throughout the cytoplasm.
iii. Insulin and glucagon both have liver cells as their target cells. If they had the same
second messenger, they would both have the same effect, rather than having
opposite effects on glycogen, for example.
208.
a) Explain why insulin cannot be taken by mouth.
b) Suggest how people with type 1 diabetes can monitor the effectiveness of the
insulin that they takes.
c) Suggest how people with type 2 diabetes can control their blood glucose.
209.

Page 55
 a) Insulin is a protein. Its molecules would be hydrolyzed to amino acids in the digestive
system.
b) People with type 1 diabetes are encouraged to test their blood or urine regularly for
glucose.
c) They can adjust their diet accordingly. They should eat small amounts of carbohydrate
fairly regularly, rather than large quantities at any one time. High-sugar foods such as
confectionery should be avoided, as these may result in a rapid and dangerous rise in
blood glucose concentrations. People with type 2 diabetes can also take exercise
frequently.
210. List:
a) Three organelles each lacking a boundary membrane
b) Three organelles each bounded by a single membrane
c) Three organelles each bounded by two membranes (an envelope)
211.
a) Nucleolus, ribosome, centrioles, centrosome, microtubule
b) Lysosomes, rough ER, smooth ER, Golgi body
c) Nucleus, mitochondrion, chloroplast
212. Identify each cell structure or organelle from its description below:
a) Manufactures lysosomes
b) Manufactures ribosomes
c) Site of protein synthesis
d) Can bud off vesicles which form the Golgi body
e) Can transport newly synthesized protein round the cell
f) Manufactures ATP in animal and plant cells
g) Controls the activity of the cell because it contains DNA
h) Carries out photosynthesis
i) Can act as the starting point for the growth of spindle microtubules during cell
division.
j) Contains chromatin
k) Partially permeable membrane only about 7 nm thick.
213.
a) Golgi body;
b) Nucleolus;
c) Ribosome;
d) ER / rough ER;
e) Rough ER;
f) Mitochondrion;
g) Nucleus;
h) Chloroplast;
i) Centrosome (accept centriole);
j) Nucleus;
k) Plasma membrane;
214. Distinguish between the following pairs of terms
a) Magnification and resolution
Page 56
 b) Nucleus and nucleolus
c) Light microscope and electron microscope
d) Chromatin and chromosome
e) Membrane and envelope
f) Smooth ER and rough ER
g) Prokaryote and eukaryote 1.6
215.
a) Explain the advantage of being able to adjust the diameter of bronchioles.
b) How many times does an oxygen molecule cross a cell surface membrane as it
moves from the air into a red blood cell?
216.
a) During exercise, the bronchioles are wider to allow more air to reach the alveoli to
supply the large quantities of oxygen needed during exercise and to remove
carbon dioxide.
b) Five – into and then out of a cell in the alveolar wall, into and then out of a cell in
the capillary wall, and then into a red blood cell.
217.
a) Which type of cell respiration is common to all types of cell respiration?
b) Where does this step of cell respiration take place in a cell?
c) Why does that make a sense?
d) Why do we inhale oxygen and exhale carbon dioxide?
218.
a) Glycolysis
b) In the cytoplasm.
c) All cells need some form of cell respiration and all have cytoplasm; only
eukaryotic cells have mitochondria.
d) The inhaled oxygen is distributed by blood to our body cells for cell respiration
and the by-product is carbon dioxide. Carbon dioxide is carried back to our lungs
and we breathe it out.
219. From the following information, construct a food web.
a)
 Grass is eaten by rabbits, grasshopper and mice.
 Rabbits are eaten by hawks.
 Grasshoppers are eaten by toads and mice and garter snakes.
 Mice are eaten by hawks.
 Toads are eaten by hognose snakes.
 Hognose snakes are eaten by hawks.
 Garter snakes are eaten by hawks.
b) From the above food web, determine the trophic level of the toad.
220. The diagram below summarizes the cell cycle.

Page 57
 a) G1, S and G2 are three stages of interphase. Describe any one event that occurs in
each stage.
b) What is meant by cytokinesis?
c) Describe any one event that occur on each of the four phases of mitosis.
d) State 4 differences between mitosis and meiosis.
221. The table below shows the molecules of oxygen, sodium ions and food particles in
the water surrounding an amoeba. Name the physiological process by which each of
them enters the cytoplasm of an amoeba.
Molecules Physiological process
Oxygen
Sodium ions
water
Food particle

222. List the blood vessels and organs in sequence as urea passes through them from
liver where it is made to the kidney where it is excreted.
223.
a) Define the following terms:
i. Vaccine
ii. Immunization
iii. Natural active immunity
iv. Artificial active immunity
v. Passive immunity
vi. Natural passive immunity
vii. Artificial passive immunity
b) For each of the following infectious diseases, describe the mode of transmission,
the symptoms of the disease, and the methods by which the incidence of the
disease can be reduced.
i. Cholera
Page 58
 ii. AIDS
224. The diagram below shows a vertical section through the human heart. The arrows
indicate the direction of movement of electrical activity, which starts heart muscle
contraction.

a) Name the structures A, B, C and D.

b) Explain why each of the following is important for pumping blood through the
heart.
i. There is a slight delay in the passage of electrical activity that takes place at point
B.
ii. The contraction of the ventricles starts at the base.
iii. Describe how stimulation of the cardiovascular center in the brain may result in an
increase in heart rate.
225.
a) The diagram below represents part of the ileum lining.

i. Name the structure represented above.

ii. Name the parts labelled S, T and L.
iii. Explain how the above structure is adapted to its function
b) Study the reaction below and then answer the questions that follow:
→
i. Name the compound X
ii. What is the significance of storing trypsin in the form of trypsinogen in the
pancreas?

Page 59
 226. Complete the following description of enzymes by adding the most appropriate
word or words in gaps.
a) Enzymes are biological catalysts which increase the rate of reaction by reducing
……………… needed for the reaction to take place
b) Enzymes are globular …… Which possess a region on their surface where binding
to a substrate occurs This region is called ………… The bonds which maintain
the tertiary structure of enzymes can be disrupted by factors such as ………… and
……… , reducing the catalytic action of enzymes
227. A netlike membrane complex of superposed flat saccule with vesicles detaching
from its extremities is observed during electron microscope.
a) Name the observed structure
b) What is its biological function?
228. Study the diagram below and answer the questions that follow:

a) Name the blood vessels labelled A, B and C.

b) If the animal has recently fed on a diet which is rich in proteins and carbohydrates
in which of the vessels labelled A, B and C would you expect to find the highest
concentration for each of the following:
i. Glucose
ii. Amino acids
iii. Carbon dioxide
iv. Oxygen
v. Urea
229. Name the hormones with the functions described below and the endocrine glands
that produce them.
a) That stimulates the production of red blood cells by the bonne marrow
b) Prepares the body for emergency situations
c) Lowers the blood calcium level.
d) Causes the reabsorption of water in the kidney.
e) Stimulates the production of LH
230. Which blood vessel in humans has:
a) The highest pressure
b) The highest oxygen concentration

Page 60
 c) The highest carbon dioxide concentration
d) The highest concentration of glucose following a meal?
231. The significance of vascularization of the endometrium before implantation in
mammals is to
a) Ensure the attachment of the fetus into the uterine wall.
b) Prevent menstruation.
c) Assist in producing hormones which maintain pregnancy.
d) Facilitate food and oxygen supply.
232. Which of the following structure is haploid?
a) Primary oocyte
b) Spermatogonium
c) Secondary oocyte
d) Germinal epithelium
233. In any ecosystem, a continued input of energy is required because
a) Matter is continuously used in metabolic process
b) Biological succession occurs very slowly.
c) Of the continued increase in population in the ecosystem
d) Energy is lost each time it is transferred between organisms
234. Which of the following organelles would most likely be abundant in the tail of a
tadpole at a time of its reabsorption during metamorphosis.
a) Centrioles
b) Lysosomes
c) Golgi apparatus
d) ER
235. An impulse crosses a synapse by means of
a) Sodium ions
b) Calcium ions
c) Potassium ions
d) Neurotransmitter chemical
236. Which of the following would contribute to the greenhouse effect?
a) Use of nuclear power
b) Use of fossil fuels
c) Excessive use of fertilizers
d) Accumulation of sewage in water bodies.
237. During the light stage of photosynthesis, water is an important raw material in that
it
a) Gives off oxygen
b) Provides hydrogen that reduces NADP+.
c) Reduces carbon dioxide to carbohydrates.
d) Provides electrons.
238. Which of the following would occur at the onset of an action potential?
Page 61
 a) Potassium ions enter
b) Sodium ions leave
c) Potassium ions leave.
d) Sodium ions enter.
239. The lack of a nucleus in the red blood cell enables it to
a) Have a high affinity for oxygen.
b) Be more permeable to oxygen.
c) Give up oxygen more readily.
d) Contains more hemoglobin.
240. The primary meristematic tissue in plants which gives rise to the cortex is the
a) Ground meristem
b) Procambium
c) Protoderm
d) Protoxylem
241. A rhesus positive fetus whose mother is rhesus negative may not be born alive
because the
a) Mother’s body produces antigens against fetal antibodies.
b) Fetus lacks antibodies against the mother’s antigens
c) Mother’s body produces antibodies against the fetal antigens
d) Mother’s red blood cells mix with the fetal blood
242. The tails of the phospholipids lie in the center of the cell membrane due to their
being
a) Light
b) Hydrophilic
c) Polar
d) Hydrophobic
243. Which of the following hormones helps to guard against miscarriage in pregnancy?
a) Estrogens
b) Progesterone
c) Oxytocin
d) Prolactin
244. Which of the following is correct about a natural semi-permeable membrane?
a) Does not allow the passage of solute molecules.
b) Always allow equal movement of water molecules to either side of the membrane.
c) Allows passage of the solvent molecule more than solute molecules.
d) Allows passage of solvent and solute molecules equally.
245. Which of the following mineral nutrients are constituents of chlorophyll?
a) Potassium and Sulphur.
b) Nitrogen and magnesium
c) Calcium and phosphorus
d) Zinc and copper.
Page 62
 246. A rat requires more energy per unit body weight than required by a human because
a rat
a) Has a larger surface area
b) Is more active
c) Has high body temperature
d) Has a high metabolic rate
247. Some amino acids are known as essential because they are
a) More important in the body metabolism than others.
b) Not made by the body.
c) Contained in first class proteins
d) Required in larger amounts than others.
248. Which one of the following hormones induces the liver to secrete non-enzymatic
substances used in digestion?
a) Thyroxine
b) Adrenaline
c) Secretin
d) Insulin
249. Which of the following does not play part in regulating the salt concentration of a
mammalian blood?
a) Kidney
b) Skin
c) Liver
d) Pituitary gland
250. Which of the following hereditary characteristics is known to be sex limited?
a) Hemophilia
b) Baldness
c) Albinism
d) Color blindness.
251. Which of the following is true of diploid parthenogenesis? The eggs are formed by
a) Meiosis and develop without fertilization
b) Mitosis and develop after fertilization.
c) Meiosis and develop after fertilization
d) Mitosis and develop without fertilization
252. In the mammalian menstrual cycle, the decline in the level of progesterone is due
to
a) Successful conception
b) Formation of corpus luteum
c) Degeneration of corpus luteum
d) Maturation of Graafian follicle
253. The products of the light reactions in photosynthesis are
a) NADH, ATP and O2.
Page 63
 b) NADP, ATP and O2.
c) NADPH, ADP and O2.
d) NADPH, ATP and O2.
254. Which one of the following stages of photosynthesis uses light energy directly?
a) Regeneration of ribulose biphosphate.
b) Production of energy in the form of ATP.
c) Reduction of carbon dioxide.
d) Formation of phosphoglyceric acid.
255. All of the following are stimulate by luteinizing hormone except
a) Proliferation of the uterine wall.
b) Development of the corpus luteum.
c) Stimulation of the corpus luteum to produce progesterone.
d) Ovulation.
256. Pancreatic juice contains the enzymes
a) Amylase, peptidase, trypsinogen
b) Amylase, pepsin, trypsinogen
c) Lipase, amylase, trypsinogen, peptidase
d) Lipase, amylase, pepsin, maltase
257. Which one of the following cell organelles would be most active at sites where
substances move against concentration gradients?
a) Ribosomes
b) Lysosomes
c) Mitochondria
d) Golgi bodies
258. In sexually reproducing organisms, maintenance of a species is achieved at meiosis
by
a) Halving DNA amount
b) Doubling DNA amount
c) Maintaining DNA amount
d) Increasing DNA amount by fourfold.
259. The two strands of DNA easily separate during replication because of the
a) Helical nature of nucleotides
b) The closeness of the base pairs
c) Weak hydrogen bonds between base pairs
d) The weak hydrogen bonds between phosphate and sugar.
260. Which one of the following is not correct about viruses? They
a) Can only reproduce in living cells.
b) Are the smallest living organisms.
c) Are facultative parasites.
d) Do not have a cellular structure.
261. Among the following compounds, one that cannot be hydrolyzed is
Page 64
 a) Glycogen
b) Galactose
c) Lactose
d) Maltose
262. Which one of the following substances are not transported in the mammalian
blood?
a) Urea and glucose
b) Insulin and pepsin
c) ATP and pepsin
d) Carbon dioxide and sodium chloride
263. The mycorrhizae on some plant roots serve to
a) Fix nitrogen from the atmosphere
b) Absorb mineral salts from the soil.
c) Break down humus.
d) Synthesize carbohydrates.
264. A mother who lacked milk in her breasts at the birth of her baby was diagnosed to
have a brain damage. Which one of the following parts of the brain is most likely to
have been affected?
a) Posterior lobe of the pituitary gland
b) Pineal body
c) Anterior lobe of the pituitary gland
d) Cerebrum.
265. Which one of the following processes does not require respiratory energy?
a) Synthesis of cellulose
b) Meiosis
c) Loss of water from the stomata
d) Mineral salt absorption
266. Which one of the following is characteristic of all vertebrates?
a) Homeothermy
b) A cranium
c) Double circulation
d) Pentadactyl limb
267. Which one of the following features are most useful to amphibians in living in an
aquatic habitat?
a) Moist skin, membrane around eggs and gills.
b) Membrane around eggs, gills and webbed feet.
c) Long hind limbs, short forelimbs and gills.
d) Webbed feet, moist skin and gills.
268. In which one of the following does anaerobic respiration not occur?
a) Skeletal muscle
b) Yeast cell
Page 65
 c) Bacteria
d) Smooth muscle
269. Which one of the following belongs to a different phylum?
a) Octopus
b) Scorpion
c) Millipede
d) Crab
270. Which one of the following features of red blood cells does not contribute to their
high absorptive nature of oxygen? They
a) Possess a thin flexible membrane
b) Possess a biconcave disc shape
c) Are filled with hemoglobin
d) Are manufactured at a high rate

Use the information below to answer question 270 and 271. In mice, yellow fur (Y) is
dominant over grey fur (y). When two mice were mated, the offspring were in the ratio of 2
yellow to 1 grey.

271. From the results, which of the following were the likely genotypes of the parents?
a) Both were homozygous dominant
b) Both were heterozygous
c) One was heterozygous and the other homozygous dominant
d) Both were homozygous recessive.
272. Which of the following best explains the results?
a) Double recessive allele for fur color is lethal.
b) Heterozygous condition for fur color is lethal.
c) Fur color could be sex linked
d) Double dominant allele for fur color is lethal.
273. Which one of the following hormones is secreted by the neurosecretory cells in
mammals?
a) Adrenaline
b) Antidiuretic hormone
c) Insulin
d) Thyroxin
274. The reproductive stage of Plasmodium in the liver is represented by the
a) Zygote
b) Gametocyte
c) Merozoite
d) Sporozoite
275. Which one of the following structures is responsible for initiating the contractions
of the heart?

Page 66
 a) Purkinje tissue
b) Atrio-ventricular node
c) Sino atrial node
d) Heart muscle
276. Which one of the following qualities of the guard cells least contributes to their
opening?
a) Uneven thickened wall.
b) Inner walls being less elastic than outer walls.
c) Presence of chloroplasts
d) Presence of vacuoles.
277. In which one of the following parts of the cell does most production of ATP occur?
a) Matrix of mitochondrion
b) Cristae of mitochondrion
c) Cytoplasm of cell
d) Outer membrane of mitochondrion
278. In which one of the following does a notochord exists?
a) Amphioxus
b) Hydra
c) Cockroach
d) Earthworm
279. Which one of the following is in the same phylum as the earthworm?
a) Millipede
b) Leech
c) Tapeworm
d) Roundworm
280. Which of the following substances consists of globular proteins?
a) Enzymes
b) Keratin
c) Elastin
d) Collagen
281. A person who walks unsteadily may have a defect in the
a) Cerebrum
b) Cerebellum
c) Medulla oblongata
d) Hypothalamus
282. What would be the phenotypes of children born on a color blind man and a normal
woman?
a) All normal
b) Only girls normal
c) Only boys colorblind
d) All colorblind
Page 67
 283. Which of the following animals has a double circulatory system?
a) Fish
b) Octopus
c) Frog
d) Squid
284. Which of the following is not homeostatically regulated in the body?
a) Glucose
b) Water
c) Carbon dioxide
d) Fat
285. To which one of the following phyla does a flatworm belong?
a) Nematode
b) Arthropoda
c) Platyhelminthes
d) Coelenterates
286. The organism that requires only inorganic raw material from the environment is
a) Virus
b) Amoeba
c) Euglena
d) Plasma
287. Which of the following vitamins is water soluble?
a) A
b) E
c) D
d) C
288. Which of the following describes the sodium-potassium pump?
a) Active pumping of potassium ions out of the axon and sodium ions into it.
b) Equal concentration of the ions on either side of the axon when it is at rest.
c) Inability of the axon to absorb the two ions passively.
d) Active pumping of sodium ions out of the axon and potassium ions into it.
289. Which one of the following is not an adaptation of animals living in deserts
environments?
a) Use of metabolic water
b) Ability to reduce filtrate volume
c) Possession of a long loop of Henle
d) Production of ammonia
290. Which one of the following is not a transmitter substance?
a) Acetylcholine
b) Cholinesterase
c) Atrophine
d) Noradrenaline
Page 68
 291. The lymphatic system is important in
a) Promoting blood clotting
b) Distribution of body heat
c) Transporting hormones around the boy
d) Draining excess tissue fluid into the blood circulatory system.
292. In the human brain, body temperature, metabolism, heart rate, sexual development,
sleep and the body's use of fat and water are influenced by this region of the brain.
This region of the brain is the:
a) Hypothalamus
b) Midbrain
c) Corpus callosum
d) Cerebellum
293. In most axons, the myelin sheath is interrupted at intervals of about 1 millimeter or
more. These interruptions are called the:
a) Glial
b) Nodes of Ranvier
c) Collaterals
d) Nodes of Babinet
294. Sickle cell anaemia and Huntington's chorea are both:
a) Virus-related diseases
b) Bacteria-related diseases
c) Congenital disorders
d) None of the above
295. Melatonin is produced by the:
a) Skin
b) Pineal gland
c) Liver
d) Pituitary gland
296. Which of the following statements is TRUE of insulin? Is it:
a) Secreted by the pancreas
b) A protein
c) Involved in the metabolism of glucose
d) All of the above
297. Select the hormone INCORRECTLY paired with its target.
a) TSH - thyroid gland
b) ACTH - anterior pituitary
c) LH - ovary or testis
d) MSH - melanocytes
298. Which of the following tissues secrete hormones?
a) Pancreas
b) Ovaries
c) Gastro-intestinal tract
d) All of the above
299. Which of the following do sperm NOT travel through?
a) Ureter
b) Urethra

Page 69
 c) Vas deferens
d) Epididymis
300. The placenta in humans is derived from the:
a) Embryo only
b) Uterus only
c) Endometrium and embryo
d) None of the above
301. Synapsis and crossing over of chromosomes occurs in which phases of meiosis?
a) Interphase
b) Prophase
c) Metaphase
d) Telophase
302. A layer of dead skin cells is found in the:
a) Subcutaneous tissue
b) Dermis
c) Epidermis
d) No dead cells are in the skin
303. Which of the following is NOT a component of the human axial skeleton?
a) Sternum
b) Vertebral column
c) Tarsals
d) Skull
304. Select the INCORRECT statement concerning the muscular system.
a) Bones contact other bones at joints.
b) Flexors decrease the angle of a joint.
c) Adductors move a limb away from the midline.
d) Tendons attach muscle to bone.
305. When the potential difference across a membrane of a neuron equals the threshold,
what results?
a) Movement of the membrane
b) Action potential
c) Relaxation
d) Contraction
306. Which structure does NOT play a part in the motion of cells?
a) Microvilli
b) Cilia
c) Flagella
d) Pseudopodia
307. Tissue differentiation begins at which stage?
a) Zygote
b) Morula
c) Blastula
d) Gastrula
308. The nervous system develops from which germ layer?
a) Ectoderm
b) Mesoderm

Page 70
 c) Endoderm
d) None of the above
309. The valve between the right ventricle and the pulmonary artery is the:
a) Mitral valve
b) Semilunar valve
c) Bicuspid valve
d) Tricuspid valve
310. Which of the following is NOT a function of the kidney?
a) Excretion of urea
b) Regulation of fluids and electrolytes
c) Elimination of toxic substances
d) Defecation
311. Digestion of carbohydrates begins where?
a) Small intestines
b) Colon
c) Mouth
d) Stomach
312. Digestion of proteins begins in which of the following human organs?
a) Small intestines
b) Colon
c) Mouth
d) Stomach
313. Bile has what function in digestion?
a) Emulsify lipids
b) Digest proteins
c) Gluconeogenesis
d) Digest carbohydrates
314. A virus must do what to reproduce?
a) Form a latent virus
b) Undergo transformation
c) Infect a cell
d) Conjugate
315. Oxygen enters the body of a grasshopper through:
a) Gills
b) Spinnerets
c) Spiracles
d) Book lungs
316. A heart with a single atrium and single ventricle is a characteristic of adult:
a) Amphibians
b) Arthropods
c) Birds
d) Fish
317. During which phase of the cell cycle are normal components of the cell synthesized
and assembled?

