J. Antibiot.

61(3): 120–127, 2008

THE JOURNAL OF
ORIGINAL ARTICLE ANTIBIOTICS

CRP Regulator Modulates Multidrug Resistance of

Escherichia coli by Repressing the mdtEF Multidrug
Efflux Genes
Kunihiko Nishino, Yasuko Senda, Akihito Yamaguchi

Received: September 25, 2007 / Accepted: February 26, 2008

© Japan Antibiotics Research Association

Abstract Multidrug efflux pumps contribute to the Introduction

resistance of Escherichia coli against many antibiotics and
biocides. Here, we report that the CRP regulator modulates Multidrug efflux pumps cause serious problems in cancer
multidrug resistance in E. coli through repression of the chemotherapy and the treatment of bacterial infections. In
genes encoding the MdtEF multidrug efflux pump. bacteria, resistance to drugs is associated with multidrug
Screening of mutants for ability to increase b -lactam efflux pumps that function to decrease cellular drug
resistance in E. coli led to the identification of a mutation in accumulation [1, 2]. Such pumps are classified into the
crp, which codes for the major global regulator of following five families on the basis of sequence similarity:
catabolite-sensitive operons. Deletion of crp significantly 1) the major facilitator, 2) resistance-nodulation-cell
increased the resistance of the E. coli strain to oxacillin, division (RND), 3) small multidrug resistance, 4) multidrug
azithromycin, erythromycin and crystal violet. The increase and toxic compound extrusion, and 5) ATP-binding cassette
in drug resistance caused by crp deletion was completely families [3
5]. In Gram-negative bacteria, pumps
suppressed by deletion of the multifunctional outer belonging to the RND family are especially effective in
membrane channel gene tolC. TolC interacts with different generating resistance [1, 6
8]. The sequencing of bacterial
drug efflux pumps. Among the twenty drug efflux pumps in genomes enables us to trace putative drug-resistance genes
E. coli, quantitative real-time PCR analysis showed that [9, 10]. There are many putative and proven drug efflux
CRP repressed the expression of mdtEF. Deletion of mdtEF pumps in the genome of Escherichia coli. Our previous
completely suppressed CRP-modulated multidrug studies have shown that E. coli has twenty functional drug
resistance. Therefore, in addition to its role in catabolite efflux pumps [11]. Because many of these pumps have
control, CRP contributes to multidrug resistance in E. coli. overlapping substrate spectra [11], it is intriguing that
Our results indicate that the CRP regulator modulates bacteria, with their economically organized genomes,
multidrug resistance in E. coli by repressing expression of harbor such large sets of multidrug efflux genes.
the MdtEF multidrug efflux pump. The key to understanding how bacteria utilize these
multiple pumps lies in the regulation of pump expression.
Keywords CRP, efflux pump, Escherichia coli, MdtEF, Currently available data show that multidrug efflux pumps
multidrug resistance are often expressed under precise and elaborate
transcriptional control [12
15]. Expression of acrAB,

K. Nishino, A. Yamaguchi (Corresponding authors), Y. Senda, Tokyo, Japan

Department of Cell Membrane Biology, Institute of Scientific and A. Yamaguchi: CREST, Japan Science and Technology Agency,
Industrial Research, Osaka University, 8-1 Mihogaoka, Ibaraki, Tokyo, Japan
Osaka 567-0047, Japan, E-mail: nishino@sanken.osaka-u.ac.jp; K. Nishino, Y. Senda, A. Yamaguchi: Graduate School of
akihito@sanken.osaka-u.ac.jp Pharmaceutical Sciences, Osaka University, Osaka, Japan
K. Nishino: PRESTO, Japan Science and Technology Agency,
 121

