One-step inactivation of chromosomal genes in

Escherichia coli K-12 using PCR products

Kirill A. Datsenko and Barry L. Wanner*
Department of Biological Sciences, Purdue University, West Lafayette, IN 47907

Communicated by Jonathan Beckwith, Harvard Medical School, Boston, MA, April 11, 2000 (received for review February 13, 2000)

We have developed a simple and highly efficient method to disrupt mutants are recombinase proficient but lack exonuclease V (15,
chromosomal genes in Escherichia coli in which PCR primers pro- 16) has led to using singly mutated recD derivatives of E. coli (1)
vide the homology to the targeted gene(s). In this procedure, in similar gene disruption experiments.
recombination requires the phage ␭ Red recombinase, which is It has been known for a long time that many bacteriophages
synthesized under the control of an inducible promoter on an encode their own homologous recombination systems (17). It has
easily curable, low copy number plasmid. To demonstrate the also recently been shown that the ␭ Red (␥, ␤, exo) function
utility of this approach, we generated PCR products by using promotes a greatly enhanced rate of recombination over that
primers with 36- to 50-nt extensions that are homologous to exhibited by recBC sbcB or recD mutants when using linear DNA
regions adjacent to the gene to be inactivated and template (18). Yet this system has produced no chromosomal gene
plasmids carrying antibiotic resistance genes that are flanked by disruptions when using PCR fragments with short homology
FRT (FLP recognition target) sites. By using the respective PCR extensions (unpublished data). A system has been developed that
products, we made 13 different disruptions of chromosomal genes. uses the RecET recombinase to disrupt plasmid-borne genes
Mutants of the arcB, cyaA, lacZYA, ompR-envZ, phnR, pstB, pstCA, with such fragments (19); it has also been used to make a single
pstS, pstSCAB-phoU, recA, and torSTRCAD genes or operons were chromosomal deletion, but in that instance very long (138-nt)
isolated as antibiotic-resistant colonies after the introduction into primers were used.
bacteria carrying a Red expression plasmid of synthetic (PCR- Here we describe a procedure based on the Red system that
generated) DNA. The resistance genes were then eliminated by has allowed us to make more than 40 different disruptions on the
using a helper plasmid encoding the FLP recombinase which is also E. coli chromosome without a single failure. The basic strategy
easily curable. This procedure should be widely useful, especially in is to replace a chromosomal sequence (e.g., gene B in Fig. 1) with
genome analysis of E. coli and other bacteria because the proce- a selectable antibiotic resistance gene that is generated by PCR
dure can be done in wild-type cells. by using primers with 36-nt homology extensions (H1 and H2).
This is accomplished by Red-mediated recombination in these
bacterial genomics 兩 FLP recombinase 兩 FRT sites 兩 Red recombinase flanking homologies. After selection, the resistance gene can
also be eliminated by using a helper plasmid expressing the FLP
recombinase, which acts on the directly repeated FRT (FLP
T he availability of complete bacterial genome sequences has
provided a wealth of information on the molecular structure
and organization of a myriad of genes and ORFs whose functions
recognition target) sites flanking the resistance gene. The Red
and FLP helper plasmids can be simply cured by growth at 37°C
are poorly understood. A systematic mutational analysis of genes because they are temperature-sensitive replicons.
in their normal location can provide significant insight into their
function. Although a number of general allele replacement Materials and Methods
methods (1–7) can be used to inactivate bacterial chromosomal Media, Chemicals and Other Reagents. Ampicillin-, chlorampheni-
genes, these all require creating the gene disruption on a suitable col- (CmR), and kanamycin-resistant (KmR) transformants were
plasmid before recombining it onto the chromosome. In con- selected on tryptone-yeast extract agar medium (20) containing
trast, genes can be directly disrupted in Saccharomyces cerevisiae the respective antibiotic at 100, 25, and 25 ␮g兾ml. 5-Bromo-4-
by transformation with PCR fragments encoding a selectable chloro-3-indolyl ␤-D-galactopyranoside (Bachem) or 5-bromo-
marker and having only 35 nt of flanking DNA homologous to 4-chloro-3-indolyl-phosphate-p-toluidine (Bachem) were used at
the chromosome (8). This PCR-mediated gene replacement 40 ␮g兾ml to detect ␤-galactosidase or bacterial alkaline phos-
method has greatly facilitated the generation of specific mutants phatase (Bap) activity, respectively. Bap constitutive mutants
in the functional analysis of the yeast genome; it relies on the were streaked along with controls on media without an indicator
high efficiency of mitotic recombination in yeast (9). Directed dye and verified by dripping onto the colonies a solution of 0.4%
disruption of chromosomal genes can also be done in Candida p-nitrophenyl-phosphate (Sigma) in 1 M Tris䡠HCl, pH 8 (21). A
albicans by using similar PCR fragments with 50- to 60-nt total of 1 mM L-arabinose or isopropyl-␤-D-galactopyranoside
homology extensions (10). (Sigma) was used for induction. SOB and SOC media were
In contrast to yeast and a few naturally competent bacteria, prepared as described elsewhere (22). Oligonucleotides were
most bacteria are not readily transformable with linear DNA. from IDT (Coralville, IA). Enzymes were from New England
One reason Escherichia coli is not so transformable is because of Biolabs unless indicated otherwise. Taq polymerase was used in
the presence of intracellular exonucleases that degrade linear all PCR tests. Taq and Pfu (Stratagene) polymerases were mixed
DNA (11). However, recombination-proficient mutants lacking
exonuclease V of the RecBCD recombination complex are
transformable with linear DNA (12). Recombination can occur Abbreviations: Bap, bacterial alkaline phosphatase; CmR, chloramphenicol-resistant; FRT,
FLP recognition target; KmR, kanamycin-resistant; kan, kanamycin resistance gene; cat,
in recB or recC mutants carrying a suppressor (sbcA or sbcB) chloramphenicol resistance gene.
mutation that activates an alternative recombination pathway; *To whom reprint requests should be addressed. E-mail: BLW@bilbo.bio.purdue.edu.
sbcA activates the RecET recombinase of the Rac prophage,
The publication costs of this article were defrayed in part by page charge payment. This
whereas sbcB enhances recombination by the RecF pathway article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C.
(13). Such recBC sbcB mutants have been especially useful for §1734 solely to indicate this fact.
recombining in vitro constructed mutations onto the E. coli Article published online before print: Proc. Natl. Acad. Sci. USA, 10.1073兾pnas.120163297.
chromosome by using linear DNA (14). The discovery that recD Article and publication date are at www.pnas.org兾cgi兾doi兾10.1073兾pnas.120163297

