Infectious Diseases v05

Advanced Flow Cytometry
for Infectious Diseases

Article Collection
Sponsored by:
Accurately detect your infectious disease model
The ZE5 Cell Analyzer can detect down to 0.2 µm in cell size, can run at 100,000 events
per second with washes and low carryover, and it has an established publication catalog in
infectious diseases. Advance your research with the ZE5 Cell Analyzer, infectious disease
antibody portfolio, and newly launched, exceptionally bright StarBright Dyes, which allow
you to separate negative from positive, even for rare and dim populations.
To learn more, visit bio-rad.com/cellanalysis
#ScienceForward
Contents
4 50
Introduction CD4+ T Cell Activation and Associated
Susceptibility to Hiv-1 Infection in vitro
5 Increased Following Acute Resistance
Exercise in Human Subjects
Flow Cytometry: An Overview BY ALEXANDER K. HOLBROOK, HUNTER D. PETERSON, SAMANTHA A.
BY KATHERINE M. MCKINNON BIANCHI, BRAD W. MACDONALD, ERIC C. BREDAHL, MICHAEL BELSHAN
& JACOB A. SIEDLIK
Current Protocols in Immunology
16
Physiological Reports
Adapting to the Coronavirus Pandemic:

62
Building and Incorporating a Diagnostic Modularly Programmable Nanoparticle
Pipeline in a Shared Resource Vaccine Based on Polyethyleneimine for
Laboratory Personalized Cancer Immunotherapy
BY JUTAEK NAM, SEJIN SON, KYUNG SOO PARK, AND JAMES J. MOON
BY EMMA RUSSELL, ANA AGUA-DOCE, LOTTE CARR, ASHA MALLA, KEROL
BARTOLOVIC, DINA LEVI, CARL HENDERSON, DEBIPRIYA DAS, HEFIN Advanced Science
RHYS, PHILIP HOBSON, SUKHVEER PUREWAL, ANDREW RIDDELL
Cytometry Part A
26 COVER IMAGE © BIO-RAD
A Mouse Model of Sublethal

Leptospirosis: Protocols for Infection
with Leptospira Through Natural
Transmission Routes, for Monitoring
Clinical and Molecular Scores of
Disease, and for Evaluation of the Host
Immune Response
BY NISHA NAIR AND MARIA GOMES-SOLECKI
Current Protocols in Microbiology
3
Introduction
Few technologies are more central to the investigation of and uptake of the nanoparticles, tumor tissues were processed
therapeutic development for infectious diseases than flow via flow cytometry for the intracellular concentration of
cytometry. Capable of identifying and characterizing single nanoparticle as well as the activation state of tumor-draining
cells based on cellular markers, this technology is critical to lymph nodes. They report that optimized nanovaccines
understanding immune responses to infection from pathogens were highly effective at priming of antigen-specific CD8+
and the pathology of cancer. Further, the development of T-cells with antitumor efficacy, illustrating their therapeutic
therapeutics to infections such as SARS-CoV-2 or personalized potential.
medicine approaches to cancer treatment benefit from this
By introducing readers to the advantages of flow cytometry
foundational technology. This collection of articles presents
for diagnostic development and research into infectious
a sampling of studies utilizing flow cytometry to better
disease, we hope to empower users to investigate the use of
understand infectious diseases and develop diagnostic and
this technology to address their specific research or diagnostic
therapeutic interventions.
goals. For more information and resources for flow cytometry,
First, McKinnon (2018) provides an in-depth overview of the we encourage you to visit the Bio-Rad ZE5 Cell Analyzer
flow cytometry technologies available to researchers. They product page and explore the resources provided there.
discuss the different modalities of flow cytometry as well as
By Jeremy Petravicz, PhD, Editor,
their potential applications to answering research questions.
Current Protocols
Next, Russell et al. (2020) describes the process of designing
a clinical diagnostic laboratory for SARS-CoV-2 testing at The
Francis Crick Institute’s Flow Cytometry Science Technology
Platform. This includes an accounting of factors, such as References
COVID-19 restrictions, that impacted the development of
a functional diagnostic pipeline and SARS-CoV-2 assay McKinnon, K. M. (2018). Flow cytometry: An overview.
development. Continuing, Nair and Gomes-Solecki (2020) Current Protocols in Immunology, 120, 5.1.1–5.1.11. https://
describe protocols for bacterial infection of mouse models doi.org/10.1002/cpim.40
with Leptospira to recapitulate disease progression and
Russell, E., et al (2021). Adapting to the Coronavirus
physiologically relevant transmission routes. They also discuss
Pandemic: Building and Incorporating a Diagnostic Pipeline
protocols for evaluating clinical, molecular, and histological
in a Shared Resource Laboratory. Cytometry, 99: 90-99.
scores, as well as flow cytometry based-analysis of the host-
https://doi.org/10.1002/cyto.a.24248
immune response. Moving to human studies, Holbrook et
al. (2019) used flow cytometry to examine the effects of Nair, N., & Gomes-Solecki, M. (2020). A mouse model of
acute resistance exercise on CD4+ T lymphocyte activation sublethal leptospirosis: Protocols for infection with Leptospira
and replication (susceptibility) of HIV-1. They were able to through natural transmission routes, for monitoring clinical
demonstrate that acute bouts of resistance exercise increased and molecular scores of disease, and for evaluation of the
the activation state of CD4+ T lymphocytes, lead to an increase host immune Response. Current Protocols in Microbiology, 59,
in infection susceptibility and the potential for this measure e127. https://doi.org/10.1002/cpmc.127
to quantify exercise-induced changes in immune function.
Holbrook, A. K., et al (2019). CD4+ T cell activation and
Lastly, personalized treatments such as cancer vaccines
associated susceptibility to HIV-1 infection in vitro increased
holds great therapeutic potential. One emerging technology
following acute resistance exercise in human subjects. Physiol
for this area is programmable nanoparticle vaccines.
Rep, 7 ( 18), e14234, https://doi.org/10.14814/phy2.14234
Polyethyleneimine (PEI)-based nanoparticle vaccines have
been studied for the treatment of numerous infectious diseases Nam, J., et al (2021). Modularly Programmable Nanoparticle
previously. In Nam et al. (2021), they explore the potential Vaccine Based on Polyethyleneimine for Personalized
of modularly programmed PEI-based nanoparticle vaccines Cancer Immunotherapy. Adv. Sci., 8, 2002577. https://doi.
for personalized cancer immunotherapy. To characterize the org/10.1002/advs.202002577
4
Flow Cytometry: An Overview UNIT 5.1
Katherine M. McKinnon1
1
Vaccine Branch, National Cancer Institute, National Institutes of Health, Bethesda,
Maryland
Flow cytometry is a technology that provides rapid multi-parametric analy-

sis of single cells in solution. Flow cytometers utilize lasers as light sources
to produce both scattered and fluorescent light signals that are read by de-
tectors such as photodiodes or photomultiplier tubes. These light signals are
converted into electronic signals that are analyzed by a computer and writ-
ten to a standardized format (.fcs) data file. Cell populations can be analyzed
and/or purified based on their fluorescent or light scattering characteristics.
A variety of fluorescent reagents are utilized in flow cytometry. These in-
clude fluorescently conjugated antibodies, nucleic acid binding dyes, viability
dyes, ion indicator dyes, and fluorescent expression proteins. Flow cytome-
try is a powerful tool that has applications in immunology, molecular biology,
bacteriology, virology, cancer biology, and infectious disease monitoring. It has
seen dramatic advances over the last 30 years, allowing unprecedented detail in
studies of the immune system and other areas of cell biology. C 2018 by John
Wiley & Sons, Inc.

Keywords: flow cytometry fluorescence reagents light scatter
INTRODUCTION cancer biology, and infectious disease moni-

Flow cytometry is a technology that rapidly toring. For example, it is very effective for the
analyzes single cells or particles suspended study of the immune system and the immune
in a buffered salt-based solution as they flow response to infectious diseases and cancer. It
past single or multiple lasers. Each particle allows for the simultaneous characterization
is analyzed for visible light scatter and one or of mixed populations of cells from blood and
multiple fluorescence parameters. Visible light bone marrow as well as solid tissues that can
scatter is measured in two different directions, be dissociated into single cells such as lymph
the forward direction (forward scatter, FSC) nodes, spleen, mucosal tissues, solid tumors,
which can indicate the relative size of the cell etc. In addition to analysis of populations of
and at 90° (side scatter, SSC) which indicates cells, a major application of flow cytometry
the internal complexity or granularity of the is sorting cells into uniform populations to be
cell. Light scatter is independent of fluores- used for further downstream analysis. A more
cence. Samples are prepared for fluorescence detailed look at applications will be discussed
measurement through transfection and expres- later in this unit.
sion of fluorescent proteins (ex. green fluores- The instrumentation used for flow cytome-
cent protein, GFP), staining with fluorescent try has evolved over the last several decades.
dyes (e.g., propidium iodide, which labels nu- Multiple laser systems are common as are in-
cleic acids such as DNA) or immunostaining struments designed for specific purposes, such
with fluorescently conjugated antibodies (e.g., as systems with 96-well loaders for bead anal-
CD3 antibody conjugated to fluorescein isoth- ysis, systems that combine microscopy and
iocyanate, FITC). flow cytometry, and systems that combine
Flow cytometry is a powerful tool with mass spectrometry and flow cytometry. An
applications in multiple disciplines such as overview of current instrumentation platforms
immunology, virology, molecular biology, will be covered in this unit. Immunofluore-
scence and Cell
Sorting
Current Protocols in Immunology 5.1.1–5.1.11, February 2018

Published online February 2018 in Wiley Online Library (wileyonlinelibrary.com).
doi: 10.1002/cpim.40

Copyright C 2018 John Wiley & Sons, Inc.
5
The increase in available reagents over the tect a small window of a specific wavelength
last several years has led to explosive growth of light. For example, a 450/50 bandpass filter
in the number of parameters used in flow cy- passes fluorescent light with a wavelength of
tometry experiments. There has been a dra- 450 nm ± 25 nm through the filter to be read
matic increase in fluorochromes that can be by the detector. The electronic system converts
conjugated to monoclonal antibodies, such as the signals from the detectors into digital sig-
tandem dyes and polymer dyes. In addition, nals that can be read by a computer.
there has been an increase in available fluo- Multiple laser systems are common with
rescent proteins beyond GFP that can be used instruments often having 20 parameters (e.g.
for transfection, such as mCherry, mBanana, FSC, SSC, and 18 fluorescent detectors).
mOrange, mNeptune, etc. These advances in There are new instrument platforms being in-
fluorochromes and instrumentation has led to troduced with five or more lasers and 30-50
experiments with the possibility of 30+ pa- parameters, but these are less common. The
rameters. most common lasers used in traditional flow
Finally, data analysis has been expanded to cytometers are 488 nm (blue), 405 nm (vio-
evaluate the additional information available let), 532 nm (green), 552 nm (green), 561 nm
from the new instrumentation and reagents. (green-yellow), 640 nm (red) and 355 nm (ul-
Traditional two parameter histogram (dot plot) traviolet). Additional laser wavelengths are
gating and analysis is still being used fre- available for specialized applications. In addi-
quently. However, the increase in number of tion, there are instruments that have replaced
parameters and complexity in experiments is PMTs with avalanche photodiodes (APD) for
leading to the use of newer cluster data analysis fluorescence detection, with the aim of in-
algorithms such a principal component anal- creasing sensitivity.
ysis (PCA), spanning-tree progression anal-
ysis of density-normalized events (SPADE),
and t-stochastic neighbour embedding (tSNE).
Acoustic Focusing Cytometers
This cytometer uses ultrasonic waves to
These improved methods of data mining al-
better focus cells for laser interrogation. This
low useful information to be extracted from
type of acoustic focusing allows for higher
the high-dimensional data now available from
sample input and less sample clogging. This
flow cytometry.
cytometer can utilize up to 4 lasers and 14
fluorescence channels.
INSTRUMENTATION
Traditional Flow Cytometers Cell Sorters
Traditional flow cytometers consist of three A specific type of traditional flow cytometer
systems: fluidics, optics, and electronics. The is the cell sorter which can purify and collect
fluidics system consists of sheath fluid (usually samples for further analysis. A cell sorter al-
a buffered saline solution) that is pressurized lows the user to select (gate) a population of
to deliver and focus the sample to the laser in- cells or particles which is positive (or nega-
tercept or interrogation point where the sam- tive) for the desired parameters and then direct
ple is analyzed. The optical system consists of those cells into a collection vessel. The cell
excitation optics (lasers) and collection optics sorter separates cells by oscillating the sam-
(photomultiplier tubes or PMTs and photodi- ple stream of liquid at a high frequency to
odes) that generate the visible and fluorescent generate drops. The drops are then given ei-
light signals used to analyze the sample. A ther a positive or negative charge and passed
series of dichroic filters steer the fluorescent through metal deflection plates where they are
light to specific detectors and bandpass fil- directed to a specific collection vessel based
ters determine the wavelengths of light that on their charge. The collection vessels can be
are read so that each individual fluorochrome tubes, slides or plates (96-well or 384-well are
can be detected and measured. More specifi- common).
cally, dichroic filters are filters that pass light There are two types of cell sorters, quartz
through that is either shorter or longer in wave- cuvette and "jet-in-air", that differ in where the
length and reflect the remaining light at an laser interrogation point is located. The quartz
angle. For example, a 450 dichroic long pass cuvette cell sorters have fixed laser alignment
(DLP) filter lets light with a wavelength longer and are easier to prepare for a sort. The "jet in
than 450 nm through the filter and bounces the air" cell sorters need to have the lasers aligned
Flow Cytometry: shorter wavelengths of light off at an angle to daily and are more difficult to set up but are
An Overview
be sent to another detector. Bandpass filters de- more adaptable for small particle detection.

6
Imaging Cytometers Small flow cytometers with usually 2 lasers
Imaging flow cytometers (IFC) combine and 96-well loaders have been developed to
traditional flow cytometry with fluorescence analyze these assays. These instruments have
microscopy. This allows for rapid analysis of small footprints and optical bench designs that
a sample for morphology and multi-parameter are optimized to detect and discriminate beads
fluorescence at both a single cell and popu- with different amounts of fluorescence along
lation level (Barteneva, Fasler-Kan, & Vorob- two channels. Instruments have been devel-
jev, 2012). IFC can track protein distributions oped that can detect 100-500 different bead
within individual cells like a confocal or fluo- combinations.
rescence microscope but is also able to process
large numbers of cells like a flow cytometer. Spectral Analyzers
They are particularly useful in multiple appli- One of the challenges of multi-parameter
cations such as cell signaling, co-localization flow cytometry is compensation (erasing spec-
studies, cell to cell interactions, DNA dam- tral overlap) between flurochromes. A new
age and repair, and any application that needs type of flow cytometer, the spectral analyzer
to be able to coordinate cellular location with is specifically designed to address this prob-
fluorescence expression in large populations lem. A spectral analyzer measures the en-
of cells. tire fluorescent emission spectra for each flu-
orochrome in a multicolor sample to create
a spectral fingerprint. Then during analysis,
Mass Cytometers each spectra is unmixed to provide a pure
Mass cytometers combine time-of-flight
signal for each fluorochrome (Sony, 2017).
mass spectrometry and flow cytometry. Cells
Spectral analysis is starting to replace tradi-
are labeled with heavy metal ion-tagged an-
tional PMTs as a detection method for high-
tibodies (usually from the lanthanide series)
dimensional flow cytometry.
instead of fluorescently-tagged antibodies and
detected using time-of-flight mass spectrome-
New Detector Technologies
try. Mass cytometers do not have FSC or SSC
Photomultiplier tubes (PMTs) remain the
light detection, and therefore do not allow for
standard detector technology for flow cytome-
the conventional method of detecting cell ag-
try. Their high sensitivity and low backgrounds
gregates. However other methods such as cell
make them useful for fluorescence technology.
barcoding can be employed for this purpose
However, solid state detectors are starting to
(Leipold, Newell, & Maecker, 2015). Also,
appear in some cytometers. Avalanche photo-
mass cytometry does not have cellular autoflu-
diodes (APDs) are inexpensive, sensitive and
orescence signals and reagents do not have the
highly linear, and are more spectrally respon-
emission spectral overlap associated with flu-
sive in the long red region. Silicon photodiodes
orescent labels so compensation is not needed.
(SiPDs) are also a promising option for solid
However, the sample is destroyed during anal-
state detectors.
ysis so cell sorting is not possible, and the
acquisition rate is much lower than a standard
flow cytometer (1000 cells/second instead of REAGENTS
10,000 cells/second). Currently, there are com-
mercially available reagents for 40 channels
Small Organic Molecules
Small organic molecules such as fluo-
but this number will increase with the intro-
roscein (MW=389 Da), Alexa Fluor 488 (flu-
duction of other metal ions such as platinum
orescein analog, MW=643 Da), Texas Red
for conjugation to antibodies (Mei, Leipold, &
(TxRed, MW=625 Da), Alexa Fluor 647
Maecker, 2016).
(MW=1155 Da), Pacific Blue (MW=242 Da),
and Cy5 (MW=762 Da) are commonly used
Cytometers for Bead Array Analysis for antibody conjugation. These have consis-
Multiplex bead arrays have become pop- tent emission spectra and a small Stokes shift
ular for analyzing large amounts of analytes (the difference between excitation wavelength
in small sample volumes. Briefly, these assays and emission wavelength, approximately
utilize capture beads with a known amount of 50-100 nm). These are also stable and rea-
fluorescence in a specific channel and a re- sonably easy to conjugate to antibodies. The
porter molecule detected by a separate laser to Alexa Fluor (Thermo Fisher) dyes were de-
quantify the amount of captured analyte asso- signed to be more resistant to photobleaching Immunofluore-
ciated with the specific bead. It is essentially and are better reagent choices for samples that scence and Cell
Sorting
the equivalent of 100 ELISA assays. will also be used for imaging.

7
Phycobiliproteins to increase the available fluorochromes that
Phycobiliproteins are large protein can be excited with a single laser source. For
molecules derived from cyanobacteria, dino- example, Texas Red has a maximum excita-
flagellates, and algae. These are large tion of 589 nm, and PE has an emission of
molecules, for example phycoerythrin (PE) 585 nm, so by coupling PE to Texas Red, the
has a molecular weight of 240,000 Da. These emission from PE is used to excite Texas Red
proteins have large Stokes shifts (75-200 nm) through FRET, allowing PE-TxRed to be ex-
and are very stable with consistent emission cited by either a 488 nm or 532 nm laser. The
spectra. Because of their large size, phy- polymer chain antibodies use the same method
cobiliproteins are excellent for quantitative to increase available fluorochromes that can
flow cytometry since they usually have a be excited by a single laser. Tandem dyes
1:1 protein to fluorochrome ratio during are extremely bright with large Stokes shift
conjugation. However, phycobiliproteins are values (150-300 nm) which is useful when
susceptible to photobleaching and are not dealing with low antigen density. However,
recommended for applications with long or tandem dyes are less stable than the donor
repeated exposure to excitation sources. Ex- fluorochromes and can differ from lot to lot
amples of phycobilibroteins are phycoerythrin in their energy transfer efficiency, complicat-
(PE), allophycocyanin (APC), and peridinin ing compensation. Most of the longer Brilliant
chlorophyll protein (PerCP). polymer dyes are also tandems and share these
issues.
Quantum Dots
Quantum Dots (Qdots) are semiconductor Metal Conjugates for Mass Cytometry
nanocrystals that have tight fluorescence emis- Antibodies for use in mass cytometry are
sion spectra associated with the size of the conjugated to single isotope heavy metal ions
nanocrystal. They are optimally excited with in the lanthanide series of elements. There are
UV or violet lasers but can be minimally ex- currently 35 lanthanide series isotopes com-
cited by multiple lasers. This minimal exci- mercially available for antibody conjugation.
tation complicates fluorescence compensation These probes are non-fluorescent and only ap-
when Qdots are used in multi-parameter ex- plicable for mass cytometry. Additional anti-
periments. Because of the compensation issues body conjugates will become available as soon
and difficulty in conjugating Qdots to antibod- as other metal elements are evaluated for suit-
ies, these reagents have largely been replaced ability with this platform.
with the polymer dyes in multi-parameter
staining panels. Fluorescent Proteins
Fluorescent proteins are frequently used
Polymer Dyes as reporter systems for gene expression. The
Polymer dyes consist of polymer chains most commonly used is green fluorescent pro-
that collect light signals and can be "tuned" to tein (GFP) derived from the jellyfish Aequorea
absorb and emit light at specific wavelengths victoria (Tsien, 1998). GFP was cloned to
based on the length of the polymer chain and generate cyan fluorescent protein (CFP) and
the attached molecular subunits. These dyes yellow fluorescent protein (YFP). Red flu-
are very stable and have similar quantum ef- orescent protein (DsRed) was derived from
ficiency to phycobiliproteins with greatly in- the mushroom anemone, Discosoma (Mikhail
creased photostability. Since polymer dyes can V. Matz, 1999) and then cloned for use in
be made to absorb light only at specific wave- protein expression systems. Next generation
lengths, they avoid the issues with multiple monomeric fluorescent proteins (mCherry,
laser excitation that make Qdot reagents dif- mBanana) were cloned from DsRed and have
ficult to use in multi-parameter experiments. broader excitation and emission spectra. The
Examples of these reagents are the Brilliant violet and green/yellow excited fluorescent
Violet (BV), Brilliant Ultraviolet (BUV) and proteins see especially heavy use in flow cy-
Brilliant Blue (BB) reagents. tometry. New fluorescent proteins are contin-
uously being discovered and generated; cur-
Tandem Dyes rently, several hundred exist, with excitation
Tandem dyes chemically couple either phy- and emission spectra ranging from the ultra-
cobiliproteins (PE, APC, PerCP) or polymers violet to near infrared. The presence of many
dyes (BV421, BUV395) with small organic laser wavelengths on modern flow cytometers
Flow Cytometry: fluorochromes (Cy3, Cy5, Cy7) to create a dye has dramatically expanded the use of fluores-
An Overview
that uses fluorescence energy transfer (FRET) cent proteins in flow cytometry.