Table 1 Escherichia coli strains used in this study

Strain or Plasmid Original name Characteristics Source or references

Strains as in text
KAM3 KAM3 Derivative of TG1 that lacks acrB 21
D crp NKE 1220 KAM3Dcrp This study
D tolC NKE 822 KAM3DtolC This study
D tolCD crp NKE 1221 KAM3DtolCDcrp This study
D mdtEF NKE 356 KAM3DmdtEF 34
D mdtEFD crp NKE 1222 KAM3DmdtEFDcrp This study

which encodes the major AcrAB efflux pump, is subject to complex was electroporated into KAM3, then
multiple levels of regulation. In E. coli, it is modulated approximately 10,000 colonies were screened. Cells were
locally by the local repressor AcrR [16]. At a more global plated on LB-agar medium [22] containing 25 m g/ml
level, it is modulated by stress conditions and by global kanamycin and inhibitory concentrations of various drugs.
regulators such as MarA, SoxS and Rob [17, 18]. These Genomic DNA was prepared from the drug-resistant strains
examples illustrate the complexity and diversity of the digested with SmaI, then immediately ligated. Ligation
mechanisms regulating bacterial multidrug efflux pumps. products were electroporated into strain EC100D pir-116
The E. coli cyclic AMP receptor protein (CRP) is an and kanamycin-resistant transformants were selected.
important transcription factor that regulates the initiation of Plasmid DNAs were purified from these strains and were
transcription for more than 100 genes, mainly involved in sequenced with primers KAN-2 FP-1 and R6KAN-2 RP-1
the catabolism of carbon sources other than glucose [19]. (Epicenter). Sequence data were used to interrogate the E.
E. coli utilizes glucose preferentially over other sugars and coli MG1655 sequence (http://genolist.pasteur.fr/Colibri/)
only catabolizes other sugars when the supply of glucose is to identify the sites of transposon insertion.
depleted [20]. The presence of glucose prevents E. coli
from catabolizing alternative sugars by several Construction of Gene Deletion Mutants
mechanisms, one of which is to lower the level of cAMP, To construct gene deletion mutants from E. coli KAM3
the inducer for CRP. cells [21], precise in-frame deletions were generated by
In this study, we show that CRP contributes to multidrug crossover PCR with the primers listed in Table 2, described
resistance in E. coli in addition to its role in catabolite previously [23]. The fragment containing the deletion was
control. The results suggest a previously uncharacterized cloned into the BamHI site of the pKO3 vector [23], a gene
physiological role for CRP in multidrug resistance. replacement vector that contains a temperature-sensitive
origin of replication and markers for positive and negative
selection for chromosome integration and excision. The
Materials and Methods deletion was introduced into the chromosome by the pKO3
gene replacement protocol, as described previously [23].
Bacterial Strains, Plasmids and Growth Conditions
The bacterial strains and plasmids used in this study are Determination of the MIC for Toxic Compounds
listed in Table 1. The E. coli strains used are derived from The antibacterial activities of different agents were
the strain KAM3 [21]. Bacterial strains were grown at 37°C determined on L-agar (1.0% tryptone, 0.5% yeast extract,
in Luria-Bertani (LB) broth [22]. Cells were rapidly 0.5% NaCl) plates containing the compounds (Sigma)
collected for total RNA extraction when the cultures indicated in Table 3 at various concentrations. Agar plates
reached an optical density of 0.6 at 600 nm. were made by the two-fold agar dilution technique as
described [24]. To determine the MICs, bacteria were
Screening for Regulators of Multidrug Resistance grown in Luria-Bertani broth at 37°C overnight and diluted
DNA manipulation generally followed standard practice in the same medium, then tested at a final inoculum size of
[22]. Strain KAM3 was subjected to transposon 104 cfu m l1 using a multipoint inoculator (Sakuma
mutagenesis using the EZ-Tn5
R6Kg ori/KAN-2Tnp Seisakusyo, Tokyo, Japan), after incubation at 37°C for 20
Transposome kit (Epicenter) according to the hours. The MIC was the lowest concentration of compound
manufacturer’s instructions. Briefly, the Transposome that inhibited cell growth.
122

Table 2 Primers used in this study

Primer Sequence (5’ to 3’)