Page 71
 a) The M phase
b) The G1 phase
c) The S phase
d) The G2 phase
318. A cell nucleus contains which of the following?
a) DNA only
b) DNA and protein only
c) DNA, RNA and protein.
d) All are false
319. In eukaryotic photosynthetic cells, which of the following occurs when electrons
flow cyclically through the electron transport chain associated with photosystem I?
a) Synthesis of ATP.
b) Reduction of NADP+ to NADPH
c) Release of O2.
d) Reduction of CO2 to sugar.
e) Formation of water.
320. Which of the following statements about mitochondria and chloroplasts is generally
true?
a) Plants have chloroplasts but no mitochondria, animals have mitochondria but
no chloroplasts.
b) Plants have chloroplasts but no mitochondria, fungi have mitochondria but no
chloroplasts.
c) Plants and fungi have chloroplasts but no mitochondria, animals have only
mitochondria.
d) Plants and fungi have chloroplasts but no mitochondria, animals have only
mitochondria.
e) Plants have both chloroplasts and mitochondria, animals and fungi have only
mitochondria.
321. Which of the following sets of reactions occurs in the stroma of the chloroplast in
plant cells?
a) Calvin cycle
b) Krebs cycle
c) Fermentation
d) Decarboxylation
e) Ammonification
322. Double fertilization is a unique feature of flowering plants. In this process, one
sperm unites with the egg to yield a zygote. The second sperm unites with the polar
nuclei to initiate the formation of the
a) Megagametophyte
b) Endodermis
c) Embryo
d) Endosperm
e) Epicotyl
323. Which of the following tissues in an actively photosynthesizing plant would have the
highest rate of oxygen production?
a) Cortex
b) Palisade mesophyll
Page 72
 c) Epidermis
d) Vascular cambium
e) Endodermis
324. Which of the following statements about fungi is not true?
a) They are all eukaryotic
b) They all have rigid cell walls
c) Most are filamentous
d) Some are photosynthetic
e) Many are capable of both sexual and asexual reproduction.
325. Which of the following characteristics distinguishes angiosperms from
gymnosperms?
a) Perennial growth
b) True roots
c) Apical growth
d) Seeds enclosed in ovaries
e) Vascular cambium that produces phloem and xylem.
326. Use the figure below to answer the question that follow

Transpiration in the leaf depends on the transport of potassium ions into:

a) Into O
b) Into P
c) From M to L
d) From M to Q
e) From P to L.
327. Examine the following cell.

Based on the internal structure, the cell is likely to

a) Be a cheek epithelial cell.
b) Be a mature red blood cell.

Page 73
 c) Require high levels of oxygen.
d) Produce high levels of sugars.
328. Before the Krebs cycle can proceed, pyruvic acid must be converted into
a) Citric acid
b) Glucose
c) acetylcoA
d) Glucose
e) NADH
329. The net number of ATP made directly by glycolysis is
a) 2
b) 6
c) 32
d) 38
330. Cellular respiration is similar to photosynthesis in that they both
a) Produce ATP
b) Involve chemiosmosis
c) Make PGAL
d) All of the above
331. By accepting electrons and protons, the oxygen used in aerobic respiration turns into
a) CO2
b) H2O
c) C6H12O6
d) ATP
332. The Krebs cycle occurs in the
a) Cytosol
b) Outer mitochondrial membrane
c) Mitochondrial matrix
d) Space between the inner and outer mitochondrial membrane
333. During each turn of the Krebs cycle,
a) Two CO2 molecules are produced
b) Two ATP molecules are consumed
c) Pyruvic acid combines with oxaloacetic acid
d) Glucose combines with a four-carbon molecule.
334. Most of the ATP synthesized in aerobic respiration is made
a) During glycolysis
b) Through fermentation
c) In the cytosol
d) Through chemiosmosis
335. Which of the following is not part of the light reactions?
a) Splitting of water
b) Electron transport
c) Carbon fixation
d) Absorption of light energy
336. Most of the PGAL made in thee Calvin cycle is used to
a) Synthesize carbohydrates
b) Keep the cycle operating
c) Convert light energy into chemical energy
Page 74
 d) Drive the light reactions
337. A product in the overall equation for photosynthesis is
a) O2
b) CO2
c) H2O
d) RuBP
338. A reactant used in the Calvin cycle is
a) H2O
b) Glucose
c) CO2
d) O2
339. Accessory pigments
a) Add color to plants but do not absorb light energy
b) Absorb colors of light that chlorophyll a cannot absorb
c) Receive electrons from the electron transport chain of photosystem I.
d) Are not involved in photosynthesis
340. Ribosomes are
a) Surrounded by a double membrane
b) Manufactured in the cytosol
c) Composed of proteins and RNA
d) Attached to the smooth ER
341. A prokaryote has
a) A nucleus
b) A cell membrane
c) Membrane-bound organelles
d) All of the above
342. The function of the Golgi apparatus is to
a) Synthesize proteins
b) Release energy
c) Modify proteins for export
d) Synthesize lipids
343. The nucleolus is
a) The control center of the cell
b) The storehouse of genetic information
c) The site where ribosomes are synthesized
d) None of the above
344. Plastids
a) Store pigments
b) Store membranes
c) Synthesize proteins
d) Secrete proteins
345. Mesophyll is the site of
a) Water absorption
b) Storage
c) Photosynthesis
d) Secondary growth
346. Nonfunctional xylem in the center of a tree trunk is
Page 75
 a) Summerwood
b) Sapwood
c) Springwood
d) Heartwood
347. Water moves between tracheids through
a) End walls
b) Stomata
c) Vessel elements
d) Pits
348. The root apical meristem is protected by the
a) Bud scales
b) Cuticle
c) Root cap
d) Cortex
349. Collenchyma and sclerenchyma function mainly in
a) Storage
b) Support
c) Photosynthesis
d) Transport
350. Most monocots do not have
a) Primary growth
b) Secondary growth
c) Xylem
d) Phloem
351. If you observe a cross section of a root under the microscope and see that strands of
xylem alternate with strands of phloem and that there is a central core of pith, the plant
is a (n)
a) Dicot
b) Monocot
c) Annual
d) Perrennial
352. A waterproof substance occurs in cell walls of
a) Cortex
b) Endodermal cells
c) Palisade mesophyll cells
d) Vessel elements
353. The body needs vitamins because
a) Supply it with energy
b) Serve as coenzymes
c) Function as enzymes
d) Act as hormones
354. The primary function of carbohydrates is to
a) Break down molecules
b) Aid in digestion
c) Supply the body with energy
355. During absorption, the lacteals absorb
a) Glycogen
Page 76
 b) Glycerol and fatty acids
c) Amino acids and monosaccharides
d) Lactose
356. Tars
a) Cause an increase in heart rate
b) Are stimulants
c) Paralyze cilia
d) Are neurotransmitters
357. Addiction
a) Occurs when the body becomes dependent on the drug
b) Occurs when a supply of a drug is stopped
c) Is easily reversed when the supply of a drug is stopped
d) Is caused by illegal drugs
358. Certain viruses have reverse transcriptase, an enzyme that
a) Synthesizes RNA using DNA as a template
b) Unites viral DNA with host DNA
c) Synthesizes DNA using RNA as a template
d) Assists the release of viruses from the host cell.
359. Viroids differ from viruses in
a) Their larger size
b) Absence of a capsid
c) Absence of nucleic acids
d) Ability to cause disease in plants
360. The head region of a bacteriophage is used to
a) Attach the phage to the bacterial wall.
b) Enclose the nucleic acid
c) Transmit the nucleic acid to the bacterium
d) Take over the genetic machinery of the cell.
361. Temperate viruses are those that
a) Take over the genetic machinery of the host cell.
b) Are composed sorely of protein
c) Attach themselves to the ribosomes of the host cell
d) Integrate their viral genes into the DNA of the host cell
362. Five amino acids linked by peptide bonds form how many water molecules?
a) 2
b) 3
c) 4
d) 5
363. An organism that exists as a single cell is called
a) An organ
b) A tissue
c) Unicellular
d) Multicellular
364. Which of the following structures utilizes the sun’s energy to make carbohydrates?
a) Vacuole
b) Chloroplast
c) Cilia
Page 77
 d) Mitochondria
365. Membrane-bound structures found inside eukaryotic cells are called
a) Prokaryotes
b) Organelles
c) Nuclei
d) Cell walls
366. Which of the following pairs of terms is not related?
a) Nucleus-DNA
b) Flagella-chromatin
c) Chloroplasts-chlorophyll
d) Cell wall-cellulose
367. In an amoeba, which structure digests food in a vacuole by releasing enzymes?
a) Golgi apparatus
b) ER
c) Lysosome
d) Mitochondria
368. Angiosperms
a) Produce flowers and also have their seeds in fruits
b) Produce cones with naked seeds
c) Are all dicotyledons
d) Are all perennials
369. In which division are flowering plants classified?
a) Bryophyta
b) Cycadophyta
c) Coniferophyta
d) Antophyta
370. What are the two classes of antophytes?
a) Monocotyledons and dicotyledons
b) Biennials and perennials
c) Annuals and biennials
d) Angiosperms and gymnosperms
371. Which plants have leaves with a branching network of veins and flower parts in
multiple of four or five?
a) Monocotyledons
b) Annuals
c) Perennials
d) Dicotyledons
372. A cross section of a root shows a star-shaped mass of xylem when the plant is a(n)
a) Dicot
b) Monocot
c) Annual
d) Perennial
373. One advantage to plants of having fruit-enclosed seeds is that
a) People will eat them
b) They can store food in the winter
c) They have added protection for the newly developing plant.
d) They will have a longer life span.
Page 78
 374. Cambium and apical meristems are example of
a) Photosynthetic tissue
b) Protective tissue
c) Growth tissue
d) Transport tissue
375. The cells that regulate the size of the stomata are
a) Cuticle
b) Guard cell
c) Epidermal cell
d) Mesophyll cell
376. By eating fruit, mammals help
a) Fertilize flowers
b) Nastic movements
c) Photoperiodism
d) Disperse seeds
377. While feeding, butterflies and bees carry pollen from flower to flower causing
a) Pollination
b) Dormancy
c) Nastic movement
d) Photoperiodism
378. After pollination, a pollen tube grows downward from the stigma through the style to
the
a) Anther
b) Pistil
c) Fruit
d) Ovary
379. Flowering plants undergo
a) Spore formation
b) Asexual reproduction
c) Double fertilization
d) Single fertilization
380. After fertilization, the triploid cell becomes
a) Plant embryo
b) Endosperm
c) Hormone
d) Ovary
381. The substances that regulate flower and seed development and the timing of fruit and
leaf drop in the autumn are called
a) Enzymes
b) Ions
c) Hormones
d) Plasma
382. Auxins and gibberellins are plant hormones that stimulate
a) Growth
b) Seed germination
c) Fruit ripening
d) Tropisms
Page 79
 383. The period of inactivity in a mature seed is known as
a) Dormancy
b) Germination
c) Resting
d) Maturity
384. What does a plant zygote develops into?
a) A plant embryo
b) An endosperm
c) A hormone
d) An ovary
385. Which of the following is not a good descriptive term of the structure of DNA?
a) Parallel
b) Base paired
c) Double stranded
d) Organic
e) Semiconservative replicated
386. Sulfur is an essential nutrient because it is required for the synthesis of
a) Lipids
b) Proteins
c) Carbohydrates
d) Nucleic acids
e) Cell walls
387. What is the relationship between amylose, glycogen and starch?
a) Amylose is a monosaccharide, while the other wo are polysaccharides
b) Glycogen, starch and amylose are polymers of glucose.
c) Amylose and glycogen are found in animals, while starch in plants.
d) Glycogen is composed of amylose, while starch is unrelated to the other two.
e) Glucose is broken down in order to form both glycogen and starch.
388. What do insects and fungi have in common?
a) Both are dimorphic
b) Both are capable of anaerobic respiration
c) Both have a substance called chitin
d) Both produce the hormone called estrogen
e) Both forms require a soil-bound life stage
389. Which cellular structure is present in all cells?
a) a cell wall
b) a nucleus
c) mitochondria
d) a cytoskeleton
e) ribosomes
390. How are mitochondria and chloroplasts similar?
a) Both are about the same size as viruses
b) Both have their own ribosomes
c) Both are connected to the ER
d) Both function in the Calvin cycle
e) Both are associated with catabolic activities
391. DNA can be found in
Page 80
 a) A cell nucleus
b) A ribosome
c) A mitochondrion
d) A, B and C
e) Both A and C
392. Which of the following does not represent a form of active transport?
a) Endocytosis
b) Sodium-potassium pump
c) Hydrogen ion transport with the gradient
d) Exocytosis
e) Hydrogen ion transport against the gradient
393. Which of the following does not affect enzyme action?
a) PH
b) Temperature
c) Nitrogen
d) Cofactors
e) Inhibitors
394. An enzyme is composed of ………… subunits
a) Fatty acid
b) Amino acid
c) Lipid
d) Simple sugar
e) Organic ion
395. Which of the following is not an exergonic reaction?
a) Muscle contraction
b) Fire
c) Digestion
d) Lipid synthesis
e) Respiration
396. The production of two molecules of pyruvate from a molecule of glucose is classified
as a(n)
a) Catabolic process
b) Synthetic reaction
c) Aerobic respiration
d) Anabolic process
e) Oxidation reaction
397. Which of the following classes of compounds contain the most energy per gram?
a) Fats
b) Proteins
c) Carbohydrates
d) Monosaccharides
e) B, C and D.
398. What is the final electron acceptor in the mitochondrial electron transport chain?
a) ADP
b) ATP
c) O2
d) NAD
Page 81
 e) Coenzyme A
399. Photoheterotrophs are best described as organisms that obtain energy to make ATP
a) From organic compounds but use sunlight to produce carbon sources
b) From sunlight but cannot make organic compounds from CO2.
c) From some forms of chemicals
d) From organic compounds
400. The process of converting pyruvate to acetyl coA
a) Produce 3 ATP by substrate level phosphorylation
b) Produce 3 ATP by oxidative phosphorylation
c) Produce one molecule of CO2.
d) Both A and C.
e) Both A and D.
401. The net CO2 production from a single turn of the Krebs cycle is
a) 2
b) 3
c) 11
d) 12
e) None of the above
402. Which of the following occurs during the Calvin cycle?
a) Synthesis of glucose
b) Carbon fixation
c) Photolysis
d) All of the above
e) Both A and B.
403. Pigments that can absorb light energy include
a) Chlorophyll b
b) Carotenoids
c) Chlorophyll a
d) All of the above
e) Both A and C
404. Which of the following is the smallest structure of the group?
a) Chloroplast
b) Thylakoid
c) Grana
d) Mitochondria
e) It is impossible to tell
405. Molecular oxygen (O2) is associated with
a) Photolysis
b) The mitochondrial electron transport chain
c) The Calvin cycle
d) All of the above
e) A and B only
406. Which of the following initially traps solar energy in the process of photosynthesis?
a) Water
b) Chlorophyll
c) Glucose
d) NADP+
Page 82
 e) ATP
407. Which of the following is not true of phototrophs?
a) They capture light energy
b) They can be bacteria
c) They store energy as glucose
d) They never function as autotrophs
e) All of the above is true.
408. Photolysis is involved in
a) The cyclic pathway of ATP formation.
b) Carotenoid pigments
c) Photosystem I.
d) The non cyclic pathway of ATP formation.
e) Both A and C.
409. …………… are organic materials that can absorb light energy?
a) Pigments
b) Lipids
c) Fats both B and C.
d) None of the above.
410. Water serves as a source of …… in chloroplasts
a) Oxygen waste
b) Electrons
c) Hydrogen ions
d) All of the above
e) Both B and C.
411. The period of nuclear division is called
a) G2 phase
b) Mitosis
c) S phase
d) G1 phase
e) Cytokinesis
412. Which best describes the distribution of DNA following mitosis?
a) Each daughter cell gets the same amount of DNA as was in the mother cell.
b) Each daughter cell gets one half as much DNA as was in the mother cell.
c) Each daughter cell gets the same number of genes as was in the mother cell.
d) Each daughter cell gets one quarter as much DNA as was in the mother cell.
e) Both A and C are true.
413. Prokaryotes replicate by
a) Mitosis
b) Binary fission
c) Meiosis
d) Double fertilization
e) None of the above.
414. In mitosis, each daughter cell gets …… Of the mother’s phase DNA.
a) 50 %
b) 75 %
c) 25 %
d) 100 %
Page 83
 e) None of the above
415. During which phase of mitosis does chromatin become a chromosome?
a) Anaphase
b) Interphase
c) Prophase
d) Metaphase
e) Cytokinesis
416. During which stage do the sister chromatids separate
a) Prophase I
b) Prophase II
c) Anaphase II
d) Anaphase I
e) Telophase I
417. Synapsis occurs during
a) Mitosis
b) Prophase I
c) Metaphase II
d) Anaphase I
e) Telophase I
418. A father with type A blood and a mother with type B blood will always have children
with
a) Blood type A
b) Blood type B
c) Blood type AB
d) Blood type O
e) None of the above
419. A father with type A blood and a mother with type A blood
a) Will always have children with Blood type A
b) May have children with Blood type O
c) May have children with Blood type AB
d) None of the above
420. The alleles associated with the ABO blood groups are
a) A, B and AB
b) A, B and O.
c) R and r
d) Rh+ and Rh-
e) A, B, AB and O.
421. A pair of homologous chromosomes may differ from other chromosomes in terms of
a) Size
b) Banding patterns
c) The alleles they carry
d) Position of the centromere
e) All of the above
422. Which is not true of human chromosomes?
a) The haploid number is 23
b) The diploid number is 46
c) There are 23 pairs of chromosomes.
Page 84
 d) Human gametes end up with two of each type of 23chromosomes
e) Human gametes end up with one of each type of 23chromosomes
423. A change in a nucleotide sequence that results in the addition or deletion of a single
nucleotide and largely changes the amino acid sequence of the resulting peptide is
known as
a) Nonsense mutation
b) Silent mutation
c) Missense mutation
d) Frameshift mutation
e) None of the above
424. The first step in the process of viral replication is
a) Penetration of the host cell membrane
b) Assembly
c) Attachment
d) Takeover of host cellular machinery
425. A prion is
a) a virus that infects bacteria
b) an infectious protein
c) a virus related to influenza
d) a vaccine that protects against bacterial infections
e) none of the above
426. the process involving a sudden, almost explosive release of viruses from a host cell is
called
a) lysogeny
b) lysis
c) a prion
d) assembly
e) none of the above
427. ………… produce seeds
a) Ferns
b) Mosses
c) Angiosperms
d) Gymnosperms
e) Both C and D.
428. Monocots have
a) One cotyledon
b) Netted veins in their leaves
c) Endosperm in their seeds
d) All of the above
e) A and C only
429. ……………… produce rhizomes and fronds
a) Ferns
b) Mosses
c) Angiosperms
d) Gymnosperms
e) Both C and D
430. ……………… produce a prothallus.
Page 85
 a) Ferns
b) Mosses
c) Angiosperms
d) Gymnosperms
e) Both C and D.
431. In plants, oxygen is
a) Consumed within mitochondria
b) Released by chloroplasts
c) Detoxified by peroxisomes
d) Released in the form of ozone
e) Both A and B
432. A relationship between two species where both are harmed is called
a) Mutualism
b) Symbiosis
c) Commensalism
d) Neutral interaction
e) Completion
433. A(n) …………… is the most favorable habitat for an organism
a) Biome
b) Ecosystem
c) Environment
d) Niche
e) Stratum
434. About what percentage of the energy content contained within the biomass is passed
from one trophic level to the next?
a) 50%
b) 2 %
c) 25 %
d) 15 %
e) 10 %
435. Most terrestrial communities will not exceed …… trophic levels
a) One
b) Three
c) Two
d) Four
e) Six
436. …………… is the process that produces N2 gas
a) Nitrogen fixation
b) Ammonification
c) Denitrification
d) Decomposition
e) Nitrification
437. What is biological magnification?
a) The buildup of carbon deposits on the ocean floor
b) The process whereby toxins increasingly accumulate at higher levels in the
food chain.

Page 86
 c) The ever-increasing importance of one species as ecosystems become less
diverse.
d) The buildup of carbon dioxide that causes global warming
e) The spread of a parasite within a population as the density reaches the carrying
capacity.