6640 – 6645 兩 PNAS 兩 June 6, 2000 兩 vol. 97 兩 no. 12

 at 30°C to an OD600 of ⬇0.6 and then made electrocompetent by
concentrating 100-fold and washing three times with ice-cold
10% glycerol. PCR products were gel-purified, digested with
DpnI, repurified, and suspended in elution buffer (10 mM Tris,
pH 8.0). Electroporation was done by using a Cell-Porator with
a voltage booster and 0.15-cm chambers according to the
manufacturer’s instructions (GIBCO兾BRL) by using 25 ␮l of
cells and 10–100 ng of PCR product. Shocked cells were added
to 1-ml SOC, incubated 1 h at 37°C, and then one-half was spread
onto agar to select CmR or KmR transformants. If none grew
within 24 h, the remainder was spread after standing overnight
at room temperature. After primary selection, mutants were
maintained on medium without an antibiotic. They were colony-
purified once nonselectively at 37°C and then tested for ampi-
cillin sensitivity to test for loss of the helper plasmid. If it was not
lost, then a few were colony-purified once at 43°C and similarly
tested.

PCR Verification. Three PCRs were used to show that all mutants
have the correct structure. A freshly isolated colony was sus-
pended in 20-␮l water with a plastic tip from which 5-␮l portions
were used in separate 20-␮l PCRs following a 2-min preincu-
Fig. 1. A simple gene disruption strategy. H1 and H2 refer to the homology
bation, ‘‘hot start,’’ at 95°C. Common test primers included: c1
extensions or regions. P1 and P2 refer to priming sites.
(TTATACGCAAGGCGACAAGG) and c2 (GATCTTCCGT-
CACAGGTAGG) for cat, and k1 (CAGTCATAGCCGAAT-