8
Nucleic Acid Dyes APPLICATIONS
Nucleic acid dyes bind DNA, RNA, or Flow cytometry has a wealth of techniques
both. These are used to quantitate DNA and applications suitable for multiple fields of
for cell cycle analysis (Propidium Iodide, study. In this section, applications are broadly
7-aminoactinomycin D or 7AAD, DyeCy- grouped under specific disciplines; however,
cle Violet, 4’,6-diamidino-2-phenylindole or any of these techniques can be used in all fields
DAPI), discriminate chromosomes for sort- of study.
ing (Hoescht 33342, Chromomycin A3), sort-
ing stem cells using side population analysis
(Hoescht 33342), cell viability analysis, and Immunology
for sorting bacteria. They can be combined
with another marker such as fluorochrome Immunophenotyping
conjugated anti-bromodeoxyuridine (BrdU) to Flow cytometry is most commonly used
determine proliferation. for immunophenotyping. This application uti-
lizes the unique ability of flow cytometry
Proliferation Dyes to simultaneously analyze mixed populations
Cell proliferation can be measured by puls- of immune cells for multiple parameters.
ing cells with BrdU (bromodeoxyuridine) and In its simplest form, an immunophenotyp-
then staining with an antibody against BrdU ing experiment consists of cells stained with
and a DNA dye. However, this method does not fluorochrome-conjugated antibodies that are
allow for long term proliferation studies. Car- targeted against antigens on the cell surface.
boxyfluoroscein succinimidly ester (CFSE) Most of these antigens are given "cluster of dif-
and other similar dyes can be used to follow ferentiation" numbers or CD numbers by the
multiple divisions of proliferating cells. Red Human Leukocyte Differentiation Workshops
and violet excited variants of these dyes are so that a common nomenclature is used to de-
also now available. Each cell is permanently fine monoclonal antibodies that are directed
labeled with the dye and the subsequent gen- against specific cellular antigens. For exam-
erations of cells inherit lower amounts of the ple, CD3 is "cluster of differentiation number
dye due to the dilution of the dye. These dyes 3" and is used to define the T cell co-receptor
do not affect cell growth or morphology and that is present on all T cells.
are suitable for long term proliferation studies. Most immune cells have specific CD mark-
ers that define them as a population of cells.
Viability Dyes These cell markers are called lineage mark-
Cell viability can be measured through ex- ers and are used to define specific cell pop-
clusion of dyes (Propidium iodide, DAPI) or ulations for additional analysis in each im-
by the binding of a dye to amines within a munophenotyping experiment. Examples are
cell to determine if the cell membrane is in- the T cell markers (CD3, CD4, CD8), B cell
tact. The exclusion dyes cannot be fixed and markers (CD19, CD20), monocyte markers
are only suitable for cells that are not infec- (CD14, CD11b) and natural killer (NK) cell
tious and will be analyzed immediately. Amine markers (CD56, CD161).
binding dyes such as the Live/Dead reagents In addition to lineage markers that de-
(ThermoFisher), Zombie dyes (Biolegend) or fine populations of immune cells, other
Fixable Viablity dyes (BD Biosciences) can markers are used to characterize each cell
be fixed and used for cells that are infectious, population. These markers can include ac-
cells that need to be stained for internal anti- tivation markers (CD69, CD25, CD62L),
gens, and cells that need to be stored prior to memory markers (CD45RO, CD27), tis-
acquisition. sue homing markers (α4/β7) and chemokine
receptor markers (CCR7, CCR5, CXCR4,
Calcium Indicator Dyes CCR6). Often, immunophenotyping experi-
Calcium indicator dyes undergo a color ments also include intracellular markers such
shift upon binding to calcium. They are used to as FoxP3 (defines Treg cells), cytokines (IFN-
indicate cell activation and signaling. The data γ, TNF-α, IL-2 define TH 1 cells), proliferation
is expressed as a ratio of the two wavelengths markers (Ki67, CFSE), and antigen specific
associated with bound and unbound calcium markers (major histocompatibility or MHC
and dye. The most commonly used dye re- Tetramers). Current instruments and reagents
mains indo-1, an ultraviolet biphasic calcium are capable of 28 color immunophenotyping Immunofluore-
probe. Blue-green calcium probes including experiments, although it is more common to scence and Cell
Sorting
fluo-3 are also available. have experiments in the 12-15 color range. A

9
Table 5.1.1 Example of a 15-Color Treg Cell Staining Panel
Laser Dichroic filter Bandpass filter Fluorochromes

488 nm 505LP 525/50 CD14 FITC
488 nm 690LP 710/50 CD4 PerCP-Cy5.5
532 nm 575/26 CD127 PE
532 nm 600LP 610/20 TGF-B1 PE-CF594
532 nm 635LP 660/20 HLA-DR PE-Cy5
532 nm 685LP 710/50
532 nm 755LP 780/60 CD73 PE-Cy7
628 nm 670/30 CD25 APC
628 nm 685LP 730/45 CD3 Ax700
628 nm 755LP 780/60 CD20 APC-Cy7
405 nm 450/50 FoxP3 BV421
405 nm 505LP 525/50 Live/Dead Aqua Dye
405 nm 557LP 560/20
405 nm 570LP 585/42
405 nm 600LP 610/20 CD39 BV605
405 nm 635LP 670/30 CD8 BV650
405 nm 690LP 710/50 IL-10 BV711
405 nm 750LP 780/60 CD45 BV786
sample 15-color Treg cell immunophenotyping such as peptides from a vaccine, to measure
panel is shown in Table 5.1.1. immune response.
Following protein transport inhibitor treat-
Antigen specific responses ment, cells are stained for viability markers
Antigen specific responses can be measured and cell surface markers, then fixed and per-
by stimulating immune cells with a specific meabilized for intracellular staining with anti-
antigen and then looking for cytokine pro- cytokine antibodies.
duction, proliferation, activation, memory, or
antigen recognition through MHC multimers. Proliferation analysis
MHC multimers are MHC monomers (MHC-I Cell proliferation can be measured by flow
or MHC-II) that are usually biotinylated and cytometry using several different assays and
then bound to a fluorescent streptavidin back- markers. These assays use different methods to
bone in groups of 4 (tetramer), 5 (pentamer) target proliferation-related events such as in-
or 10 (dextramer). These MHC multimers are corporation of thymidine analogs (BrdU) into
"loaded" with the antigen of choice and then replicating DNA, generational tracking of in-
used to bind to T cells that recognize the anti- heritable permanent dyes (CFSE), and expres-
gen, thus indicating the level of response to a sion of proliferation related antigens (Ki67,
specific antigen. This application is commonly PCNA).
used in vaccine studies. The flow cytometry equivalent of the
3
H thymidine proliferation assay utilizes the
Intracellular cytokine analysis thymidine analogs BrdU or EdU (ethynyl de-
Intracellular cytokine analysis is performed oxyuridine) to pulse growing cells for 2 to
by treating immune cells with a protein trans- 6 hours. Following this incubation, the cells
port inhibitor (Brefeldin A or Monensin) for are stained for surface markers (optional) and
2 to 12 hours to allow for cytokines produced then fixed and permeabilized for staining the
by the cells to accumulate within the cell, en- incorporated BrdU or EdU. The BrdU pro-
abling better detection. Cells can be stimulated cedure utilizes DNase to exposed the BrdU
Flow Cytometry: with various antigens during this incubation,
An Overview for antibody staining, but the EdU procedure

10
Figure 5.1.1 Example of CFSE staining used for proliferation analysis. Human CD4+ T cells
were stained with CFSE and then stimulated for 5 days with an antigen. Each peak of CFSE
staining represents one generation of cell division.
utilizes a copper catalyzed click chemistry used by the immune system to maintain the
to detect the EdU. Both methods are usually homeostasis by removing cells without trig-
counterstained with a DNA-binding dye like gering an inflammatory response. This is in
propidium iodide. In addition, both the BrdU contrast to necrosis, a type of cell death that
and EdU method are compatible with staining does trigger an inflammatory response. Apop-
for additional intracellular antigen markers. tosis is the mechanism of cell death for clon-
CFSE and other similar dyes (CellTrace Vi- ally expanded T cells following an immune
olet, FarRed, etc) cross the cellular membrane response, for self-targeting T cells, for autore-
in living cells and bind covalently and per- active B cells, and multiple other cells in the
manently to intracellular structures (usually to immune system.
lysine residues or other amines). The daughter The detection of apoptosis by flow cytom-
cells of each subsequent generation inherit the etry utilizes multiple targets along the cascade
dye allowing for long term analysis of prolif- of apoptosis-associated events. The transloca-
eration. This technique is very useful when tion of phosphatidylserine to the outer layer
following proliferation resulting from long- of the plasma membrane is detected by An-
term antigen stimulation. An example of CFSE nexin V staining, the endonuclease digestion
staining is shown in Figure 5.1.1. of DNA is detected by the TUNEL (TdT dUTP
Expression of proliferation-related anti- Nick End Labeling) assay, and the activation
gens can also be used as a marker for proof Caspases can be detected by antibodies
liferation. Ki67 is a protein expressed during and dyes, mitochondrial apoptosis is targeted
all phases of cell proliferation but not during by dyes that determine mitochondrial mem-
cell quiescence. Proliferating cell nuclear anti- brane potential and chromatin condensation in
gen (PCNA) is required for DNA replication. the nucleus detected by staining with Hoescht
The presence of either Ki67 or PCNA is an in- 33342.
dicator of cell proliferation. Ki67, PCNA, and Annexin V is a phospholipid binding pro-
BrdU staining in the same cells is shown in tein that binds to phosphatidylserine when it
Figure 5.1.2. is translocated to the outer layer of the cel-
lular membrane during apoptosis. A viability
Apoptosis analysis exclusion dye (like propidium iodide) should
Apoptosis, or programed cell death, is a be used when staining with Annexin V to con-
phenomenon that is frequently examined in firm that the binding is happening on the outer Immunofluore-
immunology and other fields of study. It is scence and Cell
surface of the cellular membrane. Sorting

11
Figure 5.1.2 Example of BrdU, Ki67, and PCNA used to measure proliferation. Cells from the
H23 lung cancer cell line were fixed and then stained with BrdU, Ki67 or PCNA, and DAPI. The
BrdU sample was pulsed for 2 hr with BrdU prior to staining. The samples were counterstained
with DAPI to indicate cell cycle as well as proliferation. The positive cells are indicated in the
rectangular region.
TUNEL is a technique that utilizes the abil- protein–protein interactions. These method-
ity of terminal deoxynucleotidyl transferase ologies revolutionized the detection and iso-
(TdT) to label the ends of DNA breaks associ- lation of cells where the fluorescence is de-
ated with apoptosis with dUTP (deoxyuridine tected only in response to surrogate (Han et al.,
triphosphate) or BrdU. The dUTP or BrdU are 2014). This technology is used for multiple
labeled with a fluorchrome for detection and applications, for example in vivo tracking of
the cells are counter stained with a DNA dye transplanted cells, bacterial or viral infections,
prior to data acquisition. and gene knockout in cells to further elucidate
The caspase signaling pathway is activated gene function.
in most cases of apoptosis. This is targeted by
using intracellular staining and antibodies that Cell cycle analysis
are specific to the active form of caspase 3. Cell cycle analysis assays consist of stain-
There are additional assays that utilize fluo- ing DNA with a saturating amount of DNA
rogenic substrates that when exposed to cas- binding dye. In most cases, the cells are fixed
pase activity are cleaved and then emit fluo- with a 70% ethanol solution which permeabi-
rescence. lizes the cells and then stained with the dye
Mitochondrial apoptosis does not always (PI, 7AAD, DAPI). However, there are dyes
utilize the caspase pathway so different meth- that can enter living cells and stain DNA with-
ods are used for detection. Most of these meth- out harm to the cells such as Hoescht 33342.
ods examine mitochondria membrane poten- In this type of analysis, samples are acquired
tial such as using the dye JC-1. However, there at a low flow rate with linear amplification and
is an antibody against APO2.7 that is localized then analyzed using ploidy modeling software
on the mitochondrial membrane and only ex- to determine the cell cycle phases.
pressed during apoptosis.
Signal transduction flow cytometry
This application uses antibodies made
Molecular Biology against resting and phosphorylated signaling
molecules. The use of these reagents and spe-
Fluorescent protein analysis cialized buffers in staining panels allows for
Fluorescent proteins (GFP, mCherry, YFP, the study of signaling pathways in mixed pop-
mRuby, etc) are used as markers for protein ex- ulations of cells.
pression. Typically, cells are transfected with
a plasmid that contains a promotor sequence RNA flow cytometry
and encodes for a gene of interest along with RNA flow cytometry combines flow cy-
a fluorescent protein. The expression of the tometry with fluorescent in situ hybridiza-
fluorescent protein is used as an indicator for tion (FISH) to detect RNA expression along
the expression of the gene of interest. More re- with protein expression. This technique re-
cently, the expression of a split bi- or tri-partied quires staining panel optimization since not
Flow Cytometry: fluorescence complementation linked to other all fluorochrome conjugated antibodies will
An Overview
proteins allow detection of RNA–protein and withstand treatment at 40°C for multiple 1 hr

12
incubations. It is a useful technique when an- Multiplexed bead array assays
tibodies are not available for a target and RNA Multiplexed bead array assays are sets of
expression can be used instead. beads coated with antibodies against specific
soluble proteins or nucleic acids. Each bead
has a known amount of fluorescence and a
Cell Sorting specific target which gives a location for the
Cell sorting utilizes a flow cytometer with bead in the matrix. The collection of up to 100
cell sorting capabilities to separate and purify beads are incubated with the sample of interest,
cells or particles for further analysis. Essen- treated with a fluorescence reporter and then
tially, any cell or particle that can be made flu- acquired on a flow cytometer with at least 2
orescent can be separated by a cell sorter. Cells lasers to detect the 2 different fluorochromes.
can be sorted into 96 or 384 well plates, tubes Special software is used to calculate analyte
and slides. A few common types of samples amounts based on fluorescence.
are transfected cells expressing a fluorescent
protein, stem cells, tumor infiltrating lympho- Phagocytosis assays
cytes, tumor cells, and white blood cell popula- Using fluorescently tagged bioparticles or
tions. A major consideration with any cell sort bacteria, it is possible to detect phagocytosis
is scaling up the amount of antibody needed using flow cytometry. The bacteria are labeled
for staining large amounts of cells. with a pH sensitive dye that only fluoresces
when exposed to the lower pH of a phagosome,
indicating that the bacteria are phagocytosed.
Other Applications Small particle analysis and sorting
Using flow cytometers with enhanced sen-
Absolute cell counting sitivity, it is possible to detect and sort exo-
Absolute cell counting can be added to any
somes and other sub-micron particles. Anal-
immunophenotyping experiment. The proce-
ysis of cellular exosomes, viruses, and other
dure utilizes fluorescent beads of a known
subcellular particles creates new applications
concentration that is acquired along with the
in multiple fields including cancer biology,
sample. The sample is analyzed and the gated
cancer therapy, and vaccine development. This
number of cells for the population of interest is
technology is still in its development stages,
compared with the number of beads acquired
but techniques and instrumentation are rapidly
in the same sample to generate the number of
improving to make this application more ac-
cells per milliliter.
cessible in the near future.
Quantitative flow cytometry DATA ANALYSIS

Quantitative flow cytometry uses a bead
based standard to generate a staining curve FCS 3.1 File Standard
of known fluorescence amounts. Cells are The FCS file format was created in 1984
then acquired with the same instrument set- to standardize flow cytometry list mode data
tings and linear regression analysis is used files. All flow cytometry data files have the
to calculate the amount of fluorescence on ".fcs" file extension that allow the files to be
the cells. Depending on the bead system read by any flow cytometry analysis program.
used, this can be expressed as Antibodies The current fcs file standard is FCS 3.1.
Bound per Cell (ABC), Antibody Binding
Capacity (ABC) or Molecules of Equivalent Conventional Flow Cytometry
Soluble Fluorochrome (MESF). The best flu- Analysis
orochrome for this application is PE which, Conventional flow cytometry analysis con-
because of its size, almost always bind to an sists of drawing a region around a population
antibody with a 1:1 Fluorochrome to Protein of cells (gating) and applying that region to
Ratio. Molecular Equivalent of Soluble Flu- other parameters within the experiment. This
orescence (MESF) standards can be used to allows specific groups of cells to be selected
convert arbitrary fluorescence intensity mea- for further analysis of other markers. For ex-
surements to number of fluorescent molecules, ample, helper T cells can first be defined by
by generating a standard curve and regression CD3+, CD4+ expression, and then analyzed
from MESF-bead data in any specific exper- for activation by looking within that popula- Immunofluore-
iment, to quantitate approximate numbers of tion for expression of an activation marker, scence and Cell
Sorting
fluorescent labels on a cell. like CD25 (IL-2Rα), and then IFN-γ cytokine

13
Figure 5.1.3 Example of gating for standard data analysis using FlowJo 10.3. Cells are first
gated to remove doublets, for viability, for light scatter, and then for specific lineage markers. This
example is looking at CM9(SIV-gag) Dextramer staining on CD8 cells in PBMC from a vaccinated
Rhesus macaque.
production. An example of gating is in Mathematically, t-SNE is similar to PCA,

Figure 5.1.3. but it can identify more co-segregating fea-
Multiple commercial computer programs, tures than PCA, since t-SNE optimizes only
in addition to the instrument-provided soft- the clustering of similar objects with each
ware, are available for analysis of flow cytom- other, while PCA optimizes both proximity
etry data. The most popular are FlowJo, FCS of similar events and separation of dissimi-
Express, WinList, Kaluza and WinMDI. lar events. Most of these algorithms require
data reduction or down sampling techniques
Cell Cycle Analysis to reduce the complexity of data prior to
Cell cycle analysis software programs uses analysis.
ploidy modeling to determine the phase of the Cytobank is another source for cloud-based
cell cycle represented by the DNA histogram. high dimensional data analysis where users up-
ModFit LT is a program dedicated to this type load data and subscribe to the web-based plat-
of analysis. In addition, a cell cycle analysis form. tSNE is available as plug-in for FlowJo
module is available on FlowJo. and FCSExpress software.
Analysis of High Dimensional Data
Analysis of high dimensional data contain- LITERATURE CITED
ing 14 plus parameters using conventional flow Barteneva, N. S., Fasler-Kan, E., & Vorobjev, I. A.
(2012). Imaging flow cytometry: Coping with
gating strategies is cumbersome and time con-
heterogeneity in biological systems. The Journal
suming. In addition, it is possible to miss of Histochemistry and Cytochemistry, 60(10),
interesting populations of cells because rela- 723–733. doi: 10.1369/0022155412453052.
tionships between markers are not easily deter- Han, Y., Wang, S., Zhang, Z., Ma, X., Li, W.,
mined using traditional gating methods. There Zhang, X., . . . Cui, Z. (2014). In vivo imaging
are multiple new analytical tools that are be- of protein-protein and RNA-protein interactions
ing used to visualize and analyze this type using novel far-red fluorescence complementa-
tion systems. Nucleic Acids Research, 42(13),
of data. Examples are SPADE (Spanning-tree
e103. doi: 10.1093/nar/gku408.
progression analysis of density-normalized
Leipold, M. D., Newell, E. W., & Maecker, H.
events), tSNE (t-Distributed Stochastic Neigh-
T. (2015). Multiparameter Phenotyping of Hu-
bor Embedding), PCA (Principal compo- man PBMCs Using Mass Cytometry. Meth-
Flow Cytometry: nent analysis), and FLOCK (FLOw clustering ods in Molecular Biology, 1343, 81–95. doi:
An Overview
without K). 10.1007/978-1-4939-2963-4_7.