438. The figure below shows the structure of a chloroplast

a) Name the structures A and B.

b) Using the letters given below, show on the diagram
i. ATP is produced (X)
ii. NADPH is reduced (Y)
iii. ATP is broken down into ADP and inorganic phosphate (Y)
c) State the type of molecule in the chloroplast contains
i. Magnesium
ii. Iron
d) What is the name given to the substance which combines with CO2 in the
Calvin cycle?
e) What is the name given to the first stable product produced in the Calvin cycle
(light independent reactions of photosynthesis)?
f) Where does photolysis occur in the chloroplast?
439. The figure below indicates the influence of growth hormones on the given seedling.
Observe and answer the related questions

a) Name the hormone which regulates this growth phenomenon.

b) Indicate the side A/B which must have the high concentration of the hormone
mentioned in a.
440. The diagram below indicates four coleoptiles used to study the effect of light from
one direction

Page 87
 a) How can you arrange these coleoptiles in order for them to receive the light
from one direction?
b) The coleoptiles have been maintained for many days with the light from the
direction as it is shown by the diagram above.
i. Describe how will be the length of each of the coleoptile?
ii. Describe the direction of the growth movement of each coleoptile
Coleoptile A
Coleoptile B
Coleoptile C
Coleoptile D
c) What is the part of the coleoptiles that detects the direction where light comes
from?
441. Diabetes mellitus is a complex disease which occurs in two main forms, insulin-
dependent (type I) and non-insulin dependent (type II). Type I diabetes is sometimes
called juvenile onset diabetes and people affected require frequent injections of
insulin. The cells which produce the insulin appear to have been destroyed by the
body’s immune system Type II diabetes can occur at any age but characteristically in
adulthood. It can often be found in people who are obese from overeating. Type II
diabetes appears to be the result of a failure to respond to insulin which may be the
result of reduced number of insulin receptors. In many cases this form of disease may
be controlled by dietary means. For both types of diabetes, exercise is also often
beneficial
a) Which cells are destroyed in type I diabetes?
b) Outline four effects of insulin in the control of blood glucose levels.
c) Why does insulin have to be taken by injection rather than swallowing a tablet
d) Suggest what sort of molecules insulin receptors are and state where they
would be found.
e) Suggest why exercise may be beneficial for both types of diabetes
f) Complete the table below accordingly
Hormonal defect Associated disease condition
Oversecretion of thyroxine
Myxoedema
Oversecretion of GH in puberty
Gigantism
Undersecretion of GH during infancy
Diabetes insipidus

442. The figure below shows oxygen dissociation curves of two animals X and Y living in
two different habitats

Page 88
 a) From the figure, state three differences in the behavior of the two animals.
b) Outline the characteristics of the hemoglobin of animal Y.
c) From characteristics in b, suggest the nature of the habitat in which the animal
Y lives.
d) Human hemoglobin has a higher affinity for carbon monoxide than oxygen.
What is the effect of this fact?
443.
a)
X Y
Has a lower affinity for oxygen Has a higher affinity for oxygen
Has a lower rate of oxygen saturation Has a higher rate of oxygen saturation
Releases oxygen slowly at lower Releases oxygen rapidly at lower
oxygen partial pressures oxygen partial pressures
b)
 Has a higher affinity for oxygen
 Has a high rate of oxygen saturation
 Releases oxygen more rapidly at lower oxygen partial pressures
c) Animal Y lives in a habitat with low oxygen partial pressures such as at high
altitude.
d) In the hemoglobin molecule, carbon monoxide readily replaces oxygen. It
binds irreversibly with hemoglobin molecules and thus reduces oxygen
carriage of the blood. As a result, the body tissues are deprived of oxygen
leading to tissue death.
444. In an aquatic ecosystem which was affected by an insecticide, analysis of energy
flow and concentration of the pesticide at each trophic level in a food chain was made.
The results are shown on a pyramid of biomass of the ecosystem

Page 89
 a) What does the width of each bar of the pyramid represent?
b) Explain why from producers to consumers
i. The levels of the pesticide increase?
ii. The flow of energy decrease?
c) From the biomass, explain how the producers can sustain the herbivores.
d) Give three ecological problems that may arise through the use of pesticides
445.
a) The width of each bar represents the total mass of organisms at each trophic
level per unit area or volume.
b)
i. The pesticide is persistent and non-biodegradable. It accumulates in the
tissues without being metabolized.
ii. Energy is lost between trophic levels as heat, death and decay.
c) By having a higher turnover than the herbivores so that productivity of the
producers is higher than that of the herbivores.
d)
 A few pests may become resistant leading to pest resurgence.
 They may kill/affect useful organisms in the ecosystems like pollinators
or decay organisms.
 The killed pests may be the only source of food to some organisms that
prey upon pest organisms whose population also reduces.
446. The figure below shows a bivalent at a particular stage of meiosis

Page 90
 a) Name the parts labeled A, B, C and D.
b) What is a bivalent?
c) At what stage of meiosis is the bivalent formed?
d) What is the role played by part C?
e) In abnormal conditions, chromosome set 21 in humans may show three similar
chromosomes
i. What is the name given to this condition?
ii. What does this condition cause in the individual possessing it?
iii. How does this condition arise?
447.
a) A: centromere; B: chromatid; C: chiasma (crossing over); D: pair of sister
chromatids
b) A bivalent is a pair of homologous chromosomes formed during prophase I of
meiosis in a process called synapsis.
c) Prophase I of meiosis. Reason: it is during prophase I of meiosis that
homologous chromosomes pair up to form bivalent in which non sister
chromatids cross-over.
d) It is the site of genetic exchange between chromatids.
e)
i. The condition is called Down syndrome or trisomy 21 or mongolism.
ii. It causes mental retardation and reduced resistance to diseases.
iii. It results from non-disjunction of chromosome 21 during anaphase of
meiosis. The final effect is that two chromosomes enter the daughter cell
(gamete), and none enters the other, instead of one entering each after
meiosis. During fertilization the child inherits three of chromosome 21, a
condition called Down syndrome or trisomy 21.
448.
a) State the similarities and differences between bryophytes and pteridophytes.
b) Discuss the significance of alternation of generations to the life cycles of
plants.
449.
a) Similarities
Both show alternation of generations involving two distinct phases: an haploid
gametophyte and a diploid sporophyte.
Page 91
 Both reproduce by asexual and sexual means
Both are flowerless plants
Both contain chlorophyll
Differences
Bryophyte Pteridophyte
Sporophyte has no roots Sporophyte has true roots
Sporophyte is nutritionally dependent Sporophyte is only a temporary
om the gametophye structure
Gametophyte is dominant Sporophyte is dominant
Absence of vascular tissues Presence of vascular tissues

450.
a) What is biological pest control?
b) Explain the precautions to be taken in application of biological pest control?
c) Describe qualities of a good pesticide?
451.
a) Biological pest control is the control of the population of pests using their
natural enemy in form of predators/ pathogens/parasites.
b)
i. The climatic conditions should be carefully matched to ensure that thy
favor the natural enemy of the pest especially when the population of the
pest is at peak.
ii. The predator must be released at a time when the population has reached
large numbers to provide sufficient food for the natural enemy. Otherwise,
these organisms may be wiped out prematurely resulting in pest
resurgence.
iii. Interactions of the organism with native species should be carefully
monitored to ensure that the natural enemy is not preyed upon by other
unsuspected organisms. It helps also to identify prey organisms which may
be preferred instead of the target one.
c)
i. Persistence: the pesticide should not remain in the environment for a long
time, including within organisms without being broken down. Long term
persistence may lead to accumulation of the pesticide along the food
chains, thereby affecting untargeted organisms.
ii. Toxicity: this should be adequate to be able to kill the target pests and not
injure the crops.
iii. Specificity: the pesticide should have a narrow range of organisms it
affects. Otherwise it may kill the pest and its natural predators, leading to
resurgence when a few pests survive.
452.
a) What is instinctive behavior?
b) State two factors that influence instinctive behavior.
c) Territorial behavior is common among animal species. Give
i. Four advantages of this behavior.
ii. Three disadvantages of this behavior.

Page 92
 453.
a) Instinctive behavior refers to species-specific, protective or procreation
activities of an individual in the environment exhibited independent of
environmental influence.
b)
 Species type
 Genetic constitution
 Exposure to behavior provoking stimuli
c)
Advantages of territorial behavior
 Population growth is mainly controlled
 Intraspecific competition is reduced
 It minimizes spread of diseases and parasites
 The available resources are protected and shared evenly among the
population
 Genes from strong organisms or the fittest are passed on to the next
generation…
Disadvantages of territorial behavior
 A lot of energy is lost in guarding the territory against intruders
 May lead to death of weak individuals
 Unfavorable genes carried by strong individuals end up being
propagated to future generations.
 Individuals in the territory have limited choices of food and mates
because food supply is limited to these present in the territory
454. The figure below shows two types of arrangements A and B of sensory cells in the
mammalian eye

a) What is the effect of each arrangement on the response of the eye?

i. Effect of arrangement of A
ii. Effect of arrangement of B
b) Explain how the effect of arrangement is brought about
i. Effect of arrangement of A
ii. Effect of arrangement of B
c) Under which conditions is each arrangement most effective and why?
i. Effect of arrangement of A

Page 93
 ii. Effect of arrangement of B
455.
a)
i. Improves sensitivity of the eye
ii. Improves the visual acuity of the eye
b)
i. Subthreshold level falling on individual sensory cells create
depolarization potential which summate to form an action potential in
the bipolar neuron.
The action potential travels to the brain which perceives an image of the
area illuminated. This improves sensitivity of the eye.
ii. Light energy from parts of an object which are close together can fall on
separate sensory cells.
If the light energy is large enough, an action potential is built up in each
cell which is transmitted individually to the brain.
Thus the brain interprets these as two or more separate points on the
object.
456. The table below shows the amount of DDT present in organisms in an aquatic food
chain.
Where the DDT level measured Amount of DDT/ppm
Water 0.0003
Phytoplankton 0.006
Zooplankton 0.04
Herbivorous fish 0.39
Carnivorous fish 1.8
Fish-eating birds 14.3
a) Calculate how many times the DDT is more concentrated in carnivorous fish
compared with its concentration in water.
b) What do the results in (a) show?
c) Explain why the concentration of DDT changes from water to carnivorous fish?
d) State two effects of DDT to organisms.
e) Explain how a pest sprayed with a pesticide may flourish afterwards.
457.
[ ]
a) [ ]
b) DDT accumulates in the tissues of organisms along the food chain.
c) DDT is very resistant to biodegradation yet has a very high lipid solubility. In
animal tissues, it becomes concentrated and accumulates in fat tissues along
the food web.
d) It interferes with conduction of nerve impulses in the nervous system.
In birds, it interferes with proper formation of egg shells.
DDT may have a possible mutagenic effect especially on pests on continual
use.
e) The pests may mutate and produce pesticide resistant progeny. These survive
and flourish in increasing number as the pesticide no longer can kill these
pests.

Page 94
 458. Four test tubes were filled with pond water, prepared as shown below, then placed in
bright light

Test tube A Test tube B Test tube C Test tube C

Pond weed Pond weed Pond weed Pond weed
25ºC Water snail 10ºC Tube enclosed in
25ºC aluminium foil 25ºC
a) Which tube would produce the most oxygen?
b) Explain why each of the other tubes would produce less oxygen.
c) What does this investigation tell you about the effects of temperature and
carbon dioxide concentration on photosynthesis rate?
459. The diagram below represents the structure of the heart

a) Copy the diagram and use the arrows to indicate the direction of blood flow
through the heart.
b) Name the parts labelled A to I.
c) What are the functions of C and H?
d) Why de ventricles have thicker muscular walls than atria?
e) Describe what happens in one heartbeat.
f) How does cardiac muscle differ from muscles which move the body?
460. Blood contains red cells, granulocytes, lymphocytes and platelets. Which of these
four contains each of the following sentences described:
a) Contain hemoglobin
b) Most are phagocytic
c) Transport oxygen
d) Made in the bone marrow
e) Play a part in blood clotting
f) Move like an amoeba
g) Produce antibodies
461. The diagram below shows the position of various tissues in a cross-section through a
plant.

Page 95
 a) Which part of the plant has its tissues distributed as shown in this diagram?
b) Name the parts labelled A to F?
c) Give the label letter and the name of the part which:
i. Are vascular tissues
ii. Transport the products of photosynthesis
iii. Transport water
iv. Divide by mitosis
v. Support the plant
462. The diagram below shows some of the muscles and bones of a human arm

a) Name the bones labelled A, C, E and F?

b) Describe the types of movement possible at joints D and H?
c) How is the shape of the bones at joints D and H related to the movements
which they can perform?
d) Name the flexor and extensor muscles which move joint D.
e) Complete the sentences opposite by placing a tick (V) under one of the
headings provided)

Muscle Muscle Both Both

Page 96
 G B muscles muscles
contracts contracts contract relax
When lifting a
weight in the hand
When pressing on a
desk top
When the arm hangs
loosely at your side
463. The diagram below shows a cross-section of the spinal cord
a) Name the parts labelled A to G.
b) What is the name of th region indicated by label H (where two neurons meet)?
Briely explain whay happens at this point.
c) The arrows on the diagram represent nerve impulses. Briefly explain what a
nerve impulse is.
d) Name four places where nerve impulses shown on fibre A could have come
from.

e) What is the destination of impulses moving along fibre B?

f) Describe the main difference between region D and region E.
464. Study the illustrations of the two plants with adaptations which enable them to
survive in conditions where water is usually in short supply.
a) List at least three ways (there are more) in which the Oleander leaf is adapted
to restrict water loss by evaporation through its cuticle and transpiration
through its stomata.
b) What is the advantage of a two-layered palisade in Oleander?

Page 97
 Fig: Oleander leaf (vertical with a small area highly magnified)
What effect will the thick cuticle and two-layered epidermis have on light
penetration?)

Page 98
 Fig: Cactus (Opuntia)
c) In the course of evolution, the leaves of Opuntia have become reduced to non-
photosynthetic spines. How does this help to restrict water loss by
transpiration?
d) Since Opuntia has no leaves, what part of the plant carries out photosynthesis?
e) What other characteristics illustrated in the figure enable Opuntia to survive in
dry conditions?

465. Oat coleoptiles were used in the experiments illustrated below. The experiments were
conducted in the dark.
a) What can you conclude from the results of experiment P?
b) Why was plain agar used on coleoptiles C of experiment Q?
c) What can you conclude from the results of experiment Q?
d) From the results of experiment R what can you conclude about the effects of
auxin on coleoptiles?

Page 99
 466. The following list names a type of cell and a brief description of its role. Suggest in
each case two organelles that might be numerous or well developed in that cell.
a) A sperm cell swims a considerable distance carrying a man’s chromosomes
b) A type of white blood cell engulfs and digests foreign material.
c) Cells lining a kidney tubule reabsorb soluble substances against a
concentration gradient.
d) Liver cells manufacture proteins and lipids at a rapid rate.
467.
a) What are the three basic components of a nucleotide?
b) In terms of the structure of the DNA molecule, explain why the base pairings
are not adenine and guanine and thymine with cytosine.
c) Suggest a reason why the base pairings of adenine with cytosine and guanine
and guanine with thymine do not work.
d) If 19 % of the base pairs in human DNA is guanine, what percentage of human
DN is thymine? Show your working.
468.
a) Name the cell organelle involved in translation.
b) A codon found on a section of messenger RNA has the sequence of bases
AUC. List the sequence of bases on:
c) The transfer RNA anticodon that attaches to this codon
d) The template strand of DNA that formed the mRNA codon.
e) Describe the role of tRNA in the process of translation.
f) A strand of mRNA has 64 codons but the protein produced from it has only 63
amino acids. Suggest a reason for this difference.

Page 100
 469. Scientists have developed a variety of ways to represent the three dimensional
structure of proteins. The figure below shows one way of representing the structure of
the protein hemoglobin.

a) Name A and state its role.

b) With reference to the figure, explain why a molecule of hemoglobin is said to
show both tertiary and quaternary structure.
470. The figure below shows the flow of energy through a terrestrial ecosystem each year.
All the figures are in KJ.m-3.year-1.

a) Give the name of the group of organisms represented by box A.

b) Which group of organisms are secondary consumers?
c) Calculate the percentage efficiency with which light energy is transferred to
energy in green plants. Show your working.
d) State three reasons why so little of the solar energy is transferred to energy in
green plants?
e) Calculate the amount of energy that is lost as heat from plant-eating insects.
Show your working.
471.
a) Decomposers / saprobiontic organisms (fungus and bacteria)
b) Plant-eating insects
c)

Page 101
 d)
Most of the sun’s energy is absorbed by the atmosphere
Much of the light does not fall on the chloroplast
Factors may limit the rate of photosynthesis
Not all wavelengths are used in photosynthesis
Some energy is reflected by the leaves
Some energy is used in the respiration of producers
e)
( )
472.
a) Fill in the table below indicating the substances added to blood and removed
from blood as it passes through the organ itself.
Organ Substance added to blood Substance removed from
the blood
Lungs
Kidneys
Liver
Muscles
Villus of small
intestines
b) What substances assist blood in its:
i. Transport function
ii. Defensive functions
473.
a) How is osmosis different from diffusion?
b) Potato strips were left in various liquids. The percentage changes in mass gain
(+) or loss (-) are given below:
Concentration of glucose 0 5 10 15 20
solution Water
Percentage change + 15 +5 4 -11 - 16
i. In which liquid did the potato strips increase in mass? Explain why.
ii. If the potato strips had been smaller, what effects would this have had
on the activity? Explain why.
iii. What change would you expect if the potato strips had been boiled?
474. The rhythmic contraction of the human heart is not initiated by nervous stimulation,
or the heart is innervated.
a) Briefly explain how the rhythmic contraction of the heart is brought about.
b) Name two nerves that innervate the heart.
c) What role is played by the two nerves?
d) What is the importance of the following?
i. The AVN
ii. The bundle of His and Purkyne tissue?
475.

Page 102
 a) It is brought about by the myogenic nature of the cardiac muscle initiated by
the sino-atrial node (SAN) pacemaker which sends off impulses to the rest of
the heart.
b) The sympathetic nerve and the parasympathetic nerve.
c) Role played by the two nerves: impulses via the sympathetic nerve accelerate
heart beat; impulses via the parasympathetic nerve slow down heartbeat.
d) Importance of
i. AVN: it is the only passage of impulses from atria to the ventricles. It
also accelerate transmission to the ventricles.
ii. The bundle of His and Purkinje tissue: they accelerate impulses
transmission over the ventricles and hence result in much faster
contraction.
476.
a) Name the substances transported by red blood cells.
b) What is the role of the following in the transport function of red blood cells
i. Haemoglobinic acid
ii. Sodium chloride
iii. Carbonic anhydrase
c) What is meant by the term chloride shift?
d) What is the function of the chloride shift?
477.
a) Substances transported by blood: oxygen, carbon dioxide and carbon
monoxide.
b)
i. Formation results in the buffering of H+ resulting from the dissociation
of carbonic acid.
ii. Sodium chloride: dissociates to give Cl- that diffuses into the red blood
cell during chloride shift.
iii. Carbonic anhydrase: catalyzes the combination of carbon dioxide and
water to form carbonic acid and increases diffusion of carbon dioxide
into the red blood cell.
c) Chloride shift is the diffusion of Cl- ions from the plasma into red blood cell.
d) Function of the chloride shift: to maintain the charge of the RBC after the exit
of HCO3-.
478.
a) Study the diagram below of a section of the human eye and then complete the
table below which contains a list of functions of five of the parts shown in the
diagram. For each function, fill in the letter and the name of the correct part.

Page 103
 Function Letter Name
Prevents the reflection of the light rays
Sensitive to light
Helps to bend rays of light
Causes change of shape of lens
Moves the eyeball up and down
b) Describe how you would show that you have a blind spot in your right eye
using a car with a cross and a spot marked on it.
479. The table below gives the names of certain structures which connect one organ of the
human body with another. Complete the right hand column of the table to show two
organs which are connected by each structure. One example of how to do it is given.
Structures Organs connected by this
structure
Bronchus Trachea with lung
Bile duct
Ureter
Optic nerve
Eustachian tube

480.
a) What is a reflex action?
b) Which four structures are essential parts of this reflex?
c) What causes a reflex action to occur?
d) Give one example of e reflex action.
e) The result of the reflex action occurs in the effector. Name two different types
of effectors.
481.
a) Name the three parts of the joint indicated

Page 104
 b) What is the fluid X and what is its function?
c) Name two types of movable joint and say where each one can be found in a
mammal.
d) Name the tissue which connects muscles to bones.
e) Why are skeletal muscles always in opposing sets?
482. In the DNA molecule, there are four bases: two purines and two pyrimidines.
a) Name them
b) Name the sugar
i. In DNA
ii. In RNA
c) What is a nucleotide?
d) What are the possible pairings of the four bases?
483. Four potatoes were carefully dried on blotting paper and weighed. Each piece
weighed 3 g. One was placed in each tube as shown in the drawing below:

a) After 48 hours, which potato cylinder would be the heaviest?

b) The movement of which substance was mainly responsible for the weight
changes in the potato cylinders?
c) Name the process which was responsible for this movement in tubes B, C and
D.
d) A fifth potato cylinder, also weighing 3 g, was cut in half and both pieces were
treated in the same way as tube A. After the same 49 hour period, how would
the combined weight of the two halves compare with the weight of the single
cylinder in tube A? Give a reason for your answer.