GENETICS
10:1 and used per Taq instructions to generate DNAs for cloning AGCCT), k2 (CGGTGCCCTGAATGAACTGC), and kt (CG-
and mutagenesis. Qiagen products (Hilden, Germany) were used GCCACAGTCGATGAATCC) for kan. Two reactions were
to isolate plasmid DNAs, gel-purify fragments, or purify PCR done by using nearby locus-specific primers with the respective
products. common test primer (c1, c2, k1, or k2) to test for both new
junction fragments. A third reaction was carried out with the
Bacteria. BW25113 (lacIq rrnBT14 ⌬lacZWJ16 hsdR514 ⌬araBA- flanking locus-specific primers to verify simultaneous loss of the
DAH33 ⌬rhaBADLD78), BW25993 (lacIq hsdR514 ⌬araBADAH33 parental (nonmutant) fragment and gain of the new mutant-
⌬rhaBAD LD78 ), and BW25141 (lacI q rrnB T14 ⌬lacZ WJ16 specific fragment. The latter was repeated after elimination of
⌬phoBR580 hsdR514 ⌬araBADAH33 ⌬rhaBADLD78 galU95 end- the resistance gene. A fourth reaction was sometimes done with
ABT333 uidA(⌬MluI)::pir⫹ recA1) are derivatives of the F-, ␭-, E. primers k2 and kt to test for a 471-nt kan fragment. Control
coli K-12 strain BD792 [CGSC6159 (23)] and have no other colonies were always tested side-by-side.
known mutations. The ⌬araBAD AH33 , ⌬phoBR580,
⌬rhaBADLD78, uidA(⌬MluI)::pir⫹, and linked rrnBT14 ⌬lacZWJ16 Eliminating Antibiotic Resistance Gene. pCP20 is an ampicillin and
mutations were recombined onto the chromosome by allele CmR plasmid that shows temperature-sensitive replication and
replacement (3, 24, 25). Conditional replicative oriR␥ plasmids thermal induction of FLP synthesis (26). CmR and KmR mutants
were maintained in the pir⫹ host BW25141 or similar ones (25). were transformed with pCP20, and ampicillin-resistant transfor-
Several mutations were transferred by using P1kc transduction mants were selected at 30°C, after which a few were colony-
(24). BT340 [DH5␣ carrying pCP20 (26)], MG1655 [CGSC6300 purified once nonselectively at 43°C and then tested for loss of
(27)], and the endABT333, galU95, and hsdR514 alleles have been all antibiotic resistances. The majority lost the FRT-flanked
described (25). resistance gene and the FLP helper plasmid simultaneously.

Plasmids. pANTS␥ (28) and pINT-ts (29) were from M. Koob Nomenclature. One allele number signifies all mutations gener-
(University of Wisconsin, Madison), pBAD18 (30) from L. ated with a particular primer pair, as these are identical except
Guzman (Harvard Medical School, Boston), pCP15 (26) from for the inserted DNA. An allele number followed by a double
W. Wackernagel (Universitat Oldenburg, Oldenburg, Germa- colon and a descriptor for the inserted sequence indicates those
ny), pSC140 from S. Chiang (Harvard Medical School) and S. with an insertion. For example, DE(lacZYA)514::cat and
Chiang and J. J. Mekalanos, personal communication; and DE(lacZYA)514::kan refer to mutations made with the same
pTP223 from K. Murphy (18). The Red helper plasmids (see Fig. primers and pKD3 (cat) or pKD4 (kan) as template, respectively.
2) are derivatives of pINT-ts which contain araC-ParaB and ␥ ␤ After eviction of the resistance gene, the mutation(s) is simply
exo (without or with tL3) DNA fragments that were PCR- called DE(lacZYA)514, as these are identical regardless of
generated by using pBAD18 and ␭ DNA as template, respec- history.
tively. The template plasmids are derivatives of pANTS␥ that
contain an FRT-flanked kanamycin resistance (kan) or chlor- Results
amphenicol resistance (cat) gene from pCP15 or pSC140, re- Description of the Red Disruption System. The Red system includes
spectively. Synthetic DNAs containing FRT sites without or with three genes: ␥, ␤, and exo, whose products are called Gam, Bet,
a juxtaposed ribosome-binding site were generated by PCR. and Exo, respectively (18). Gam inhibits the host RecBCD
Details will be reported elsewhere. All relevant segments gen- exonuclease V so that Bet and Exo can gain access to DNA ends
erated by PCR were sequenced on both strands in the Micro- to promote recombination. In preliminary studies we attempted
biology and Molecular Genetics Core Facility at Harvard Med- to make chromosomal mutations by using the multicopy Red
ical School. plasmid pTP223 and PCR products with short homology exten-
sions, but were unsuccessful. We therefore made several low
Gene Disruption. Transformants carrying a Red helper plasmid copy plasmids such as pKD20 (Fig. 2) encoding the Red recom-
were grown in 5-ml SOB cultures with ampicillin and L-arabinose binase. pKD20 has an optimized ribosome-binding site for