14
Mei, H. E., Leipold, M. D., & Maecker, H. T. Anthozoa species. Nature Biotechnology, 17,
(2016). Platinum-conjugated antibodies for ap- 969–973. doi: 10.1038/13657.
plication in mass cytometry. Cytometry. Part A, Sony. (2017). Sony SA3800 Spectral Analyzer.
89(3), 292–300. doi: 10.1002/cyto.a.22778. Retrieved from https://www.sonybiotechnology
Matz, M. V., Fradkov, A. F., Labas, Y. A., .com/us/instruments/sa3800-spectral-analyzer/.
Savitsky, A. P., Zaraisky, A. G., Markelov, Tsien, R. Y. (1998). Green Fluorescent Protein. An-
M. L., & Lukyanov, S. A. (1999). Flu- nual Review of Biochemistry, 67, 509–544. doi:
orescent proteins from nonbioluminescent 10.1146/annurev.biochem.67.1.509.
Immunofluore-
scence and Cell
Sorting

15
SRL COMMUNICATION
Adapting to the Coronavirus Pandemic: Building and

Incorporating a Diagnostic Pipeline in a Shared
Resource Laboratory
Emma Russell, Ana Agua-Doce, Lotte Carr, Asha Malla, Kerol Bartolovic, Dina Levi,
Carl Henderson, Debipriya Das, Hefin Rhys, Philip Hobson, Sukhveer Purewal, Andrew Riddell*
AT the beginning of February 2020, the COVID-19 outbreak Consortium that successfully developed a diagnostic polymer-
in the UK gathered pace and it seemed highly probable that ase chain reaction (PCR) pipeline (1,2). The Flow STP was
the United Kingdom would follow similar lockdown restric- engaged to support COVID-19 research at the Crick, helping
tion policies seen in other European countries. The Crick’s to develop novel flow cytometry assays utilizing SARS-CoV-2
Flow Cytometry Science Technology Platform (Flow STP) virus-specific proteins. The STP was tasked with building a
helped prepare scientists to finish current experiments and new clinical diagnostic lab and running a novel enzyme-
store experimental material during lockdown to enable an linked immunosorbent assay (ELISA) that had been devel-
efficient restart upon the eventual lifting of the restrictions. oped for detecting antibodies against the S1 spike of the
During this time safety measures were introduced into the SARS-CoV-2 virus. The key processes required are outlined
Flow STP, including social distancing, that directly reduced in Figure 1.
the number of instruments available for use. When lockdown
was announced in the United Kingdom on the 23rd March SARS-CoV-2 ASSAY DEVELOPMENT
2020 the total number of staff allowed into the Crick was
The Flow STP was involved in the development of serology
reduced to a core group of key workers. The Flow STP was
studies, comprising assays, and diagnostic tests focused on
given key worker status and operated to provide flow cyto-
antibodies present in serum. Initially, work began on three
metry to Crick scientists whose sole focus was now
assays: one cell-based, one bead-based, and an ELISA. The
COVID-19.
early development of these required many steps, beginning
In the lead-up to lockdown communications were sent
with a feasible idea through to procuring and testing reagents
to scientists to highlight the possible implications of the pan-
and methods. During protocol development testing was
demic on Flow STP operation. There were significant changes
required to ensure their precision, accuracy, and coherence.
in the way the Flow STP operated due to the challenges faced
To accommodate the assay development and pipeline a
outlined in Table 1.
restricted access containment level 2 (CL2) laboratory was
In early May 2020 the Crick prepared to support testing
created, housing a ZE5™ (Bio-Rad, Hercules, CA) and LSR
during the pandemic by establishing the Crick COVID-19
Fortessa™ (BD Biosciences, San Jose, CA), for analysis of
The Francis Crick Institute, Flow Cytometry Science and Technology Platform,
London, UK
Published online 22 November 2020 in Wiley Online Library
Received 18 August 2020; Revised 23 September 2020; Accepted 19 (wileyonlinelibrary.com)
October 2020
DOI: 10.1002/cyto.a.24248
Grant sponsor: Cancer Research UK, Grant number: FC001999; Grant sponsor:
© 2020 The Authors. Cytometry Part A published by Wiley Periodicals LLC on
Medical Research Council; Grant sponsor: Wellcome Trust
behalf of International Society for Advancement of Cytometry.
Additional Supporting Information may be found in the online version of this
This is an open access article under the terms of the Creative Commons
article.
Attribution License, which permits use, distribution and reproduction in any
*Correspondence to: Andrew Riddell, Flow Cytometry Science Technology medium, provided the original work is properly cited.
Platform Lead, The Francis Crick Institute, 1 Midland Road, London NW1 1AT,
UK. Email: andy.riddell@crick.ac.uk
Cytometry Part A 99A: 90–99, 2021
16
SRL COMMUNICATION
Table 1. Table to highlight the approaches taken to overcome each challenge faced throughout the pandemic and pipeline creation
CHALLENGE APPROACH
As a consequence of social distancing staffing levels Staff predominantly worked from home unless required to attend the
had to be reduced. Crick to aid in assay development.
Other members of the team were furloughed under the government
Coronavirus Job Retention Scheme.
Employees received mandatory weekly COVID-19 swab tests to confirm
suitability to work.
A designated place was created in the lab where scientists could safely
drop off and collect samples to reduce face-to-face contact. Users
communicated with scientists via online video calling. Use of some
instruments in close proximity was restricted, there was reduced
occupancy in laboratories and extended cleaning regimes were put in
place.
Training was suspended to prevent any potential spread of infection, and
remote support was provided as required.
The strict and constantly changing timelines for the The Crick worked closely with a UKAS accredited medical laboratory to
development of both the assays and pipeline. quickly meet the governance requirements allowing swift assay
development.
Introducing the different approach required to work The team was able to draw on diagnostic expertise from existing staff
in diagnostics versus research. members within the Crick with a diagnostic background.
We consulted with qualified biomedical scientists within the Crick to
highlight where processes need adapting to conform to diagnostic
standards.
Restrictions imposed by space available to A complete overhaul of both the layout and laboratory equipment was
accommodate equipment and staff. undertaken in less than a week to meet the requirements of a CL2
diagnostic facility.
Balancing the COVID-19 pipeline with usual Users previously trained in cell sorting were required to perform their
workload responsibilities. own sorts and analysis and were encouraged to help their nontrained
colleagues to use the facility with oversight from the STP staff.
During lockdown non-essential flow cytometry work was suspended and
external users were banned.
Incorporating COVID-19 compliant practices into Use of PPE including masks and face shields.
training regimes for new users.
Development of a series of online videos to provide an alternative to face
to face contact.
serological samples. A second CL2 laboratory was created for pipeline. The pipeline is in the process of attaining this
ELISA testing. accreditation.
Other standards and recommendations include those
from the Royal College of Pathologists’ “The retention and
THE ROLE OF GOVERNANCE IN DIAGNOSTICS storage of pathological records and specimens” (5). These
outline how to store samples and records required in relation
To operate as a clinical diagnostic lab specific standards must
to each sample. In the United Kingdom (and Europe) all per-
be attained. The United Kingdom Accreditation Service
sonal data must be handled in accordance with data protec-
(UKAS) is a government-recognized body that provides certi-
tion laws and regulations (the GDPR and UK Data Protection
fied testing, inspection, and calibration services together with
Act 2018) (6) and all internal recording and sample handling
an oversight function. UKAS requires medical laboratories to
systems must be fit for purpose.
have International Organization for Standardization (ISO)
Completing adequate staff training was imperative and
15189:2012 certification for quality and competence to run a
staff who built the necessary workflows and resources of the
clinical laboratory (3, 4). To meet these standards the Flow
SARS-CoV-2 ELISA assay trained other staff to become com-
STP created new clinical-grade protocols and standard oper-
petent in all processes of the pipeline. Those members of staff
ating procedures (SOPs). The key requirements are auditabil-
trained others until all were fully trained. A training log was
ity and the ability to connect the samples to their results;
kept for each member of staff as part of the audit process and
these shaped the protocols and the design of the Crick’s new
17
SRL COMMUNICATION
Figure 1. Outline of the key processes involved in pipeline development and implementation.
updated when new assays were introduced. The team received • The temperature of fridges and freezers via a sample man-
information regarding how sample handling adhered to the agement system to give an independent secondary
Human Tissue Act 2004 in the United Kingdom and training recording.
in the following areas:
• Good Clinical Practice (GCP) and the legal framework of a Access to sample material was restricted in the interest
diagnostics lab. of safety, information security, and confidentiality. Other gov-
• Data protection laws (the GDPR and UK Data Protection ernance comes from the Crick’s institutional policy
Act 2018) (6). documents.
Auditability was achieved through recording processes RULES ON RESULTS REPORTING

within the pipeline. Internal quality control (QC) standards for
the assays must be kept as specified in the ISO 15189:2012 stan- The final step of the pipeline was reporting serology test
dard. The following reports were stored and made accessible: results to a UKAS accredited medical laboratory by a certified
• Instrumentation QC, maintenance history and validation Biomedical Scientist (BMS). The BMS’s responsibility is to
results. oversee the process and to ensure the results meet the specific
• Reagents QC including validation batch numbers. standards set out above. They are given the processed results
• External Quality Assurance (EQA) using a national or of the tests, as well as the raw data, to assess the quality and
internationally recognized body, such as NEQAS in the ensure they meet the standards for a clinical virologist to
United Kingdom (7). make a diagnosis.
• Maintenance and calibration records for equipment for
example, pipettes used in the pipeline, must be kept for up BUILDING A DIAGNOSTIC PIPELINE
to the lifetime of the equipment plus 4 years (5). The audit trail formed the basis for the development of the
sample reception process. At every decision point in
Building a SARS-CoV-2 diagnostic pipeline in a SRL
18
SRL COMMUNICATION
Figure 2. The flowchart outlines the steps taken along the pipeline from the moment of sample receipt to running the assay. The yellow
pathway follows the person performing the tasks and making decisions. The blue pathway indicates a second person who checks the
action of the person following the yellow pathway, as well as, tracking the sample manually along the pipeline. Rectangles denote
actions, diamonds indicate decision points and circles provide the two end points.
designing the pipeline the primary concern was to ensure the instruction before samples were processed. This removed the
sample could not be separated from its result. A two-person chance of processing a sample that was not meant to be tested
approach, as outlined in Figure 2, was used to enhance the or one that met rejection criteria which would potentially
level of security within the decision making and verification invalidate the result.
processes. SOPs were created to give clear guidelines for how As the pipeline developed, samples were received from
the process should be carried out. These documents will be multiple sources for various uses which required either diag-
extended and added to over time. nostic, research based or quality control output channels. The
Logs were created to identify the sample status across the sample reception process was evolved to accommodate this.
entire pipeline and allowed identification of potential
breakpoints along the way. For each breakpoint a contingency
plan was developed in case of errors as shown in Table 2. The
WHY NOT AUTOMATE FROM THE OUTSET?
contingencies were then graded on a traffic light system: red, The pipeline was started manually to get it working as quickly
amber, and green to indicate the level of impact on the outcome as possible and to enable a more efficient and timely digital
of the assay and dictate the level of verification required. development process. The parameters for a Laboratory Infor-
As part of this process quarantine measures were intro- mation Management System (LIMS) evolved from building
duced ensuring that unscheduled samples that arrived with- the pipeline physically from scratch. Pressure tests in the
out manifests, or samples with specific rejection criteria were form of dummy runs with batches of mock samples were
stored in a separate area. This was a location within the fridge undertaken to test the robustness of the manual pipeline.
that was separated by quarantine criteria notifying the team These steps were then used as a framework for digitization as
that the reporting body should be contacted for further shown in Table 3.
19
SRL COMMUNICATION
Table 2. Demonstrates examples of contingencies in place and an accurate serological evaluation. Other ways of testing for
their grading in case of operator error or equipment failures SARS-CoV-2-specific antibodies were developed including
throughout pipeline.
both ELISA and flow cytometry assays with cells and beads.
ISSUE CONTINGENCY GRADE The development of such tests for diagnostic purposes
required each variable to be tested and validated. There is
Aspirator breaks. Use multi-channel Green
currently no gold standard for SARS-CoV-2 serological tests
pipette to remove
so we used different commercial assays to cross validate our
wash.
internal assays. Although mostly concordant, the different
No precoated plates Masterplate stored in Green
tests showed disparity between some positive samples. The
prepared. fridge at 4 C for up
disparity may be due to biological differences or varying assay
to 72 h.
sensitivities. Importantly, the negatives remained concordant.
Barcode scanner Manually record the Amber
Unlike in research, a diagnostic pipeline requires strictly
breaks. barcode number in
defined protocols to minimize variability and ensure reliable
the paper log and on
reporting to external parties. The team identified steps in the
the 2 ml tube,
pipeline where human error could possibly be introduced and
proceed as normal.
incorporated extra checks or contingencies to prevent this.
Clumpy/hemolyzed Record this Amber
The first obvious step for introduction of human error was in
sample upon information in log
the creation of the 96-well master plate. As well as human
aliquoting. and continue.
pipetting errors there was potential to introduce mismatches
Plate reader failure. Add 50 μl of 1 M Red
between sample position and sample ID. We therefore auto-
NaOH to quench
mated this step using a robot to decant samples from their
plate at 15 min after
tubes into a recorded position on the master plate. As the
addition of substrate,
robot had not been previously used in a diagnostic pipeline
store in dark by
several tests and validations had to be done. At least five runs
wrapping in foil at
of an ELISA assay with large sample numbers (n > 30) were
room temperature
carried out comparing the reproducibility of the robot to
until problem can be
human pipetting.
resolved.
We calculated the intra and inter percentage coefficients of
If >12 h repeat assay.
variation (% CV) to measure the variability of samples both
Any steps not Terminate assay and Red
within and between each run. We found that dispensing sam-
completed as per repeat next day.
ples using the robot gave an intra-assay % CV of 13.07 ± 14.86
SOP/missed.
(mean ± SD) while human pipetting resulted in an intra-assay
% CV of 7.85 ± 4.74%. Conversely, robotic and human
pipetting resulted in interassay % CVs of 19.45 ± 7.51 and
23.50 ± 11.63 respectively as shown in Figure 3. This suggested
Once all the parameters had been defined and tested that while robotic sample dispensing increased intra-assay vari-
automating the process removed multiple sources of potential ation, believed to be due to uneven volume dispensing, it
human error. This increased not only the efficiency of the slightly decreased interassay variation. Importantly, we found
pipeline by reducing time spent performing manual steps but the interassay variation in outcomes for each sample
also freed up time spent by staff performing the tasks. (as detected, not detected, or indeterminate) to be lower for
Initially, we used a commercial electronic sample track- robot versus human pipetting as shown in Figure 4. Taken
ing system already in place at the Crick. After collaborating together and with time constraints these data indicated that the
with the Scientific Computing STP a web app-based LIMS assay uncertainty was within reasonable limits and the use of
was developed that encompassed all the specific requirements the robot for pipetting resulted in more consistent sample
and parameters the commercial option could not. This outcomes.
custom-built system relied upon barcoding and robot tech- For validation it was necessary to demonstrate specificity,
nology to electronically track the samples through the pipe- sensitivity and reproducibility within the results of the pipe-
line. After further rounds of dummy runs and the creation of line (8,9). Using the ELISA assay as an example we evaluated
new SOPs, to include the new LIMS, the pipeline was fully reproducibility by preparing multiple master plates with dif-
automated leaving the manual system in place as a contin- ferent operators. Our test batch of samples contained posi-
gency for any potential point of failure. tives (n = 45) and negatives (n = 40) as previously confirmed
by an independent laboratory through PCR and a commer-
cially available assay. The criterion set for specificity was that
VALIDATING THE PIPELINE tests should not report a negative sample as positive. The cri-
Despite the abundance of recent studies on SARS-CoV-2 rig- terion for sensitivity was that tests should not report a posi-
orous testing and knowledge of the immune response to the tive sample as negative. Finally, for reproducibility the
disease was still lacking. This posed a problem with reporting criterion was that results should be consistent among the five
20
SRL COMMUNICATION
Table 3. Breakdown of the steps involved in the pipeline, how each step is manually recorded and the proposed electronic alternative
TASK MANUAL STEP ELECTRONIC ALTERNATIVE
Samples received by the Crick from Sample delivery recorded via Crick Notification system alerts
courier. usual processes
Flow team that samples have been
received
Samples collected from Crick drop off Operator signs the paper log to Notification system alerts
point and transported in the transfer confirm collection of samples
box via shortest route.
Flow team the samples are in transit to
the lab
Sample container placed in hood and Operator records if any sample Operator records if any sample
visually inspected for leakages. leakages seen on paper log leakages are seen on LIMS
Samples scanned to confirm receipt. Record made on the paper log of Notification system alerts sender
number on box samples have been received
Quarantine process initiated for any Quarantine logbook on sample fridge Fridge Log tracks what samples are in
samples that are unexpected, requires signing into the fridge with which section of quarantine and
incorrect or missing. specific location and reason for notification system alerts sender
quarantine. samples are waiting.
For each sample 250 μl of serum will One barcode is stuck to the paper log Notification system records which
be transferred into one 5 ml tube to confirm which tubes have been samples match those we are expected
and has a bar code attached. received. to receive and highlights any
“Quarantine” samples.
Serum quality logged for any Any samples that are hemolyzed or Option on the dashboard to select
hemolyzed or viscous samples. viscous are marked next to their sample is hemolyzed or viscous for
barcode on the paper log. specific samples.
Up to 40 samples are placed onto the Table filled in with sample barcodes. The Plate barcode is scanned.
robot and duplicated in a 96-well
plate (Library Plate) with one Plate
Manifest barcode.
A copy of the Plate Manifest barcode is The robot individually scans the
attached. barcode of each sample and tracks it
into whichever well the sample is
placed.
A plate manifest layout document is
created with the date and time.
40 original 5 ml tube samples tracked Date and time of the 5 ml samples FreezerPro® records date and time the
for −80 C storage and the date and recorded. 5 ml samples are being tracked.
time marked on the rack.
Sample tubes are stored in the fridge Operator signs samples into fridge N/A
(4 C) until ELISA is complete. using paper log.
ELISA process carried out. SOP checklist double signed to confirm Electronic checklist updated when each
operator has carried out each stage. section of ELISA SOP completed.
ELISA plate placed on reader. Plate barcode is recorded on paper log. Scan plate onto reader so that
notification system logs plate
barcode as “being read”.
Results generated for reporting. Print a copy of the CSV. File generated Electronic reporting process carried out
by the plate reader and store. via LIMS.
Completed samples are transferred Sign in and sign out sheet on each FreezerPro®.
from fridge to freezer. fridge detailing what samples are
where.
21
SRL COMMUNICATION
Figure 3. The variability between robot and manual pipetting. (A) Intra-assay percent coefficients of variation (% CV) for each sample
across separate subplots for each experimental run. (B) Interassay % CV for each sample, collapsed across experimental runs.
different repeats. Our results showed the tests were reproduc- because assays could be conducted at different time points.
ible, specific and sensitive as defined in Table 4. For this the same set of samples kept at 4 C were tested at
Most diagnostic assays do not include standard curves different time points over 2 weeks.
because they are designed to provide a “YES” or “NO”
answer. During the process of pipeline validation however, we
included standard curves in some tests. These standard curves
provided us with parameters such as limits of detection
THE NEW NORMAL
(20.41 pg/ml equivalent of positive control antibody with 95% In June 2020 lockdown restrictions were eased; members of
confidence interval [17.67, 24.65]) and dilution linearity as the Crick started to return to work in a phased approach and
shown in Figure 5 and defined in Table 4. Dilution linearity normal staff duties began to increase. The decision was made
demonstrated that the coating did not interfere with accurate to split the Flow STP into two groups on a rota basis to
detection or result in nonspecific binding. enable social distancing and to prevent the entire team having
While our methods covered all the parameters required to self-isolate if one member tested positive for COVID-19.
for confidence it remained necessary to evaluate each sample Careful management of staff time was required taking into
individually. It was imperative to evaluate sample stability consideration both annual and sick leave requirements.
22
SRL COMMUNICATION
Figure 4. The reproducibility between robot and manual pipetting. (A) Alluvial plots showing how the outcome for each well changes when
dispensed manually or with the robot. Separate subplots are drawn for each experimental run. Each horizontal ribbon represents a single well
and is colored by its manual pipetting outcome. (B) The same data as in A showing how the outcome for each well changes between
experimental runs. Separate subplots show manual and robot pipetting data.
Table 4. Summary of parameters used to validate the This reduction in staff numbers combined with the run-
performance and suitability of the ELISA assay ning of the clinical diagnostic pipeline had a major impact on
PARAMETER RESULT the services the Flow STP could provide. The pre-COVID
workload could not be sustained and was streamlined. Prior
1 Reproducibility. 1.18 ± 0.83% of samples had to the lockdown we had pretrained scientists who were able
discordant outcomesa to perform cell sorting both for themselves and their col-
2 Sensitivity. 87 ± 3.0%a leagues. Post lockdown this relieved a large burden on the
3 Specificity. 100%a Flow STP and enabled scientists to continue their research
4 Uncertainty. Intra and interassay % CVs of independently. The online booking system was adapted and
8.08 ± 7.23 and 14.57 ± 6.99, we implemented a more consultative approach to staff plan-
respectivelya ning and cell sorting which helped triage service requests.
5 Limits of 20.41 pg/ml equivalent of positive The Flow STP continues to aid researchers with COVID-
detection. control antibody with 95% 19 experiments. As previously discussed flow-based serologi-
confidence interval [17.67, cal assays continue to be under development internally. These
24.65]b will be added to the clinical diagnostic pipeline based on their
6 Dilution Linear relationship between log success. The reality of the “new normal” for the Flow STP at
linearity. positive control antibody the Crick is to continue and build on our work on serology
concentration and log assays as a clinical diagnostics lab as well as maintaining an
absorbanceb effective flow cytometry service to the Crick research labs.
a
Although our time has been repurposed, putting constraints
Mean ± standard deviation of five runs with 40 samples per run.
b
From six independent standard curves of positive control anti-
on our usual duties, we are delighted to contribute our newly
body from 0.8 to 200 ng/ml. adapted services to assist in this global pandemic.
23
SRL COMMUNICATION
Figure 5. Concentration of the anti-S1 spike protein antibody CR3022 (the assay positive control antibody) against absorbance at 405 nm
after performing six independent ELISAs. (A) is plotted on a natural scale and (B) is plotted on a semi-log scale. Two technical replicates
per plate are shown. Note that except for the saturating concentration the relationship between log concentration and log absorbance is
linear which indicates dilution linearity.
CONCLUSION their advice on protocols and for helping us to set up the CL2
laboratories. Secondly, Richard Byrne, Gill Adams, Mathew
The challenges faced by the Flow STP can be separated into
Sargent and all the hub team for responding to our instru-
those created by COVID-19 regarding the changes required
mentation requests so rapidly. With regards to ELISA assay
to everyday working practices and those posed by the uncer-
development we would like to thank Laura McCoy from
tainty and novelty of creating the pipeline as outlined in
UCL, George Kassiotis and his team for their help and Peter
Figure 1. The practices that have been put in place to over-
Cherepanov for developing the protein coating for the ELISA
come the first continue to be instilled in the current climate
as well as beads used in the bead assay. Also, thank you to
and are expected to ease off in line with both government
Jerome Nicod for providing us with the robots, to Theo San-
advice and updates to Crick policies. While this project would
derson for programming them and Phil Walker for setting up
have been possible without it, the team recognizes the advan-
the barcoding system. In addition we would like to acknowl-
tage of having diagnostic expertise to advise and guide the
edge the Crick COVID-19 Governance Team for their sup-
pipeline development process. Particularly to maximize effi-
port and guidance, to thank Richard Stone and Emma Nye
ciency by avoiding potential pitfalls. Should the reader be
for reviewing the pipeline and the Crick’s Scientific Comput-
looking to perform a similar process the authors recommend
ing STP for helping to set up a reporting strategy and the
consulting with diagnostic expertise to facilitate this. Incorpo-
LIMS. Many thanks to Kathleen Evans for her invaluable
rating the pipeline into our daily tasks while at reduced
input. Finally, the team would like to extend their thanks to
staffing levels remains an ongoing challenge. The Flow STP
all those who have not specifically been mentioned but who
have successfully carried out the development and implemen-
were fundamental to making this project possible. This work
tation of a novel SARs-CoV-2 ELISA pipeline with the confi-
was supported by the Francis Crick Institute which receives
dence that it is fit for purpose and ready for handover to be
its core funding from Cancer Research UK (FC001999), the
maintained outside the Flow STP when required.
Research Councils UK Medical Research Council (FC001999),
and the Wellcome Trust (FC001999).
ACKNOWLEDGMENTS
To set up a clinical diagnostics lab in such a short time frame
required a huge level of collaboration and assistance from
AUTHOR CONTRIBUTIONS
other members of the Crick. Firstly, thank you to the Safety, Emma Russell: Conceptualization; formal analysis; project
Health and Sustainability team as well as Nicola O’Reilly for administration; validation; writing-original draft; writing-
24
SRL COMMUNICATION
review and editing. Ana Agua-Doce: Conceptualization; • Sera is not HTA relevant material.
formal analysis; project administration; validation; writing- • Samples used were leftover serum samples from routine
original draft; writing-review and editing. Lotte Carr: clinical testing of individuals, not taken for a purpose
Conceptualization; formal analysis; project administration; within the remit of Research Ethics Committees.
validation; writing-original draft; writing-review and editing. • Individual samples were anonymized such that no personal
Asha Malla: Writing-original draft; writing-review and identifying information was present.
editing. Kerol Bartolovic: Conceptualization; writing-original
draft; writing-review and editing. Dina Levi: Writing-original These samples were provided with appropriate consents
draft; writing-review and editing. Carl Henderson: Writing- from the source.
original draft; writing-review and editing. Debipriya Das:
Writing-original draft; writing-review and editing. Hefin
Rhys: Conceptualization; formal analysis; project administra- LITERATURE CITED
tion; validation; writing-original draft; writing-review and 1. Houlihan CF, Vora N, Byrne, T, Lewer, D, Kelly, G, Heaney, J, Gandhi, S, Spyer, MJ,
Beale, R, & Cherepanov, P, et al. Pandemic peak SARS-CoV-2 infection and serocon-
editing. Philip Hobson: Conceptualization; formal analysis; version rates in London frontline health-care workers. Lancet 2020;396:e6–e7.
project administration; validation; writing-original draft; 2. Aitken, J, Allen, Z, Ambler, R, Ambrose, K, Ashton, E, Avola, A, Balakrishnan, S,
Barns-Jenkins, C, Barr, G, & Barrell, S , et al. Scalable and robust SARS-CoV-2 testing
writing-review and editing. Sukhveer Purewal: Conceptuali- in an academic center. Nat Biotechnol2020;38:927–931.
zation; project administration; writing-original draft; writing- 3. Medical laboratories — Requirements for quality and competence (ISO 15189:2012).
EUROPEAN COMMITTEE FOR STANDARDIZATION Ref. No. EN ISO 15189:
review and editing. Andrew Riddell: Conceptualization; 2012
formal analysis; project administration; resources; writing- 4. Burnett DA. Practical Guide to ISO 15189 in Laboratory Medicine. London, UK:
ACB Venture Publications, 2002.
original draft; writing-review and editing. 5. Royal College of Pathologists. The Retention and Storage of Pathological Records and
Specimens. 5th ed. London, UK: Royal College of Pathologists, 2005.
6. https://libraryfaqs.worc.ac.uk/faq/230277
DECLARATION 7. https://ukneqas.org.uk
8. https://www.oie.int/fileadmin/Home/eng/Health_standards/aahm/current/chapitre_
The following rationale was applied to conclude that no ethics validation_diagnostics_assays.pdf
approval was required to conduct this assay development: 9. (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4541289/)
25
A Mouse Model of Sublethal
Leptospirosis: Protocols for Infection with
Leptospira Through Natural Transmission
Routes, for Monitoring Clinical and
Molecular Scores of Disease, and for
Evaluation of the Host Immune Response
Nisha Nair1 and Maria Gomes-Solecki1,2
1
Department of Microbiology, Immunology and Biochemistry, The University of Tennessee
Health Science Center, Memphis, Tennessee
2
Corresponding author: mgomesso@uthsc.edu
Leptospirosis is a zoonotic disease caused by pathogenic Leptospira species