For gene deletion

crp-No CGCGCGGCCGCACAATCGACCACATCCTGACGCCC
crp-Ni CACGCAATAACCTTCACACTCCAAATTTATAACCATGCGCGGTTATCCTCTGTTATAAGC
crp-Ci GTTATAAATTTGGAGTGTGAAGGTTATTGCGTGTAATCCCGTCGGAGTGGCGCGTTAC
crp-Co CGCGTCGACCCAGTTAAACAATCCGTACCAGAG
tolC-No CGCGGATCCTCATCCCGGCAACCATCTC
tolC-Ni CACGCAATAACCTTCACACTCCAAATTTATAACCATTCCTTGTGGTGAAGCAGTAT
tolC-Ci GTTATAAATTTGGAGTGTGAAGGTTATTGCGTGTGATGACGACGACGGGG
tolC-Co CGCGGATCCGCTGGATTGCTGGGCC
mdtE-No CGCGGATCCCAGTTCAAAATTATGCAACTGATTCTG
mdtE-Ni CACGCAATAACCTTCACACTCCAAATTTATAACCATTTTAGTCCCTGAAAATTCTTGAG
mdtF-Ci GTTATAAATTTGGAGTGTGAAGGTTATTGCGTGTAACGTGTAAATGAGAGTAAGGTTGA
mdtF-Co CGCGGATCCCGTCAAATTCCTCTGCATACTATTGC
For quantitative PCR
rrsA-F CGGTGGAGCATGTGGTTTAA
rrsA-R GAAAACTTCCGTGGATGTCAAGA
acrA-F GTCTATCACCCTACGCGCTATCTT
acrA-R GCGCGCACGAACATACC
acrD-F GTACCCTGGCGATTTTTTCATT
acrD-R CGGTCACTCGCACATTCG
acrE-F CGTGATTGCCGCAAAAGC
acrE-R TTGGCGCAGTGACTTTGGTA
bcr-F TGTTTTTCTGTTCGTGATGACCAT
bcr-R GGAACATATTTAACGCGCCAAT
cusB-F CGCTTACCGTGGGCGATA
cusB-R TTCCACCCAGTCAGGAATGG
emrA-F GCGAATATTGAGGTGCAGAAAA
emrA-R GGCACACGGCGGTTGTA
emrD-F GTGGATCCCCGACTGGTTT
emrD-R CCCGGCACCGAAAAAGA
emrE-F GGTATTGTCCTGATTAGCTTACTGTCAT
emrE-R GCACAAATCAACATCATGCCTATAA
emrK-F GCGCTTAAACGTACGGATATTAAGA
emrK-R ACTGTTTCGCCGACCTGAAC
fsr-F TGGTGTTGGCGCAAATCA
fsr-R TCGTCGCTTTGGGTTTTCC
macA-F CGGTGATTGCCGCACAA
macA-R TTACCAGCATGGCGCTCAT
mdfA-F CTTGCTGTTAGCGCGTCTGA
mdfA-R GCCAGCCGCCCATAATAAT
mdtA-F CGCCGTAGAACAGGCAGTTC
mdtA-R TGCGCACCGTAACGGTATTA
mdtE-F CCCCCGGTTCGGTCAA
mdtE-R GGACGTATCTCGGCAACTTCAT
mdtF-F TTACCGTCAGCGCTACCTATCC
mdtF-R GCCATCAAGCCCATTCATATTT
mdtG-F CGGTATTGTCTTCAGCATTACATTTT
mdtG-R GGCGAGTCCACCCCAAA
mdtH-F TTTTCACCCTGATTTGTCTGTTTTAT
mdtH-R CAGCGAAGCACTTAAGGTTTCA
mdtJ-F TGATGAAAATTGCCGGGTTAA
 123

Table 2 Continued

Primer Sequence (5’ to 3’)

mdtJ-R CGCTTTACGGGTACCTGATTTTA
mdtK-F CCGGTTATCGCGCAATTAAAT
mdtK-R GAAACCTTGTCGCACCTGATG
mdtL-F TATCCCGCCGGGATTGATAT
mdtL-R CGCTTCGCTGGCATTGA
mdtM-F CGTGATTTTAATGCCGATGTCA
mdtM-R GCCATACCGCCAGCAAGAT
tolC-F CCGGGATTTCTGACACCTCTT
tolC-R TTTGTTCTGGCCCATATTGCT