Datsenko and Wanner PNAS 兩 June 6, 2000 兩 vol. 97 兩 no. 12 兩 6641

 plate plasmids. In these experiments, we found a high proportion
of antibiotic-resistant transformants without gene disruptions.
Instead, many carried what appeared to be new plasmids that
apparently escaped DpnI digestion [which was done to eliminate
methylated (unamplified) template DNA (19)] by being synthe-
sized in an aberrant PCR. These apparently resulted from our
use of plasmids as templates (data not shown). To circumvent
their occurrence, we constructed new template plasmids that are
conditional (oriR␥) replicons that require the trans-acting ⌸
protein (the pir gene product) for replication. They also have
resistance genes that are flanked by directly repeated FRT sites.
By using pKD20 and these template plasmids (Fig. 3), we made
several chromosomal gene disruptions as described below.
Our standard protocol is illustrated in Fig. 1. PCR products
were generated by using several pairs of 56- to 70-nt-long primers
that included 36- to 50-nt homology extensions and 20-nt priming
sequences for pKD3, pKD4, or pKD13 as template (Table 1).
The respective 1.1-, 1.6-, or 1.4-kbp PCR products were purified,
treated with DpnI, and then transformed into bacteria carrying
the Red helper plasmid as described in Materials and Methods.
We routinely obtained tens or hundreds of CmR or KmR
transformants of BW25113 (or similar strains) carrying pKD20.
None was found in absence of arabinose, thus showing a
requirement for the Red recombinase. Fewer were usually found
Fig. 2. Red recombinase expression plasmids. pKD20 and pKD46 (not shown) for MG1655 carrying pKD20. Differences are likely due to
include 1,894 nt (31348 –33241) and 2,154 nt (31088 –33241) of phage ␭ BW25113, unlike MG1655, being ⌬araBAD, hsdR, or both.
(GenBank accession no. J02459), respectively. Because similar numbers of transformants were found when
MG1655 carrying pKD20 was grown with 10 mM arabinose,
hsdR⫹ is not a major problem despite the presence of E. coli K12
efficient translation of ␥ and expresses ␥, ␤, and exo from the restriction recognition sites (31) within the FRT-flanked resis-
arabinose-inducible ParaB promoter. It is also a temperature- tance cassettes. Restriction would have a lesser effect if single-
sensitive replicon to allow for its easy elimination. stranded DNA were the primary recombination substrate under
We carried out several preliminary gene disruption experi- these conditions. We found similar numbers of recombinants
ments by using pKD20 and similar plasmids, essentially as when using 36- to 50-nt homology extensions; however, this may
described in Materials and Methods, except with different tem- have resulted from our use of unpurified (and unmodified)

Fig. 3. Template plasmids. (A) Linear representations of the template plasmids. Arrowheads show locations and orientations of priming sites. P1: priming sites
0, 1, and 3; P2: priming site 2; P4: priming site 4. c1, c2, k1, k2, and kt: common test primers. (B) Sequences remaining after FLP-mediated excision of the antibiotic
resistance genes. Priming sites 0, 1, and 3 begin at nucleotides 1, 2, and 3, respectively. Priming sites 2 and 4 begin at the left or right ends, as shown. Arrows
with open arrowheads show the nearly perfect FRT site inverted repeats. The ribosome binding site (rbs) and methionine (met) start codon are marked.