that are maintained in sylvatic and domestic environments by transmission
among rodents and other carriers. Humans become infected after contact of
breached skin or mucosa with contaminated water or soil. Understanding per-
sistent or sublethal infection in a host is critical for controlling human risk of
exposure to pathogenic Leptospira. Animal models that recapitulate disease
progression after infection via natural transmission routes are more appropriate
for validation of vaccines and therapeutics. Furthermore, the ability to measure
shedding of live Leptospira in urine of reservoir and carrier hosts can be used
to develop new diagnostic assays and sensors to evaluate human risk of expo-
sure. We developed inbred mouse models of Leptospirosis, that bypass survival
as a criterion, in which we can analyze both pathogen and host factors affect-
ing sublethal infection (<1 month), including shedding of Leptospira in urine.
Mice are infected with pathogenic Leptospira using a physiologic route, and
the clinical, histological, and molecular scores of disease are measured. Fur-
thermore, the host immune response to Leptospira is evaluated. This mouse
model also provides a tool in which to test fundamental hypotheses related to
host-pathogen interactions and the immune mechanisms engaged in protective
and pathogenic immune responses. © 2020 Wiley Periodicals LLC
Basic Protocol 1: Culture and maintenance of virulent Leptospira
Basic Protocol 2: Infection of mice through a physiologic route and collection
of clinical scores and biological samples
Basic Protocol 3: Analysis of pathogenesis after Leptospira infection
Keywords: Leptospira mouse model natural transmission routes
physiologic route of infection sublethal leptospirosis
Nair and
Gomes-Solecki
Current Protocols in Microbiology e127, Volume 59

Published in Wiley Online Library (wileyonlinelibrary.com).
doi: 10.1002/cpmc.127
26 © 2020 Wiley Periodicals LLC
INTRODUCTION
Leptospirosis is a neglected emerging zoonotic disease with worldwide distribution that
affects virtually all vertebrates, mostly in tropical regions in resource-poor countries. It
is estimated to cause ∼1 million cases and ∼60,000 deaths a year globally (Costa et al.,
2015). Reservoir hosts of Leptospira (e.g., rats, mice) and other carriers (cows, sheep,
dogs, wildlife) become persistently infected and shed the bacteria in urine into the envi-
ronment, maintaining the spirochete in its enzootic cycle. Humans become infected after
contact of breached skin or mucosa with contaminated water or soil (Bharti et al., 2003;
Casanovas-Massana et al., 2018; Schneider et al., 2018). Rats are good empirical animal
models of chronic (>3 months) infection (Bonilla-Santiago & Nally, 2011, Thiermann,
1981), but the lack of reagents for immunology research limit their use. Our goal was
to develop inbred mouse models of Leptospirosis that bypass survival as a criterion, in
which we can study both pathogen and host factors affecting persistent sublethal infection
(<1 month) and shedding of live Leptospira in urine.
We describe a mouse model of sublethal leptospirosis that produces consistent mea-

surable readouts of disease progression and pathogen dissemination following infection
through natural physiologic routes (Nair, Guedes, Werts, & Gomes-Solecki, 2020; Sul-
livan, Nair, Potula, & Gomes-Solecki, 2017). This model helps investigators understand
persistent human disease, which affects ∼90% of patients (Costa et al., 2015). It can be
used to acquire data on the performance and toxicity of therapeutics for sublethal lep-
tospirosis, on the efficacy and safety of vaccines including shedding-blocking vaccines,
and on the antibody- and cellular-mediated immune mechanisms engaged in protective or
pathological immune responses to vaccines or to other immunomodulator agents. It can
be used to acquire proof-of-principle data on sensitivity, specificity, and accuracy of new
non-invasive diagnostic tools designed to capture Leptospira directly in urine for human
and veterinary applications. Furthermore, it can be used for analysis of host-pathogen in-
teractions using pathogenic, intermediate, and non-pathogenic Leptospira serovars and
to answer other basic research questions that require analysis of primary cells after in-
fection or vaccination of live animals. Below is a representation of the methods herein
described (Fig. 1).
Basic Protocol 1: Culture and maintenance of virulent Leptospira

Here, we describe how to culture Leptospira in vitro, how to quantify Leptospira both by
counting live motile bacteria under a dark-field microscope and by qPCR, how to freeze
Figure 1 Workflow for infection of mice with pathogenic Leptospira and subsequent collection of biological
samples.

27
cultures, and how to passage cultured pathogenic Leptospira in hamster to maintain vir-
ulent stocks in the laboratory.
Basic Protocol 2: Infection of mice through a physiologic route, and collection of

clinical scores and biological samples
In this protocol, we describe how to infect mice with pathogenic Leptospira using three
natural physiologic routes of infection (transdermal abrasion and conjunctival and nasal
mucosa), how to record clinical scores (weight) that correlate with disease progression,
and how to collect blood, urine, and tissues to process for analysis of pathogenesis.
Basic Protocol 3: Analysis of pathogenesis after Leptospira infection

The purpose of this protocol is to provide guidance on which techniques to use to evaluate
dissemination of Leptospira to target tissues and how to evaluate molecular, cellular,
and histologic differences that characterize the immune response to infection and tissue
inflammation.
CULTURE AND MAINTENANCE OF VIRULENT LEPTOSPIRA BASIC

PROTOCOL 1
In vitro culture of Leptospira is essential to produce the inoculum needed for assess-
ment of host-pathogen interactions. Furthermore, a growth curve is the gold standard
test of bacterial viability. Here, we describe how to culture Leptospira in vitro from a
frozen stock, how to quantify the number of spirochetes in culture, and how to make
stocks for freezing. Finally, we describe how to passage Leptospira in vivo to produce
highly virulent bacteria from hamster kidney, which is then maintained by n vitro sub-
culture. Quantification of live Leptospira is done by enumeration of motile spirochetes
in a Petroff-Hausser chamber under a dark-field microscope followed by confirmation by
qPCR. All of these techniques must be mastered before infection of live animals.
Definitions
BSL2/ABSL2 = Biosafety Level 2/Animal Biosafety Level 2
EMJH = Ellinghausen-McCullough-Johnson-Harris
PPE = personal protective equipment
DFM = dark-field microscopy
PCR = polymerase chain reaction
RT-PCR = reverse-transcriptase polymerase chain reaction
DNA = deoxyribonucleic acid
PBS = phosphate-buffered saline
CAUTION: Biosafety Level 2 (BSL-2)/Animal Biosafety Level 2 (ABSL-2) procedures
must be used for handling Leptospira cultures and infected hamsters. Personal protective
equipment (PPE) needed: glasses or goggles, cap, mask, gloves, and gown.
NOTE: All animal experiments require approval by the local ethical and animal handling
offices.
Materials
Pathogenic Leptospira species (Leptospira): we use Leptospira interrogans serovar
Copenhageni strain Fiocruz L1-130 (ATCC #BAA-1198)
EMJH base medium (BD, cat. no. 279410)
Leptospira enrichment EMJH (BD DifcoTM , cat. no. 279510)
DNeasy Blood & Tissue Kit (Qiagen, cat. no. 69506)
Maxima Probe/ROX qPCR 2× mix (Thermo Fisher Scientific, cat. no. K0233)
Leptospira-specific TAMRA probe and 16S rRNA primers (Eurofins Scientific, Nair and
Gomes-Solecki
Table 1)

28
Table 1 TAMRA Probes and Primers for RT-PCR
Leptospira specific
Lepto_F CCCGCGTCCGATTAG
Lepto_R TCCATTGTGGCCGAACAC
LIC_TAMRA CTCACCAAGGCGACGATCGGTAGC
Mouse specific
β-actin _F CCACAGCTGAGAGGGAAATC
β-actin_R CCAATAGTGATGACCTGGCCG
β-actin_TAMRA GGAGATGGCCACTGCCGCATC
TNF-α_F CACACTCAGATCATCTTCTCAAAAT
TNF-α_R AAGGTACAACCCATCGGCTGGCA
TNF-α-TAMRA AGCCTGTAGCCCACGTCGTAGCAAAC
IFN-γ _F CAAGTGGCATAGATGTGGAAGAAA
IFN-γ_R CTGGCTCTGCAGGATTTTCA
IFN-γ-TAMRA GGAGGAACTGGCAAAAGGATGGTGAC
RANTES_F AGTGCTCCAATCTTGCAGTCGT
RANTES_R CTTCTTCTCTGGGTTGGCACACACT
RANTES-TAMRA TTGTCACTCGAAGGAACCG
MIP2_F TGACTTCAAGAACATCCAGAGCTT
MIP2_R CTTGAGAGTGGCTATGACTTCTGTC
MIP2-TAMRA TGACGCCCCCAGGACCCCA
KC_F CGAGGCTTGCCTTGACCCTGAA
KC_R GGGACACCTTTTAGCATCTT
KC_TAMRA CCCTTGGTTCAGAAAATTGTCCA
IL-4_F TGTACCAGGAGCCATATCCA
IL-4_R TTCTTCGTTGCTGTGAGGAC
IL-4_TAMRA ATCCATCTCCGTGCATGGCG
iNOS_F GCTGGGCTGTACAAACCTTC
iNOS_R GCATTGGAAGTGAAGCGTTTC
iNOS_TAMRA GGCAGCCTGTGAGACCTTTGAT
ColA1_F TAAGGGTACCGCTGGAGAAC
ColA1_R GTTCACCTCTCTCACCAGCA
ColA1_TAMRA AGAGCGAGGCCTTCCCGGAC
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, cat. no.D2650-100ML)

Liquid nitrogen (N2 )
Phosphate-buffered saline (PBS; Sigma-Aldrich, cat. no. TMS-012-A)
Hamster, 4-weeks-old, male or female
Forane (Isoflurane, USP, Baxter, SKU cat. no. 10011936060)
14-ml round-bottom tube (Thermo Fisher Scientific, cat. no.150268)

30°C incubator
Glass slides and coverslips (VWR micro cover glass)
Nair and Dark-field microscope (DFM; Zeiss, USA)
Gomes-Solecki
Petroff-Hausser chamber (Hausser Scientific, cat. no.3900)

29
Eppendorf minispin microcentrifuge (Eppendorf, cat. no. 022668498)
StepOne Plus Real-Time PCR System (Thermo Fisher Scientific, cat. no.
43-766-00) or any other real-time PCR system
MicroAmpTM Fast Optical 96-Well Reaction Plate with Barcode, 0.1 ml (Thermo
Fisher Scientific, cat. no. 4366932)
0.5 ml O-ring screw-cap cryovials (Midsci, SKU cat. no. AV-2125-S0)
Syringe (BD, cat. no. 309657)
21-G needles (BD, cat. no. 305167)
Somnosuite (Kent Scientific Corporation, cat. no. SS-01)
Surgical equipment
Additional reagents and equipment for euthanasia (see Current Protocols article:
Donovan & Brown, 2006a) injection (see Current Protocols article: Donovan &
Brown, 2006b), and anesthesia (see Current Protocols article: Donovan &
Brown, 2001) of rodents
Culture of Leptospira in vitro
1. Thaw 250 μl of a frozen stock and immediately add to 4.25 ml of EMJH base
medium. Add 500 μl of the supplement (BD DifcoTM Leptospira enrichment EMJH)
and add 5-fluorouracil at a final concentration of 100 μg/ml in a 14-ml round-bottom
tube.
2. Place cultures at 30°C up to 4 weeks.
5-Fluorouracil prevents contamination of the culture by inhibiting the growth of other
organisms, but does not affect the growth of Leptospira. When reviving a frozen stock,
inoculate quickly after thawing into supplemented EMJH base, and add 5-FU 3-4 days
after confirming growth under dark-field microscopy (DFM).
3. Monitor the culture for the presence of live, motile spirochetes by DFM every 3-
4 days: deposit 5 μl of culture on a glass slide and cover with a coverslip before
checking under the 40× objective of the microscope. Set aside a 100-μl aliquot of
the culture for quantification by qPCR.
Other pathogenic Leptospira species should grow under these standard conditions.
However, differences exist between species and serovars. If the above protocol proves
unsuccessful, consider trying modifications such as replacing plastic tubes with glass,
wrapping tubes in aluminum foil to provide a dark environment, and adding or omitting
supplements in the EMJH base (unpub. observ.).
Quantification and determination of viability

Quantification of Leptospira can be done by DFM of cultured Leptospira and confirmed
by amplification of Leptospira 16S rRNA by qPCR.
Quantification of live Leptospira by DFM

4. Add 10 μl of a 1- to 3-week-old culture of Leptospira to the grid of a Petroff-Hausser
(PH) chamber and cover the grid with a glass coverslip.
5. Count motile spirochetes in five fields of the PH chamber under a DFM set at 20×
or 40×.
6. To graph a growth curve, count the number of Leptospira at a minimum of three
time points—e.g., d1, d7, and d14 if growing Leptospira from a frozen stock; or d1,
d3, and d7 if growing Leptospira from infected kidney.
The total number of Leptospira in the culture is calculated as follows:
No. of bacteria/ml = (avg. of 5 squares) × 25 × dilution factor × 50,000. Nair and

Gomes-Solecki

30
Quantification of live and dead Leptospira by qPCR
7. Prepare a known standard curve of a Leptospira stock: Take 108 Leptospira cells
enumerated under DFM and microcentrifuge at maximum speed in an Eppendorf
minispin microcentrifuge. Purify the DNA with a DNeasy kit and serially dilute to
105 -101 cells/μl.
8. Load 18 μl of PCR master mix per well (prepared using Leptospira-specific primers
and TAMRA probe (listed in Table 1) and Maxima Probe/ROX qPCR 2× mix, as
TM
per the instructions of Maxima probe/ROX 2× mix user guide) on a MicroAmp
Fast Optical 96-Well Reaction Plate.
9. Add 2 μl of the known standard curve DNA and 2 μl of the test culture (1-3 week
old) into separate assigned wells.
10. Run the StepOne Plus PCR machine program recommended for the Maxima
Probe/ROX qPCR master mix (usually 40 cycles).
11. Analyze data by comparison to the known standard curve.
Leptospira are always quantified by DFM before inoculation of live cultures into animals;
qPCR is used as a confirmatory method, employing primers and probes specific for the
Leptospira species of interest, keeping in mind that qPCR will amplify DNA from both
live and dead spirochetes.
Live culture quantification by DFM should be within 1 Log of qPCR quantification.
Counting with Petroff-Hausser chamber under DFM is considered the gold standard for
enumeration.
Personnel should be previously trained in use of the qPCR machine.
Freezing a culture of Leptospira

12. Add 4% of DMSO to a culture of Leptospira after it reaches cell density >107
cells/ml.
13. Add 250 μl of culture per 0.5-ml cryovial and freeze at −80°C or in liquid nitrogen
immediately.
Infection of hamsters
Maintenance of virulence in pathogenic Leptospira requires passaging cultured bacteria
in hamsters in vivo. Virulent Leptospira are obtained by culturing kidney from infected
hamsters.
14. Inoculate 500 μl of PBS containing 1000-5000 Leptospira previously quantified by
DFM into the peritoneal cavity of an hamster anesthetized with 2%-5% isoflurane
using a Somnosuite instrument according to the manufacturer’s operating instruc-
tions.
Intraperitoneal injection of rodents is described in detail in Current Protocols article
Donovan & Brown (2006). Anesthesia of rodents is described in Current Protocols article
Donovan & Brown (2001).
15. Monitor the hamster for 15 days: record weight and signs of disease such as loss of
appetite, arched back, and prostration, and determine when the animal reaches the
endpoint criterion (>10% weight loss).
16. Euthanize the hamster with 5% isoflurane (see Current Protocols article: Donovan
& Brown, 2001), harvest the kidneys aseptically, cut the kidney into four pieces. and
place each piece in one tube containing 5 ml of EMJH base medium supplemented
with 500 μl Leptospira enrichment EMJH. Incubate the tubes at 30°C up to 4 weeks
Nair and
Gomes-Solecki to recover live virulent Leptospira.