Page 105
 484.
a) B. Reason: potato cells would take up water fastest and most easily from the
weakest of the solutions.
b) Water
c) Osmosis
d) The combined weight of the two halves would be less. The surface area for
evaporation of water is greater, so water loss would be quicker.
485. Three thermos flasks A, B and C were set up as shown in the diagram.

The temperature of each flask was noted at the beginning of the investigation, and
each day during a week in school. The observations were:
Monday Tuesday Wednesday Thursday Friday
Flask A, ºC 20.0 20.5 23.5 23.7 24.2
Flask B, ºC 20.0 20.0 24.3 24.5 25.0
Flask C, ºC 20.0 20.0 20.1 20.0 20.2
a) What is the source of heat produced by germinating peas?
b) Why did the temperature in flask B rise towards the end of the week?
c) Why is important to use thermos flasks in this investigation and not ordinary
glass bottles?
d) What is the importance of disinfectant in flask C?
e) Why does the temperature in flask C change slightly during the week?
486.
a) Butterflies show distinct changes during their life cycle. Fill in the boxes to
show the remaining three stages in the diagram of their life cycle.

b) Name any vertebrate which shows distinct stages in its life cycle.

Page 106
 c) What is the name given to the type of life cycle shown by the animal you have
named and by butterflies?
487. The complex structure of proteins can be explained in terms of four levels of
structure: primary, secondary, tertiary and quaternary.
a) Primary structure involves the sequence of amino acids that are bonded
together to form a polypeptide. State the name of the linkage that bonds the
amino acids together.
b) Beta-pleated sheet are an example of secondary structure. State one other
example.
c) Tertiary structure in globular proteins involves the folding of polypeptides.
State one type of bond that stabilizes the tertiary structure.
d) Outline the quaternary structure of proteins. Give an example of a protein with
quaternary structure.
488.
a) Peptide bonds/ peptidic bonds
b)
c) Ionic/ polar/ hydrogen/ hydrophobic/disulfide bonds
d) Linking together of polypeptides to form a single protein, using the same
bonding as for tertiary structure. Example: hemoglobin has four polypeptide
chains.
489. The proximal convoluted tubule of a part of the nephron (kidney tubule). Its function
is selective reabsorption of substances useful to the body.
a) Outline how the liquid flows through the proximal convoluted tubule is
produced.
b)
i. Water and mineral salts are selectively reabsorbed by the proximal
convoluted tubule. State the names of one other substance that is
selectively reabsorbed.
ii. State the names of the processes used to reabsorb water and salts.
The drawing below shows the structure of a cell from the wall of the proximal
convoluted tubule.

c) The actual size of the cell is shown on the diagram. Calculate the linear
magnification of the drawing. Show your working.

Page 107
 d) Explain how the structure of the proximal convoluted tubule, as shown in the
diagram, is adapted to carry out selective reabsorption.
490.
a) High blood pressure in afferent arterioles leads to the ultrafiltration in the
gromerulus The filtrate drains through the Bowman’s capsule to the proximal
convoluted tubule.
b)
i. Glucose/ Amino acids
ii. Water by osmosis
Salts by active transport/ facilitated diffusion
c)
Size of image = 4.9 cm = 49,000 µm
Scale bar represents 10 µm
( )
d) Microvilli increase the surface area for absorption/ Active transport.
Mitochondria produce ATP for active transport.
491. A polygenic character is controlled by two genes with two alleles. How many
different possible genotypes are there for this character?
492. 9
493. The respiratory quotient (RQ) is used to show what substances are being metabolized
in respiration. The RQ of a substrate may be calculated using the formula below:

When the unsaturated fatty acid linoleic acid is respired aerobically the equation is

a) Calculate how many molecules of carbon dioxide are produced when one molecule
of linoleic acid is respired aerobically.
b) Calculate how many molecules of water are produced when one molecule of
linoleic acid is respired aerobically.
c) Calculate the RQ of linoleic acid.
494. The diagram shows the sequence of bases in a short length of mRNA.
AUGGCCUCGAUAACGGCCACCUAA
a) 7
b) 7
c) Give the DNA sequence which would be complementary to the first bases in
this piece of mRNA?
d) Name the process by which mRNA is formed in the nucleus.
e) Give two ways in which the structure of a molecule of tRNA differs from the
structure of a molecule of mRNA.
495. State the property of water and explains its importance in each of the following cases
a) The cooling of a crop plant
b) The survival of fish in ice-covered lakes
c) Insects such as pond-skaters, which can walk on water
d) The transport of glucose and ions in a mammal.

Page 108
 496. The diagram shows the sequence of events in the development of a mature ovarian
(Graafian) follicle and corpus luteum

a) What is the main hormone produced by the ovary when stage B is present?
b) Which two of stages A to E would you expect to find in the ovary of a woman
during the early stages of pregnancy?
c) Give the reason for your answer on b.
d) Some oral contraceptives contain only estrogens. Which of the stages A to E
would you expect to find in the ovary of a woman who had been taking such an
oral contraceptive for a prolonged period of time?
e) Give reasons for your answer on d.
497. The diagram shows the structure of a human sperm.

a) Explain the part played by the organelles labelled A in the process leading to
fertilization.
b) The acrosome contains an enzyme that breaks down proteins. Describe the
function of this enzyme in the process leading to fertilization?
c) Give two ways in which cell division in sperm formation differs from cell
division in egg formation.
498. The diagram shows chemical pathways involved in respiration and photosynthesis

Page 109
 a) Name the process that produces pyruvate from glucose
b) Name the compounds labelled X and Y
c) In which part of a chloroplast is glycerate-3-phosphate converted into ribulose
biphosphate?
d) Describe the role of ribulose biphosphate in photosynthesis.
499. The diagram shows an ovule from a dicotyledonous plant, immediately after self-
pollination has occurred.

a) The structures within the ovule are haploid (n), diploid (2n) or triploid (3n).
Copy and complete the table, naming the structures A to D, indicating the
number of chromosomes sets present and the % contribution to each structure
made by the male and/or female parts of the parent plant

b) Describe the structural changes which occur after fertilization, leading to the
development of the seed and fruit.
c) State three reasons why not all seeds germinate immediately after dispersal
even though conditions are favorable for germination.
500. The figure below shows some of the homeostatic changes that occur as a result of
water being lost from the blood due to sweating

Page 110
 a) Describe the changes in water potential that occurs in the blood as a result of
sweating.
b) Which of the structures shown acts as
i. A receptor
ii. An effector
c) Describe how ADH gets from the pituitary gland to the kidney
d) The kidney conserves the water that is already in the blood. Given that the
water potential of the blood remains in its normal level prior to sweating,
suggest what is happening in process X
e) State as precisely as possible what mechanism is shown by the line labelled A.
501.
a) As sweating involves a loss of water from the blood, its water potential will
decrease/ be lower/ more negative.
b)
i. Osmoreceptor cells in the hypothalamus
ii. Kidney
c) As it is a hormone, it is transported in the blood.
d) Absorption/ taking in/ drinking the water. Because water has been lost during
sweating. As the water potential of the blood returns to normal, the lost water
must have been replaced. However, the kidney excretes less water, it does not
replace it. Therefore process X must be the way that water is replaced.
e) Negative feedback.
502. The graph below shows the effect of temperature on the rate of reaction of an
enzyme.

a) What is indicated by X?

Page 111
 b) What temperature would X be for a mammalian enzyme?
c) Explain what is happening in region A.
d) Explain what is happening in region B.
e) Enzymes are effective because they lower the activation energy of the reactions
they catalyse Explain what is meant by ‘activation energy’
503.
a) Optimum temperature
b) 37 °C; accept 40 °C
c) As temperature increases the kinetic energy of the molecules increases;
d) The rate of collision between substrate and, enzyme / active site, increases; rate
of reaction increases; [3]
e) The enzyme is gradually being denatured; When the rate is zero the enzyme is
completely denatured;
Also accept: enzyme loses tertiary structure; substrate no longer fits into active
site / active site loses its (specific) shape so substrate does not fit.
196
504. The diagram below shows an alveolus.

a) Name:
i. Cells A, B and C
ii. The fluid at D.
b) Calculate the actual distance indicated by X–Y. Show your working.
c) Explain how alveoli are adapted for the exchange of gases.
505.
a)
i. A squamous epithelial cell; B red blood cell; C endothelial cell
ii. D (blood) plasma
b) b distance of scale bar is 15 mm; 15 mm = 10 μm; X–Y distance measured on
page is 43 mm; 43 ‚ 15 × 10 = 29 μm
c) (very) large number forming a large surface area; squamous epithelial cells
are very thin to give short diffusion distance; surrounded by capillaries so
well supplied with blood; capillaries are very close so short diffusion
distance; well ventilated so air constantly refreshed; maintains concentration
gradients for oxygen and carbon dioxide.
506. The figure below is a section of an alveolus and surrounding capillary

Page 112
 a) Name:
i. Cells A, B and C
ii. The fluid at D.
b) Calculate the actual diameter of the alveolus along the line X-Y. Show your
working and give your answer to the nearest micrometer.
c) Describe the role of elastic fibers in the wall of the alveolus.
d) With reference to the figure above, explain how the alveolus are adapted for
gas exchange.
e) Chronic obstructive pulmonary disease (COPD) is a progressive disease that
develops in many smokers. COPD refers to two conditions:
 Chronic bronchitis
 Emphysema
i. State two ways in which the lung tissue of someone with emphysema
differs from the lung tissue of someone with healthy lungs.
ii. State two symptoms of emphysema.
507. The following are various sub-units into which a species of plant or animal can
be divided: cell, organ, organelle, organism, organ system and tissue.
a) Arrange them in order starting with the simplest and ending with the most
complex.
b) Which of the following can be applied to
i. Cat
ii. Amoeba
iii. Leaf
iv. Chloroplast
v. Muscle
vi. Alimentary canal (gut)
508. Experiments on photosynthesis may involve the following: variegated leaves,
soda lime or caustic soda, ethanol, iodine, oxygen and starch.
Which would you use to:
a) Prevent leaves getting carbon dioxide?
b) Remove chlorophyll from the leaves?
c) Test whether chlorophyll is essential for photosynthesis?
d) Test a decolorized leaf for starch
e) Which are the products of photosynthesis?
f) If water containing were fed to a photosynthesizing plant, in which
product would the appear?

Page 113
 g) Before doing any photosynthesis experiment with a pot plant, what must first
be removed from its leaves?
509.
a) Label the diagram below of the human retina shown below.

b) Define the term accommodation.

c) What is the function of the iris?
510.
a) A: Cone cell, B: rod cell; C: bipolar neuron.
b) Eye accommodation is the ability of the eye to focus on both near and distant
objects on the retina.
c) The iris regulates the size of the pupil.
511. The composition of blood passing through uterine vessels and umbilical
vessels was analyzed and results presented in a table as shown below:
% composition
Substances Uterine Umbilical Uterine vein Umbilical
analyzed artery % artery % vein
Oxygen 10 10 90 70
Carbon dioxide 80 75 8 12
Glucose 90 2 2 80
Urea 20 60 80 12
a) Name the structure that allows exchange of substances between uterine vessels and
umbilical vessels.
b) Explain the characteristics of the structure named in (a) that adapts it to its
function.
c) Explain the difference in the direction of blood flow between the umbilical artery
and the umbilical vein.
d) Account for the difference in the composition of blood in the umbilical artery and
the umbilical vein.
e) Explain why the uterine vein had high CO2 content.
f) Explain why the uterine vein had the highest content of urea than all the other
blood vessels.
512.
Page 114
 a) Placenta
b) Numerous villi to create a large surface area over which diffusion occurs/
numerous blood vessels for efficient transport of materials/ thin membrane for
rapid diffusion of substances.
c) The umbilical artery directs blood to the placenta from the fetus. The umbilical
vein directs blood away from the placenta to the fetus. This is because the
artery carries deoxygenated blood to the placenta for oxygenation and removal
of wastes.
d) The blood in the umbilical artery has a higher concentration of waste products
like urea and carbon dioxide than the umbilical vein. The umbilical vein has a
higher concentration of glucose and oxygen than the umbilical artery.
e) This is because the carbon dioxide in the fetus blood diffuses across the
placenta into the maternal blood. It accumulates in the uterine vein which
transports it away from the uterus.
f) Urea from the fetal blood diffuses across the placenta into the maternal blood
where it accumulates and is transported away from the uterus by the uterine
vein. Maternal blood contain in addition urea from its own body.
513. The chart below is a summary of photosynthesis. Study it then answer the
questions that follow:

a) Name raw materials required for stage one of this process.

b) State the name given to stage one and two of this process.
i. tage one ……………
ii. Stage two …………
c) From the above chart, what is the origin of the oxygen given out by plants
during photosynthesis?
d) State the role of light in photosynthesis.
514. The diagram below represents the epidermis of the leaf

Page 115
 a) Name the parts marked E, F and G.
b) State two aspects of cell E that are an adaptation to its function.
c) Describe the changes that would take place in E if the cells were placed in
concentrated sugar solution for a long period.
515.
a) E: Guard cell; F: stoma; G: Epidermal cell
b) Thick inelastic inner walls; thin elastic outer walls
c) Water would leave the vacuole and cytoplasm by osmosis, they shrink, the
cytoplasm draws away from the cell wall and the guard cell becomes
plasmolyzed.
516. The following table shows energy requirements and nutrients of individuals in
different age groups and sexes
Occupational and Energy Nutrients
age requirement Protein (mg) Iron (mg) Calcium (mg)
Retired male 6400 KJ 25 4.2 0.4
Mason 14200 KJ 110 16.6 1
Teenage boy 14900 KJ 112 17.0 1.2
Retired female 4400 KJ 16 2.1 0.1
Pregnant house wife 10300 KJ 110 24 1.5
Teenage girl 9800 KJ 116 22.1 1.1
a) Account for the differences in energy and nutrients requirements between:
i. Teenage girl and teenage boy
ii. Retired female and pregnant house wife
iii. Retired male and mason
b) Other than age and occupation, give other factors that influence energy
requirement in man.
c) State two functions in each case for calcium and iron in the body.
517.
a)
i. Teenage boy requires more energy than a teenage girl because boys
undergo rapid muscular growth compared to girls. The teenage girls
require more proteins and iron nutrients because of rapid growth and
menstruation.
ii. A pregnant housewife require more nutrients than a retired female because
of the developing fetus in her uterus.

Page 116
 iii. A retired male requires less energy and nutrients because he does less work
and is declining in growth. A mason requires more energy and more
nutrients because he carries out more strenuous activity.
b) Sex, body size, health of the person
c) Calcium: formation of strong bones and teeth, muscle contraction, blood
clotting and transmission of nerve impulses. Iron: formation of hemoglobin and
myoglobin.
518.
a) Give three factors that aid ultrafiltration in the glomerulus.
b) Give an explanation of the following:
i. Plasma proteins are absent in the glomerular filtrate.
ii. Urine of a normal person does not have glucose.
iii. During cold days, one produces large quantities of dilute urine.
519.
a) Afferent vessel is wider than efferent vessel; blood enters the glomerulus from
renal artery that branches from aorta, so blood is at high pressure; glomerulus
is made of thin capillary walls that allow substances to easily pass through it.
b)
i. Plasma proteins are large molecules which cannot pass through the small
pores of the glomerulus.
ii. All glucose is reabsorbed at the proximal convoluted tubule.
iii. In cold days, one does not produce sweat, so all excess water is lost as
urine.
520. The figure below illustrates positions taken by an African gecko at 9:00 am and
at midday

a) Describe the exchange of heat between the gecko and the rock at:
i. 9:00 am
ii. 12 noon
b) Describe how the changes in temperature between 9:00 -12:00 affects the
activity of the gecko.
Page 117
 521.
a)
i. The gecko gains heat by conduction from the rock at 9:00 am.
ii. The gecko loses heat to the stone by conduction from the rock at 12:00 am.
b) At 9:00 am, the temperature of the environment were low, so the gecko was
not very active; at 12:00 the temperature rose and the gecko became active,
enzyme activity in its body increased and thus there was more energy
available for activities.
522. Study the diagram below then answer the questions that follow.

a) Name the structures marked Q, R, S, T, U and W.

b) When some pressure is applied at W, a fluid appears at V. Name the fluid and
state its contents.
523. The figure below shows changes in the body temperatures of a student and a
frog in relation to air temperature over a period of 24 hours.

a) What does this graph tell you about the body temperature of a student and that
a frog?

Page 118
 b) State the disadvantages of the temperature control mechanisms employed by
the frog.
c) Suggest possible causes of sudden body temperature increase in frog between
24:00 hours.
524. In an ecological study, a scientist obtained the following data
Organism Population Biomass in kg
S 10,000 10
T 1,000 0.1
R 100 0.01
M 10,000 1,000
N 10 0.01

a) Work out a possible food chain from the above ecosystem.

b)
i. Construct a pyramid of biomass using the data above.
ii. Which two organisms are most likely to occupy the same trophic level in the
ecosystem? Give reasons for your answer.
iii. Which organisms are most likely to be producers? Give reasons for your
answer.
iv. State the disadvantages of representing ecological data in a pyramid of
numbers.
c)
i. Give two organisms that are likely to be competing for nutrients.
ii. Name the type of competition exhibited by organisms you have named in (c) (i)
above?
iii. Which organism is likely to be the lightest in terms of average body weight?
525.
a) M S T R N
b)
i.

ii. N and R; because they have the same biomass.

iii. M; has the largest biomass.
iv. Pyramid of numbers do not reflect the actual energy in trophic
level that can sustain the subsequent trophic levels.
c)
i. N and R
ii. Interspecific competition

Page 119
 d) S
526. Study the figure below that shows an embryo sac

a) Name the parts T and R

b) State where the above structure is found in a flower.
c) State the fate of T and R after fertilization.
527.
a) T: polar nuclei; R: egg cell
b) Ovule; also accept ovary
c) T fuses with one male nucleus to form a triploid nucleus which develops into
the endosperm. R fuses with another male nucleus to form a diploid zygote
which eventually develops into an embryo.
528. The diagram below illustrates two types of reproduction

a) Name reproduction types A and B.

b) State 2 advantages of type A.
529. State the role played by the following parts of seed in germination.
a) Endosperm
b) Micropyle
c) Seed coat
530.
a) Endosperm: provide stored food substances which are broken down to simpler
substances by hydrolysis.

Page 120
 b) Allows water and air to enter into the seed.
c) Ruptures to release the plumule and the radicle.
531.
a) State the methods of breaking seed dormancy.
b) The diagram below represents a section through a root tip.

i. Name the regions of growth labelled A, B and C.

ii. Name and state the functions of D.
532.
a) Reducing germination inhibitors; softening of seed coat by water; mechanical
breakdown of seed coat.
b)
i. A: region of permanent tissue; B: region of elongation; C: region
of cell division
ii. Root cap: protects the delicate apical meristem
533. The diagram below shows a stem of a plant growing round a tree trunk.

State the name given to this type of response.

534. Name the part of the brain involved in
a) Controlling involuntary responses
b) Maintaining balance and posture
c) Keeping memory
535.
a) Medulla oblongata/ also accept brain stem
Page 121
 b) Cerebellum
c) Cerebrum
536. The figure below shows some defect of the eye

a) Name this defect

b) Name the type of lens that can be used to correct the above defect.
537. Name diagram below represents two types of nerve cells commonly found in
mammals

a) Name cells A and B.

b)
i. Name the structures labelled K, L, N and O.
ii. Give the functions of L and n.
538. The diagram below represents a human ear

Page 122
 a) Give the parts whose function has been given below
i. Amplifies sounds in the middle ear
ii. Concentrates sound waves into the external auditory canal.
b) Name the parts labelled A, B, C, D and E and state their functions.
539. The figure below shows the pattern of growth in an insect measured by
increase in fresh weight.

a) What is the term given to describe this kind of growth?

b) Explain the changes that occur in the insect from point A to B on the graph
with emphasis on what happens at X.
540.
a) Intermittent growth / discontinuous growth
b) The insect molts at X/ sheds its exoskeleton/ undergoes ecdysis; and then
gradually grows rapidly before the new cuticle hardens between X and B.
541. Two potted plants A and B were placed in the dark for two days. Each was
then placed in an air tight bell jar as follows. Each plant was then tested for starch.

Page 123
 a) Why were the plants put in a dark place for two days?
b) What was the result of the starch test in plant B? Explain your answer.
542. The diagram below shows a section through the brain of a human being

a) Name the parts A, B and C in the figure.

b) How does the function of A differ from that of the other labelled parts?
c) What will be the effect on the body if the parts A and C were injured?
543. The figure below illustrates a process that takes place in the alimentary canal

a) Name the process

b) Name two muscles that enhance the above process
c) Explain the importance of roughage in the above process.