6642 兩 www.pnas.org Datsenko and Wanner

 Table 1. Allele designations of chromosomal gene disruptions
Priming
Mutation* Template(s) Homology extensions† sites‡

DE(lacZYA)514 pKD3, pKD4 36 nt; H1: 365662C; H2: 360842 P0; P2

DE(ompR-envZ)516 pKD13 50 nt; H1: 3534269C; H2: 3532141 P1; P4
DE(torSTRCAD)517 pKD13 50 nt; H1: 1052654; H2: 1061625C P1; P4
⌬arcB40 pKD3 50 nt; H1: 3350706C; H2: 3348269 P1; P2
⌬cyaA1403 pKD13 38 nt; H1: 3988674; H2: 3991330C P1; P4
⌬phnR171 pKD4 36 nt; H1: 2242; H2: 3016C P3; P2
⌬pstB608 pKD4 44 nt; H1: 3906010C; H2: 3905260 P1; P2
⌬pstCA607 pKD4 44 nt; H1: 3908039C; H2: 3905991 P1; P2
⌬pstS605 pKD3, pKD4 36 nt; H1: 3909143C; H2: 3908059 P3; P2
⌬pstSCAB-phoU606 pKD13 36 nt; H1: 3909339C; H2: 3904418 P1; P4
⌬recA635 pKD13 50 nt; H1: 2821868C; H2: 2820743 P1; P4

*All except two were made in pKD20 transformants of BW25113. DE(lacZYA)514 mutants were made in the
isogenic Lac⫹ strain BW25993; phnR was disrupted in three similar strains carrying the Salmonella typhimurium
LT2 phosphonatase gene cluster (32) on the chromosome. Some were also made in MG1655 transformants.
†Extension lengths are given first. Numerals identify the 3⬘ nucleotide of the extension in the E. coli genome

sequence [(ref. 33; GenBank accession no. U00096) or the S. typhimurium phnR entry (GenBank accession no.
U69493)]. C, complement; H1, homology 1; H2, homology 2.
‡One primer had the H1 extension and the 3⬘ sequence for priming site 0 (P0), 1 (P1), or 3 (P3). The other had the

H2 extension and the 3⬘ sequence for the complement of priming site 2 (P2) or 4 (P4).

GENETICS
primers in these experiments as longer primers are expected to region for one of the PCR primers. The same synthetic DNA also
be less pure. Importantly, when using PCR products targeted to always gave recombinants with the correct sequence.
the lac and pst genes, all transformants displayed the expected
Lac⫺ or Bap constitutive phenotype, respectively. The resistance More Gene Disruptions. We targeted disruptions to six additional
genes were eliminated by using a FLP helper plasmid. chromosomal loci (Fig. 6; Table 1). In all but one case, all of the
CmR or KmR transformants tested had the predicted structure
Disruptions of the lac Operon. We used both pKD3 and pKD4 as using similar PCR tests. The one exception concerned the cya
templates to delete precisely a 5,178-nt segment of the lacZYA (adenylate cyclase) locus. In this case, all KmR transformants
operon with the same 56-nt primers (Table 1). DE(lacZYA)514 grew poorly, as expected for cya mutants. Yet subsequent tests
leaves lacI intact, removes the lac promoter, lacZ, lacY, and lacA revealed many to be spontaneous KmR mutants, which can also
entirely, and leaves intact the terminator for the downstream, arise and often grow slowly (35, 36). Importantly, all transfor-
oppositely oriented, cynX (Fig. 4). Two or three representative
mutants were characterized from each of several experiments in
which CmR or KmR colonies were isolated after transformation
of different hosts with PCR fragments that were generated
independently. PCR tests using locus-specific primers and cat- or
kan-specific primers revealed that all had new junction and
locus-specific fragments of the expected sizes. On elimination of
the resistance gene, the resultant mutants also gave the expected
size new fragment in a PCR test with locus-specific primers. We
also showed that, as expected, the gene disruptions can be
transferred into new strains by P1 transduction. The resultant
CmR and KmR transductants as well as their antibiotic-sensitive
derivatives gave the expected fragments in similar PCR tests.
Thus, these mutants have the correct structures.