RNA Extraction Table 3 Susceptibility of E. coli strains to b -lactams and

Total RNA was isolated from bacterial cultures using an toxic compounds
RNeasy Protect Bacteria Mini Kit (Qiagen) and RNase-
Free DNase (Qiagen) as described previously [25]. The MIC (m g/ml)
absence of genomic DNA from DNase-treated RNA Strain
OXA AZM ERM CV
samples was confirmed by both non-denaturing agarose
electrophoresis gels and PCR with primers known to target
KAM3 0.5 0.5 2 0.5
genomic DNA. The RNA concentration was determined
D crp 4 4 16 8
spectrophotometrically [22]. D tolC 0.5 0.5 2 0.5
D tolCD crp 0.5 0.5 2 0.5
Determination of Specific Transcript Levels by D mdtEF 0.5 0.5 2 0.5
Quantitative Real-time PCR Following Reverse D mdtEFD crp 0.5 0.5 2 0.5
Transcription
Bulk cDNA samples were synthesized from total RNA OXA, oxacillin; AZM, azithromycin; ERM, erythromycin; CV, crystal
using TaqMan Reverse Transcription Reagents (PE Applied violet.
Values in boldface are larger than those of KAM3 strain.
Biosystems) and random hexamers as described previously
MIC determinations were repeated at least three times.
[26, 27]. The specific primer pairs listed in Table 2 were
designed using ABI PRISM Primer Express software (PE
Applied Biosystems). rrs of the 16S rRNA gene was strain lacking a functional acrB gene in the screening in
chosen as the normalizing gene [28]. Real-time PCR was order to identify regulatory elements involved in the
performed with each specific primer pair using SYBR expression of other multidrug resistance systems. The
Green PCR Master Mix (PE Applied Biosystems). The transposon insertion mutants were made from the strain
reactions were run on an ABI PRISM 7000 Sequence KAM3 as described in Materials and Methods. The
Detection System (PE Applied Biosystems); the mutants were plated on LB agar containing 25 m g/ml
fluorescence signal due to SYBR Green intercalation was kanamycin and inhibitory concentrations of various drugs.
monitored to quantify the double-stranded DNA product In one experiment, the medium contained 2.0 m g/ml of
formed in each PCR cycle. oxacillin, which had an MIC of 0.5 m g/ml against KAM3.
When one of the mutant colonies that grew on this medium
was purified and reexamined, we indeed found a 8-fold
Results increase in oxacillin MIC against the transposon insertion
mutant (data not shown).
Mutation in the crp Locus Increases Resistance to Sequencing determined that the transposon was inserted
Oxacillin into the coding sequence of crp. CRP is the major global
Expression of multidrug efflux genes is often regulated in a regulator of catabolite-sensitive operons and it controls its
complex manner, as described in the introduction. We own synthesis [19]. It seemed possible that deletion of crp
therefore screened the mutants of E. coli that increased might be causing the transcriptional activation of genes
multidrug resistance levels in this organism. We used a host involved in oxacillin resistance.
124