Page 124
 d) State how the stomach protects its walls against digestion by enzyme pepsin.
e) Name the enzyme that is produced in the stomach of infants to enhance
digestion of milk protein.
f) State any one function of HCl produced in the stomach during the digestion
process.
544.
a) Peristalsis
b) Longitudinal and circular muscles
c) Helps in initiating peristalsis
d) Produces mucus, production of enzymes in inactive form.
e) Rennin
f) Neutralization of alkaline solution from mouth; kills disease causing germs in
stomach.
545. The diagram below shows how the body regulates blood glucose levels

a) Identify Y
b) Identify X
c) State 2 functions of X
546.

a) What is the apparatus shown above being used to demonstrate?

b) What would you observe after some time?
547.
a)

Page 125
 i. What is meant by excretion?
ii. Urea and carbon dioxide are excretory products of the human body. In the
case of each product name a substance from which it is derived.
b) The diagram shows the structure of a nephron and its associated blood supply.

i. Name the parts A, B, C, D, E and F.

ii. From which blood vessel is A derived?
iii. Where in the kidney is B located?
iv. Give the part of the nephron in which each of the following takes
place:
1. Filtration
2. Reabsorption of amino acids.
v. Give two features of the nephron that aid filtration.
vi. Name a group of biomolecules in the blood which are too large to
pass through the filtration system of the nephron.
vii. Suggest two situations which may result in a drop in the water
content of the blood.
c) When the water content of the blood drops a hormone is released. Name this
hormone and the endocrine gland from which it is secreted.
d) Explain the role of the hormone at its target area, when the water content of the
blood is low.
548.
a)
i. Excretion is the removal of metabolic wastes products from the body.
ii. Carbon dioxide is a waste product of the metabolism of carbohydrates
and lipids. Urea is a waste product of the metabolism of proteins and
nucleic acids.
b)

Page 126
 i. A: Afferent arteriole; B: Bowman’s capsule; C: Proximal
convoluted tubule; D: Loop of Henle; F: Distal convoluted tubule;
F: collecting duct.
ii. From the renal artery
iii. In the renal cortex
iv.
1. Glomerulus
2. Mainly in the proximal convoluted tubule
v. The afferent vessel is wider than the efferent vessel; the
glomerulus is permeable.
vi. Proteins and fats
vii. After dehydration (for example after doing physical exercise) and
after a long period without drinking water.
c) ADH from the hypothalamus (also accept pituitary gland).
d) Its increases the reabsorption of water in the kidney.
549.
a) Name the openings in the leaf which allow the entry of carbon dioxide for
photosynthesis.State a factor which influences the diameter of these openings.
b) During photosynthesis oxygen is produced.
i. From what substance is oxygen produced?
ii. In which stage of photosynthesis is oxygen produced?
iii. Give two possible fates of oxygen following its production.
c) Give an account of the role of each of the following in photosynthesis:
i. ATP
ii. NADPH
550.
a) Name a structure in the human digestive system, other than teeth, which is
involved in mechanical digestion.
b) Describe two functions of bile in relation to digestion.
c) Answer the following in relation to a lipase:
i. Where is it secreted?
ii. Where does it act?
iii. What is the approximate pH at its site of action?
d) What are symbiotic bacteria? Give two activities of symbiotic bacteria in the
human digestive system.
e) Name the part(s) of the digestive system in which the following are absorbed
into the blood.
551. In humans, widening of the female hips is one example of physical changes
that distinguish the sexes but are not essential for reproduction. To what term does
the definition in italics refer?
a) What term is used for the time in a young person’s life when such changes take
place?
b) Name the hormone that maintains such changes throughout the life of a male.
c) Describe the role of estrogen andprogesterone in the control of the events of
the menstrual cycle.

Page 127
 d) Answer the following questions in relation to the development of a human
zygote.
i. By which type of cell division does the zygote divide?
ii. The placenta forms from tissues of the mother and the fetus. Give
two roles of the placenta.
iii. Give one change experienced by the mother that indicates to her
that the birth process is starting.
552. The table below shows the composition of five foods A, B, C, D and E. Study
it and answer the following questions
Composition per kg
Food KJ/100mg Proteins Fats Carbohydrates Vit C Vit D Iron
A 3800 0.4g 8.6g 0 0 40g 0
B 130 1.2g 0 8g 220g 0 0
C 1150 8.8g 1.5g 60g 0 0 0
D 400 2.0g 0.1g 25g 10g 0 6mg
E 1650 0 0 100g 0 0 0
From the table, which food among A, B, C, D and E would:
a) Help prevent anemia and why?
b) Help prevent scurvy and why?
c) Help prevent anemia and why?
d) Help prevent rickets and why?
e) Provide most energy and why?
f) Be best for growth and why?
553. The wings of birds and those if insects are superficially similar but their
internal structure is completely different
a) Name the type of evolution that lead to the similarity in the two types of wings.
b) Explain how the similarity in the wings of the two groups of organisms came
about.
c) Give two other examples of this type of evolution.
554. Many animals have organs that appear to have little or no function and are
usually smaller than their fully functional equivalents in related species.
a) What is the scientific name for such organs?
b) Explain the existence of such organs.
c) Give 5 examples of such organs in man.
555. Hemophilia is an X-linked recessive condition. The following pedigree shows a
portion of a family in which some members have hemophilia. Those on the pedigree
with hemophilia are shaded.

Page 128
 a) Use appropriate allele symbols from XH, Xhand Y to indicate the genotype of each of
the following individuals. I1 and I2.
b) The couple II1 and II2 have a son. What is the probability that the child has
hemophilia?
c) The couple II5 and II6 have a son. What is the probability that the child has
hemophilia?
556. The following diagram outlines processes that occur in living cells.

a. Name the process represented at X.

b. Describe the sequence of events that occurs during the process at X.
c. In the process at Y, the molecule shown below has a specific function.

d. Describe the structure of this molecule and then relate its structure to the
specific function that the molecule has in the process occurring at Y.
557. The following diagram shows a synapse between the end of one neuron and the
dendrite of another.

a. What is the general name for molecule X?

b. Describe what occurs at stage P.

Page 129
 c. Explain, with the use of a diagram, how the message is transmitted along the axon
of the post-synaptic neuron.
558. Hormone X is a lipid-soluble hormone produced by one of the human endocrine
glands. Consider each of the following general models for signal reception and
transduction.

a) Which model, model S or model T, best corresponds to the mechanism of hormone

X? Explain your choice.
b) Some tissues in the human body would not respond to hormone X.What is the most
likely explanation for this condition?
c) A tissue that has been responsive to hormone X may, over time, lose its response to
hormone X, even though the concentration of hormone X remains unchanged.
Based on your understanding of how a hormone controls the functioning of cells,
suggest reasons for this decrease in responsiveness.
559. The breakdown of glucose in aerobic respiration can be represented as occurring
in three stages, as shown below.

a. Within a cell, where does the electron transport stage of aerobic respiration
occur?
b. Describe what happens during the electron transport stage. In your answer
include the name of product Z.

Page 130
 560. The following diagram shows a portion of an unknown macromolecule found
in cells. The remaining portion of the macromolecule contains the same
repeating unit.

Two students discuss this diagram. Peter suggests it represents cellulose. Mary
disagrees. He suggests that the diagram represents the enzyme cellulase. Name
the student who is correct and explain why.
561. The diagram below shows the structure of a particular protein molecule.

a. The protein contains two distinctive types of polypeptide chains labelled X and Y.
What are the names of these two types?
b. Proteins can be found in the membrane of a cell. Draw a labelled diagram to show the
arrangement of both proteins and other major components in the plasma membrane.
c. Consider the molecules you have labelled in your diagram in part b. Apart from the
protein molecules, describe the roles played by the molecules in the plasma
membrane.
562.
a) Fill in the following table

Page 131
 b) Outline any three adaptive features that the following have to conserve water.
i. Xerophytes
ii. Desert mammals.
563. What Carbohydrate is :
a) First formed in Photosynthesis?
b) Used by body cells to produce DNA?
c) Used by plants to start the light independent reactions of photosynthesis?
d) The major storage Carbohydrate in Plants?
e) The major storage Carbohydrate in Animals?
f) The constituent of Exoskeletons of Arthropods (Insects & Crustacea)?
g) Formed by unbranched chains of beta-Glucose and cross-bridges?
h) The form in which most Carbohydrates are transported (= translocated) in Plants?
i) The constituent of the body Energy store molecule ATP?
564.
a) Triose phosphate or phosphoglyceraldehyde (PGAL) or glyceraldehyde-3-
phosphate
b) Deoxyribose
c) Ribulose biphosphate
d) starch
e) glycogen
f) chitin
g) cellulose
h) sucrose
i) ribose
565. Use the figure below to answer the questions that follow

Page 132
 i. The above diagram refers to a molecule of
a) mRNA
b) tRNA
c) DNA
d) rRNA
ii. item labeled A refers to
a) The codon
b) Amino acid attachment binding site
c) The anticodon
d) Hydrogen bond
iii. Item labeled B refers to
a) The codon
b) Amino acid attachment site
c) Hydrogen bond
d) The anticodon

566. Use the figure below to answer the questions that follow

Which letter represents the

i. Large ribosomal subunit
ii. Ribosome
iii. mRNA strand

Page 133
 iv. polypeptide
v. small subunit
567. Fill in the table below of the type of learned behavior the missing words
………………………… Solve their problems suddenly, not by
trial and error, they apparently use
mental ability
Imprinting …………………………………
……………………… Learning by association (Pavlov’s dog)
Operant conditioning ………………………………
This is learning in which repeated ……………………………
exposure to a stimulus results in reduced
responsiveness to the stimulus.
568. The diagram below shows the blood supply through the liver

a) Label the parts indicated

b) Which two substances would be present in greater concentration in vessel E
after a meal?
c) After a period of vigorous activity, there would be an increase in the
concentration of a substance in vessel C. Name this substance.
d) State two functions of the liver.
e) Name a structure other than blood vessels, is associated with the liver and state
its function.
569.
a) A: vena cava; B: aorta; C: hepatic vein; D: hepatic artery; E: hepatic portal
vein
b) Glucose, amino acids
c) Glucose

Page 134
 d) Store glycogen, produces bile…
e) Name of structure: gall bladder. Function: stores bile.
570. The figure below illustrates an internal section of a kidney

a) State the differences in the composition of fluids passing through vessels P and Q.
b) State two similarities between vessels P and Q in terms of composition of fluids
passing through them.
c) State the substances that would be in high concentration as fluids that pass through
vessel R in individuals
i. Suffering from diabetes mellitus
ii. Suffering from nephritis
d) Name the organ where R empties its contents.
571.
a)
P Q
More oxygen Less oxygen
More urea Less urea
More water Balanced water
b) Both contain blood cells; both carry nutrients such as glucose and amino acids
c)
i. Glucose
ii. Proteins
d) Urinary bladder
572. State two roles of adrenaline in the human body.
573. Increases metabolic rate; increases rate of breakdown of glycogen to glucose;
causes more blood to be directed to vital organs during emergency situations; can be
used as a neurotransmitter…

574. Fill in the following table on the reproductive system

Hormone Where produced Functions

Page 135
 FSH ……………… ………………
…………… ……………… Stimulates the production
of androgens in the testes
…………… Pituitary gland Initiates ovulation
…………… Corpus luteum …………………
575. The diagram below represents the transverse section of two mammalian teeth

a) Name the structure marked T, V, W and Y and state their functions.

b)
i. Explain how the wearing of the part marked V would affect the
function of the tooth F.
ii. State the functions of tooth F.
iii. Explain how tooth F is adapted to its functions.
c) State how you would prevent tooth decay.
576.
a) T: blood capillaries, V: enamel, W: dentine, Y: pulp cavity.
b)
i. V is enamel; wearing off exposes the dentine and cavity hence
making the tooth sensitive and painful.
ii. Molar is used for crushing and grinding the food.
iii. Has wider crown for crushing and grinding food; root branched to
hold tooth firmly; has cusps for grinding food.
c) Brushing teeth after meals, eating foods rich in calcium and phosphorus.
577. Name the plant tissues involved in
a) Transpiration
b) Translocation
578.
a) Leaves/ xylem
b) Phloem
579. Give one factor that influences
a) Capillarity
b) Root pressure
Page 136
 580.
a) Thinness of the tube. In a thin tube, capillarity is faster.
b) Height of the stem. Root pressure can only push water up a short distance.
581.
a) Differentiate between between natural immunity and artificial immunity.
b) Describe the importance of vaccines in the fight against diseases.
582. The diagram below represents a mammalian respiratory organ

a) Identify this organ and state where it is found.

b) State four characteristics of gaseous exchange surfaces which can be observed
in this organ.
583.
a) Lungs
b)
 A large surface area relative to the volume of the body.
 It is permeable to carbon dioxide and oxygen. This also makes it
permeable to water, which makes them moist.
 It has a thin membrane. In case of the gas exchange surface in human
lungs, the distance gases have to diffuse from the air to the blood is less
than 15µm.
 It has a ventilation mechanism to ensure a continuous supply of air to
the lungs.
584.
a) State the gas given out when hydrogen peroxide is broken down by catalase
enzyme.
b) Name the organ of the body of a mammal where the process in (a) takes place.
585.
a) Oxygen
b) Liver
586.
a) Name a pigment found in the Malpighian layer of the skin.
b) State two functions of this pigment.
587.

Page 137
 a) Melanin.
b) Melanin protects skin cells against UV rays; melanin gives color to the skin.
588. Name the functions of the following parts of an embryo
Part Function
Chorion
Amnion
Amniotic fluid
Umbilical cord
589.
Part Function
Chorion Surrounds the embryo offering protection
Amnion Surrounds the embryo creating an amnion cavity with
amniotic fluid
Amniotic fluid Keeps fetus moist; cushions the fetus; provides a stable
environment.
Umbilical cord Connects developing fetus to the placenta/ carry nutrients
to the fetus and carry metabolic wastes away of the fetus.
590.
a) Distinguish between homologous structures and analogous structures with
specific examples.
b) Name the type of evolution exhibited by comparing:
i. Flipper of whale and forelimb of desert rat.
ii. Wing of a bat and wing of butterfly
iii. Wing of a flamingo and wing of an insect
591.
a) Homologous structures: structures with common origin but modified for
different functions. Eg: pentadactyl limbs in mammals.
Analogous structures: they do not have the common origin but have the same
use. Eg: wings of birds and insects.
b)
i. Divergent evolution
ii. Convergent evolution
iii. Convergent evolution
592. The diagram below illustrates two types of joints

Page 138
 a) Identify the joints
b) Name U, T, R and S.
c) State the functions of U and S.
d) What name is given to joints containing S?
e) Distinguish between the types of movement in joints A and B.
593.
a) A: knee joint/ hinge joint
B: Hip or ball and socket joint
b) U: articular cartilage; T: muscle; R: tendon; S: synovial fluid.
c) S: lubrication, reduces friction at joints.
U: cover and protects the bone from wearing due to friction.
d) Synovial joints
e) Joint A allow movement in one plane only. Joint B allows movement in all
directions.
594.
a) What is meant by the following terms?
i. Nastic movements
ii. Tropic movements
b) Name any two external stimuli to which plants respond?
c) How do plants respond to the stimuli in (b) above?
d) Of what value to the plants are the types of responses stated in (c) above?
e) Apart from growth movements, name any two other developmental changes
which occur in plants in response to environmental stimuli.
595. Ann is polydactylous; this is a condition which means she has six fingers on
each hand and six toes on each foot. Polydactyly is controlled by one pair of genes,
and is caused by a dominant allele, P.
a) What is a dominant allele?
b) Ann has two dominant P alleles for polydactyly. What is the term for a person
who has two identical alleles for a particular gene?

Page 139
 c) Ann is married to a man with two recessive alleles (pp) for the condition. A
fertilized egg produced by the couple divides by mitosis to form two cells.
Which allele would the two cells contain?
d) What is a recessive allele?
e) A polydactylous man has one P allele and one p allele. He is married to a
woman who has two recessive alleles (pp) for the condition. They plan to have
a baby. What are the chances that their child will be polydactylous?
596.
a) What draws water all the way from the roots to the leaves of a plant?
b) What is transported in the xylem vessels?
c) What is transported along the phloem tissue?
d) Describe how cells become turgid but do not burst?
597.
a) For each of the bird's beak and feet describe their adaptations to the methods of
feeding and locomotion of foot E.

b) What features adapt birds for flying? State any four adaptations.
598. A student bought a chocolate bar and carried out several food tests on it. The
following results were obtained
Benedicts test: an orange color
Biuret test: the color remains blue
Iodine test: a blue-black color
a) What two types of food are present in the chocolate bar?
b) Using the results given above, give one reason to explain why a chocolate bar
is not a balanced diet.
c) Eating this kind of chocolate bar regularly may lead to someone becoming
overweight. Explain why.
599.
a) Describe the role of RNA polymerase in transcription.
b) Which other enzyme is involved in transcription and what is its role?
c) Why is splicing of pre-mRNA necessary?
Page 140
 d) A sequence of bases along the template strand of DNA is ATGCAAGTCCAG.
i. What is the sequence of bases on a messenger RNA molecule that has
been transcribed from this part of the DNA molecule?
ii. How many amino acids does the sequence code for?
e) A gene is made up of 756 pairs. The mRNA that is transcribed from this gene
is only 254 nucleotides long. Explain why there is this difference.
600.
a) The enzyme RNA polymerase moves along the template DNA strand causing
the nucleotides on this strand to join with the individual complementary
nucleotides from the pool which is present in the nucleus. The RNA
polymerase adds the nucleotides one at a time, to build a strand of mRNA until
it reaches a particular sequence of nucleotide bases on the DNA which it
recognizes as a stop code.
b) DNA helicase: it acts on a specific region of the DNA molecule to break the
hydrogen bonds between the bases, causing the two strands to separate and
expose the nucleotide bases in that region.
c) Splicing is necessary because pre-mRNA has nucleotide derived from introns
in DNA. These introns are non-functional and if left in the mRNA would lead
to the production of non-functional polypeptides or no polypeptides at all.
Splicing removes these non-functional introns from pre-mRNA.
d)
i. UACGUUCAGGUC
ii. 4 amino acids (one amino acid is coded for by three bases; 12
bases code for 4 amino acids).
e) Some of the base pairs in the genes are introns/ non-functional DNA. These
introns are spliced from mRNA so that the resulting mRNA has fewer
nucleotides.
601. The diagram shows part of the nitrogen cycle between the atmosphere, the
plants and the soil in a field of clover (a legume) and grass.

a) Name

Page 141
 i. The process by which atmospheric nitrogen is converted into
organic nitrogen.
ii. An organism capable of carrying out this process.
b) Outline how atmospheric nitrogen may be converted into inorganic nitrogen
without the aid of microorganisms.
c) Outline the sequence of processes involved in the conversion of organic to
inorganic nitrogen in the soil.
d) In terms of cycling of nitrogen in this field, state
i. Two consequences of the farmer cutting and removing the grass
and clover.
ii. The effect of the soil becoming waterlogged.
602. The diagram shows two oxyhemoglobin dissociation curves

a) Use the graph to explain why human hemoglobin

i. Is saturated with oxygen in the lungs
ii. Releases oxygen when it reaches the tissues
b) Explain what causes human oxyhemoglobin to give up a greater proportion of
the oxygen it carries during vigorous exercise.
c) Lugworms live in deep sand on sea shores. When the tide is in, they obtain
oxygen by pumping water over their gills. At low tide there is no water to
pump over the gills. Curve B on the graph shows the dissociation curve of
lugworm oxyhemoglobin. Explain the advantage of hemoglobin of this type to
the lugworm.
603. During the cardiac cycle the pressure in different chambers of the heart varies
in a regular pattern
a) State in which chamber of the heart
i. The greatest pressure is generated

Page 142
 ii. The greatest change in pressure occurs

The diagram shows the changes in blood pressure during one cardiac cycle

b) With reference to the diagram

i. Explain what is happening at X and Y.
ii. Calculate the heart rate in beats per minute. Show your working.
604. The table below shows the speed by which different axons conduct action
potentials
Axon Myelin Axon Transmission
diameter /µm speed /ms-1
Human motor neuron to leg Yes 20 120
muscle
Human sensory neuron from Yes 10 50
skin pressure receptor
Squid giant axon No 500 25
Human motor neuron to No 1 2
internal organ
a) Using data from the table, describe the effect of axon diameter on the speed of
conductance of an action potential.
b) The data show that a myelinated axon conducts an action potential faster than
an unmyelinated one. Explain why this is so.
c) What is the name of the cells whose membranes make the myelin sheath
around some types of neurons?