Disruptions of the pstSCAB-phoU Operon. We made four different

disruptions of the pstSCAB-phoU operon (Table 1). One pre-
cisely removes pstS, one removes pstCA, one removes pstB, and
a fourth removes the entire operon including its promoter (Fig.
5). Mutations of this operon result in constitutive expression of
the phosphate (Pho) regulon (34). After elimination of the
resistance genes, we showed the pstS and pstB mutations are
nonpolar, as such mutants were complemented by plasmids
carrying pstS⫹ or pstB⫹ alone, respectively. The pstCA mutant
was not tested because of the lack of an appropriate comple-
menting plasmid. All mutations were verified by using locus-
Fig. 4. Structures and PCR verification of DE(lacZYA)514 mutations. Top line
specific and common test primers (Fig. 4) as described above.
shows the region near the wild-type lac operon. (A—C) Structures of the
The new junction fragments from representative ⌬pstS605, DE(lacZYA)514 alleles generated using pKD4 as template, pKD3 as template,
⌬pstCA607, and ⌬pstB608 mutants were also directly sequenced and after elimination of the resistance genes, respectively. Numerals above
following PCR amplification. Although most had the exact the structures refer to locus-specific primers. The predicted PCR test products
predicted sequence, occasional mutants lacked 1 nt within the are shown. See Fig. 3 for other notations.

Datsenko and Wanner PNAS 兩 June 6, 2000 兩 vol. 97 兩 no. 12 兩 6643

Fig. 5. Structures of pstSCAB-phoU operon mutations. Top line shows the
wild-type pstSCAB-phoU operon. Lower lines show the gene disruptions. The
new junction fragments for the ⌬pstS605, ⌬pstCA607, and ⌬pstB608 muta-
tions were amplified by using primer 492 with 491, 497 with 498, and 495 with
496, respectively, and sequenced. See Fig. 4 for other notations.

mants shown to carry kan were also shown to be correct by PCR

as well as by phenotype.

Discussion
Our method for disrupting E. coli chromosomal genes is anal-
ogous to one that has been used for many years in yeast (8). It
is based on results of K. Murphy (18) who provided us with his
materials before publication. Because multicopy plasmids might
interfere with recombination by acting as competitive inhibitors
(18), we cloned the Red genes (␥, ␤, and exo) into a low copy
number plasmid. We used a vector which shows temperature-
sensitive replication (37) to permit its easy curing from the
resultant mutants. The plasmids pKD20 and pKD46 (Fig. 2)
express the Red system under control of a well-regulated pro-
moter to avoid unwanted recombinational events under nonin-
ducing conditions. They differ in that the latter has the native tL3
terminator downstream of exo. Although all recombinants de-
scribed here were made by using pKD20, we now use pKD46
instead because we recently discovered that pKD46 yields a
greatly enhanced number of recombinants. The reason is un-
known. Curiously, tL3 encodes a small ORF that may be
responsible for a host inhibition (Hin) phenotype, for which the
basis is unknown (38). Fig. 6. Structures of other gene disruptions. See Fig. 4 for notations.
We also constructed special template plasmids. These have the
conditional oriR␥ origin to reduce a background number of
resistant colonies carrying template-like plasmids that can pre- and priming sites in Fig. 3, elimination of the antibiotic resistance
dominate (at least when small circular plasmids are used as gene leaves behind an 82- to 85-nt scar in place of the disrupted
templates). When making gene disruptions using the templates gene(s). pKD3 and pKD4 are identical except for the region