31
17. Two to three days after euthanasia, remove the kidney tissue from the tube and return
the culture to the 30°C incubator.
18. Monitor the cultures for live motile Leptospira weekly by observation under the
DFM.
19. When Leptospira cultures reach cell density of >107 bacteria/ml, prepare DMSO
stocks and freeze in −80°C (see steps 12 and 13) to save for later use.
Hamster passage 1 cultures frozen as DMSO stocks can be subcultured up to passage 4
in vitro without losing virulence; these subcultures are then used to prepare inoculum to
infect mice.
Removing kidney tissue from EMJH culture after 3-4 days (before it starts to decay) al-
lows for faster growth of Leptospira than leaving the tissues in the tube for 2-4 weeks.
INFECTION OF MICE THROUGH A PHYSIOLOGIC ROUTE AND

COLLECTION OF CLINICAL SCORES AND BIOLOGICAL SAMPLES
In the protocols below, we describe how to infect mice using three physiologic routes of
infection, how to keep records of weight (gain or loss), how to collect urine and blood
from live mice, and how to collect tissues for analysis of pathogenesis after euthanasia.
The basic protocol describes infection through transdermal abrasion (TD; Nair et al.,
2020). Infection through other physiologic routes such as the conjunctiva (CJ; Sullivan
et al., 2017) and nasal mucosa (NM; Nair et al., 2020) are presented as alternate protocols.
Although described by others (Asoh et al., 2014), we did not succeed in infecting mice
through the oral route (Nair et al., 2020). Thus, oral infection is not described.
In general, mice are anesthetized and inoculated with a prequantified dose of infectious
Leptospira, the weight is recorded, and blood and urine are collected during 15-21 days.
After euthanasia, blood and kidneys are collected, and other tissues, such as lung, liver,
and spleen, may be collected for further analysis of pathogenesis.
Infection of mice via physiologic routes of infection
Natural transmission routes of infection are more appropriate to fully validate vaccines,
therapeutics, and diagnostic assays for human and veterinary use. Here, we describe a
main protocol for transdermal abrasion and two alternate physiologic infection routes.
The standard laboratory practice of intraperitoneal inoculation (Richer, Potula, Melo,
Vieira, & Gomes-Solecki, 2015) is added for comparative purposes. For experimental
outcomes strictly dependent on infection dose, the intraperitoneal route is recommended.
Materials specific to each infection route and the protocol steps are listed below.
NOTE: These infection protocols were established using Leptospira interrogans serovar
Copenhageni strain Fiocruz L1-130 and C3H-HeJ mice older than 9 weeks. Other
pathogenic Leptospira species may be used. If so, before proceeding with the entire pro-
tocol, consider doing a dose titration using 105 -108 Leptospira for infection and PCR
from urine as a readout to determine the best infection dose. Mice younger than 9 weeks
can be used.
must be used for handling Leptospira cultures and infected mice. Personal protective
offices.
Definitions
TD = transdermal abrasion
Nair and
CJ = conjunctival inoculation Gomes-Solecki
NM = nasal mucosa inoculation

32
IP = intraperitoneal inoculation
BSC II = Class II biological safety cabinet
BASIC INFECTION OF MICE VIA TRANSDERMAL ABRASION

PROTOCOL 2
A transdermal abrasion protocol should be considered when questions arise regarding
infection through wounded skin. The materials below are needed for infection via trans-
dermal abrasion and for all of the infection routes described in the alternate protocols.
Materials
9-11 week old C3H/HeJ mice (The Jackson Laboratory)
Forane (Isoflurane, USP, Baxter, SKU cat. no. 10011936060)
Sterile alcohol pads
∼108 L. interrogans (see Basic Protocol 1) in 50 μl sterile PBS (Sigma-Aldrich,
cat. no. TMS-012-A)
Somnosuite (Kent Scientific Corporation, cat. no. SS-01)
Hair clippers
Sterile razor blades
Sandpaper
Sterile non-adhesive gauze pads (Medique, cat. no. 64212)
Occlusive bandage (Curad, or any non-medicated adhesive bandage)
Disposable Animal Biosafety Level 2 (ABSL-2) mouse cages
10-, 20-, and 200-μl repeat pipettor and sterile tips (Rainin LTS)
Additional reagents and equipment for anesthesia (see Current Protocols article:
Donovan & Brown, 2001) of rodents
1. Anesthetize mice with 4%-5% isoflurane for induction and 1%-2% for maintenance
(see Current Protocols article: Donovan & Brown, 2001) using a Somnosuite.
2. Clip and shave a small area of fur (<1 in.2 ) in the mouse dorsal area (to prevent
grooming and scratching).
3. Clean the shaved area using alcohol pads and allow to dry. Use a sterile razor or
sandpaper to gently scrape the skin while avoiding deep cuts and bleeding.
4. Add 25 μl of the L. interrogans culture (108 organisms/50 μl PBS) to the wound and
allow the liquid to absorb and air dry. This process can be repeated until sufficient
volume has been added to the wound to reach the required infection dose (∼108 for
L. interrogans).
5. Cover the wound using sterile non-adhesive gauze pads and an occlusive bandage.
6. House mice individually in ABSL-2 cages for 8 days until the wound starts to heal.
After 8 days, mice can be grouped in numbers of four per cage.
7. Monitor the wound three times on the day of the procedure to confirm that the oc-
clusive bandage has not been removed, and then daily until termination (d15-21) to
check for clinical signs of disease.
ALTERNATE CONJUNCTIVAL (CJ) INFECTION

PROTOCOL 1
Additional Materials (also see Basic Protocol 2)
3.34 × 109 L. interrogans/ml in sterile PBS (Sigma-Aldrich, cat. no. TMS-012-A)
1. Anesthetize mice in a Somnosuite with 4%-5% isoflurane for induction and 1%-2%
for maintenance (see Current Protocols article: Donovan & Brown, 2001).
Nair and 2. Using a 10-μl pipette tip, apply 10 μl of the 3.34 × 109 Leptospira/ml culture on the
Gomes-Solecki medial canthus of one eye; then add 10 μl of the culture in the other eye.

33
3. Gently massage the eyelids to spread the liquid evenly over the conjunctiva.
4. Allow enough time (∼20 min) for the bacterial culture to be absorbed.
5. To attain the infection dose of 1−2 × 108 L. interrogans/mouse, repeat the above
process for a total of three times per eye.
6. House mice in groups of four in ABSL-2 cages.
7. Monitor three times on the day of the procedure and then daily until termination (d
15-21) to check for clinical signs of disease.
NASAL MUCOSA (NM) INFECTION ALTERNATE

PROTOCOL 2
3.34 × 109 L. interrogans/ml in sterile PBS (Sigma-Aldrich, cat. no. TMS-012-A)
(see Basic Protocol 1)
1. Anesthetize mice with 4%-5% isoflurane for induction and 1%-2% for maintenance
(see Current Protocols article: Donovan & Brown, 2001).
2. Deposit 10 μl of sterile PBS containing L. interrogans as small drops into each nostril,
synchronized with inhalation.
The volume added per nostril has to be adjusted in order to attain a desired infectious
dose.

4. Monitor mice daily until termination (d 15-21) to check for clinical signs of disease.
INTRAPERITONEAL (IP) INFECTION ALTERNATE

PROTOCOL 3
Materials
∼106 to 108 L. interrogans in 60 μl sterile PBS (Sigma-Aldrich, cat. no.
TMS-012-A)
25-G needles (BD, cat. no. 305122)
Additional reagents and equipment for anesthesia (see Current Protocols article:
Donovan & Brown, 2001) and intraperitoneal injection (see Current Protocols
article: Donovan & Brown, 2006b) of mice
1. Anesthetize mice with 4%-5% isoflurane for induction (see Current Protocols article:
Donovan & Brown, 2001).
2. Using a 25-G needle, carefully inoculate 100-200 μl of PBS containing 106 -108 L.
interrogans into the peritoneal cavity of the mouse (see Current Protocols article:
Donovan & Brown, 2006b).
4. Monitor mice daily until termination (d 15-21) to check for clinical signs of disease.
COLLECTION OF CLINICAL SCORES AND BIOLOGICAL SAMPLES SUPPORT

AFTER INFECTION PROTOCOL
Assessment of pathogenesis and immune responses induced by infectious Leptospira
can be done after processing of clinical scores and tissues from mice, before and after
euthanasia. From live mice, we collect weight records and urine daily, and blood every
other day. We use weight loss as a clinical measurement of disease progression, and we
quantify Leptospira load in blood and urine to estimate bacterial dissemination to target
organs, colonization of the kidneys, and shedding. After euthanasia, blood, kidney, lung, Nair and
liver, and spleen are collected. Gomes-Solecki

34
Weight Measurement
Empty tip box or small bowl
TM
Weighing balance (Fisher Science Education Portable Balances)
1a. Place an empty tip box/bowl on a scale and record its weight (tare).
2a. Place a mouse inside the tared box on the scale and record the weight daily for up
to 15-21 days.
Urine Collection from Live Mice
Sterilized piece of aluminum foil (6-in. × 6-in.)
Transfer pipet or 200-μl repeat pipettor with tips
Labeled sterile 1.5-ml microcentrifuge tubes (e.g., Eppendorf)
1b. Transfer one cage into BSL-2 biosafety cabinet after sterilizing the surface.
2b. Spread a 6-in. × 6-in. size sterilized piece of aluminum foil inside the biosafety
cabinet.
3b. Gently but effectively restrain one mouse within one hand and hold the animal
directly above the aluminum foil.
4b. Gently massage the bladder area of the mouse until it urinates.
Female mice tend to urinate readily. Male mice comply with more difficulty.
Do not apply pressure while massaging to collect urine. If urine cannot be collected, put
the mouse back in the cage and repeat the procedure after a couple of hours.
5b. Using a pipette collect the urine from aluminum foil into a sterile 1.5-ml micro-
centrifuge tube.
6b. Store the urine in a −20°C freezer.
Blood Collection from Live Mice
Mouse Tailveiner restraint (Braintree Scientific Inc., cat. no. TV-150)
23-G needle (BD, cat. no. 305193)
Lancet
Capillary tubes (Thermo Fisher Scientific, cat. no. 22-260943)
Pipet bulb (Thermo Fisher Scientific, cat. no. 22-170-406)
1c. Restrain the mouse with its tail accessible for drawing blood.
2c. Use a 23-G needle to pierce the tail vein. Alternatively, a lancet can also be used
to pierce the tail vein.
3c. Massage the tail gently and collect the blood using a capillary tube with a bulb.
4c. Centrifuge the tube and save the plasma/serum in an Eppendorf at −20°C.
Blood can be collected using a pipettor and sterile tips instead of a capillary tube; however,
the capillary tube is much more efficient.
Up to 50 μl of blood is collected from the tail every other day until d 15-d 21 (max 150 μl
per week).
Collection of Tissues After Euthanasia: Blood, Kidney, Lung, Liver, and Spleen
Heat-inactivated fetal bovine serum (FBS; Thermo Fisher Scientific, cat. no.
10-082-139)
Nair and Corning penicillin-streptomycin solution (Thermo Fisher Scientific, cat. no.
Gomes-Solecki MT30001CI)

35
RPMI 1640 medium (Thermo Fisher Scientific, cat. no. MT10041CV)
70% ethanol
RNAlaterTM (Thermo Fisher Scientific, cat. no. AM7021)
EMJH base medium (BD, cat. no. 279410)
Leptospira enrichment EMJH (BD DifcoTM , cat. no. 279510)
Neutral buffered formalin (Thermo Fisher Scientific, cat. no. 22-110-869)
15 -ml tubes (VWR, cat. no. 89039-664)

Sterile surgical equipment (scissors, scalpel, forceps, dissecting pins)
Instant sealing sterilization pouches (Thermo Fisher Scientific, cat. no. 01-812-55)
Sterile tissue culture petri dishes
Sterile 1.5-ml microcentrifuge tubes (e.g., Eppendorf) and 10-ml culture tubes
Additional reagents and equipment for euthanasia of mice (see Current Protocols
article: Donovan & Brown, 2006a)
Humane endpoints and euthanasia
Mice are euthanized when weight loss reaches 20% unless they reach a depressed state
(>15% weight loss plus ruffled fur plus loss of mobility) before losing 20% of weight.
1d. Euthanize mice (see Current Protocols article: Donovan & Brown, 2006a) by CO2
asphyxiation or 5% isoflurane and exsanguination, and thoracotomy.
Collection of tissues
2d. Prepare complete RPMI 1640 medium by combining 50 ml of heat-inactivated
FBS and 5 ml of penicillin-streptomycin solution in 445 ml RPMI 1640 medium.
Aliquot 5 ml of into a sterile 15-ml tube and place it on ice.
3d. Spray the euthanized mouse with 70% ethanol, drain excess ethanol on a paper
towel, and place it on its back on a styrofoam holder (the Styrofoam holder from
a box of 50-ml conical Falcon-type tubes works well for this purpose). Pin down
its four limbs in a cross format.
4d. Using sterile surgical scissors or a scalpel, cut an incision line from the navel to the
top of the thorax, and with forceps, pull the skin and muscles aside (like opening a
book) to access the organs in the thorax (lung) and peritoneal cavity (liver, spleen,
and kidney).
Surgical equipment is sterilized by autoclaving in instant sealing sterilization pouches
prior to euthanasia.
5d. Hold an organ (e.g., kidney) with forceps and cut the blood vessels to release
it from the abdominal cavity. First, collect spleen into a tube with 5 ml RPMI
complete medium, and store on ice until processing. Place each organ in a sterile
tissue culture petri dish and cut in three or four fractions as needed (except spleen).
This work is done under aseptic conditions.
6d. Place one third of each organ (lung, liver, kidney) in a microcentrifuge tube con-
taining 0.5-1 ml (ideally 10 μl per mg tissue) of RNAlaterTM and freeze for pu-
rification of Leptospira DNA. Place one third of each organ in another microcen-
trifuge tube containing 0.5-1 ml of RNAlaterTM and freeze at −80°C to process
for mRNA purification for assessment of inflammatory mediators (e.g., cytokines,
fibrosis markers). Finally, place the remaining one third of the organ in a sterile 10-
ml tube containing 7 ml of EMJH medium supplemented with 500 μl of Leptospira
enrichment EMJH to culture Leptospira.
7d. Place the other kidney in neutral buffered formalin for histopathology staining and
for immunohistochemistry.
Nair and
Gomes-Solecki

36
Kidney can also be collected for analysis of single cells as described in Basic Protocol 3
for spleen (Evaluation of the host humoral and cellular immune responses to Leptospira
infection).
BASIC ANALYSIS OF PATHOGENESIS AFTER LEPTOSPIRA INFECTION

PROTOCOL 3
In this protocol, we first describe which techniques to use to evaluate dissemination of
Leptospira in blood, urine, and target tissues such as lung, liver, and kidney. We use qPCR
for bacterial load quantification and culture of tissues to assess Leptospira viability. Sec-
ond, we describe the techniques that we use to evaluate molecular, cellular, and histo-
logic differences that allow for determination of pathogenesis after Leptospira infection.
Classic histologic staining and immunohistochemistry techniques are used to evaluate
histopathology and typing of immune cell infiltrates in the kidney; inflammation of the
target organ (kidney) is accessed by quantification of immune markers (chemokines, cy-
tokines, fibrosis markers) by RT-PCR and by flow cytometric analysis of the kidney; and,
lastly, immunoassays and flow cytometry are used to evaluate the host’s antibody and cel-
lular immune responses to Leptospira infection from serum and spleen, respectively.
Definitions
ELISA = enzyme-linked immunosorbent assay
HRP = horseradish peroxidase
RT = room temperature (20°C-25°C)
PCR = polymerase chain reaction
RT-PCR = reverse-transcriptase polymerase chain reaction
TAMRA = 6-carboxyfluorescein–6-carboxytetramethylrhodamine
H&E = Hematoxylin and Eosin
PAS-D = Periodic Acid Schiff Diastase
must be used for handling Leptospira cultures and infected mice. Personal protective
offices.
Materials
Tissues collected from euthanized, Leptospira-infected mice (see Support Protocol,
steps 6d and 7d)
DNeasy Blood & Tissue Kit (Qiagen, cat. no. 69506)
NucleoSpin® Tissue Kit (Takarabio USA Inc., cat. no. 740952.250)
Leptospira-specific TAMRA probe and 16S rRNA primers (Eurofins Scientific)
RNeasy Mini Kit (Qiagen, cat. no. 74106)
RNase inhibitor (Applied BiosystemsTM, cat. no. 4374967)
RNase-free DNase (Qiagen, cat. no. 79254)
High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, cat. no.
4368814)
TAMRA probe and primers: sequences in Table 1
Maxima Probe/ROX qPCR Master Mix (2×) (Thermo Fisher Scientific, cat. no.
K0233)
Neutral buffered formalin (Thermo Fisher Scientific, cat. no. 22-110-869)
Culture of >108 Leptospira/ml (see Basic Protocol 1)
10× phosphate-buffered saline (PBS; Thermo Fisher Scientific, cat. no.
BP399-500)
Nair and Modified Lowry Protein Assay Kit (Thermo Fisher Scientific, cat. no. PI23240)
Gomes-Solecki

37
1× coating buffer: add 10.6 g of sodium carbonate (anhydrous) to 100 ml of
distilled water; adjust the pH to 9.5; make up total volume to 1 L
Alternatively, purchase 5× carbonate buffer (VWR, cat. no. 421701-BL) and
dilute 1:5 to make 1× buffer (i.e., 1 ml of 5× buffer in 4 ml deionized water)
Washing buffer: PBST (1× PBS containing 0.05% Tween; add 100 ml of 10× PBS
to 900 ml of distilled water. then add 500 μl of Tween 20)
Alternatively, purchase 10× PBS/0.5% Tween (Thermo Fisher Scientific, cat. no.
AAJ63596K3) and dilute to 1×
Blocking buffer: 1× PBST + 1% BSA (Thermo Fisher Scientific, cat. no.
BP9704100), prepared fresh daily: add 500 mg of BSA to 50 ml of washing
buffer
Serum samples (prepared from blood taken in the Support Protocol)
Goat anti−mouse IgG (H+L) secondary antibody, HRP (Jackson
ImmunoResearch, cat. no. 115-035-146)
Peroxidase AffiniPure F(ab’)2 fragment goat anti−mouse IgM, μ-chain-specific
(Jackson ImmunoResearch, cat. no. 115-036-020)
TMB SureBlue Microwell Peroxidase Substrate (Thermo Fisher Scientific, cat. no.
5067497 or Seracare Life Sciences, cat. no. 51200083)
TMB stop solution (VWR, cat. no. 95059-200)
Spleen in RPMI medium (see Support Protocol, “d” steps)
1× ACK lysing buffer (Thermo Fisher Scientific, cat. no. BW10548E)
RPMI 1640 medium (Thermo Fisher Scientific, cat. no. MT10041CV)
Fetal bovine serum, (FBS; R&D systems, cat. no. S11150)
Nexcelcom Bioscience acridine orange (AO)/propidium iodide (PI) viability stain
(Thermo Fisher Scientific, cat. no. NC0285242)
Staining buffer: 1× DPBS (Thermo Fisher Scientific, cat. no. 14-190-144)
containing 3% heat-inactivated FBS)
Fc block: Ultra-LEAFTM Purified anti-mouse CD16/32 Antibody (BioLegend, cat.
no. 101329)
CD3 clone 17A2 conjugated with fluorescein isothiocyanate (FITC; Tonbo
Biosciences, cat. no. 35-0032-U100)
CD4 clone RM4-5 conjugated with phycoerythrin (PE; Tonbo Biosciences, cat. no.
50-0042-U100)
CD8 clone 53-6.7 conjugated with allophycocyanin (APC)-Cy7 (Tonbo
Biosciences, cat. no. 25-0081-U100)
CD62L clone MEL-14 conjugated with PE-Cy7 (Tonbo Biosciences, cat. no.
60-0621-U100)
CD44 clone IM7 conjugated with APC (BioLegend, cat. no. 103012)
CD19 clone 1D3 conjugated with PE (Tonbo Biosciences, cat. no. 50-0193-U100)
4% paraformaldehyde in PBS (Thermo Fisher Scientific, cat. no. J19943K2)
TM TM
Invitrogen UltraComp eBeads (Thermo Fisher Scientific, cat. no. 50-112-9040)
Nanodrop One microvolume UV/Vis spectrophotometer (Thermo Fisher Scientific,

cat. no. 84-027-42PR20)
TM
MicroAmp Fast Optical 96-Well Reaction Plate with Barcode, 0.1 ml (Thermo
Fisher Scientific, cat. no. 4366932)
TM
StepOnePlus Real-Time PCR System (Thermo Fisher Scientific, cat. no.
4376600)
15-ml tubes (VWR, cat. no. 21008-216)
Axio Zeiss Imager A1 light microscope
Refrigerated centrifuge Nair and
Dark-field microscope (DFM; Zeiss, USA) Gomes-Solecki

38
2.0-ml microcentrifuge tubes (VWR cat. no. 20170-170)
Heat block
–80°C Freezer
TM
MaxiSorp flat-bottom 96-well plate (Nunc, cat. no. 44-2404-21)
ELISA plate washer: Fisher AccuWash 96 (Thermo Fisher Scientific, cat. no. 14
377 577)
Wypall paper towels (Thermo Fisher Scientific, cat. no. 15-235-83)
Multichannel pipettor and tips
Polystyrene reservoirs, 50 ml, sterile (VWR, cat. no. 89094-680)
SpetramaxPlus ELISA reader (Molecular Devices) or another ELISA reader
Petri dish–60 mm × 15 mm (VWR, cat. no. 25384-092 )
TM
Fisherbrand Frosted slides (Thermo Fisher Scientific, cat. no. 12-550-343)
70-μm-pore-size and 40-μm-pore-size nylon filters (BD Falcon, cat. no.
22-363-548 and 22-363-547)
Luna-FL automated cell counter (Logos Biosystems)
96-well plate, V-bottom, polypropylene (Millipore Sigma, SKU cat. no.
M8185-100EA)
LSR II flow cytometer (BD Immunocytometry Systems)
ZE5 Cell Analyzer (Bio-Rad)
qPCR and RT-PCR
We use qPCR for quantification of Leptospira load in tissues and cultures of organs.
We use RT-PCR to quantify immune markers of infection in tissues.
1. Extract DNA from blood, urine, kidney (20-25 mg) and other tissues using DNeasy
Blood & Tissue Kit and NucleoSpin tissue kit according the manufacturer’s instruc-
tions.
2. Quantify Leptospira using a TAMRA probe and primers (Table 1) to Leptospira 16S
rRNA by qPCR as described in Basic Protocol 1, steps 7–11.
3. Extract total RNA from 15-20 mg of tissue using an RNeasy Mini kit following the
manufacturer’s protocol for on-column DNase digestion. Quantify and analyze the
RNA for purity by loading 2 μl onto the Nanodrop One and measuring absorbance
(A) at 260, 280, and 230 nm. RNA is considered to be pure if the ratio of A260/280 is
∼2 and A260/A230 is in the range of 2.0-2.2.
4. Reverse transcribe 1 μg of RNA using a high-capacity cDNA reverse transcription
kit, with RNase inhibitor, in a 20-μl reaction according to the manufacturer’s proto-
col. Place tubes on the thermal cycler using the reaction conditions recommended
by the cDNA Reverse Transcription Kit.
5. Set up the PCR reaction for the target gene using primers and TAMRA probes
TM
described in Table 1: add 2 μl of cDNA per well of a MicroAmp Fast
Optical 96-Well Reaction Plate previously loaded with 18 μl of master mix
per well [as per reaction conditions recommended by the Maxima Probe/ROX
qPCR Master Mix (2×)]. A no-template control (NTC) without DNA is used
as a negative control. All samples are run in duplicate using comparative Ct
method.
An additional step of DNase digestion is performed, according to manufacturer’s in-
structions, while performing RNA purification. DNase digestion will ensure that the
purified RNA is free from genomic DNA contamination, and that the results of gene
expression obtained are from the cDNA and not due to the presence of genomic
Nair and DNA.
Gomes-Solecki

39
PCR data are reported as the relative increase in mRNA transcript levels of a given
marker corrected for by the respective levels of β-actin.
Histopathology and immunohistochemistry of the kidney

Histologic staining involves fixation, processing, embedding, sectioning, and staining
or immunostaining (Alturkistani, Tashkandi, & Mohammedsaleh, 2016), all of which
require ultra-specialized equipment. For this reason, we use the services of Research
Histology Core facilities (UTHSC and Vanderbilt University) to acquire histologic and
immunohistochemistry data. These services are commonly offered by major U.S. univer-
sities. The only techniques we perform in the laboratory are fixation of the tissue after
harvest from the mouse and scoring of histopathology and immunohistochemistry analy-
sis after we receive the stained slides. For resources on how to perform classic histology
and immunohistochemistry techniques in the laboratory, consult Junqueira’s Basic His-
tology: Text and Atlas (Mescher, 2018).
6. For fixation, place the tissue in a 15-ml tube containing 10% neutral buffered for-
malin.
7. Submit/ship the material to the Histology Research Core
8. Determine histopathology and immunohistochemistry scores as follows:
H&E or PAS-D: Measure the glomeruli size in five fields per sample, and average
groups. Grade nephritis scores blindly on a scale of 0-5 in a longitudinal section
of the organ following previously published criteria (Chan, Madaio, & Shlomchik,
1997).
An example of PAS-D staining is shown in Figure 2.
Masson trichrome: Digitally analyze (40×, Photoshop) five randomly chosen fields
as a percentage of pixels of the total area.
An example is shown in Figure 3. Masson’s trichrome staining is very sensitive to process-
ing of the tissue before and after staining. It should only be performed between groups of
the same experiment by experienced personnel.
Immunohistochemistry: Count positive cells/total cells per antibody marker in 10

randomly chosen fields (400×) from the cortex and medulla of kidney. At least two
Figure 2 Histopathology of the kidney. (A) PAS-D staining showing shrinkage of glomeruli, infiltration of
immune cells, and loss of tubular structure in the infected group (20×); (B) diameter of glomeruli is measured
under 20× using a measurement function (e.g., CaptaVision Software). Legend: white arrow, tubules; black
arrow, infiltration of immune cells; black triangle, glomerulus (Sullivan et al., 2017).