Page 143
 d) State whether the presence of myelin or the diameter of the axon has the
greater influence on the speed of conductance of an action potential. Use the
information from the table to explain your answer.
e) The squid is an ectothermic animal. This means that its body temperature
fluctuates with the temperature of the waters in which it lives. Suggest how
this might affect the speed a squid conducts action potentials along its axon.
605.
a) The greater the diameter of the axon, the faster the speed of conductance. From
the table, compare data from the table: myelinated axon with a diameter of 20
µm and a speed of 120 ms-1and that with a diameter of 10 µm and a speed of
50 ms-1. Also a non myelinated axon with a diameter of 500 µm and a speed of
25 ms-1and that with a diameter of 1 µm and a speed of 2 ms-1.
b) In myelinated axon, the myelin acts as an insulator, speeding the transmission
of nerve impulses. Action potentials can only form where there is no myelin (at
nodes of Ranvier). The action potential therefore jumps from node to node
(salutatory conduction) which makes its conductance faster. Thus, the action
potential jumps from node to node as it travels along the axon.
c) Schwann cells. Accept also oligodendrocytes
d) Yes. Compare data from the table: a myelinated axon conducts nerve impulses
at a speed of 120 ms-1whereas a non myelinated axon conducts impulses at a
speed of 25 ms-1. The presence of myelin has the greatest effect because a
myelinated human sensory axon conducts action potential at twice the speed of
the squid giant axon despite being 1/50th of its diameter.
e) Temperature affects the speed of conductance of action potentials. The higher
the temperature, the faster the speed of conductance quid’s conductance of
action potentials will therefore changes as the environmental temperature
changes. It will react more slowly at lower temperature.
606. An experiment was carried out with two groups of people. Group X has type I
diabetes mellitus while group Y did not (control group). Every 15 minutes blood
samples were taken from all members of both groups and the mean of levels of insulin,
glucagon, and glucose were calculated. After an hour, every person was given a
glucose drink. The results are shown in the figure below:

Page 144
 a) Name a hormone other than insulin and glucagon that is involved in regulating
blood glucose levels.
b) State two differences between groups X and Y in the way insulin secretion
responds to the drinking of glucose.
c) Suggest a reason why the glucose level falls in both groups during the first
hour.
d) Using information from the graphs, explain the changes in the blood glucose
level in group Y after the glucose drink.
e) Explain the difference in blood glucose level in group X compared to group Y.
f) Suggest what might happen to the blood glucose level of group X if they had
no food intake over the next 24 hours.
607.
a) Adrenaline/ cortisol
b) The rise in insulin level is greater in group Y than in group X. The rise in
insulin level is more rapid in group Y than in group X.
c) Glucose is removed from blood by cells using it for respiration.
d) Glucose level rises at first because the glucose that is drink is absorbed into the
blood (glucose line on the graph rises). This rise in blood glucose causes
insulin to be secreted from B cells in the pancreas (insulin line rises steeply).
Insulin causes increased uptake of glucose into liver and muscle cells, converts
glucose into glycogen and fat and increases cellular respiration. All these
actions have the effect of reducing glucose levels (glucose line falls from 2.5
hours). As the glucose level rises after one hour, so the glucagon level falls.
The reduction in glucagon level decreases glucose production from other

Page 145
 sources (from glycogen, amino acids and glycerol) and so also helps to reduce
blood glucose levels. As blood glucose level falls (after 2.5 hours) so the
glucagon level increases to help maintain the blood glucose at its normal level.
e) Group X has diabetes and therefore the intake of glucose does not stimulate
insulin production (insulin level as shown by the graph is low). The glucose
level in the blood therefore continue to rise (glucose line rises steeply) as there
is no insulin to reduce its level. Blood glucose level remains high, falling only
slightly as it is respired by cells.
f) As it was respired by cells, the glucose level would decrease steadily until it
fell below the normal level.
608. What are four main things that members of a species share?
609. All organisms of the same species
 Can interbreed to produce fertile offspring.
 Have the same number of chromosomes
 Are similar in appearance
 They share biochemical, physiological and anatomical characteristics.
610. The drawing in the figure has been made from an electron micrograph of a cell
lining the human intestine

a) Give the name of the structures labelled A to H.

b) Give the letter of the structure that best fits the following descriptions
i. Produces ATP
ii. Manufactures ribosomal RNA
iii. Possesses structures called cristae
iv. Produces the enzymes shown being released from the cell.
611.
a) A: Golgi apparatus, B: nuclear envelope; C: nucleoplasm; D: mitochondrion;
E: nuclear pore; F: Rough endoplasmic reticulum; G: Nucleolus; H: lysosome.
b) i. D; ii: G; iii. D; iv. F
612. The following list names a type of cell and a brief description of its role.
Suggest in each two organelles that might be numerous or well developed in that cell.
a) A sperm cell swims a considerable distance carrying a man’s chromosomes

Page 146
 b) A type of white blood cell engulfs and digests foreign matter.
c) Cells lining a kidney tubule reabsorb substances against a concentration
gradient.
d) Liver cells manufacture proteins and lipids at a rapid rate.
613.
a) Mitochondria and nucleus.
b) Golgi apparatus and lysosomes / transport vesicles
c) Microvilli and mitochondria
d) RER/ribosomes and SER
614.
a) Many diseases can be controlled through vaccination and some, like smallpox,
have been eradicated by this means. In the case of influenza, however, the
vaccine against it is not always effective. Suggest a reason for this.
b) Give three reasons why it has proved difficult to control tuberculosis by
vaccination.
615.
a) The influenza virus displays antigen variability. Its antigens change frequently
and so antibodies no longer recognize the virus. New vaccines are produced to
stimulate the production of new antigens that complement the new antigens.
b) Any three from: HIV infection means that more people have impaired immune
system/ more refugees carrying TB move frequently and live in overcrowded
temporary conditions/ more mobile population/ more elderly people – they
often have less effective immune system.
616.
a) Describe why the genetic code is described as
i.Universal
ii.Degenerate
iii.Non-overlapping
b) State three ways in which the molecular structure of RNA differs from DNA.
c) Distinguish between a codon and an anticodon
d) Explain why:
i.DNA needs to be chemically stable
ii.mRNA needs to be easily broken down (chemically unstable)
617.
a)
i. Universal because it is the same in all organisms.
ii. Degenerate because most amino acids have more than one codon.
iii. Non-overlapping because each nitrogen base in the sequence of
mRNA is read once.
b) RNA is smaller, DNA is larger; RNA is single stranded, DNA is double
stranded; RNA has Uracil, DNA has thymine…
Page 147
 c) A codon is a triplet of bases on mRNA that codes for an amino acid. An
anticodon is a triplet of bases on a transfer RNA that is complementary to the
codon.
d)
i. DNA needs to be stable to allow it to be passes from generation to
generation unchanged and thereby allow offspring to be very similar to
their parents. Any change in the DNA is a mutation and is normally
harmful.
ii. mRNA is produced to help manufacturing a protein e.g. enzymes. It would
be wasteful to produce them when they are not needed periodically.
mRNA breaks down once it has been used and is produced again only
when it is required.
618.
a) Name the cell organelle involved in translation.
b) A codon found on mRNA has the sequence of bases AUC. List the sequence of
bases found on:
i. The transfer RNA anticodon that attaches on this codon.
ii. The template strand that formed the mRNA codon
c) Describe the role of tRNA in the process of translation.
d) A strand of mRNA has 64 codons but the protein produced from it has only 63
amino acids. Suggest a reason for this difference.
619.
a) Ribosome
b)
i. UAG
ii. TAG
c) A tRNA attaches an amino acid at one end and has a sequence of three bases,
called an anticodon, at the other end. The tRNA molecule is transferred to a
ribosome on a mRNA molecule. The anticodon on tRNA pairs with the
complementary codon sequence on mRNA. Further tRNA molecules with
amino acids attached line up along the mRNA in the sequence determined by
the mRNA bases. The amino acids are joined by peptide bonds, therefore the
tRNA has helped to ensure the correct sequence of amino acids in the
polypeptide.
d) One of the anticodon is a stop codon that indicates the end of polypeptide
synthesis. Stop codons do not code for any amino acid and hence there is one
less amino acid than are codons.
620. The data below represents the concentrations of ions in the cell sap of a
bean plant and that of the water in the soil in which it grew
Ions Na+ K+ Mg2+ Ca2+ Cl- SO42-

Page 148
 Cell sap 50 49 11 13 101 13

Soil 1.2 0.5 3.0 1.3 1.0 0.67

water
a) Name the process involved in the uptake of ions from the soil to cell sap.
b) What effect would the following changes have on this process?
i. Reduced oxygen supply
ii. Increased concentration of glucose.
c) Other than the uptake of mineral ions, state the role played by this process in living
organisms.
621.
a) Distinguish between homodont and heterodont dentition
b) State the role of carnassial teeth in a lion.
c) An organism was found to have the dental formula below:

i. Calculate the total number of teeth in the organism.

ii. With a reason, suggest the mode of feeding of the organism from
which the dental formula was obtained.
622. Name the blood vessel that transports blood from:
a) Lungs to heart
b) The aorta to the kidneys
c) The aorta to the liver
d) Liver to the vena cava
e) The small intestines to the liver
623. A man claims to be the father of a child. The man is blood group A while
the mother is blood group A and the child is blood group AB. State with your reasons
whether you think the man could be the father of the child.
624.
a) Explain how meiosis and fertilization can result in genetic variation among
offspring.
b) Explain, using examples, how the environment may affect the phenotype of an
organism.
625. Color blindness is a condition characterized by the inability of the brain to
perceive certain colors accurately. The most common form is termed red-green color
blindness (RCG). RCG results from a recessive allele.
0.6 of females worldwide have RCG
8.0 of males worldwide have RCG
The figure below shows the occurrence of RCG in one family

Page 149
 a) Explain the meaning of the term allele and recessive
b) Explain why females are less likely than males to have RCG.
c) With reference to the figure, and using R for the dominant allele and r for
the recessive allele, state the genotypes of the individuals 1, 4, 6 and 10.
626.
a) Allele: different forms of the same gene. Recessive: an allele that is expressed
only in the homozygous state.
b) The allele for RCG is on the X chromosome. As a male has only one X
chromosome, he requires just one recessive allele to be colorblind.A female
has two X and so requires two alleles, which is less likely.
c) 1: XRXr; 4: XRY; 6: XrY; 10: XrXr
627.
a) Different conditions affect how enzymes work. Name one condition that might
vary between one organelle and another.
b) The enzymes that control a pathway are often attached to the inner membrane
of a cell organelle in a very precise sequence. Suggest why enzymes are
attached in a very precise sequence.
c) The figure below represents an enzyme and its substrate. Of the other four
molecules shown, one is a competitive inhibitor and one is a non-competitive
inhibitor of the enzyme.

i. What is the number of the molecule is a competitive inhibitor?

ii. What is the number of the molecule is a non-competitive
inhibitor?
d) Consider the following diagram showing end product inhibition

Page 150
 If the end product inhibited enzyme B, rather than enzyme A, what would be:
i. Initial effect on the quantity of intermediate 1.
ii. Overall longer term effect on the level of the end product?
628.
a) Substrate concentration. Not temperature.
b) In a metabolic pathway, the product of one reaction acts as the substrate for the
next reactions. By having the enzymes in appropriate sequence there is a
greater chance of each enzyme coming into contact with its substrate than
having the enzymes floating freely in the organelle. This is a more efficient
means of controlling the end products.
c)
i. 2
ii. 4
d)
i. B would increase
ii. It would be unchanged
629. The figure below represents a polypeptide made up of seven amino acids A-G

a) What is the chemical formula of the group represented by the box?

b) Name the type of bond that links amino acids together.
c) What is the type of reaction that links amino acids called
d) Name the test that is used to test for proteins
e) Proteins molecules are held together by a combination of the following peptide
bonds, hydrogen bonds, ionic bonds, disulfide bridges, hydrophobic
interactions. Which one or more of these bonds:
a) Maintains the primary structure of a protein?
b) Maintains the secondary structure of a protein?
c) Maintains the primary structure of a protein?
d) Are individually the two strongest?
630.
a) COOH
b) Peptide
c) Condensation

Page 151
 d) Biuret test: to 1cm3 of test solution, add 1 cm3 of sodium hydroxide (NaOH)
followed by 2 drops of copper (II) sulphate. If the color changes from blue to
purple, proteins are present. If the color remains blue, proteins are absent.
e)
i. Peptide
ii. Peptide and hydrogen
iii. Peptide, hydrogen, ionic, disulfide bridges and hydrophobic
interactions.
iv. Peptide and disulfide bridges
631.
a) What is meant by a selectively permeable membrane?
b) Under standard conditions of pressure and temperature, what is the water
potential of pure water?
c) Four cells have the following water potentials.

In what order would the cells be placed for water to pass from one cell to the
next if arranged in a line?
632.
a) A membrane that is permeable to water molecules (and a few other small
molecules) but not to larger molecules.
b) Zero
c) C, D, A, B
633.
a) Explain why enzymes function less well at lower temperatures.
b) Explain how high temperatures may prevent enzymes from functioning well.
c) Enzymes produced by microorganisms are responsible for spoiling food.
Using this fact and your knowledge of enzymes suggest a reason in each case
why the following procedures are carried out:
i. Food is heated to a high temperature before being canned.
ii. Some foods, such as onions are preserved in vinegar.
634.
a) To function, enzymes must physically collide with their substrate. Lower
temperature decreases the kinetic energy of both enzymes and substrate
molecules which move around less quickly. They hence collide less often and
therefore react less frequently.
b) The heat causes hydrogen and other bonds in the enzyme molecule to break.
The shape of the enzyme molecule changes as does the active site. The
substrate no longer fits the active site.

Page 152
 c)
i. High temperatures denature enzymes and so they cannot spoil the food.
ii. Vinegar is very acidic. The low pH will denature the enzymes and so
preserve the food.
635. Starch in the diet is digested by the enzymes amylase and then maltase to form
glucose. Glucose must be absorbed into the body so that it can be used by cells as a
substrate for respiration. The glucose is absorbed from the exchange surface of the
small intestine into the epithelial cells that line it. This absorption occurs partly by
diffusion.
a) Glucose molecules mostly diffuse into cells through the pores in the proteins
that span the phospholipid bilayer. Why do they not pass through the
phospholipid bilayer?
b) State two changes to the structure of plasma membrane that would increase the
rate at which glucose diffuses into cell.
c) The other molecule required by cells for respiration is oxygen. This diffuses
into the blood through the epithelial layers of the alveoli and blood capillaries.
By how much would each of the following changes increase or decrease the
rate of diffusion of oxygen?
i. The surface area of the alveoli is doubled
ii. The surface of the alveoli is halved and the oxygen concentration
gradient is doubled.
iii. The oxygen concentration gradient is halved and the total thickness of the
epithelial layers is doubled.
iv. The oxygen concentration of the blood is halved and the carbon dioxide
concentration of the alveoli is doubled.
636.
a) Because only lipid-soluble substances diffuse across the phospholipid bilayer
easily, water soluble ones such as glucose diffuse only very slowly.
b) It could increase its surface area with microvilli or have many protein with
pores that span the phospholipid bilayer. (NB: the thickness of the plasma
membrane does not vary to any degree).
c)
i. Increases two times / doubles
ii. No change
iii. Decreases four times / it is one quarter
iv. Increases two times / doubles
637. The figure below represents a phospholipid molecule

Page 153
 a) Give the names of the structures labelled A and B.
b) State how the structures A and B differ in the way they react to water.
c) Which chemical elements are found in fats?
d) What is meant by a saturated fatty acid?
638.
a) Why are enzymes effective in small quantities?
b) Explain why changing an amino acid that makes up the active site could
prevent the enzyme from functioning.
c) Why might changing certain amino acids that are not part of the active site also
prevent the enzyme from functioning?
639.
a) They are not used in the chemical reaction and so can be used again and again.
b) The changed amino acid may no longer bind to the substrate which will not be
well positioned if at all in the active site,
c) The changed amino acid may be one that forms the hydrogen bonds. If the new
amino acid does not form the hydrogen bonds the overall shape of the enzyme
will change, including the active site that the substrate may no longer fit.
640. Muntjac are small deer found throughout Asia. Cells at the base of the
epidermis in the epidermis continually divide by mitosis. The figure below shows the
chromosomes from a skin cell of a female Indian muntjac deer at metaphase of
mitosis.

a)
i. State the diploid chromosome number of the female Indian muntjac deer.
ii. Name X and state its role in mitosis
iii. On a copy, shade in a pair of homologous chromosomes
iv. Draw one of the chromosomes shown in the figure as it would appear
during anaphase of mitosis.

Page 154
 v.With a drawing show how one of its cells would appear in Anaphase I of
meiosis.
b) Outline what happens to a chromosome between the end of anaphase and the
start of the next mitosis.
c) During the formation of eggs in the ovary of the female Indian muntjac deer,
the chromosome number changes. State what happens to the chromosome
number and explain why this change is necessary.
641.
a)
i. 6
ii. Centromere: the site of attachment to spindle fibers
iii.

iv.
b) The chromosomes condense and become indistinct being visible only as
chromatin. The DNA is then used as a template to transcribe mRNA which is
used to form new proteins from which new cell organelles are constructed. In
the interphase, the DNA is replicated so that at the end of replication each
chromosome is made of two sister chromatids. At the end of anaphase, each
chromosome is made of one chromatid.
c) The chromosome number is halved from six to three during the process of
meiosis. This is necessary to maintain the diploid number of chromosomes (2n)
after of an egg by a sperm. Without this reduction, the number of chromosomes
would double at each generation.
642.
a) State two ways in which DNA of a prokaryotic cell differs from that of a
eukaryotic cell.
b) What is the function of the protein found in chromosomes?
c) How is the considerable length of a DNA molecule compacted into a
chromosome?
d) Suppose the total length of all the DNA in a single human muscle cell is 2.3
meters.
i. If all the DNA were distributed equally between the
chromosomes, what would be the length of DNA in each one?
ii. What do you think the length of DNA is in a brain cell?
643.
a) In prokaryotic cells the DNA is circular and is not associated with proteins (it
does not have chromosomes).
Page 155
 b) It keeps the DNA into position.
c) It is looped and coiled a number of times.
d)
i. 46 chromosomes in every cell
ii. 2.1 meters (all cells have the same quantity of DNA)
644.
a) The cardiac cycle describes the events that occur during one heartbeat. The
figure below shows the changes in blood pressure that occur within the left
atrium, left ventricle and aorta during one heartbeat.

In the table below, match up ach event during the cardiac cycle with an
appropriate number 1to 7 on the figure above. You should put only one
number in each box. You may use each number once, more than once or
not at all.
The first answer has been completed for you.
Event during the cardiac cycle Number
Atrioventricular (bicuspid) valve opens 6
Ventricular systole
Semilunar (aortic) valve closes
Left ventricle and left atrium both relaxing
Semilunar (aortic) valve opens
b) Explain the roles of the sinoatrial node (SA node), atrioventricular node (AV
node) and the purkyne tissue during one heartbeat.
645.
a) The missing numbers in sequence from the top down are: 1; 5; 2; 4.
b) A wave of excitation spreads out from the sinoatrial node across both atria,
causing their walls to contract. A layer of non-conductive tissue
(atrioventricular septum) prevents the wave crossing to the ventricles. The
wave of excitation is allowed to pass through a second group of cells called the
Page 156
 atrioventricular node (AV node), which lies between the atria. The
atrioventricular node, after a short delay (0.1 - 0.2 second), conveys a wave of
excitation between the ventricles along a series of specialized muscle fibers
called the Purkyne fibers through the atrioventricular septum to the base of the
ventricles. The wave of excitation is released from the Purkyne tissue, causing
the walls of the ventricles to contract quickly at the same time from the apex of
the heart upwards.
646. In mice there are several alleles of the gene that controls the intensity of
pigmentation of the fur. The alleles are listed in order of dominance with C as the
most dominant.
C = Full color
Cch = Chinchilla
Ch = Himalayan
Cp = Platinum
Ca = Albino
The gene for eye color has two alleles. The allele for black eyes, B, is dominant, while
the allele for red eyes, b, is recessive.
A mouse with full color and black eyes was crossed with a Himalayan mouse with
black eyes. One of the offspring was albino with red eyes.
Using the symbols above, draw a genetic diagram to show the genotypes and
phenotypesof the offspring of the cross.
647.
Parental phenotypes Full color and black eyes and Himalayan and black eyes
Parental genotypes CCaBb ChCaBb

Gametes CB, Cb, CaB, Cab and ChB, Chb, CaB, Cab.

Gametes CB Cb CaB Cab

Ch B CChBB CChBb ChCaB ChCaBb
h h h h a
Cb CC Bb CC bb C C Bb ChCabb
CaB CCaBB CCaBb CaCaBB CaCaBb
a a a a a
Cb CC Bb CC bb C C Bb CaCabb
6 offspring - Full color and black eyes
2 offspring - Full color and red eyes
3 offspring - Himalayan and black eyes
1 offspring - Himalayan and red eyes
3 offspring - Albino and black eyes
1 offspring - albino and red eyes
648. The fruit fly, Drosophila melanogaster, feeds on sugars found in damaged
fruits. A fly with normal features is called a wild type. It has a striped body and its

Page 157
 wings are longer than its abdomen. There are mutant variations such as an ebony
colored body or vestigial wings. These three types are shown below:

Wild type features are coded for by dominant alleles.

A for wild type body and B for wild type wings.
a) Two wild types fruit flies were crossed. Each had alleles A and B and carried
alleles for ebony body and vestigial wings. Draw a genetic diagram to show the
possible offspring of this cross.
b) When the two heterozygous fruit flies in (a) were crossed, 384 eggs hatched
and developed into adult flies. What will be the expected phenotypes in these
adult flies?
c) If the observed value are: 207 with striped body/Long wings; 79 with striped
body/vestigial wings; 68 with ebony body/Long wings and 30 with ebony
body/vestigial wings, calculate the chi square and state whether there is a
significant difference between observed and expected results. Use the chi
square table below

649.
a) A = allele for striped body; a = allele for ebony body
B = allele for long wings; b = allele for vestigial wings
Parental phenotypes: striped body/Long wings and striped body/Long wings
Parental genotypes: AaBb and AaBb
Gametes: AB, Ab, aB, ab and AB, Ab, aB, ab
Gametes AB Ab aB ab
AB AABB AABb AaBB AaBb
Ab AABb AAbb AaBb Aabb
aB AaBB AaBb aaBB aaBb
ab AaBb Aabb aaBb aabb
9 striped body/Long wings

Page 158
 3 striped body/vestigial wings
3 ebony body/Long wings
1 ebony body/vestigial wings
b) Among 384 eggs that hatched and developed into adult flies;
216 had striped body/Long wings
72 had striped body/vestigial wings
72 had ebony body/Long wings
24 had ebony body/vestigial wings
c)

The value is smaller than that observed in the chi square table above. So, there
is no significant difference between observed and expected results.
650. In the majority of photosynthetic organisms, fixation of carbon dioxide occurs
in the Calvin cycle. The figure below shows a summary of the Calvin cycle

a) State:
i. The name of the five carbon sugar in the cycle.
ii. The name of the enzyme that fixes carbon dioxide.
iii.Where in the chloroplast the Calvin cycle occurs?
iv. The name of another compound that is produced in the light
dependent reactions that is used in the Calvin cycle.
b) The figure below the changes in the relative concentrations of RuBP and GP
produced in the Calvin cycle before and after a light source is switched off. All
other conditions are constant.