6644 兩 www.pnas.org Datsenko and Wanner

between the FRT sites, so they create an identical scar that has though this revealed that the majority were correct, about 10%
stop codons in all six reading frames. As drawn, this scar has an had 1-nt deletions. The incorrect ones probably resulted from
idealized ribosome binding site and start codon for downstream PCR products generated from a primer lacking an internal base.
(rightward) gene expression (Fig. 3). When using these as Oligonucleotides with internal 1-nt deletions arise from chemical
templates, gene disruptions within the pst operon were also synthesis and are difficult to remove by conventional purification
nonpolar. They can therefore be used to create nonpolar gene methods (39, 40), especially when using 60-nt or longer primers.
deletions within operons or deletions that remove only an All 1-nt deletions occurred at or very near the junction of a
N-terminal coding region and express a C-terminal protein priming site and homology extension. This is expected as PCR
domain. In contrast, the pKD13 scar has no translation signals. primers with 1-nt deletions elsewhere are likely to prime less well
Therefore, we have used it primarily to disrupt single genes or or be incorporated into PCR products that recombine less
entire operons. Its scar has stop codons in all three forward but efficiently. Accordingly, the junction fragments of all mutants
in only one reverse reading frame. Because of the presence of whose actual sequence is critical for their further study are
two ORFs in the orientation opposite that of Fig. 3, pKD13 routinely sequenced to avoid mutants with 1-nt deletions.
might also be useful for creating in-frame deletions in which the In summary, we have isolated chromosomal mutants with 13
scar encodes a new 27-residue internal peptide(s). different gene disruptions by direct transformation of E. coli
These scars could be problematic under certain conditions. carrying a Red helper plasmid with PCR products having short
Because of the limited homology that is required for gene homology extensions for the targeted locus. This method should
disruption when using the Red system, a new PCR fragment can be widely useful. It should also be rather straightforward to
recombine at the new targeted gene or at the scar of an earlier extend its use to other bacteria. To adapt it to more distantly
gene disruption. To avoid such occurrences, we have made single related bacteria, it may be necessary to express the Red system
gene disruptions in wild-type hosts and constructed multiple under different control or from another low copy number vector.
mutants in standard P1 crosses. However, other chromosomal
In some cases, it may be advantageous to substitute an analogous
rearrangements might result from FLP-promoted recombina-
recombinase from a phage(s) specific for a particular group of
tion events between FRT sites at different loci. Although we
bacteria.
have seen no such events, we routinely rechecked all gene

GENETICS
disruption sites by PCR on elimination of a resistance gene from
This manuscript is dedicated to the memory of H. E. Umbarger who died
a new locus in such multiple mutants. on November 15, 1999. We thank individuals cited in the text for samples;
All gene disruption mutants were verified by a PCR strategy Don Court, Jean-Marc Ghigo, and Kenan Murphy for communicating
which tested for the presence of new locus- and junction-specific unpublished results; Jill Hutchcroft and Irwin Tessman for critically
fragments of predicted sizes. As further verification, the locus- reading the manuscript; and lab members for helpful discussions. This
specific fragments from selected mutants were PCR-amplified research was supported by Award MCB-9730034 from the National
and sequenced after elimination of the resistance gene. Al- Science Foundation.