40
Figure 3 Histopathology of the kidney. (A) Masson trichrome staining of kidney sections from infected mice
pre-treated with PBS and with Lactobacillus plantarum. (B) Digital quantification of fibrosis was determined as
the % area (pixels) where blue staining exceeds a threshold. The slides were processed and stained in parallel,
and images where taken using the same illumination (Potula et al., 2017).
sections per kidney are counted for each experiment. Acquire images at 200×, or
400× using a Zeiss microscope with ZEN software.
An example is shown in Figure 4.
Evaluation of the host humoral and cellular immune responses to Leptospira

infection
The immune response to Leptospira is evaluated by quantification of Leptospira-specific
antibodies in serum and by analysis of immune cell populations by flow cytometry of
single cell suspensions (spleen) and other techniques to determine signatures of gene
expression.
Serological analysis of immunoglobulins

We use ELISA to evaluate immunoglobulin class and isotype and to quantify total anti-
body as well as Leptospira-specific antibody in the serum of infected mice. Quantification
of total antibody and determination of IgG isotype in serum is done using the Ready-Set-
Go enzyme-linked immunosorbent assay (ELISA) [Thermo Fisher Scientific, cat. no.
88-50400-22 (IgG) and 50-246-320 (IgM)] and kits for IgG1, IgG2a, and IgG3 (Thermo
Fisher Scientific, cat. no. 88-50410-22, 88-50420-22, and 88-50440-22, respectively) ac-
cording to the manufacturer’s instructions. Determination of IgM- and IgG-specific an-
tibodies to Leptospira is done by ELISA using heat-killed Leptospira or purified recom-
binant proteins as antigens to coat a 96-microwell plate.
Production of heat-killed Leptospira antigen

9. Centrifuge 5 ml culture of Leptospira (108 /ml) 10 min at 12,000 × g. Discard the
supernatant.
10. Wash pellet with 5 ml PBS, then centrifuge 10 min at 12,000 × g.
11. Count the cells under DFM. Adjust to 107 -109 cells/ml with PBS.
12. Aliquot 1 ml of bacteria into 2-ml tubes.
Nair and
Gomes-Solecki

41
Figure 4 Immunohistochemistry of the kidney. Immunostaining of kidney sections from groups of
treated mice in the presence or absence of Leptospira infection using various leucocyte markers
(CD45+, NIMP-R14+, F4/80+, and CD3+) (Potula et al., 2017).
13. Subject Leptospira to heat killing for 15 min at 95°C. Heat killing is confirmed by
checking under the DFM: no motile Leptospira are expected to be visible.
If motile Leptospira are visible under DFM, the process is repeated until no motile Lep-
tospira are observed (up to three times over 1 hr).
14. Determine the protein concentration using the Modified Lowry Protein Assay Kit
according to the manufacturer’s protocol.
Quantification of Leptospira-specific antibody (IgM and IgG) in serum
15. Coat a plate with antigen as follows. Dilute heat-killed Leptospira in 1× coating
buffer to a final concentration of 1 × 105 -108 /well or 100 μl/well of 4 mg/ml of
heat-killed Leptospira in a flat-bottom 96-well plate. Cover the plate and incubate
overnight at 4°C.
This protocol can be modified to test antibody levels against recombinant proteins as anti-
gens. Instead of heat-killed Leptospira, coat the plates with 0.1-1 μg/ml of the proteins
in coating buffer in step 15 and follow the protocol from step 16.
16. Next morning wash the plate using the ELISA plate washer and run a total of four
washes with 300 μl washing buffer.
17. To block the plate: Pour blocking buffer into a new reagent reservoir and add
250 μl of blocking buffer (1× PBST+ 1 %BSA; prepare fresh) in each well (us-
ing a multichannel pipet) and incubate for 1-2 hr at room temperature or 37°C.
If a plate washer is not available, use a multichannel pipettor to dispense 300 μl of
washing buffer per well, dump the washing buffer into a sink. and tap dry over a layer of Nair and
Gomes-Solecki
3-4 clean paper towels.

42
At this point, the plate can be stored at 4°C for maximum of 2 days (cover the plate or
put plate inside a ziplock bag). Otherwise, continue following the protocol.
18. Wash the plate two times with 300 μl washing buffer. Tap dry over a layer of 3-4
clean paper towels.
19. Dilute the serum samples 1:100 in blocking buffer, add 100 μl of diluted serum
sample to each well of the Test plate, cover the plate, and incubate for 1.5 hr at room
temperature or 1 hr at 37°C.
20. Wash the Test plate four times; tap dry over a layer of 3-4 clean paper towels.
21. Clean the plate washer: Dip the wash head in washing buffer (1×PBST) in the blue
boat provided with the instrument and run a Wash plate twice to remove any primary
sera sticking to the wash head.
We use two 96-well plates to run the enzymatic reaction: one is labeled Test plate and
contains the serum samples subject to study; the second plate is a Wash plate used to
clean up the plate washer instrument after the washes.
22. Dilute the secondary antibody-HRP (IgM or IgG) in blocking buffer and pour this
into a new reagent reservoir. Add 100 μl to the wells of the Test plate using a multi-
channel pipettor. Cover the plate and incubate 1 hr at room temperature or 37°C for
30 min.
23. Wash the Test plate four times on the plate washer; tap dry over a layer of 3-4 clean
paper towels.
24. Clean the plate washer: Dip the wash head in 1×PBST in the blue boat provided
with the instrument and run a Wash plate with the “2 wash” program to remove any
HRP-conjugated antibody sticking onto the wash head.
25. Add 100 μl of TMB SureBlue substrate at room temperature into each well of the
Test plate using a multichannel pipettor.
26. Cover the plate and incubate for 15 min at room temperature or 37°C.
27. Add 100 μl of TMB Stop Solution into each well and read the absorbance at 450 nm
in the SpectraMax ELISA reader; save the file and export the raw data as an .xls
file for analysis.
28. Connect the washer to the MilliQ bottle and run a wash cycle with MilliQ water.
If the instrument is left in buffer, solutes form deposits and block the tubing.
Before starting the enzymatic reaction part of this protocol, aliquot the volume of TMB
SureBlue required for the ELISA in a 50-ml tube and keep it at room temperature covered
in foil (TMB substrate is light sensitive and is to be used at room temperature).
Profiling immune cell populations (T and B cells) by flow cytometry

Cellular immune responses to Leptospira infection are studied in our laboratory by pro-
filing immune cell populations (T and B cells) by flow cytometric analysis of single cells
isolated from spleen. Quantification of signatures of gene expression produced by im-
mune cells can also be done using a T-Cell & B-Cell Activation RT2 Profiler PCR Array
(Qiagen, PAMM-053Z) according to the manufacturer recommendation.
Cell preparation
29. Transfer spleen and the complete RPMI medium from the 15-ml tube to a petri dish.
Nair and
30. Tease the spleen with frosted slides to produce single cell suspensions.
Gomes-Solecki

43
31. Centrifuge 4 min at 453 × g, at 4°C. Discard the supernatant.
32. Add 2 ml/spleen of 1× ACK lysing buffer to lyse red blood cells and let stand for
2 min. Stop the reaction by adding 3-5 ml of RPMI 1640 containing 10% heat-
inactivated fetal bovine serum.
33. Wash the cells in RPMI 1640 containing 10% heat-inactivated fetal bovine serum,
followed by passage through 70-μm pore-size and 40-μm pore-size nylon filters
34. Count the cells using a Luna-FL automated cell counter.
Flow cytometric cell staining
35. Analyze cell viability by mixing 18 μl of splenocyte suspension obtained in step
33 with 2 μl of acridine orange−propidium iodide staining solution in the Luna-FL
automated cell counter.
36. Stain 1−5 × 106 live cells per well of a 96-well V-bottom plate:
a. Incubate cells in 0.5-1 μg Fc block (Ultra-LEAFTM Purified anti-mouse CD16/32
antibody) for 15 min at 4°C in staining buffer, wash twice with staining buffer,
each time centrifuging 4 min at 453 × g, 4°C, and incubate with the appropriate
marker for surface staining in the dark for 30 min at 4°C.
InvitrogenTM UltraComp eBeadsTM are also stained using each of the conjugates (used
for surface staining) separately to create compensation controls.
b. The following are the surface markers used for T cell panel:
CD3 clone 17A2 conjugated with fluorescein isothiocyanate (FITC) (1:200)
CD4 clone RM4-5 conjugated with phycoerythrin (PE) (1:150)
CD8 clone 53-6.7 conjugated with allophycocyanin (APC)-Cy7 (1:150)
CD62L clone MEL-14 conjugated with PE-Cy7 (1:150)
CD44 clone IM7 conjugated with APC (1:150)
Pacific blue as the dump channel.
c. The following are the surface markers used for the B cell panel:
CD3 clone 17A2 conjugated with fluorescein isothiocyanate (FITC) (1:200)
CD19 clone 1D3 conjugated with PE (1:150).
Stain control beads and cells using the same dilution. Wash cells twice in staining buffer.
37. Fixation with 4% paraformaldehyde (optional): Wash the cells with staining buffer,
centrifuge 4 min at 453 × g, 4°C, and resuspend in 0.5 ml of 4% paraformaldehyde
solution. Incubate the cells for 15 min at room temperature and wash with 1× PBS.
Resuspend the cells in 1× PBS and store at 4°C until analysis.
38. For flow cytometry, acquire cells on an LSR II flow cytometer equipped with 405,
488, 561, and 640 nm excitation lasers or a ZE5 Analyzer.
39. Collect data using BD FACSDiva software (BD Biosciences) for LSRII, or Everest
software for ZE5 analyzer.
The cells fixed with 4% paraformaldehyde solution can be stored up to a couple of days
(at 4°C in the dark) for analysis.
COMMENTARY
Background Information 2005, Werts et al., 2001). However, in mice,
Although Leptospira are not considered signaling occurs through TLR2 as well as
Gram-negative, they do produce lipopolysac- TLR4 (Nahori et al., 2005). Mice can tolerate
charide (LPS), a potent inflammatory cell wall levels of LPS endotoxin 250 times higher than
component. In human cells, Leptospira LPS humans (Copeland et al., 2005), which makes
signals through TLR2 rather than the conven- them excellent reservoir hosts for a number of
Nair and
tional TLR4 signaling system (Nahori et al., human pathogens, including Leptospira. For Gomes-Solecki

44
this reason, infection doses in mice have to be mutation leads to impaired TLR4 recognition,
at least 2-3 logs higher than infectious doses in which renders these mice hyporesponsive to
higher-phylum vertebrates like humans. The Leptospiral LPS. Thus, a substandard immune
sine qua non condition for a reservoir host is to response to infection should lead to dissem-
remain persistently infected with the pathogen ination of greater numbers of Leptospira to
that it maintains in the enzootic cycle. tissues. This factor facilitates establishment
Transmission to sylvatic rodents results in of an animal model of infection that allows
asymptomatic infection (Ko, Goarant, & Pi- for consistent measurement of significant
cardeau, 2009). In the first studies in which in- differences between infected and uninfected
bred mice were tested, Balb/c did not develop mice (Nair et al., 2020, Potula, Richer,
evident clinical signs of leptospirosis (Adler Werts, & Gomes-Solecki, 2017, Richer et al.,
& Faine, 1976, 1977). Thus, asymptomatic 2015, Sullivan et al., 2017). We adapted the
infection was conflated with resistance to in- C3H-HeJ lethal model previously used by
fection, and as such, mice were not considered Pereira and colleagues (Pereira, Andrade,
suitable models of leptospirosis. However, the Marchevsky, & Ribeiro dos Santos, 1998),
concept of resistance to infection is at odds Nally and colleagues (Nally, Fishbein, Blanco,
with the mouse’s role as a reservoir host of & Lovett, 2005), and Vinetz and colleagues
Leptospira. To fulfil its role as reservoir host, (Viriyakosol, Matthias, Swancutt, Kirkland, &
the mouse immune system must allow the Vinetz, 2006), but, rather than infecting young
spirochete to disseminate to tissues and be 4-week-old mice, we infected adult mice at
shed in urine. Mice infected with biolumi- ∼10 weeks of age (Richer et al., 2015) be-
nescent L. interrogans followed for 5 months cause the mouse immune system is functional
developed chronic leptospirosis (Ratet et al., after 5 weeks of age (Landreth, 2002). Thus,
2014). Others showed that although infec- infection at 10 weeks allows for inclusion of a
tion of inbred mice did not result in lethal 5-week vaccination schedule before challenge
infection, some strains developed pathology is performed. Measurable clinical indicators
indicative of subclinical infection (Santos of infection can be obtained in the form of
et al., 2010). To break the reservoir-host tol- weight loss, bacterial load in blood and urine
erance of lipopolysaccaride (LPS), high doses over time, bacterial colonization of target
of pathogenic Leptospira are used, and >2 × tissues (such as kidney), and expression of
108 Leptospira interrogans ser. Copenhageni certain inflammatory cytokine and chemokine
can lead to lethality of adult C57BL/6 KO genes in kidneys of infected mice. In addition,
(Chassin et al., 2009) and C3H-HeJ mice this model allows for analysis of the host’s
(Fig. 5). antibody and cellular immune response to
We chose the C3H/HeJ strain rather than infection. Once the basic mouse model was
C57BL/6 used by others (Chassin et al., 2009; developed using the standard laboratory
Fanton d’Andon et al., 2014; Ratet et al., intraperitoneal route of infection, we pro-
2014; Santos et al., 2010) because C3H-HeJ ceeded to adapt the model to infection via
have a point mutation (aa712, P to H) in their natural transmission routes such as ocular
tlr4 coding region (Vogel et al., 1999). This conjunctiva, transdermal abrasion, and nasal
Nair and Figure 5 Susceptibility to lethal leptospirosis (LD50) in C3H-HeJ mice inoculated with PBS (Ctrl),
Gomes-Solecki
5 × 108 and 1 × 109 Leptospira interrogans ser. Copenhageni FioCruz. N = 4 mice per group.

45
mucosa. The latter routes of infection are Depending on the species and serovars, cul-
more appropriate to fully validate vaccines, tures take from 1-3 weeks to grow. Occasion-
therapeutics, and diagnostic assays for human ally, after inoculation of a frozen stock/kidney
and veterinary use. culture, a coiled/dot form of bacteria can be
One of the drawbacks of the C3H-HeJ observed. Provided that there is no contamina-
mouse model is that, due to the point tion of the culture, the dot forms change into
mutation in TLR4, this mouse is consid- spirochetal forms over time. We use PCR over
ered immunocompromised. The analogous two time points to quickly determine if we
hyporesponsiveness and non-resposiveness have a live culture (e.g., d5 and d10 post inoc-
of C3H-HeJ and human TLR4 to Leptospira ulation). The growth rate depends on the num-
LPS led us to use humanized TLR4 transgenic ber of live bacteria in the inoculum. Preparing
C57BL-6J mice to develop an immunocom- single-use DMSO stocks to avoid multiple
petent mouse model of Leptospirosis (Nair, freeze-thaw cycles from the same master stock
Soares Guedes, Hajjar, Werts, & Gomes- will ensure reproducible cultures. To ensure
Solecki, 2020). Either using C3H-HeJ or maintenance of virulence in mice, infect ani-
humanized TLR4 C57BL-6J, these mouse mals with cultures up to passage 4 (subculture
models of infection can only help increase our in medium) of Leptospira (from the initial
knowledge of Leptospira pathogenesis if they hamster stock). All experiments performed
are adopted by the research community. must be repeated with the culture from the
same passage number. Thus, when preparing
Critical Parameters inoculum, plan for growing enough culture
Handling pathogenic Leptospira requires to save stocks for three experiments. We
strict adherence to BSL-2 protocols to protect found that the physiologic route of infection
laboratory personnel from exposure. In the an- most difficult to reproduce was transdermal
imal facility, disposable ABSL-2 mouse cages abrasion, because of the need to use proper
should be used. Since Leptospira is a slow- technique to create the wound, and that the in-
growing bacterium, aseptic techniques must tranasal route was the easiest. In case of failure
be employed when harvesting tissues, to pre- to infect mice using the transdermal route, this
vent contamination. The genetic background can be resolved by requesting assistance from
of the mouse (C3H-HeJ, C57BL/6, Balb/c) the animal facility’s attending veterinarian.
will affect the results observed. The age of
the mice is known to affect the kinetics of Understanding Results
disease progression (Nally et al., 2005; Richer If the steps of the three basic protocols
et al., 2015). We found that male hamsters are followed, one should expect to obtain the
are more susceptible to lethal infection than following results
their female counterparts (Gomes, Guedes, Basic Protocol 1: Full confluent cultures
Potula, Dellagostin, & Gomes-Solecki, 2018). (>108 ) take from 1-3 weeks to grow de-
Although we have not repeated these exper- pending on the species and serovar used. For
iments using mice, it is reasonable to expect example, a 1-week culture of L. interrogans
that male mice could be more susceptible to will show a few cells per field under a dark-
leptospirosis. Furthermore, it is considerably field microscope; a 2-week culture should
more difficult to collect urine from male than be about 106 -108 cells/ml. For maintenance
female mice. The dose of inoculum and route of virulent Leptospira, hamsters infected
of infection, i.e., intraperitoneal versus trans- intraperitoneally with 5000 L. interrogans
dermal versus nasal versus conjunctival, are should reach the endpoint criterion (>10%
known to affect the timing and load of bacteria weight loss) 8-10 days post-infection. At this
present in the blood, urine, and tissues. The point, animals should be euthanized and kid-
number of days from infection to termination ney cultured to retrieve virulent Leptospira.
is known to affect bacterial load in tissues, Basic Protocol 2: Infection of mice through
gene expression, and immune cell profiles. a physiologic route. Weight loss should be
observed between days 10 and 12 after inocu-
Troubleshooting lation; Leptospira should be detected in blood
One of the issues that frequently delay between days 1 and 7 post infection, and
initiation of experiments is that Leptospira shedding in urine is expected to start 6-8 days
is a slow-growing fastidious bacterium. It is post infection. In kidney, we usually detect
common not to be able to see bacteria under ∼104 Leptospira/mg of tissue. Differences in
a dark-field microscope using 20× and 40× transdermal and conjunctival infection should Nair and
Gomes-Solecki
magnification within 3-5 days of inoculation. be seen within 15 days of infection against the