To test whether deletion of crp confers oxacillin isolated from exponential-phase cultures of KAM3 and
resistance on the E. coli KAM3 strain, full-length wild-type D crp, and cDNA samples were synthesized using TaqMan
crp was deleted as described in Materials and Methods. reverse transcription reagents (PE Applied Biosysems) with
Oxacillin MICs for cells lacking crp were 8 times higher (4 random hexamers as primers. Real-time PCR of the cDNAs
versus 0.5 m g/ml) than for KAM3 cells (Table 3), was performed with each specific primer pair using SYBR
suggesting that the deletion of the CRP regulator indeed Green PCR Master Mix (PE Applied Biosystems). The
conferred oxacillin resistance on E. coli. expression levels of drug efflux pump genes and tolC in
D crp were compared with those in KAM3. The results are
Deletion of CRP Increases Resistance of E. coli to shown in Table 4. Expression of mdtE was significantly
Multiple Drugs increased. Deletion of crp did not increase the expression
Our results had shown that deletion of crp increased E. coli levels of other drug efflux genes and tolC (Table 4).
resistance to oxacillin. We therefore investigated the effect
of crp deletion on the susceptibility of E. coli to other toxic Effects of Deletion of the MdtEF Drug Efflux Pump on
compounds. Various drugs were tested, including common CRP-modulated Multidrug Resistance
substrates of multidrug efflux pumps, and we found that In order to determine whether multidrug resistance
crp deletion increased the resistance of the KAM3 strain to mediated by crp deletion is due to increased expression of
azithromycin, erythromycin and crystal violet (Table 3). mdtEF, we investigated the effects of deleting these genes
These results indicate that the deletion of the CRP regulator on drug resistance levels in KAM3 and D crp (Table 3).
induces multidrug resistance in E. coli. When mdtEF was deleted from the KAM3 strain there was
no change in drug resistance in the resulting strains. In the
Effect of tolC Deletion on the Multidrug Resistance
Modulated by CRP Table 4 Fold induction of specific transcripts attributed to
The results described above indicate that the expression of crp deletion as determined by qRT-PCR
a multidrug efflux pump may be induced by deletion of crp.
Gene Fold increase
In our previous study, it was revealed that at least twenty
intrinsic drug efflux transporters are encoded in the E. coli
acrA 0.920.067
chromosome [11]. Among these, RND-family transporters
acrD 1.10.081
play major roles in both intrinsic and elevated resistance of acrE 0.950.035
Gram-negative bacteria to a wide range of noxious bcr 1.20.12
compounds including s-lactams [1, 11, 29
31]. RND cusB 1.10.055
transporters need two other proteins for their function: a emrA 0.990.072
membrane fusion protein and an outer membrane channel. emrD 0.960.022
It has been reported that many drug transporter systems in emrE 1.10.071
E. coli need the membrane channel TolC in order to emrK 1.60.38
function [31
34]. fsr 0.830.13
To determine whether CRP-mediated multidrug macA 0.940.048
mdfA 1.10.15
resistance is attributable to the TolC-dependent drug efflux
mdtA 1.20.26
pump(s), we investigated the effect of tolC deletion on the
mdtE 343.5
drug resistance of the crp-deleted cells. The tolC deletion
mdtG 1.10.087
completely inhibited CRP-mediated multidrug resistance mdtH 1.30.28
(Table 3). This result indicates that CRP-mediated mdtJ 1.20.15
multidrug resistance is attributable to increased functioning mdtK 0.920.086
of a TolC-dependent drug efflux pump. mdtL 0.820.058
mdtM 0.850.11
Determination of the Amounts of Drug Exporter tolC 1.20.15
Transcripts by Quantitative Real-time Reverse
Transcription-PCR (qRT-PCR) The amount of transcript was determined by quantitative real-time PCR
as described in Materials and Methods. The fold change ratio was
In order to determine which drug efflux pump show
calculated by dividing the expression level of the gene in the D crp strain
increased expression when crp is deleted, we used qRT- by that in the KAM3 strain. Experiments were performed in triplicate
PCR to investigate changes in the amounts of drug efflux and the data are represented mean valuesstandard deviation. The
gene mRNAs dependent on crp deletion. Total RNAs were values in boldface type indicate inreases of more than tenfold.
 125

D mdtEF strain, deletion of crp conferred no drug resistance

(Table 3). Together, these data indicate that the multidrug
resistance conferred by deletion of the CRP regulator is due
to derepression of the mdtEF multidrug efflux genes.