1. Russell, C. B., Thaler, D. S. & Dahlquist, F. W. (1989) J. Bacteriol. 171, 24. Haldimann, A., Fisher, S. L., Daniels, L. L., Walsh, C. T. & Wanner, B. L.
2609–2613. (1997) J. Bacteriol. 179, 5903–5913.
2. Hamilton, C. M., Aldea, M., Washburn, B. K., Babitzke, P. & Kushner, S. R. 25. Haldimann, A., Daniels, L. L. & Wanner, B. L. (1998) J. Bacteriol. 180,
(1989) J. Bacteriol. 171, 4617–4622. 1277–1286.
3. Metcalf, W. W., Jiang, W., Daniels, L. L., Kim, S.-K., Haldimann, A. & Wanner, 26. Cherepanov, P. P. & Wackernagel, W. (1995) Gene 158, 9–14.
B. L. (1996) Plasmid 35, 1–13. 27. Metcalf, W. W., Steed, P. M. & Wanner, B. L. (1990) J. Bacteriol. 172,
4. Link, A. J., Phillips, D. & Church, G. M. (1997) J. Bacteriol. 179, 6228–6237. 3191–3200.
28. Pósfai, G., Koob, M., Hradecná, Z., Hasan, N., Filutowicz, M. & Szybalski, W.
5. Dabert, P. & Smith, G. R. (1997) Genetics 145, 877–889.
(1994) Nucleic Acids Res. 22, 2392–2398.
6. Kato, C., Ohmiya, R. & Mizuno, T. (1998) Biosci. Biotechnol. Biochem. 62,
29. Hasan, N., Koob, M. & Szybalski, W. (1994) Gene 150, 51–56.
1826–1829.
30. Guzman, L.-M., Belin, D., Carson, M. J. & Beckwith, J. (1995) J. Bacteriol. 177,
7. Pósfai, G., Kolisnychenko, V., Bereczki, Z. & Blattner, F. R. (1999) Nucleic 4121–4130.
Acids Res. 27, 4409–4415. 31. Kan, N. C., Lautenberger, J. A., Edgell, M. H. & Hutchison, C. A., III (1979)
8. Baudin, A., Ozier-Kalogeropoulos, O., Denouel, A., Lacroute, F. & Cullin, C. J. Mol. Biol. 130, 191–209.
(1993) Nucleic Acids Res. 21, 3329–3330. 32. Jiang, W., Metcalf, W. W., Lee, K.-S. & Wanner, B. L. (1995) J. Bacteriol. 177,
9. Oliver, S. G., Winson, M. K., Kell, D. B. & Baganz, F. (1998) Trends Biotechnol. 6411–6421.
16, 373–378. 33. Blattner, F. R., Plunkett, G., III, Bloch, C. A., Perna, N. T., Burland, V., Riley,
10. Wilson, R. B., Davis, D. & Mitchell, A. P. (1999) J. Bacteriol. 181, 1868–1874. M., Collado-Vides, J., Glasner, J. D., Rode, C. K., Mayhew, G. F. et al. (1997)
11. Lorenz, M. G. & Wackernagel, W. (1994) Microbiol. Rev. 58, 563–602. Science 277, 1453–1462.
12. Cosloy, S. D. & Oishi, M. (1973) Proc. Natl. Acad. Sci. USA 70, 84–87. 34. Wanner, B. L. (1996) in Escherichia coli and Salmonella typhimurium Cellular
13. Clark, A. J. & Sandler, S. J. (1994) Crit. Rev. Microbiol. 20, 125–142. and Molecular Biology, eds. Neidhardt, F. C., Curtiss, R., III, Ingraham, J. L.,
14. Winans, S. C., Elledge, S. J., Krueger, J. H. & Walker, G. C. (1985) J. Bacteriol. Lin, E. C. C., Low, K. B., Jr., Magasanik, B., Reznikoff, W. S., Riley, M.,
161, 1219–1221. Schaechter, M. & Umbarger, H. E. (Am. Soc. Microbiol., Washington, DC), pp.
15. Amundsen, S. K., Taylor, A. F., Chaudhury, A. M. & Smith, G. R. (1986) Proc. 1357–1381.
Natl. Acad. Sci. USA 83, 5558–5562. 35. Thorbjarnardottir, S. H., Magnusdottir, R. A. & Eggertsson, G. (1978) Mol.
Gen. Genet. 161, 89–98.
16. Biek, D. P. & Cohen, S. N. (1986) J. Bacteriol. 167, 594–603.
36. Sâsârman, A. & Horodniceanu, T. (1967) J. Bacteriol. 94, 1268–1269.
17. Smith, G. R. (1988) Microbiol. Rev. 52, 1–28.
37. Hashimoto-Gotoh, T., Franklin, F. C. H., Nordheim, A. & Timmis, K. N. (1981)
18. Murphy, K. C. (1998) J. Bacteriol. 180, 2063–2071. Gene 16, 227–235.
19. Zhang, Y. M., Buchholz, F., Muyrers, J. P. P. & Stewart, A. F. (1998) Nat. 38. Court, D. & Oppenheim, A. (1983) in Lambda II, eds. Hendrix, R. W., Roberts,
Genet. 20, 123–128. J. W., Stahl, F. W. & Weisberg, R. A. (Cold Spring Harbor Lab. Press,
20. Wanner, B. L. (1994) in Methods in Molecular Genetics, ed. Adolph, K. W. Plainview, NY), pp. 251–277.
(Academic, Orlando, FL), Vol. 3, pp. 291–310. 39. Temsamani, J., Kubert, M. & Agrawal, S. (1995) Nucleic Acids Res. 23,
21. Wanner, B. L. & Latterell, P. (1980) Genetics 96, 242–266. 1841–1844.
22. Hanahan, D. (1983) J. Mol. Biol. 166, 557–580. 40. Chen, D., Yan, Z., Cole, D. L. & Srivatsa, G. S. (1999) Nucleic Acids Res. 27,
23. Wanner, B. L. (1983) J. Mol. Biol. 166, 283–308. 389–395.

Datsenko and Wanner PNAS 兩 June 6, 2000 兩 vol. 97 兩 no. 12 兩 6645