Page 159
 Explain the changes in the relative concentrations of RuBP and GP after the
light source is switched off.
651.
a)
i. Ribulose
ii. Rubisco (ribulose biphosphate carboxylase)
iii. Stroma
iv. ATP or NADPH
b) Without the light, only the light independent reactions can continue. RuBP is
converted to GP for a while. However with no light, there is no ATP or
NADPH being made in the light dependent reactions. Therefore RuBP is not
regenerated in the Calvin cycle and its level falls. The GP is used up in making
triose phosphate and then hexose sugars and so its level also falls.
652. Sucrase is the enzyme that catalyzes the hydrolysis of sucrose. A student
investigated the effect of substrate concentration on the activity of this enzyme. Six
test-tubes were set up each containing 10 cm3 of different concentrations of sucrose
solutions. The test tubes were left in a water bath at 30 °C for ten minutes. After ten
minutes, 5 cm3 of a sucrase solution at 30 °C was added to each test-tube and the
reaction mixtures were stirred. After a further five minutes, the temperature of the
water bath was raised to above 85 °C and the same volume of Benedict’s solution
added to each test-tube in turn. The student recorded the time when a green color first
became visible in each test-tube The concentrations used and the student’s results are
shown in the table below.

a) Explain why the temperature of the water bath was raised to above 85 °C.

Page 160
 b) Copy the axes and sketch a graph to show the effect of substrate concentration
on the rate of hydrolysis of sucrose by sucrase.
c) With reference to the student’s results, describe and explain the effect of
increasing substrate concentration on the rate of hydrolysis of sucrose by
sucrase.
653. A number of metabolic diseases in mammals arise as a result of abnormal
endocrine function. Complete the table below concerned with this:
Name of abnormality Caused by lack of From (gland)
(hormone)
Dwarfism

Insulin

Water diabetes (diabetes

insipidus)
Thyroid of baby

654.
Name of abnormality Caused by lack of From (gland)
(hormone)
Dwarfism Growth hormone Pituitary gland

Diabetes mellitus / sugar Insulin Pancreas

diabetes
Water diabetes (diabetes Antidiuretic hormone Hypothalamus /
insipidus) (ADH) Pituitary gland

Cretinism Lack of thyroid Thyroid of baby

hormones
655. Name the parts of an angiosperm and of a mammal which:
Angiosperm Mammal

Make pollen / sperm

Receive pollen / sperm

Allow development of the embryo within

Are the intermediate source of food for the

embryo
Are responsible for the expulsion of the
embryo when it is fully developed.

Page 161
 656.
Angiosperm Mammal

Make pollen / sperm Anther Testis

Receive pollen / sperm Stigma Vagina

Allow development of the embryo within Ovary / carpel Uterus

Are the intermediate source of food for the Endosperm Placenta

embryo
Are responsible for the expulsion of the Fruit Uterus
embryo when it is fully developed.
657.
a) Explain why it is important that the daughter cells produced during a mitotic
cycle in humans are genetically identical.
b) Name two factors that increase the chance that a cancer cell will develop.
c) The figure below shows a cancer cell in the process of cell division.

With reference to the figure

i. Name the stage of cell division.
ii. Describe what is happening in the cell during this stage of cell
division.
iii. Describe how cancer cells develop into a tumor.
658.
a) So that the daughter cells have the same number of chromosomes as the parent
cell and so can carry out the same functions. If they were genetically different
they would be rejected by the body’s immune system
b) Any two from the following: genetic factors/ carcinogenic substances/
mutagenic substances such UV rays, tobacco smoke, gamma rays, viruses
Page 162
 c)
i. Cytokinesis
ii. The spindle fibers break down and the chromosomes become indistinct. The
nuclear envelope and nucleolus reform. The microtubules pull the two sides
of the cell surface membrane together so that the cell becomes narrower
towards its center until the opposite parts of the membrane fuse to give two
separate cells.
iii. Due to a mutation in the genes that regulate cell division, the cells continue
to divide uncontrollably and form a mass of tissue that does not differentiate
into specialized cells. Blood vessels develop within this tumor to supply the
cells with their necessary nutrients.
659.
a) Cell surface membranes are involved with the movement of substances into and
out of cells.
Calcium pumps in cell surface membranes maintain a concentration of calcium
ions inside the cytoplasm that is a thousand times lower than outside the cell.
The figure below shows the movement of calcium ions across a cell surface
membrane

With reference to the figure

i. Explain why calcium ions do not pass through the phospholipid bilayer.
ii. Name and describe the process by which calcium ions are moved across
the membranes.
b) Phagocytosis is the process by which bacteria are ingested by cells. Describe
the role of the cell surface membrane during phagocytosis.

Page 163
 c) Phagocytic cells contain many lysosomes. Describe the function of lysosomes
in destroying bacterial cells.
660.
a) Any two from the following: calcium ions are water soluble rather than lipid
soluble / are charged ions / are hydrophilic while the phospholipid layer is
hydrophobic.
b) Calcium ions are moved against their concentration gradients by active
transport. The ions bind with receptor proteins on the channel of carrier
proteins which span the membrane. On the inside of the cell, ATP binds to the
carrier protein causing it to change shape and open to the opposite side of the
membrane. The calcium ions are then released to the other side of the
membrane.
c) Receptor on the membrane recognize antibodies that have attached themselves
to antigens on the bacterial surface. As a result of a series of reactions, the
surface of the bacterium becomes coated with proteins called opsonins. This
facilitates the process where the membrane invaginates to enclose the bacteria
and then fuses to form a vesicle called a phagosome.
d) Lysosomes move towards the vesicle and fuse with it. Enzymes within the
lysosomes first break down the cell wall of bacteria by hydrolyzing the murein
of which it is made. Other enzymes from the lysosomes hydrolyze the peptide
bonds of proteins, the ester bonds of lipids and the glycosidic bonds of
carbohydrates to produce smaller soluble material. These soluble products are
absorbed into the cytoplasm of the phagocyte.
661. During the control of blood sugar in a mammal two antagonistic hormones are
employed. Fill in the table about them
Raises blood sugar Lowers blood sugar

Hormone’s name

Hormone’s source

Means of stimulating gland

to secrete
Main gland stimulated by
the hormone
662.
Raises blood sugar Lowers blood sugar

Hormone’s name Glucagon Insulin

Hormone’s source Pancreas / Alpha cells of the Pancreas / Beta cells of the
islets of Langerhans islets of Langerhans

Page 164
 Means of stimulating The hormone is transported The hormone is transported
gland to secrete through blood to the liver through blood to the liver
when blood glucose is when blood glucose is
lowered increased

Main gland stimulated Liver Liver

by the hormone

663. Statements A-G below refer to activity within the nucleus of a cell. Insert in the
table those activities going on at the three stages of mitosis and meiosis indicated
Mitosis Meiosis (first division)
Interphase
Metaphase
Anaphase
A: gene number is being duplicated; B: gene number is being halved; gene number is
remaining the same; D: genes are making enzymes; E: centromeres divide; F:
centromeres do not divide; G: pairs of homologous chromosomes line up on the
equator of the cell; H: individual chromosomes line up on the equator of the cell.

664.
Mitosis Meiosis (first division)
Interphase A, D A, D
Metaphase E, H F, G
Anaphase C B
665. Contrast the characteristics of insects with those of mammals by filling in the
blanks below
Insect Mammal
Position of skeleton in body
Main material of skeleton
Temperature control
Number of walking limbs
Where gaseous exchange occurs
Source of developing embryo’s food
666.
Insect Mammal
Position of skeleton in the body Outside Inside
(exoskeleton) (endoskeleton)
Main material of skeleton Chitin Bone
Temperature control Ectothermic Endothermic

Page 165
 Number of walking limbs 6 4
Where gaseous exchange occurs Trachea / Alveoli in the lungs
tracheoles
Source of developing embryo’s food Yolk (in the egg) Placenta (within the
mother)
667. Name and give the phylum of the organism which have the following effects on
health

Name Phylum
Cause malaria
Transmits malaria
Cause influenza
Cause athlete’s foot
Provide penicillin
Cause tetanus
Transmits venereal disease
668. Contrast the methods of gaseous exchange, locomotion, feeding and hearing in
a fish (such as a tilapia) with those of an adult frog by naming the structures involved
in each case below:
Fish Frog
Gaseous exchange
Locomotion
Feeding
hearing
669.
Fish Frog
Gaseous exchange Gills Lungs, skin
Locomotion Fins Limbs / 4 legs
Feeding Jaws Sticky tongue
hearing Lateral line Ear
670. The figure below shows a bacterial cell dividing by binary fission.

Page 166
 a) With reference to figure above, state three structural features of prokaryotic
cells that are not shown by eukaryotic cells.
b) Plant cells divide by mitosis, not binary fission.
i. State three roles of mitosis in plants
ii. Explain why cells that are produced as a result of mitosis are
genetically identical.
671.
a) Any three from the following: a prokaryotic cell lacks a nucleus/ has circular
rather than linear DNA which is not associated with proteins/ its internal
organelles are not bounded by a double membrane/ its ribosomes are
smaller…
b)
i. Any three from the following: growth / repair / asexual reproduction /
replacement of damaged cells
ii. They are identical because in anaphase stage of mitosis, identical sister
chromatids separate and enter each new cell. These chromatids are
identical because during the semi-conservative replication of DNA, each
strand acts as a template for the formation of a complementary strand.
The resulting two DNA helices formed are therefore identical and so the
two cells formed during mitosis have identical alleles and hence the same
genotype.
672.
a) What are the three basic components of a nucleotide?
b) In terms of the structure of DNA molecule, explain why the base pairings are
not adenine with guanine and thymine with cytosine?
c) Suggest a reason why the base pairings of adenine with cytosine and guanine
with thymine do not occur?
d) If 19.9% of the base pairs in human DNA is guanine, what percentage of
human DNA is thymine?

Page 167
 673.
a) Nitrogen base, sugar and phosphate group
b) Adenine and guanine are longer molecules than thymine and cytosine. Pairing
adenine and guanine would produce a long rung while pairing thymine with
cytosine and thymine produces a short rung.
c) The bases are linked by hydrogen bonds. The molecular structure might be
such that hydrogen bonds do not form between adenine and cytosine and
between guanine and thymine.
d) G = 19.9%. So cytosine is also equal to 19.9% since the amount of G = C. Also
A = T. So A + T = 100 – (19.9 + 19.9) = 60.2%
The amount of thymine is equal to 60.2/2 = 30.1%. A is also equal to 30.1%.
674.
a) Describe the structure of photosystems and explain how a photosystem
functions in cyclic photophosphorylation.
b) Explain briefly how reduced NADP is formed in the light-dependent stage of
photosynthesis and is used in the light-independent stage.
675. Both mosses and ferns show alternation of generations in their life cycles. Link
structures (a) – (f) concerning this with the appropriate description A –H.
A: reproduces sexually; B: reproduces asexually; C: needs water to reach the ovum; D:
needs wind for dispersal; E: grows from the zygote; F: grows into the gametophyte; G:
produces sperm; H: contains the ovum. Note: some structures can match with more
than one description.
(a) Sporophyte (d) Spore
(b) Gametophyte (e) Sperm
(c) Antheridium (f) Archegonium
676.
a) BE c) G e) C
b) AGH d) DF f) H
677. Name the structures in a bony fish that fulfill the following functions:
a) Moves the tail from side to side
b) Can act as hydroplanes
c) Provides buoyancy
d) Prevent roll
e) Sense obstacles
f) Sieve out matter that might damage the gills
g) Protects gills externally
678.
a) Muscle blocks
b) Pectoral fins
c) Swim bladder
d) Dorsal fins
e) Eye / lateral line
f) Gill-racker
g) Operculum
679. Name the part(s) of an insect-pollinated flower that usually:
a) Advertises by color and scent
b) Rewards insects with sugar solution
Page 168
 c) Enables the stigma to brush against the visiting insect
d) Protects the flower in bud
e) Contains ova (female gametes)
f) Contains ovules
680.
a) Petals
b) Nectary
c) Style
d) Sepals
e) Ovules
f) Ovary / carpels
681. Below is a diagram of the human digestive system. Name all the parts
indicated with a letter. Which letter indicates the part of the digestive system where:
a) Bile is temporary stored
b) Acid is added to food
c) Faeces leave the body
d) Most absorption takes place
e) Vitamins and minerals are stored
f) Water is absorbed

Page 169
 682.
a) What are stomata, and where are most of them found on a plant?
b) What gas enters stomata during photosynthesis and what gas pass out of
stomata during photosynthesis?
683. The polymerase chain reaction is a process which can be carried out in a
laboratory to make large quantities of identical DNA from very small samples. The
process is summarized in the flowchart.

Page 170
 a)
i. At the end of one cycle, two molecules of DNA have been
produced from each original molecule. How many DNA
molecules will have been produced from one molecule of DNA
after 5 complete cycles?
ii. Suggest one practical use to which this technique might b put.
b) Give two ways in which the polymerase chain reaction differs from the process
of transcription.
c) The polymerase chain reaction involves semi-conservative replication. Explain
what is meant by semi-conservative replication.
684. The stems of tomato plants can be different colors (green or purple) and may
be hairy or without hairs (hairless). Each character is controlled by a different gene.
Each gene has two alleles. The following symbols are used to represent the alleles
involved.
A: dominant allele for color
a: recessive allele for color
B: dominant allele for hairiness of stem
b: recessive allele for hairiness of stem
In an experiment. A homozygous tomato plant with a green, hairless stem was crossed
with a homozygous plant with a purple, hairy stem. The F1 were collected and grown.
All the resulting F1 seedlings had purple, hairy stems.
a) State the genotypes of each of the parent plants and of the F1 seedlings in this
cross.
b) The F1 plants were self-pollinated (interbred). The phenotypes and numbers
of offspring are given in a table below.
Phenotypes Number of offspring
Purple, hairy stem 293
Purple, hairless stem 15
Green, hairy stem 12
Green, hairless stem 98
i. In this dihybrid cross, what would be the expected ratio of the
phenotypes in the offspring?
ii. Explain the differences between the expected ratio and the
numbers shown in the table.

Page 171
 c) A tomato grower wants to find out which of the purple, hairy plants are
homozygous for both characters.
i. State the genotype of the plant which should be crossed with the
purple, hairy plants in this test cross.
ii. Explain why this genotype should be used.
685. Trace the path of a glucose molecule (naming only the larger blood vessels)
from intestinal capillaries to the brain where it is respired, and then trace the path of
respiratory carbon dioxide from the brain to the lungs.
686. Unlike oxygen, carbon monoxide gas (present in car exhaust fumes and certain
household gas supplies) forms a chemically stable compound with iron atoms in
hemoglobin.
a) In view of this, explain why it is very dangerous to breathe this gas for more
than a few minutes.
b) If a person’s blood is damaged by carbon monoxide gas, what two processes
may eventually return his blood cells to normal?
687. Blood which flows through capillaries in the feet is at low pressure. Explain
how it is returned to the heart against the force of gravity?
688. The diagram below shows the structure of a bacterial cell seen using an
electron microscope.

a) Name the parts labelled A, B, C and D.

b) What is the magnification of the drawing?
c) Give two reasons why viruses are an exception to the cell theory.
689. The process of photosynthesis can be subdivided into two stages, one
dependent on light; the other independent of light.
a) Copy and complete the table to show the substances used in, and the end
products of, each of these stages. (Do not include solar energy).
Light dependent stage Light independent stage

Substances used 1. Water 1. Reduced NADP

2. Inorganic 2. ATP
phosphate 3. …………
3. ADP 4. …………
4. NADP
End products 1. ATP 1. NADP
2. ……… 2. ADP
3. ……… 3. Inorganic phosphate

Page 172
 4. Carbohydrate

b) What are the functions of reduced NADP and ATP in the light independent
stage of photosynthesis?
c) The graph below shows the effect of temperature on the rate of photosynthesis.

i. Explain why increasing the temperature from XºC to YºC

increases the rate of photosynthesis.
ii. Explain why increasing the temperature from YºC to ZºC
decreases the rate of photosynthesis.
690.
a) Explain what is meant by the term translocation in plants.
b) Outline the role of companion cells in translocation.
c) Outline one experimental method that has been used to show that translocation
takes place in phloem.
691. Below is a diagram of the human female reproductive tract indicating the
position of the endometrium.

a) Outline the changes which take place in the endometrium during the menstrual
cycle.
b) List three ways in which the normal sequence of events of the menstrual cycle
in sexually mature females may be altered.
c) State what happens to the muscle tissues of the uterus wall and the cervix
during the birth of a baby.

Page 173
 Endometriosis is a condition which arises when cells from the endometrium pass into
the oviducts and implant around the ovaries. The condition can result in damage to
ovarian tissue, causing reduced fertility.
The graph shows the results of a three-year study to compare the levels of successful
conception in couples in which the female was either normal or affected by
endometriosis.

d) With reference to the graph and the information given, state the effect that the
condition has on the chances of successful conception.
Women with a severe form of endometriosis are unlikely to conceive naturally
and may be offered in vitro fertilization (IVF).
e) State three ethical objections to IVF.
692. In tomatoes, the alleles for red fruit, R, is dominant to that for yellow fruit, r.
The allele for tall plant, T, is dominant to that for short plant, t. The two genes
concerned are on different chromosomes.
(a) A tomato plant is homozygous for allele R. Giving a reason for your answer in
each case, how many copies of this allele would be found in
(i) A male gamete produced by this plant
(ii) A leaf cell from this plant?
(b) A cross was made between two tomato plants.
(i) The possible genotypes of the gametes of the plant chosen as the male
parent were RT, Rt, rT and rt. What was the genotype of this plant?
(ii) The possible genotypes of the gametes of the plant chosen as female
parent were rt and rT. What was the phenotype of this plant?
(iii) What proportion of the offspring of this cross would you expect to have
red fruit? Use a genetic diagram to explain your answer.
693.
a)
i. One copy, as only one chromosome is present from each pair as the
chromosome number is halved at meiosis, i.e haploid number.
ii. Two copies, as in a leaf cell the chromosomes are in pairs, i.e diploid
b)
i. RrTt
ii. Yellow fruit, tall
iii.
Page 174
 rT rt
RT RrTT RrTt
Rt RrTt Rrtt
rT rrTT rrTt
rt rrTt rrtt
50% have red fruits
694. A potometer was assembled and the time for a bubble to travel 50 mm along
the capillary tube was found under the following conditions:
Plant leaves enclosed in a plastic bag (left for 30 minutes before readings taken),
Potometer in wind,
Potometer in shade
Potometer in darkness
Potometer in bright sunlight.
Five readings were taken under each of these conditions and average times recorded.
Condition Average time taken (seconds) for bubble to travel 50 mm
Enclosed in plastic 70
bag
Wind 42
Shade 57
Darkness 62
Bright sunlight 53
a) What conclusions can you draw from these results about the factors which
control evaporation of water from leaves?
b) Why were five readings necessary for each condition?
c) Suggest reasons why evaporation rate varies in the way indicated by these
results?
d) How could this apparatus be used to calculate the amount of water absorbed by
the shoot?
695. The following table shows the energy expended by a man depending on what
he was doing.
Activity KJ/minute
Sleeping 4.2
Sitting reading 5.8
Sawing wood 37.6
Heavy lifting 48.0
a) Name two body processes which require energy while the man is asleep.
b) Assuming the man sits still while reading. What activity is causing extra energy
expenditure?
c) For what purpose would the majority of extra energy be used during sawing
and lifting?
696. In humans, Huntington’s disease is caused by a dominant, mutant gene Draw a
genetic diagram to show the possible genotypes and phenotypes of the offspring

Page 175
 produced by a man with one allele for the disease and a woman who does not suffer
from the disease.
697. Phloem transfer cells are specialized companion cells that load sucrose into
sieve tube elements. The figure below is an electron micrograph showing phloem
tissue from a leaf of Phaseolus vulgaris. The section shows two sieve tube elements
and four phloem transfer cells. The sieve tube elements are small in this section
because it is taken at the end of a vein in the leaf.
It is thought that the many ingrowths of the cell walls in figure below are related to the
movement of large quantities of sucrose.

a) Describe how companion cells load sucrose in phloem sieve tubes.

b) Transfer cells move large quantities of sucrose into phloem sieve tubes. Suggest
why these cells have cell wall ingrowths as shown in the figure above.
c)
i. Explain the advantage of studying cells such as transfer cells with the
electron microscope rather than the light microscope.
ii. Describe the appearance of phloem sieve tubes when viewed in
longitudinal section.
698. The Atlantic herring, Clupea harengus, lives in large populations called shoals
and may grow up to 40 cm long. The figure below shows the appearance of Clupea
harengus.