Discussion

In this study, we performed a genome-wide search for a

regulator of multidrug resistance in E. coli by random
insertion and discovered that CRP down-regulates the
expression of mdtEF. We initially found by random
insertion that the mutation in crp conferred oxacillin
resistance on the KAM3 strain. Then we investigated the
susceptibility of the KAM3 strain lacking crp to various
drugs including common substrates of multidrug efflux Fig. 1 Model for CRP control of multidrug resistance.
pumps, and found that CRP modulates E. coli resistance to CRP controls expression of mdtEF multidrug efflux pump
oxacillin, azithromycin, erythromycin and crystal violet genes. The evidences in this study shows that CRP represses
(Table 3). mdtEF and deletion of crp causes multidrug resistance of
Escherichia coli.
A dominant mechanism by which E. coli and other
related bacteria sense carbon sufficiency involves cyclic
AMP and its receptor protein, CRP [19, 35]. CRP induces a needed in order to elucidate the biological significance of
sharp bend in the DNA and is capable of regulating the their regulatory networks. Such investigation may provide
expression of more than 100 genes. The mechanisms by further insights into the role of multidrug efflux systems in
which CRP regulates gene expression in response to the physiology of the cell.
variable cytoplasmic levels of cyclic AMP have been
extensively investigated with particular emphasis on E. coli Acknowledgements We thank Geroge M. Church and
and Salmonella strains [35
38]. Dozens of operons have Tomofusa Tsuchiya for providing strains and plasmids; and
been shown by classical approaches to be subject to CRP- members of our laboratory for comments on this work. We would
mediated control [39]. We have previously reported that N- also like to thank the anonymous reviewers for their thoughtful
comments on this work. This research was supported by a
acetyl-D-glucosamine induces the expression of mdtEF and
Research Aid from the Inoue Foundation for Science, the Okawa
this induction is dependent on nagE and crp, and inhibited
Foundation for Information and Telecommunications, Japan
by the addition of cyclic AMP [40]. In this study, we Research Foundation for Clinical Pharmacology, Kato Memorial
discovered the importance of CRP as a repressor of drug Bioscience Foundation, Ohyama Health Foundation Inc., Novartis
resistance through the regulation of the multidrug efflux Foundation (Japan) for the Promotion of Science, Takeda Science
pump MdtEF. These data indicates the connection between Foundation, Japan Antibiotics Research Association, Daiwa
the control of the multidrug efflux pump and sugar Securities Health Foundation, Yakult Bio-Science Foundation, the
metabolism. In this study, we used a complex growth Zoonosis Control Project of the Ministry of Agriculture, Forestry
medium in the absence of glucose. We recently measured and Fisheries of Japan, a Grant-in-Aid for Young Scientists (S)
the cellular amount of cAMP of the KAM3 strain in a from the Japan Society for the Promotion of Science, PRESTO,
complex growth medium with or without glucose. And we Japan Science and Technology Agency, Japan (to K.N.), the
found that glucose significantly reduces the cAMP amount Program for Promotion of Fundamental Studies in Health
Sciences of the National Institute of Biomedical Innovation, and a
of this strain and enhances its tolerance to multiple drugs
Grant from the Ministry of Education, Culture, Sports, Science
(Nishino K. et al., unpublished data).
and Technology of Japan (to K.N. and A.Y.).
In addition to the roles of CRP in catabolite control, we
found that it contributes to multidrug resistance in E. coli
by regulating the MdtEF multidrug efflux pump (Fig. 1).
Our results suggest a previously uncharacterized References
physiological role for CRP in multidrug resistance. Further
investigation of the regulation of multidrug efflux systems 1. Nikaido H. Multidrug efflux pumps of Gram-negative
in several natural environments, such as inside hosts, is bacteria. J Bacteriol 178: 5853–5859 (1996)
126