46
uninfected control, whereas intranasal infec- Acknowledgments
tion benefits from a longer schedule, up to 21 Several people have contributed to the
days. development of these mouse models over
Basic Protocol 3: Analysis of pathogenesis the years either through hands-on imple-
after Leptospira infection. The following in- mentation of techniques or through vigorous
flammatory markers should be increased in the scientific discussions: Luciana Richer, Hari-
kidney after infection (KC, MIP-2, RANTES, Hara Potula, Mariana Soares Guedes, Elsio
TNF-α, IFN-γ), as well as the antimicrobial Wunder, David Haake (DH), and Catherine
iNOS and the fibrosis marker ColA1. Classic Werts. Funding was provided by NIH NIAID
tissue staining techniques allow for visu- grants RO1 AI034431 (DH and MGS), R44
alization of Leptospira in the renal tubules AI096551 (MGS), R21 AI142129 (MGS),
(silver stain) and for evaluation of Leptospira- R43 AI136551 (MGS).).
induced inflammation of the kidney (hema-
toxylin and eosin, H&E; periodic acid Schiff Author Contributions
diastase, PAS-D, and Masson’s trichrome) Nisha Nair: Data curation; formal anal-
under a light microscope. Using H&E or PAS- ysis; investigation; methodology; validation;
D, we can visualize interstitial infiltration of visualization; writing-review & editing.
immune cells and score tissue damage such as Maria Gomes-Solecki: Conceptualization;
reduced glomerular size and tubular anomalies data curation; formal analysis; funding acqui-
in Leptospira-infected kidney (Richer et al., sition; methodology; project administration;
2015). We use Masson’s trichrome staining of resources; supervision; visualization; writing-
kidney sections to evaluate interstitial colla- original draft; writing-review & editing.
gen deposition (fibrosis) (Ferrer et al., 2014,
Potula et al., 2017). Immunohistochemistry Literature Cited
requires labeling specific cell markers with Adler, B., & Faine, S. (1976). Susceptibility of
antibodies. We use antibodies specific for to- mice treated with cyclophosphamide to lethal
tal leukocytes (anti-CD45), neutrophils (anti- infection with Leptospira interrogans Serovar
NIMP-R14), macrophages (anti-F4/80), and T pomona. Infection and Immunity, 14(3), 703–
708. doi: 10.1128/IAI.14.3.703-708.1976.
cells (anti-CD3) to identify these immune cell
populations in kidney cryosections (Potula Adler, B., & Faine, S. (1977). Host immuno-
logical mechanisms in the resistance of mice
et al., 2017). With regard to Leptospira- to leptospiral infections. Infection and Immu-
specific antibody, both IgM and IgG are nity, 17(1), 67–72. doi: 10.1128/IAI.17.1.67-72.
expected to be increased 2 weeks post infec- 1977.
tion. With regard to profiles of immune cell Alturkistani, H. A. T., Tashkandi, F. M., & Mo-
populations, increased effector CD3+/CD4+ hammedsaleh, Z. M. (2016). Histological stains:
T cells and decreased CD3+/CD8+ popu- A literature review and case study. Global Jour-
lations and no difference in memory T cells nal of Health Science, 8(3) doi: 10.5539/gjhs.
v8n3p72.
in single-cell suspensions from spleen at
2 weeks post-infection should be Asoh, T., Saito, M., Villanueva, S. Y., Kanemaru,
T., Gloriani, N., & Yoshida, S. (2014). Natu-
expected. ral defense by saliva and mucosa against oral
infection by Leptospira. Canadian Journal of
Time Considerations Microbiology, 60(6), 383–389. doi: 10.1139/
Basic Protocol 1: Growing Leptospira cjm-2014-0016.
cultures will take between 1 and 4 weeks de- Bharti, A. R., Nally, J. E., Ricaldi, J. N.,
pending if starting from a frozen stock (up to Matthias, M. A., Diaz, M. M., Lovett, M. A.,
4 weeks) or passaging subcultures (∼1 week). … Peru-United States Leptospirosis Consor-
tium. (2003). Leptospirosis: A zoonotic dis-
Basic Protocol 2: Infection of mice by ease of global importance. The Lancet Infec-
transdermal, conjunctival, and intraperitoneal tious Diseases, 3(12), 757–771. doi: 10.1016/
inoculation can be done following a 15-day S1473-3099(03)00830-2.
schedule, but nasal mucosal infections benefit Bonilla-Santiago, R., & Nally, J. E. (2011). Rat
from longer infection schedules, until day 21. model of chronic leptospirosis. Current Pro-
Basic Protocol 3: Acquisition and analysis tocols in Microbiology, 20, 12E.3.1−12E.3.10.
of pathogenesis data can take up to 3 months doi: 10.1002/9780471729259.mc12e03s20
after euthanasia if all the techniques described Casanovas-Massana, A., Pedra, G. G., Wunder,
in this section are used. E. A. Jr., Diggle, P. J., Begon, M., & Ko, A.
I. (2018). Quantification of Leptospira interro-
An entire protocol of infection and patho- gans survival in soil and water microcosms. Ap-
Nair and genesis analysis can be completed in 4-6
Gomes-Solecki plied and Environmental Microbiology, 84(13),
months by experienced personnel. e00507–e00518. doi: 10.1128/AEM.00507-18.

47
Chan, O., Madaio, M. P., & Shlomchik, M. J. Mescher, A. (2018). Junqueira’s Basic Histology:
(1997). The roles of B cells in MRL/lpr murine Text and Atlas (15th ed.). New York: McGraw-
lupus. Annals of the New York Academy of Sci- Hill Education.
ences, 815, 75–87. doi: 10.1111/j.1749-6632. Nahori, M. A., Fournie-Amazouz, E., Que-
1997.tb52046.x. Gewirth, N. S., Balloy, V., Chignard, M.,
Chassin, C., Picardeau, M., Goujon, J. M., Bourhy, Raetz, C. R., … Werts, C. (2005). Differential
P., Quellard, N., Darche, S., … Werts, C. TLR recognition of leptospiral lipid A and
(2009). TLR4- and TLR2-mediated B cell lipopolysaccharide in murine and human cells.
responses control the clearance of the bacterial Journal of Immunology, 175(9), 6022–6031.
pathogen, Leptospira interrogans. Journal of doi: 10.4049/jimmunol.175.9.6022.
Immunology, 183(4), 2669–2677. doi: 10.4049/ Nair, N., Guedes, M. S., Werts, C., & Gomes-
jimmunol.0900506. Solecki, M. (2020). The route of infection with
Copeland, S., Warren, H. S., Lowry, S. F., Calvano, Leptospira interrogans serovar Copenhageni af-
S. E., Remick, D., & Inflammation and the Host fects the kinetics of bacterial dissemination
Response to Injury Investigators (2005). Acute and kidney colonization. PloS Neglected Trop-
inflammatory response to endotoxin in mice and ical Diseases, 14(1), e0007950. doi: 10.1371/
humans. Clinical and Diagnostic Laboratory journal.pntd.0007950.
Immunology, 12(1), 60–67. doi: 10.1128/CDLI. Nair, N., Soares Guedes, M., Hajjar, A., Werts,
12.1.60-67.2005. C., & Gomes-Solecki, M. (2020). Humanized
Costa, F., Hagan, J. E., Calcagno, J., Kane, M., TLR4 immunocompetent mice are more sus-
Torgerson, P., Martinez-Silveira, M. S., … Ko, ceptible to kidney disease after infection with
A. I. (2015). Global morbidity and mortality of Leptospira interrogans than wild-type mice.
Leptospirosis: A systematic review. PloS Ne- BioRxiv, 2020.06.15.153106. doi: https://doi.
glected Tropical Diseases, 9(9), e0003898. doi: org/10.1101/2020.06.15.153106.
10.1371/journal.pntd.0003898. Nally, J. E., Fishbein, M. C., Blanco, D. R.,
Donovan, J., & Brown, P. (2001). Anesthesia. Cur- & Lovett, M. A. (2005). Lethal infection of
rent Protocols in Immunology, 27, 1.4.1–1.4.5. C3H/HeJ and C3H/SCID mice with an isolate of
doi: 10.1002/0471142735.im0104s27 Leptospira interrogans serovar copenhageni. In-
Donovan, J., & Brown, P. (2006a). Euthanasia. Cur- fection and Immunity, 73(10), 7014–7017. doi:
rent Protocols in Immunology, 73, 1.8.1–1.8.4. 10.1128/IAI.73.10.7014-7017.2005.
doi: 10.1002/0471142735.im0108s73 Pereira, M. M., Andrade, J., Marchevsky, R. S., &
Donovan, J., & Brown, P. (2006b). Parenteral Ribeiro dos Santos, R. (1998). Morphological
injections. Current Protocols in Immunology, characterization of lung and kidney lesions
73, 1.6.1–1.6.10. doi: 10.1002/0471142735. in C3H/HeJ mice infected with Leptospira
im0106s73 interrogans serovar icterohaemorrhagiae:
Defect of CD4+ and CD8+ T-cells are
Fanton d’Andon, M., Quellard, N., Fernandez, B., prognosticators of the disease progression. Ex-
Ratet, G., Lacroix-Lamande, S., Vandewalle, perimental and Toxicologic Pathology, 50(3),
A., … Werts, C. (2014). Leptospira interrogans 191–198. doi: 10.1016/S0940-2993(98)8008
induces fibrosis in the mouse kidney through 3-3.
Inos-dependent, TLR- and NLR-independent
signaling pathways. PloS Neglected Tropical Potula, H. H., Richer, L., Werts, C., & Gomes-
Diseases, 8(1), e2664. doi: 10.1371/journal. Solecki, M. (2017). Pre-treatment with
pntd.0002664. Lactobacillus plantarum prevents severe
pathogenesis in mice infected with Leptospira
Ferrer, M. F., Scharrig, E., Alberdi, L., Cedola, interrogans and may be associated with re-
M., Pretre, G., Drut, R., … Gomez, R. M. cruitment of myeloid cells. PloS Neglected
(2014). Decay-accelerating factor 1 deficiency Tropical Diseases, 11(8), e0005870. doi:
exacerbates leptospiral-induced murine chronic 10.1371/journal.pntd.0005870.
nephritis and renal fibrosis. PloS One, 9(7),
e102860. doi: 10.1371/journal.pone.0102860. Ratet, G., Veyrier, F. J., Fanton d’Andon, M., Kam-
merscheit, X., Nicola, M. A., Picardeau, M., …
Gomes, C. K., Guedes, M., Potula, H. H., Del- Werts, C. (2014). Live imaging of biolumines-
lagostin, O. A., & Gomes-Solecki, M. (2018). cent Leptospira interrogans in mice reveals re-
Sex matters: Male hamsters are more suscep- nal colonization as a stealth escape from the
tible to lethal infection with lower doses of blood defenses and antibiotics. PloS Neglected
pathogenic leptospira than female hamsters. In- Tropical Diseases, 8(12), e3359. doi: 10.1371/
fection and Immunity, 86(10), e00369–e003718. journal.pntd.0003359.
doi: 10.1128/IAI.00369-18.
Richer, L., Potula, H. H., Melo, R., Vieira, A., &
Ko, A. I., Goarant, C., & Picardeau, M. (2009). Gomes-Solecki, M. (2015). Mouse model for
Leptospira: The dawn of the molecular genetics sublethal Leptospira interrogans infection. In-
era for an emerging zoonotic pathogen. Nature fection and Immunity, 83(12), 4693–4700. doi:
Reviews Microbiology, 7(10), 736–747. doi: 10. 10.1128/IAI.01115-15.
1038/nrmicro2208.
Santos, C. S., Macedo, J. O., Bandeira, M.,
Landreth, K. S. (2002). Critical windows in devel- Chagas-Junior, A. D., McBride, A. J.,
opment of the rodent immune system. Human McBride, F. W., … Athanazio, D. A.
& Experimental Toxicology, 21(9-10), 493–498. Nair and
(2010). Different outcomes of experimen- Gomes-Solecki
doi: 10.1191/0960327102ht287oa. tal leptospiral infection in mouse strains

48
with distinct genotypes. Journal of Medical Viriyakosol, S., Matthias, M. A., Swancutt, M. A.,
Microbiology, 59(Pt 9), 1101–1106. doi: Kirkland, T. N., & Vinetz, J. M. (2006). Toll-
10.1099/jmm.0.021089-0. like receptor 4 protects against lethal Leptospira
Schneider, A. G., Casanovas-Massana, A., Hacker, interrogans serovar icterohaemorrhagiae infec-
K. P., Wunder, E. A., Jr., Begon, M., Reis, tion and contributes to in vivo control of lep-
M. G., … Ko, A. I. (2018). Quantification tospiral burden. Infection and Immunity, 74(2),
of pathogenic Leptospira in the soils of a 887–895. doi: 10.1128/IAI.74.2.887-895.2006.
Brazilian urban slum. PloS Neglected Tropical Vogel, S. N., Johnson, D., Perera, P. Y., Medvedev,
Diseases, 12(4), e0006415. doi: 10.1371/ A., Lariviere, L., Qureshi, S. T., & Malo, D.
journal.pntd.0006415. (1999). Cutting edge: Functional characteriza-
Sullivan, J. P., Nair, N., Potula, H. H., & Gomes- tion of the effect of the C3H/HeJ defect in mice
Solecki, M. (2017). Eye-drop inoculation leads that lack an Lpsn gene: In vivo evidence for
to sublethal leptospirosis in mice. Infection and a dominant negative mutation. Journal of Im-
Immunity, 85(4), e01050-10616. doi: 10.1128/ munology, 162(10), 5666–5670.
IAI.01050-16. Werts, C., Tapping, R. I., Mathison, J. C., Chuang,
Thiermann, A. B. (1981). The Norway rat as a T. H., Kravchenko, V., Saint Girons, I., … Ule-
selective chronic carrier of Leptospira ictero- vitch, R. J. (2001). Leptospiral lipopolysaccha-
haemorrhagiae. Journal of Wildlife Diseases, ride activates cells through a TLR2-dependent
17(1), 39–43. doi: 10.7589/0090-3558-17.1. mechanism. Nature Immunology, 2(4), 346–
39. 352. doi: 10.1038/86354.
Nair and
Gomes-Solecki

49
Physiological Reports ISSN 2051-817X
ORIGINAL RESEARCH
CD4+ T cell activation and associated susceptibility to HIV-1

infection in vitro increased following acute resistance
exercise in human subjects
Alexander K. Holbrook1, Hunter D. Peterson2, Samantha A. Bianchi2, Brad W. Macdonald2,
Eric C. Bredahl2, Michael Belshan1 & Jacob A. Siedlik2
1 Department of Medical Microbiology and Immunology, Creighton University, Omaha, Nebraska
2 Department of Exercise Science and Pre-Health Professions, Creighton University, Omaha, Nebraska
Keywords Abstract
Physical activity, T cell activation, viral
infection. Early studies in exercise immunology suggested acute bouts of exercise had an
immunosuppressive effect in human subjects. However, recent data, show
Correspondence acute bouts of combined aerobic and resistance training increase both lym-
Jacob A. Siedlik, Department of Exercise phocyte activation and proliferation. We quantified resistance exercise-induced
Science and Pre-Health Professions, changes in the activation state of CD4+ T lymphocytes via surface protein
Creighton University, 2500 California Plaza,
expression and using a medically relevant model of infection (HIV-1). Using a
Omaha, NE 68178.
Tel: +1 402 280 2474
randomized cross-over design, 10 untrained subjects completed a control and
Fax: +1 402 280 4732 exercise session. The control session consisted of 30-min seated rest while the
E-mail: jakesiedlik@creighton.edu exercise session entailed 3 sets 9 10 repetitions of back squat, leg press, and
leg extensions at 70% 1-RM with 2-min rest between each set. Venous blood
Funding information samples were obtained pre/post each session. CD4+ T lymphocytes were iso-
This work was supported by the Dr. George lated from whole blood by negative selection. Expression of activation markers
F. Haddix President’s Faculty Research Fund
(CD69 & CD25) in both nonstimulated and stimulated (costimulation
at Creighton University.
through CD3+CD28) cells were assessed by flow cytometry. Resistance exer-
Received: 24 June 2019; Revised: 22 August cised-induced effects on intracellular activation was further evaluated via
2019; Accepted: 27 August 2019 in vitro infection with HIV-1. Nonstimulated CD4+ T lymphocytes obtained
postexercise exhibited elevated CD25 expression following 24 h in culture.
doi: 10.14814/phy2.14234 Enhanced HIV-1 replication was observed in cells obtained postexercise. Our
results demonstrate that an acute bout of resistance exercise increases the acti-
Physiol Rep, 7 (18), 2019, e14234,
vation state of CD4+ T lymphocytes and results in a greater susceptibility to
https://doi.org/10.14814/phy2.14234
HIV-1 infection in vitro. These findings offer further evidence that exercise
induces activation of T lymphocytes and provides a foundation for the use of
medically relevant pathogens as indirect measures of intracellular activation.
CD4+ T cells following exposure to cognate antigen