The length of Clupea harengus shows wide variation. The figure below shows the
numbers of fish of different lengths in a population of Clupea harengus.
The arrows show the selection pressures P and S.

Page 176
 a) On a copy of the axes below, sketch a graph to show the distribution of length of
C. harengus, when selection pressures P and S operate for a few years.

b) Name this type of natural selection.

c) On a copy of the axes below, sketch a graph to show the distribution of length of
C. harengus, when selection pressure S alone operates for a few years.

d) Suggest two examples of selection pressure S.

699. In poultry, feather color is controlled by two sets of alleles, W (white)
dominant over w (colored) and B (black) dominant over b (brown).

Page 177
 a) Explain why the genetic constitution of WwBb is white.
b) Work out to show the phenotypic ratio of crossing a white cock (WwBb), with
a brown hen.
c) State the possible genotypes of a black fowl.
700.
a) The allele W prevents the expression of allele B in the phenotype when both
genes are present in a heterozygous state (WwBb). This condition is called
epistasis.
b) Parental genotypes: WwBb x wwbb
Gametes: WB, Wb, wB, wb and wb
Gametes WB Wb wB wb

wb WwBb Wwbb wwBb wwbb

Offspring phenotypes: 2/4 white; ¼ black; ¼ brown.

c) A bkack fowl can have genotypes: wwBB and wwBb.
701. In an oil seed plant species, the allele for tallness is dominant over that for
dwarfness. Meanwhile the allele for chlorophyll production and non-chlorophyll show
incomplete dominance. The heterozygous plants are variegated.
a) Using suitable symbols, construct a diagram of a cross between a tall plant
with green leaves and a dwarf plant with variegated leaves, to show the
genotypes and phenotypes of the offspring
b) Explain why 25% of the offspring of the cross in (a) would fail to survive.
702.
a) Let T be the allele for tall plant
t be the allele for tall plant
G be the allele for chlorophyll production
W be the allele for non-chlorophyll production
A tall plant with green leaves would have genotypes TTGG or TtGG while the
dwarf plant with variegated leaves would have genotype ttGW. Two crosses
are possible in this case.
Parents: TTGG x ttGW
Gametes: TG and tG, tW
Gametes tG tW

TG TtGG TtWG

Offspring phenotypes: ½ plant with tall stems and green leaves

½ plant with tall stems and variegated leaves
OR

Parents: TtGG x ttGW

Page 178
 Gametes: TG, tG and tG, tW
Gametes tG tW

TG TtGG TtWG

tG ttGG ttGW

Offspring phenotypes: ¼ plant with tall stems and green leaves

¼ plant with tall stems and variegated leaves
¼ plant with dwarf stems and green leaves
¼ plant with dwarf stems and variegated leaves
b) In the second case, 25% of the offspring have survival disadvantage in being
dwarf with variegated leaves. They cannot reach out for enough light and do
not have enough chlorophyll to absorb light for photosynthesis.
703. You are provided with three solutions: A, B and C. One solution contains the
enzyme amylase, one contains starch and one contains glucose. Starch is the substrate
of the enzyme. The product is the sugar maltose. You are provided with only one
reagent, Benedict’s solution, and the usual laboratory apparatus
a) Outline the procedure you would follow to identify the three solutions.
b) What type of reaction is catalysed by the enzyme?
704. A cell with four chromosomes undergoes a cell cycle including mitosis. Which
diagram correctly shows the changes in chromatid number during interphase?

705. Diagram 1 below shows a plant cell dividing by mitosis. Only two of the many
chromosomes are shown for simplicity.

a) What stage of mitosis is shown?

b) Draw prophase for the same cell assuming the cell has only two chromosomes, as in
diagram 1.

Page 179
 706. Which of the following statements are true and which are false?
a) Centrosomes are replicated before M phase of the cell cycle begins.
b) Sister chromatids contain identical DNA.
c) The microtubules attached to a given kinetochore extend to both poles of the
spindle.
d) Microtubule polymerisation and depolymerisation is a feature of the S phase of
the cell cycle.
e) Kinetochores are found in the centrosomes.
f) Telomeres are the sites of attachment of microtubules during mitosis.
g) Sister chromatids remain paired as they line up on the spindle at metaphase.
707.
a) Name three cell types found in:
i. xylem
ii. phloem
b) State the functions of the cell types you have named.
708. Explain how water moves from:
a) The soil into a root hair cell
b) One root cortex cell to another
c) A xylem vessel into a leaf mesophyll cell.
709. The figure is a photomicrograph of part of the kidney.

a) Name A, B, C and D.
b) Identify the region of the kidney shown in the figure and give a reason for your
identification.
c) Calculate the actual maximum width of the structure labelled A. Show your
working.
710.
a) A distal convoluted tubule; B Bowman’s capsule; C glomerulus / capillary; D
proximal convoluted tubule.
b) Cortex; glomeruli / convoluted tubules, are only found in the cortex.
c) distance = 10 mm = 10 000 μm

Page 180
 711. The rate of movement of molecules or ions across a cell surface membrane is
affected by the relative concentrations of the molecules or ions on either side of the
membrane. The graphs below show the effect of concentration difference (the
steepness of the concentration gradient) on three transport processes, namely diffusion,
facilitated diffusion and active transport.

a) With reference to the graphs, state what the three transport processes have in
common.
b) Explain the rates of transport observed when the concentration difference is zero.
c) Which one of the processes would stop if a respiratory inhibitor were added?
Explain your answer.
d) Explain the difference between the graphs for diffusion and facilitated diffusion.
712.
a) The greater the concentration difference, the greater the rate of transport;
b) (net) diffusion and facilitated diffusion only occur if there is a concentration,
difference / gradient, across the membrane or at equilibrium / if no concentration
difference, there is no, net exchange / transport across membrane / rate of
transport, is same in both directions; AW active transport can occur even if no
concentration difference; because molecules / ions are being pumped;
c) Active transport becauseactive transport depends on a supply of ATP;
provided by respiration.
d) The graph for diffusion is linear / straight line (with no maximum rate); purely
physical process / not dependent on transport proteins / channel or carrier
proteins; graph for facilitated diffusion is a curve with a maximum rate; AW
Facilitated diffusion depends on presence of, transport proteins / channel or
carrier proteins; as concentration increases, the receptor sites of these proteins
become more and more saturated / the more saturated these become, the less the
effect of increasing concentration; rate reaches a maximum when all, transport /
channel or carrier proteins, are working at full capacity / when all receptor sites
are, full / saturated.
713. Copy the diagrams below.

Page 181
 a) Identify with labels which one represents a lipid and which a phospholipid. [1]
b) For molecule A, indicate on the diagram where hydrolysis would take place if the
molecule was digested. Name the products of digestion. [2]
c) Each molecule has a head with tails attached. For molecule B, label the head to
identify its chemical nature. [1]
d) Which of the two molecules is water-soluble? Explain your answer.
e) State one function of each molecule.
714.
a) A identified as lipid, B identified as phospholipid.
b) Junction between head and tail for all three tails is indicated on diagram. Products
of digestion: fatty acidsandglycerol.
c) Head of phospholipid is labelled phosphate;
d) Phospholipid / B. Reason:phosphate is, charged / polar / hydrophilic;
e) Lipid: energy store / insulator / buoyancy / source of metabolic water / any other
suitable example; phospholipid: any reference to the importance of phospholipids
in structure of membranes.
715.
a) Copy the following table to summarize some differences between collagen and
hemoglobin.

Use the following to guide you.

Row 1: State whether globular or fibrous.
Row 2: State whether entirely helical or partly helical.
Row 3: State the type of helix.
Row 4: State whether a prosthetic group is present or absent.
Row 5: State whether soluble in water or insoluble in water.
b) State one way in which the structure of haemoglobin is related to its function.
c) Haemoglobin possesses a quaternary structure. What does this mean?
d) Name the five elements found in haemoglobin.
716.
a)

Page 182
 b) 1 mark for structural feature, 1 mark for linking this feature to its function E.g.
haemoglobin contains iron. Iron combines with oxygen.
c) The molecule has more than one polypeptide chain; R molecule has four
polypeptide chains
d) Carbon, hydrogen, oxygen, nitrogen, iron.
717. Copy and complete the following table, which compares light microscopes
with electron microscopes. Some boxes have been filled in for you.

718.

Page 183
 719. Bacillus thuringiensis produces a protein that is toxic to leaf-eating caterpillars.
This protein has been use by farmers as a natural insecticide. Recently, the gene that
codes for the toxin has been genetically engineered into several crop plants.
a) Outline how the gene that codes for the toxin could have been isolated.
The gene once isolated, is inserted into a host plant cell either by using the
bacterium Agrobacterium tumifaciens as a vector to infect a plant cell or using
a particle gun which shoots DNA-coated pellets into a plant cell.
b)
i. Suggest why a plasmid vector cannot be used to insert the gene
into plant cells.
ii. Explain why it is important to insert the gene into a single plant
cell rather than into a cell within a whole plant.
c) State two environmental implications of genetically engineered pest resistance
in plants.
It has been suggested that the integration of the gene for toxin production
fromBacillus thuringiensis into a wide range of crop plants could result in a
loss of the effectiveness of the toxin.
d) Suggest how this loss of effectiveness of the toxin might occur.
720. Animals in which genes have been altered by the technique of recombinant
DNA technology are referred to as transgenic animals.
This technique may be used, for example, to enable a sheep to produce milk which
contains proteins normally produced by humans. A human gene for the required
protein can be substituted for a similar gene in a sheep chromosome. The diagram
below shows the sequence of events in this process.

Page 184
 a) Name the enzyme which would be used to remove the gene for sheep protein
from the sheep chromosome.
b) Name the enzyme which would be used to attach the gene for the human
protein to the sheep chromosome.
c) Describe how the modified DNA might be reintroduced into a sheep.
d) Suggest two advantages of using transgenic animals rather than
microorganisms to produce human proteins.
721. In Africa, south of the Sahara and north of the Zambezi, the sickle cell allele
S
Hb is very common. In some ethnic groups the proportion of newborn babies that are
homozygous recessive can be as high as 0.053 (5.3 %). These babies suffer from sickle
cell anemia.
a) Calculate the frequency of the sickle cell allele in these ethnic groups.
b) Calculate the percentage of the population that are carriers of the sickle cell
allele.
c) Outline the reasons for the high frequency of the sickle cell allele in these
ethnic groups, despite the serious consequences of sickle cell anemia.
722. The diagram below shows a map of pBr322, a small piece of double-stranded,
circular DNA found in a bacterium in addition to the bacterial chromosome. The genes
for ampicillin resistance (Ampres) and tetracycline resistance (Tetres) are indicated.

Page 185
 Pst 1 is a restriction endonuclease (enzyme) that has its effect at the site shown. Pst 1

recognizes the base sequence and acts on the DNA between

guanine and adenine bases.
a) State the name given to such a piece of circular DNA.
b) Explain the use of such DNA in genetic engineering
c) Using the information given:
i. Explain what is meant by the term restriction endonuclease.
ii. Explain what is meant by the term sticky ends.
iii. Describe how foreign DNA could be inserted into pBr322 using Pst 1.
iv. Describe how it could be shown that bacteria in liquid culture had taken up
the modified pBr322.
723. Night blindness is a condition in which affected people have difficulty seeing
in dim light. The allele for night blindness, N, is dominant to the allele for normal
vision, n. (These alleles are not on the sex chromosomes). The diagram below shows
part of a family tree showing the inheritance of night blindness.

a) Individual 12 is a boy. What is his phenotype?

b) What is the genotype of individual 1? Explain the evidence for your answer.
c) What is the probability that the next child born to individuals 10 and 11 will be
a girl with night blindness? Show your working.
724. The drawing below shows a developing human embryo inside the uterus.

Page 186
 a)Name the parts marked A to D.
b)Name four substances which pass from the mother to the embryo.
c)Name one substance which passes from the embryo to the mother.
d)What are the functions of the parts labelled A to D?
725. The diagram below represents a cross between a heterozygous black male
mammal, and a white female. In these animals coat color is controlled by the alleles B
and b. The gene for black coat is dominant. Copy the diagram and answer the
questions.
a) In the circles write the genotypes of the parents, the gametes, and the F1
generation.
b) What is the ratio of young with black coats to those white coats in the F1
generation?
c) Which of the animals numbered in the diagram are homozygous?
d) If a black female from the F1 generation was crossed with its black male
parent, what ratio of black to white young would you expect to be produced?

726. If two Drosophila flies, heterozygous for genes of one allelomorphic pair, were
bred together and had 200 offspring, about how many would have the dominant

Page 187
 phenotype? Of these offspring some will be homozygous dominant and some
heterozygous. How is it possible to establish which is which?
727.
a) What is a cell?
b) Name three specialized animal cells and three specialized plant cells.
c) What is the name for a group of specialized cells which work together?
d) What is an organ? Name a plant and an animal organ.
728. Carry out the osmosis experiment illustrated below

a) Explain in detail why water gathers in the hollowed portion of potato B.

b) Why is potato A necessary in this experiment?
c) Explain why water does not gather in the hollowed-out portions of potatoes A
and C.
729.
a) What are the differences between aerobic and anaerobic respiration?
b) The table below shows the number of times a boy could raise a 400 g weight
with one finger during three, one-minute tests with no rest period in between.
1st test 2nd test 3rd test
Number of times 95 81 62
raised
Explain these results, using the words lactic acid, oxygen debt, and anaerobic
respiration.
730. The following table shows the energy expended by a man depending on what
he was doing
Activity KJ/minute
Sleeping 4.2
Sitting reading 5.8

Page 188
 Sawing wood 37.6
Heavy lifting 48.0
a) Name two body processes which require energy while the man is asleep.
b) Assuming the man sits still while reading, what activity is causing extra
energy expenditure?
c) For what purpose would the majority of extra energy be used during sawing
and lifting?
731.
a) Name two animals which reproduce by external fertilization and two which
reproduce by internal fertilization.
b) Which group of animals reproduces by both internal fertilization and internal
development?
c) Why does external fertilization require the production of many more gametes
than internal fertilization?
d) What are the advantages of internal development over development outside the
female’s body?
732. The diagram below is a diagram of the nitrogen cycle with certain parts
omitted.

Page 189
 a) Describe the two ways in which atmospheric nitrogen is converted into nitrates
(labels A and B).
b) Mechanism A involves an example of symbiosis. Explain symbiosis and
describe this particular example.
c) Name two organisms which produce ammonia from dead organisms (label C).
What is the name of this process?
d) What are the organisms called which change ammonia into nitrates (label D)?
e) Explain how some soil nitrates are converted back into atmospheric nitrogen
(label E).
f) Which substances released by animals from ammonia (label F)?
733. The figure below shows a potometer, an instrument used to measure the rate of
transpiration.

a) From your knowledge of how water moves up the stem, suggest a reason why
each of the following procedures is carried out when using the photometer
i. The leafy shoot is cut under water rather than in the air.
ii. All joints are sealed with waterproof jelly.
b) What assumption must be made if a potometer is used to measure the rate of
transpiration?
c) The volume of water taken in a given time can be calculated using the formula
πr2l (where π = 3 142, r = radius of the capillary tube, and l = the distance
moved by the air bubble). In an experiment the mean distance moved by the air
bubble in a capillary tube of radium 0.5 mm during 1 min was 15.28 mm.
Calculate the rate of water uptake in mm3h-1. Show your marking.

Page 190
 d) If a potometer is used to compare the transpiration rates of two different
species of plant, suggest one feature of both plant shoots that should, as far as
possible, be kept the same.
e) Suggest why the results obtained from a laboratory potometer experiment may
not be representative of the transpiration rate of the same plant in the wild.

734.
a) Name the stage during the mitotic cell cycle when replication of DNA occurs.
b) The figure below shows details of DNA replication.

i. Name the bonds shown by the dashed lines on the figure.

ii. Name the nitrogenous bases M and O.
c) Explain why DNA replication is described as semi-conservative.
d) The enzyme that catalyzes the replication of DNA checks for errors in the
process and corrects them. This makes sure that the cells produced in mitosis
are genetically identical. Explain why checking for errors and correcting them
is necessary.

Page 191
 735. DNA and RNA are important biological molecules that are involved in the
production of polypeptides. The figure below shows two nucleotides joined by a
covalent bond.

i. The figure above represents part of a DNA molecule, not part of

an RNA molecule. Explain why.
ii. Name the covalent bond between the two nucleotides.
iii. Name component X
b) Outline the role of transfer RNA (tRNA) in the production of a polypeptide.
c) Describe how a peptide bond is formed between two amino acids during
polypeptide production.
736. The figure below is a diagram of the surface of a leaf showing a stoma with its
guard cells and the surrounding epidermal cells.

a) Name the structure labelled X.

b) Explain the importance of guard cells having inner and outer walls of different
thicknesses.
c) Stomata usually open in the light. During the process of opening:
i. What is the name of the enzyme that is activated by light?
ii. What is the name of the ion that is moved into the guard cells?
iii. By what process does this ion enter the guard cell?

Page 192
 iv. Describe the relative water potential of the guard cells and the
epidermal cells when a stoma is open.
v. State how the volume of the guard cells changes when a stoma is
opening.
737. In mammals, hemoglobin is used to transport oxygen and myoglobin is used to
store oxygen in muscles. The figure below shows the oxygen dissociation curves for
myoglobin, fetal hemoglobin and adult hemoglobin.

a) Name the cells in which hemoglobin is found.

b) Use the figure to determine the percentage saturation of myoglobin and adult
hemoglobin when the partial pressure of oxygen is 3 KPa.
c) There is a large difference between the percentage saturation of myoglobin and
that of adult hemoglobin at low partial pressures of oxygen. Suggest reasons
for this.
738. The figure below shows a nephron from a mammalian kidney

Page 193
 a) Name the parts labelled A to H.
b)
i. Name a substance found in the blood plasma in the afferent arteriole but
not present in the structure labelled H.
ii. Explain why this substance is absent from structure H.
c)
i. Name a substance found in the structure labelled B but absent from the
fluid in the structure labelled E.
ii. Explain why this substance is absent from structure E.
739. Name two blood vessels through which blood passes on its journey from the
heart to the afferent arteriole. The figure below represents a cell from the wall of
structure H.

Page 194
 a) Calculate the magnification of the cell in the figure above. Show your working.
b) Name the structures labelled X.
c) Describe the function of the structures labelled X.
d) Name the structures labelled Y.
e) Explain why these cells have a large number of structure Y.
740. Mammals have closed, double circulatory systems.
a) Explain what is meant by the terms closed and double as applied to mammalian
circulatory systems.
The figure below shows a longitudinal section through a mammalian heart

Page 195
 b) Use label lines and the letters P, Q, R and S to label the following on the
figure: P – the right atrium, Q – a semilunar valve, R – a blood vessel that
carries deoxygenated blood, S – the position of the purkyne tissue.
741.
a) What is an antigen?
b) State two similarities of T cells and B cells.
c) State two differences between T cells and B cells.
742. The figure below shows part of the process of cell mediated immunity

a) What is the name of the structure labelled X?

Page 196
 b) Where did structure X originally come from?
c) Give an alternative name of the cell labelled phagocyte.
d) What type of T cell is shown in the figure?
e) This type of T cell divides by mitosis to form long lasting cells. What is this
type of cell?
f) The T cell secretes chemicals called cytokines. State two effects of cytokines.
743. The figure below represents the main stages of aerobic respiration.

a) State precisely where the reaction in boxes A, B and C occur in the cell.
b) What substance is X?
c) A total of 38 molecules of ATP is formed during the complete breakdown of
one molecule of glucose. State how many molecules are formed at each stages
A, B and C.
d) If glucose is burned, the energy transferred as heat and light is 2881 KJmol-1.
In the reactions described above, some of the energy is retained in the form of
ATP. The energy trapped in ATP is 50KYmol-1. Calculate the percentage of
the energy made available from the breakdown of one molecule of glucose
which is retained for biological reactions in the cell. Show your working.
744.
a) A: cytoplasm / cytosol; B: matrix of mitochondria; C: inner membranes of
mitochondria / cristae of mitochondria
b) Carbon dioxide
c) Stage A: 2 molecules of ATP (net); Stage B: 2 molecules of ATP; Stage c: 34
molecules of ATP
Page 197
 d) Total number of ATP molecules formed from 1 molecule from 1 molecule of
glucose during respiration = 38; each ATP molecule traps 50 KJ, therefore a
total of

745. The diagram below shows some of the three stages in anaerobic respiration in a
muscle.
a)
i. Name the process shows by stages A to C.
ii. Where in a cell this process occurs.
b)
i. Give two uses of ATP in cells
ii. At which of the stages shown in the diagram is ATP used?
+
c) NADH + H is a reduced coenzyme which is involved in anaerobic respiration.
At which of the stages shown is NADH + H+ oxidized?
746.
a)
i. Glycolysis
ii. Cytoplasm / cytosol
b)
i. Active transport / ions pumps; phosphorylation / donation of
phosphate to a substrate / named substrate / stage A used as an
example e.g. protein synthesis, muscle contraction; DNA
replication; cell division; light-independent stage of
photosynthesis.
ii. Stage A
c) Stage D

Page 198
Page 199
Page 200