2. Zgurskaya HI, Nikaido H. Multidrug resistance EmrAB. J Bacteriol 177: 2328–2334 (1995)
mechanisms: drug efflux across two membranes. Mol
Microbiol 37: 219–225 (2000) 15. Grkovic S, Brown MH, Skurray RA. Regulation of bacterial
drug export systems. Microbiol Mol Biol Rev 66: 671–701
3. Putman M, van Veen HW, Konings WN. Molecular (2002)
properties of bacterial multidrug transporters. Microbiol
Mol Biol Rev 64: 672–693 (2000) 16. Ma D, Alberti M, Lynch C, Nikaido H, Hearst JE. The local
repressor AcrR plays a modulating role in the regulation of
4. Brown MH, Paulsen IT, Skurray RA. The multidrug efflux acrAB genes of Escherichia coli by global stress signals.
protein NorM is a prototype of a new family of transporters. Mol Microbiol 19: 101–112 (1996)
Mol Microbiol 31: 394–395 (1999)
17. Randall LP, Woodward MJ. The multiple antibiotic
5. Paulsen IT, Chen J, Nelson KE, Saier MH. Comparative resistance (mar) locus and its significance. Res Vet Sci 72:
genomics of microbial drug efflux systems. J Mol Microbiol 87–93 (2002)
Biotechnol 3: 145–150 (2001)
18. Rosenberg EY, Bertenthal D, Nilles ML, Bertrand KP,
6. Murakami S, Nakashima R, Yamashita E, Yamaguchi A. Nikaido H. Bile salts and fatty acids induce the expression
Crystal structure of bacterial multidrug efflux transporter of Escherichia coli AcrAB multidrug efflux pump through
AcrB. Nature 419: 587–593 (2002) their interaction with Rob regulatory protein. Mol Microbiol
48: 1609–1619 (2003)
7. Yu EW, Aires JR, Nikaido H. AcrB multidrug efflux pump
of Escherichia coli: composite substrate-binding cavity of 19. Kolb A, Busby S, Buc H, Garges S, Adhya S.
exceptional flexibility generates its extremely wide substrate Transcriptional regulation by cAMP and its receptor protein.
specificity. J Bacteriol 185: 5657–5664 (2003) Annu Rev Biochem 62: 749–795 (1993)

8. Murakami S, Nakashima R, Yamashita E, Matsumoto T, 20. Postma P. Catabolite repression and related phenomena.
Yamaguchi A. Crystal structures of a multidrug transporter Symp Soc Gen Microbiol 39: 21–49 (1986)
reveal a functionally rotating mechanism. Nature 443:
173–179 (2006) 21. Morita Y, Kodama K, Shiota S, Mine T, Kataoka A,
Mizushima T, Tsuchiya T. NorM, a putative multidrug efflux
9. Paulsen IT, Sliwinski MK, Saier MH. Microbial genome protein, of Vibrio parahaemolyticus and its homolog in
analyses: global comparisons of transport capabilities based Escherichia coli. Antimicrob Agents Chemother 42:
on phylogenies, bioenergetics and substrate specificities. J 1778–1782 (1998)
Mol Biol 277: 573–592 (1998)
22. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a
10. Paulsen IT, Nguyen L, Sliwinski MK, Rabus R, Saier MH. laboratory manual, 2nd ed. Cold Spring Harbor Laboratory,
Microbial genome analyses: comparative transport Cold Spring Harbor, N.Y. (1989)
capabilities in eighteen prokaryotes. J Mol Biol 301: 75–100
(2000) 23. Link AJ, Phillips D, Church GM. Methods for generating
precise deletions and insertions in the genome of wild-type
11. Nishino K, Yamaguchi A. Analysis of a complete library of Escherichia coli: application to open reading frame
putative drug transporter genes in Escherichia coli. J characterization. J Bacteriol 179: 6228–6237 (1997)
Bacteriol 183: 5803–5812 (2001)
24. Nishino K, Yamaguchi A. Role of histone-like protein H-NS
12. Ahmed M, Borsch CM, Taylor SS, Vazquez-Laslop N, in multidrug resistance of Escherichia coli. J Bacteriol 186:
Neyfakh AA. A protein that activates expression of a 1423–1429 (2004)
multidrug efflux transporter upon binding the transporter
substrates. J Biol Chem 269: 28506–28513 (1994) 25. Nishino K, Honda T, Yamaguchi A. Genome-wide analyses
of Escherichia coli gene expression responsive to the BaeSR
13. Brooun A, Tomashek JJ, Lewis K. Purification and ligand two-component regulatory system. J Bacteriol 187:
binding of EmrR, a regulator of a multidrug transporter. J 1763–1772 (2005)
Bacteriol 181: 5131–5133 (1999)
26. Nishino K, Yamaguchi A. Overexpression of the response
14. Lomovskaya O, Lewis K, Matin A. EmrR is a negative regulator evgA of the two-component signal transduction
regulator of the Escherichia coli multidrug resistance pump system modulates multidrug resistance conferred by
 127

multidrug resistance transporters. J Bacteriol 183: signal transduction system modulates production of the
1455–1458 (2001) yhiUV multidrug transporter in Escherichia coli. J Bacteriol
184: 2319–2323 (2002)
27. Nishino K, Inazumi Y, Yamaguchi A. Global analysis of
genes regulated by EvgA of the two-component regulatory 35. Saier MH, Ramseier TM, Reizer J. Regulation of carbon
system in Escherichia coli. J Bacteriol 185: 2667–2672 utilization, pp. 1325–1343. In Neidhardt FC, Curtiss R,
(2003) Ingraham JL, Lin ECC, Low KB, Magasanik B, Reznikoff
WS, Riley M, Schaechter M, Umbarger HE (ed.),
28. Nishino K, Latifi T, Groisman EA. Virulence and drug Escherichia coli and Salmonella: cellular and molecular
resistance roles of multidrug efflux systems of Salmonella biology, 2nd ed. ASM Press, Washington, D.C. (1996)
enterica serovar Typhimurium. Mol Microbiol 59: 126–141
(2006) 36. Busby S, Ebright RH. Transcription activation by catabolite
activator protein (CAP). J Mol Biol 293: 199–213 (1999)
29. Ma D, Cook DN, Hearst JE, Nikaido H. Efflux pumps and
drug resistance in Gram-negative bacteria. Trends 37. Saier MH, Chauvaux S, Deutscher J, Reizer J, Ye JJ. Protein
Microbiol. 2: 489–493 (1994) phosphorylation and the regulation of carbon metabolism:
comparisons in Gram-negative versus gram-positive
30. Nikaido H. Prevention of drug access to bacterial targets: bacteria. Trends Biochem Sci 20: 267–271 (1995)
permeability barriers and active efflux. Science 264:
382–388 (1994) 38. Xu J, Johnson RC. Cyclic AMP receptor protein functions as
a repressor of the osmotically inducible promoter proP P1 in
31. Nishino K, Yamada J, Hirakawa H, Hirata T, Yamaguchi A. Escherichia coli. J Bacteriol 179: 2410–2417 (1997)
Roles of TolC-dependent multidrug transporters of
Escherichia coli in resistance to b -lactams. Antimicrob 39. Magasanik B, Neidhardt FC. Regulation of carbon and
Agents Chemother 47: 3030–3033 (2003) nitrogen utilization, pp. 1318–1325. In Neidhardt FC,
Ingraham JL, Low KB, Magasanik B, Schaechter M,
32. Elkins CA, Nikaido H. Substrate specificity of the RND- Umbarger HE (ed.), Escherichia coli and Salmonella
type multidrug efflux pumps AcrB and AcrD of Escherichia typhimurium: cellular and molecular biology. American
coli is determined predominantly by two large periplasmic Society for Microbiology, Washington, D.C. (1987)
loops. J Bacteriol 184: 6490–6498 (2002)
40. Hirakawa H, Inazumi Y, Senda Y, Kobayashi A, Hirata T,
33. Fralick JA. Evidence that TolC is required for functioning of Nishino K, Yamaguchi A. N-Acetyl-D-glucosamine induces
the Mar/AcrAB efflux pump of Escherichia coli. J Bacteriol the expression of multidrug exporter genes, mdtEF, via
178: 5803–5805 (1996) catabolite activation in Eschrichia coli. J Bacteriol 188:
5851–5858.
34. Nishino K, Yamaguchi A. EvgA of the two-component