Introduction
(Medzhitov 2007) is associated with changes in expression
The human immune system is divided into two cate- of specific proteins, including increased expression of
gories, innate and adaptive, that can elicit both broad or CD69 and CD25, which are used as early (Testi et al.
highly targeted responses. CD4+ T cells are essential medi- 1989) and intermediate (Malek 2008) markers of cellular
ators of both the innate and adaptive immune responses. activation, respectively.
They play an integral role in the overall immunocompe- It has been demonstrated that both aerobic and resis-
tence of an individual through the release of cytokines tance exercise have the potential to alter the immune state
and chemokines, the recruitment of immune cells to sites of an individual. Evidence from a 2016 meta-analytic
of infection and inflammation, the activation of macro- review suggests the proliferative response of mixed lym-
phages, and the activation of B cells to produce antigen- phocyte populations (i.e., peripheral blood mononucleo-
specific antibodies. In the adaptive arm, the activation of cytes (PBMCs)) to in vitro mitogenic stimuli is
ª 2019 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of
The Physiological Society and the American Physiological Society. 2019 | Vol. 7 | Iss. 18 | e14234
This is an open access article under the terms of the Creative Commons Attribution License,
which permits use, distribution and reproduction in any medium, provided the original work is properly cited.
50
Exercise Induced T Cell Activation and Infection A. K. Holbrook et al.
suppressed following an acute bout of exercise (Siedlik agent of acquired immune deficiency syndrome (AIDS),
et al. 2016). Notably, most of the research investigating is a member of the retrovirus family that preferentially
the effect of exercise on immunity have focused on infects activated CD4+ T lymphocytes. More than 36 mil-
PBMC proliferation in response to an acute bout of aero- lion persons are infected with HIV-1 worldwide
bic exercise (Walsh et al. 2011; b). In comparison, limited (UNAIDS). HIV-1 replication correlates strongly with the
research has been conducted examining the relationship activation state of T cells due to the metabolic require-
between acute bouts of resistance training and immunity ments of reverse transcription and integration into the
often with conflicting results (Dohi et al. 2001; Koch host genome (Gowda et al. 1989; Stevenson et al. 1990).
et al. 2001; Potteiger et al. 2001; Chan et al. 2003). Nie- Hence, any transient alteration in the metabolic state of a
man et al. (Nieman et al. 1995) observed no significant CD4+ T cell will change its susceptibility to HIV-1. Here,
differences in concanavalin A (ConA) stimulated lympho- we propose to use HIV-1 infection as a biological model
cyte proliferation in trained men following repeated sets to independently asses CD4+ T cell activation state. Nota-
of 10 repetition back squats at 65% of 1 repetition maxi- bly, quiescent CD4+ T cells, which are metabolically and
mum (1RM). Potteiger et al. (2001), however, observed transcriptionally silent (Yusuf and Fruman 2003; Tzacha-
reduced phytohemagglutinin (PHA) stimulated lympho- nis et al. 2004), were originally thought to be refractory
cyte proliferation in untrained females following an acute to HIV infection; however, evidence suggests that partially
bout of lower limb resistance training, but no change in activated cells can support infection, especially with sub-
proliferation for trained female participants. As seen sequent stimulation (Stevenson et al. 1990; Zack et al.
above, the training status of the participants, as well as 1990, 1992; Korin and Zack, 1998; Unutmaz et al. 1999;
the mitogens used for stimulation, may affect in vitro Manganaro et al. 2018).
proliferative responses. Moreover, the question of how Previous work from our laboratory demonstrated an
different immune subsets respond to acute resistance increase in CD25 expression and enhanced proliferative
exercise remains unanswered, preventing a full under- responses in CD4+ T cells following combined aerobic
standing of the clinical consequence of exercise prescrip- and resistance training exercise (i.e., circuit training)
tion. (Siedlik et al. 2017). In this study, we focused our efforts
Cellular activation in response to an antigen leads to to investigate whether resistance training alone altered
clonal expansion of antigen-specific T cells to facilitate CD4+ T cell activation state and response to co-stimula-
neutralization of an invading pathogen (Mueller et al. tion with CD28. In parallel we tested susceptibility to
1989). In laboratory and clinical settings, clonal expansion HIV-1 infection to independently validate any changes in
in response to either mitogenic stimulation or co-stimula- activation state resulting from exercise. To do this, we
tion through CD28 is commonly utilized as a measure of compared CD4+ T cells isolated from individuals prior to
lymphocyte functional ability (Siedlik et al. 2016; 2017). and after acute resistance training. Notably, the data were
Indeed, studies investigating the effects of exercise on the cross-compared to a nonexercise session as an additional
immune system have commonly used proliferation assays control. Changes in early markers of activation, specifi-
to quantify changes in lymphocyte function following an cally expression of CD25 and CD69, were analyzed from
acute bout of aerobic exercise. As addressed briefly above, two distinct perspectives. First, was there an exercise-in-
however, proliferative assays can produce ambiguous duced effect on CD4+ T cell activation absent stimuli in
results due to methodological variability (Siedlik et al. culture (Arm 1), and second, was there an exercise-in-
2016) and a failure to quantify specific elements of the duced effect on the ability of CD4+ T cells to respond to
activation process. Measurement of specific immune cell stimuli in culture (Arm 2). Together, this study represents
functions potentially can improve the understanding of a first attempt to quantify exercise-induced changes in
the impact of excise on immunity. CD4+ T cell function using a medically relevant viral
Exercise-induced alterations in immune function have model.
the potential to affect the interaction of pathogens with
the immune system. A change in cellular activation state
Methods
and/or subsequent alteration in proliferation of immune
cell subsets could alter the disease state in an individual.
Participants
For example, changes in CD4+ T lymphocyte activation
could enhance an immune response and provide greater Ten healthy, untrained, college-aged individuals
protection against an invading pathogen. Conversely, (Mean SD, n = 10 [5 male & 5 female], age =
heightened cell activation may create favorable conditions 21 2 year; weight = 71.5 10.1 kg; height = 171.8
for lymphotropic pathogens, such as human immunodefi- 7.1 cm) volunteered to participate. Untrained status was
ciency virus (HIV). Type 1 HIV (HIV-1), the etiologic defined as no more than 1 h of aerobic and/or resistance
2019 | Vol. 7 | Iss. 18 | e14234 ª 2019 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of
The Physiological Society and the American Physiological Society.
51
A. K. Holbrook et al. Exercise Induced T Cell Activation and Infection
training per week. All participants provided written electronic devices during this time and were monitored at
informed consent and completed a Health & Exercise Sta- random intervals to ensure they remained alert.
tus Questionnaire prior to participation. At the time of
recruitment, subjects were instructed to maintain their
Physiological monitoring
normal dietary patterns prior to participating in either
session, but to refrain from exercise for 24 h prior to data Participants were fitted with a Zephyr BioHarness 3
collection. Participants reported that they had neither (Zephyr Technology, Annapolis, MD) to measure heart
recently taken nor were currently using non-steroidal rate (HR). Continuous HR measures were recorded at
anti-inflammatory drugs (NSAID), aspirin, or other anti- 1 sec intervals during the training session and down-
thrombotic over-the-counter or prescription medications. loaded using the Zephyr BioHarness Log Downloader
All participants reported being negative for HIV infection. (version 1.0.29.0). HRmax was estimated using the meth-
Participants reported no cold or flu symptoms in the ods of Tanaka et al. (2001).
2 weeks prior to data collection. The study conformed to
the standards set by the Declaration of Helsinki and the
Blood collections
procedures followed were in accordance with the protocol
approved by the Creighton University Institutional Blood samples were collected in sodium heparin vacutain-
Review Board (959210-1). ers prior to (Pre) and immediately following (Post) each
testing session using standard antecubital venipuncture
technique.
3-repetition maximum assessments
Each participant completed an initial strength assessment
Antibodies and reagents
that included 3-repetition maximum [RM] barbell high
bar parallel squat, 3-RM leg press, and 3-RM leg exten- Antibodies used for flow cytometry were purchased from
sion. The 3-RM back squat was tested on their first visit BioLegend (San Diego, CA) and include: anti-CD4-Alexa
and the leg press and leg extension were assessed at a visit Fluor 700 (RPA-T4), CD69-APC/Cy7 (FN50), and CD25-
at least 2 days after squat testing. All participants com- PE (M-A251).
pleted a 5 min self-paced warm-up on a cycle ergometer
prior to starting any warm-up sets. The 3-RM testing fol-
Cell purification and culture
lowed the protocol recommended by the National
Strength and Conditioning Association (Haff and Triplett Blood samples (80 mL) were obtained at each time point
2016). For all exercises, the first warm-up set required 5– for analyses of surface marker expression and viral repli-
10 repetitions. The second warm-up set and beyond cation. CD3+CD4+ T cell isolation from peripheral blood
required 2–5 repetitions until a 3-RM was attempted. was conducted through negative selection using a Human
Participants were allowed multiple attempts at the 3-RM CD4+ T cell enrichment kit as directed by the manufac-
to attain the highest load possible. The 3RM was recorded turer (Stemcell Technologies, Vancouver, BC, Canada).
and used for estimation of 1RM values using the follow- Purity was assessed following cell isolation by staining
ing equation: (3RM/ 0.9 = 1RM). All experiment visits with anti-CD4-Alexa Fluor 700 (RPA-T4) and all samples
took place at least 1 week after completion of repetition were >97% CD4+ by flow cytometry (Kohlmeier et al.
maximum testing. 2006; Newton and Benedict, 2014; Siedlik et al. 2017).
After purification, the cells were resuspended in warm
Immunocult-XF T cell expansion medium (Stemcell
Testing protocol
Technologies, Vancouver, BC, Canada).
Following the fitness assessments, each participant ran-
domly completed a control and exercise session, which
Surface marker expression – cell stimulation
occurred between 0700 and 0745 h. Both visits occurred
and culture
within a 7-day time frame. The exercise session included
a 5-min self-paced warm-up on a cycle ergometer fol- Cells were co-stimulated through CD3+CD28 using plate-
lowed by 3 sets of 10 repetitions of back squats at 70% of bound antibodies or no simulation as previously
estimated 1-RM, 3 sets of 10 repetitions of leg press at described (Chirathaworn et al. 2002; Kohlmeier et al.
70% 1-RM, and 3 sets of 10 repetitions of leg extension 2006; Siedlik et al. 2017). Each antibody was titrated to
at 70% 1-RM with 2-min rest between sets. The control the lowest concentration that gave maximum T cell acti-
session involved the subjects sitting quietly in a room for vation: anti-CD3 (OKT3) used at 1 lg/mL (BioLegend,
30 min. Subjects were not allowed to read or use San Diego, CA) and anti-CD28 (CD28.2) at 2 lg/mL
ª 2019 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of 2019 | Vol. 7 | Iss. 18 | e14234
52
(BioLegend, San Diego, CA). Antibodies were diluted in then pelleted, washed with dPBS, and resuspended in
sterile Dulbecco’s Phosphate Buffered Saline (dPBS) (Life 550 lL fresh culture media (RPMI-1640 Medium [GE
Technologies, Grand Island, NY) added to 96-well plates Healthcare, Piscataway, NJ] + 10% Fetal bovine serum
and incubated overnight at 4°C. Unbound antibodies [Corning, Corning, New York] + 2% Penicillin/Strepto-
were removed by washing 3x with dPBS prior to cell plat- mycin [Corning, Corning, New York] + 20 mmol/L L-
ing. CD4+ T cells were plated at 1.5 9 106 cells/mL in glutamine [Corning, Corning, New York] + 50 units/mL
200 lL of Immunocult-XF T-cell media (Stemcell Tech- recombinant Human IL-2 [R&D Systems, Minneapolis,
nologies, Vancouver, BC, Canada) directly after isolation. MN]) per well, in a new 24-well plate. Cells were stimu-
Cells were cultured at 37°C in a humidified incubator lated using plate-bound antibodies as outlined above, but
with 5% CO2. Cells were analyzed by flow cytometry in 24-well plates at 2 9 106 cells/mL in 500 lL of Immu-
using anti-CD4-Alexa Fluor 700, anti-CD69-APC/Cy7, nocult-XF T-cell media (Stemcell Technologies, Vancou-
and anti-CD25-PE antibodies immediately after CD4+ T ver, BC, Canada) culture. Stimulated CD4+ T cell HIV-1
cell isolation (0 h), 24 h, and 72 h in culture using a ZE5 infections occurred after 3 days of CD3/CD28 stimula-
Cell Analyzer (Propel Labs, Fort Collins, CO). Data analy- tion. Both unstimulated and CD3/CD28 stimulated cells
sis was performed with FlowJo software v10 (TreeStar, were cultured for 17 days. Supernatant samples were col-
Ashland, OR). Compensation was performed using single lected at 0, 3, 7, 10, 14, and 17 days post infection (dpi),
antibody positive and negative controls (OneComp clarified by centrifugation, and stored at 20°C. For the
eBeads Compensation Beads, ThermoFisher Scientific, reactivation studies, unstimulated cells were activated at
Waltham, MA) in each assay. Gates were set based on flu- 14 dpi with human CD3/CD28/CD2 T cell activator
orescence minus one controls. A representative gating beads for 3 days (Stemcell Technologies, Vancouver, BC,
strategy is shown in Figure 1. Canada) and additional RT sample collected at 17 dpi.
An overview of the cell culture experiments is shown in
Figure 2.
HIV-1 viral replication assays - cell
stimulation and culture
Reverse transcriptase assay
HIV-1 NLX virus stocks were produced through the
transfection of 293T cells with 5 lg of pNLX molecular Virus replication/production was quantified by a reverse
clone and quantified by p24 antigen ELISA as previously transcriptase (RT) assay as described previously (DeBoer
described (Siedlik et al. 2016). Both unstimulated and et al. 2018). Triplicate 10 lL of supernatant were assayed
CD3/CD28 stimulated cells were infected for each condi- per timepoint. Fresh culture media was used as a negative
tion. Unstimulated CD4+ T cells were infected and cul- control, and an NLX virus standard as a positive control
tured shortly after purification. 1 9 106 cells were seeded in each reaction plate. An RT assay mix of H20,
in three wells as per condition in a 24-well plate and 50 mmol/L Tris (pH 7.9), 75 mmol/L KCL, 2 nmol/L
incubated with HIV-1 at a multiplicity of infection DTT, 0.1875 mmol/L ATP, 5 mmol/L MgCl2, RT Primer
(MOI) of 0.1 for 4 h at 37°C with 5% CO2. Cells were (25 mg/L), 0.05% NP-40, 2 lmol/L dTTP, and 2 µCi
Figure 1. Representative gating procedures for analyzed samples. (A) Illustrates usage and placement of the live cell gate in the forward
scatter versus side scatter plot. Sample populations were all >97% CD3+CD4+ following isolation. All flow data were gated as in (A) before
further analysis. An unstained sample (not shown) was used as a guide for placement of the CD4+ gate in the fully stained sample (B).
Expression of surface markers of activation in non-stimulated and stimulated cell populations were quantified using median fluorescent intensity
(MFI) of (C) CD69 and (D) CD25. Overlays of the non-stimulated (light gray) and stimulated samples (dark gray) were used to correct for the
effect of costimulation through CD28 prior to analyzing exercise-induced alterations.
53
Figure 2. Overview of experiment design. Each subject participated in both a control and exercise session with order randomized. Blood was
collected pre and post each visit (A) and CD3+CD4+ T cells isolated via negative selection. (B) Both unstimulated and CD3/CD28 stimulated cells
were cultured for 17 days. Stimulated CD4+ T cell HIV-1 infections occurred after 3 days of CD3/CD28 stimulation. Supernatant samples were
collected at 0, 3, 7, 10, 14, and 17 days post infection (dpi). Surface protein expression was quantified via flow cytometry at 0, 1, and 3 days.
[32P]-a-TTP was prepared and vortexed thoroughly (Sied- t-tests in R version 3.3.1 (Team 2014). Given the
lik et al. 2016). 30 lL of RT assay mix was added to each exploratory nature of this project, Bayesian paired sam-
well and the plate was incubated at 37°C for 3 h. RT mix ples t-tests were also performed using the BEST package
was added to Whatman paper in individual spots and in R (Kruschke 2013). Reported parameter estimates
allowed to dry. The paper was washed three times with from Bayesian models include the posterior mean differ-
29 saline-sodium citrate (SSC) for 5 min while rocking, ence, 95% highest density intervals (HDI), probability
washed once with 95% Ethanol, and allowed to dry. The the true mean difference is greater than 0, and, when
dried paper was then exposed to a phosphor screening relevant, threshold estimates to determine the probabil-
plate. After overnight exposure, the phosphor plates are ity the true difference of the means is greater than a
analyzed on GE Amersham Molecular Dynamics Typhoon 10% increase.
9410 Molecular Imager v5.0 (GE Healthcare, Piscataway,
NJ). The image was quantified using Molecular Dynamics
Results
ImageQuant v5.2 software (GE Healthcare, Piscataway,
NJ), setting the background to a negative control sample.
Resistance training session induced
substantial changes in heart rate
Statistical analysis
The exercise session elicited a substantial sympathetic
Power calculations were based on previously reported stimulus as demonstrated by the HR data. The mean pre-
data that investigated exercise-induced changes in T cell dicted HRmax for all subjects was 193 2 bpm. Average
activation and proliferation (Siedlik et al. 2017). The HR during the exercise trial was 137 14 bpm com-
power analysis indicated 10 subjects would exceed 80% pared with 82 10 bpm in the control subjects
power for detecting an effect size of dz = 0.99 [a large (P < 0.001). The average peak HR during the trials was
effect as outlined by Cohen (1992)] for relevant differ- 174 14 bpm and 109 11 bpm for exercise and con-
ences at an alpha < 0.05. For this investigation, quan- trol, respectively (P < 0.001). During the exercise session,
tification of the change in values from pre-to-post was subjects spent approximately half of the time
of more interest than the absolute values of the mea- (13.4 7.3 min) working at over 70% of their predicted
surements themselves; therefore, fold change scores were HRmax, whereas all subjects spent the entirety of the con-
calculated using log2 transformations: log2(Post/Pre). trol session under the 60% threshold of predicted HRmax.
Normality of data was verified using the D’Agostino- Summary of statistical results and comparative analyses
Pearson test. Data were analyzed using paired samples are presented in Table 1.
54
Table 1. Summary output for all statistical analyses performed.
Null hypothesis significance test Bayesian analyses
Time Meandiff t df P 95% CI Post. Meandiff SDdiff 95% HDI P (Meandiff > 0)
No-Stim
CD25 0h 0.2 0.73 9 0.49 0.8, 0.41 0.2 0.89 0.84, 0.47 0.25
24 h 0.27 2.4 9 0.04 0.02, 0.52* 0.28 0.37 0.01, 0.53 0.98
72 h 0.04 0.12 9 0.91 0.7, 0.78 0.06 1.1 0.74, 0.83 0.57
CD69 0h 0.29 0.74 9 0.48 1.7, 0.6 0.23 1.3 1.2, 0.71 0.29
24 h 0.02 0.09 9 0.93 0.37, 0.41 0.02 0.58 0.41, 0.43 0.55
72 h 0.1 0.36 9 0.73 0.53, 0.74 0.11 0.93 0.56, 0.77 0.65
CD4 0h 0.04 1.41 9 0.19 0.1, 0.02 0.04 0.1 0.11, 0.03 0.13
24 h 0.02 0.32 9 0.76 0.11, 0.15 0.02 0.19 0.12, 0.16 0.62
72 h 0.05 1.09 9 0.3 0.05, 0.14 0.05 0.15 0.06, 0.15 0.82
Stim
CD25 24 h 0.58 0.75 9 0.47 2.35, 1.18 0.51 2.5 2.4, 1.3 0.27
72 h 0.95 2.08 9 0.07 0.08, 1.98 0.96 1.5 0.16, 2.1 0.96
CD69 24 h 0.36 0.8 9 0.45 1.37, 0.65 0.04 0.76 0.94, 0.57 0.43
72 h 0.22 0.76 9 0.47 0.43, 0.86 0.23 0.96 0.48, 0.9 0.76
CD4 24 h 0.06 0.12 9 0.91 1.24, 1.12 0.29 1.3 1.2, 0.75 0.26
72 h 0.15 0.2 9 0.84 1.49, 1.78 0.12 2.4 1.6, 2 0.56
HIV-1
Viral replication 0 day 0.35 1.34 9 0.21 0.25, 0.97 0.21 0.6 0.23, 0.78 0.87
3 day 0.28 2.68 9 0.03 0.04, 0.51* 0.27 0.35 0.02, 0.53 0.98
7 day 0.3 0.79 9 0.44 0.56, 1.15 0.31 1.3 0.65, 1.2 0.76
Heart rate
Average 56 13.14 9 <0.001 46, 65* 56 14 46, 66 >0.999
Peak 66 12.42 9 <0.001 54, 78* 65 17 52, 77 >0.999
Mean differences were calculated as Experiment – Control.
exercise-induced changes in CD25 expression, in addition

Exercise induced changes in expression of
to being statistically significant, are likely physiologically
CD25 but not CD69
relevant. However, after 72 h in culture the effect dissi-
Surface expression of CD4, CD25, and CD69 was quanti- pated (P = 0.91, Fig. 3b) indicating that the increased
fied via median fluorescent intensity [MFI] immediately expression of CD25 was transient. No significant differ-
after CD4+ T cell isolation (0 h) and after 24 and 72 h in ences in the expression of CD69 were observed between
culture. Notably, CD4 expression was not significantly the exercise and control sessions at any time points
different in cells isolated pre or post the control and exer- (Fig. 3C–D). Summary data for the intensity of surface
cise session (data not shown). When examining exercise- protein expression on nonstimulated cells (Arm 1) are
induced changes in nonstimulated CD4+ T cells (Arm 1), shown in Table 2.
there was no significant difference in CD25 expression on In Arm 2, we investigated the CD4+ T cell response to
cells isolated before either the control or exercise session co-stimulation through CD28 (Fig. 4A–B). The results
(Pre). There was, however, a significant increase in CD25 showed increased expression of CD25, similar to Arm 1,
expression on cells isolated postexercise relative to the but no statistically significant (P < 0.05) differences were
control session after 24 h in culture (P = 0.04, Fig. 3a). observed. Interestingly, the average fold change in CD25
The estimated mean difference using the Bayesian model expression after 72 h in culture was elevated in the exer-
is 0.28, equivalent to a fold change increase > 21% in the cise session compared to the resting control session, but
cells collected pre-to-post the exercise session compared not to a statistically significant level (P = 0.07, Fig. 4B).
to the control. Moreover, 95% HDI does not include Follow-up Bayesian analyses to increase the predictive
zero, and the probability the true value is greater than precision estimated the mean difference for CD25 expres-
zero is 98% (Table 1). A threshold estimation indicates sion at 72 h as 0.96 (equivalent to an increase > 93% in
there is an 86.5% probability that the true difference in the exercise session relative to the control). The 95% HDI
means is greater than 10%. The analysis implies that of the difference of means includes zero, but has 96% of
55
Figure 3. Expression of surface markers of activation increased on non-stimulated CD4+ T cell populations. Human CD4+ T cells were isolated
and cultured in non-stimulated wells for 1 and 3 days then stained for CD25 and CD69 and analyzed by flow cytometry. The median
fluorescence intensity (MFI) was determined for expression of CD25 at (A) 1 day (Control: 0.03 0.36, Exercise: 0.3 0.46) and at (B) 3 days
(Control: 0.07 0.7, Exercise: 0.11 0.59). CD69 expression at (C) 1 days (Control: 0.25 0.49, Exercise: 0.27 0.54) and at (D) 3 days
(Control: 0.06 0.52, Exercise: 0.16 0.55). Data are presented as fold change from baseline and visualized as spaghetti plots with each line
representing the change between paired samples; n = 10. * Indicates a statistically significant difference (P < 0.05) from the control session.
Table 2. Summary data for surface protein expression on nonstimulated CD4+ T lymphocytes.
0h 24 h 72 h
Control
CD4 Pre 9578.9 544.7 8966.1 1216.5 9151.3 1184.3
Post 9868.3 541.7 8975.9 1022.2 9454.5 1270.9
CD69 Pre 203.3 143.2 171.4 84.7 150.8 40.1
Post 207.0 100.2 198.4 71.4 159.2 52.6
CD25 Pre 342.8 156.9 291.8 102.1 195.3 55.8
Post 374.3 150.8 291.3 71.6 212.5 83.7
Exercise
CD4 Pre 9456.9 757.3 9196.3 2251.4 8998.7 1159.1
Post 9476.2 737.0 9269.2 1850.5 9653.7 1691.0
CD69 Pre 169.7 66.1 172.1 99.2 160.4 56.5
Post 180.5 99.5 194.2 69.7 173.3 52.6
CD25 Pre 340.9 117.0 325.4 233.3 230.2 90.6
Post 332.7 123.1 370.1 206.1 231.2 41.0
Values represent median fluorescent intensity (MFI) assessed via flow cytometry. Data are presented as Mean SD.
the credible values greater than zero. Thus, there is a to stimuli. Similar to the nonstimulated Arm, there were
strong probability that the estimated parameter is greater no significant differences in CD69 expression observed at
than zero (i.e., indicative of an exercise-induced increase either 24 h or 72 h (Fig. 4C–D). Data for the intensity of
in expression). The probability that the true mean differ- surface protein expression on stimulated cells is summa-
ence would be greater than a 10% increase in CD25 rized in Table 3. Summary data for the percent of acti-
expression was calculated at 93.3%. This suggests there is vated cells in both stimulated and nonstimulated cultures
a 93.3% chance that exercise alters CD4+ T cell response are shown in Table 4.
56
Figure 4. Expression of surface markers of activation in stimulated CD4+ T cell populations. Human CD4+ T cells were stimulated for 1 and
3 days with anti-CD3 and anti-CD28 then stained for CD25 and CD69 and analyzed by flow cytometry. The median fluorescence intensity
(MFI) was determined for expression of CD25 at (A) 1 days (Control: 0.77 1.3, Exercise: 0.19 1.3) and at (B) 3 days (Control:
0.16 1.2, Exercise: 0.79 1.1). CD69 expression at (C) 1 days (Control: 0.41 0.91, Exercise: 0.06 0.71) and at (D) 3 days (Control:
0.03 0.61, Exercise: 0.25 0.6). Data are presented as fold change from baseline and visualized as spaghetti plots with each line
representing the change between paired samples; n = 10.
Table 3. Summary data for surface protein expression on CD4+ T Table 4. Summary data for percent of CD4+ T lymphocytes
cells costimulated through CD28. expressing both CD25 and CD69.
24 h 72 h 0h 24 h 72 h
Control No-stimulation
CD4 Pre 6092.3 2049.0 15675.9 3537.3 Control Pre 0.4 0.2 0.6 0.5 0.7 0.3
Post 6302.2 2090.4 17547.6 3360.9 Post 0.7 0.7 0.6 0.4 0.7 0.3
CD69 Pre 4072.4 2930.5 1031.2 269.9 Exercise Pre 0.4 0.2 0.5 0.2 0.8 0.5
Post 4436.9 2305.4 1084.5 339.1 Post 0.6 0.5 0.4 0.2 0.7 0.4
CD25 Pre 2850.3 2356.4 5496.5 4290.7 Stimulation through CD3+CD28
Post 3364.4 1889.7 4718.2 3469.1 Control Pre 57.9 19.4 69.4 18.3
Exercise Post 64.0 12.7 72.7 14.5
CD4 Pre 6417.7 2726.9 16004.6 5179.2 Exercise Pre 60.5 19.9 68.8 20.0
Post 6320.8 2505.9 16762.9 5133.9 Post 61.3 17.9 73.6 15.9
CD69 Pre 4422.8 2475.5 1748.0 1746.5
Post 4020.4 2026.4 1721.3 1270.1 Values represent percent of cells expressing both surface proteins.
CD25 Pre 3539.9 2154.8 5391.2 4791.3 Data are presented as Mean SD.
Post 3819.4 2739.6 7203.3 5967.8
Values represent median fluorescent intensity (MFI) assessed via 1 preferentially infects activated CD4+ cells due to the
flow cytometry. Data are presented as Mean SD. presence of increased metabolic activity. We hypothesized
that increased activation in CD4+ cells harvested postexer-
cise would lead to an increased susceptibility to HIV-1
HIV-1 infection is increased in stimulated
infection due to the increase in intracellular metabolism.
cells obtained postexercise
To test this, we assayed virus replication in CD4+ cells
As an alternative means to measure the level of activation isolated pre and post for both the exercise and control
in CD4+ T cells, infection with the CXCR4-tropic HIV-1 sessions for each participant. For each condition, we
NLX virus was chosen as a biological model system. HIV- infected both unstimulated (resting) and cells pre-
57
Figure 5. Susceptibility to HIV-1 infection was increased in postexercise samples. (A) Example replication curve from one subject. Virus
replication is presented as RT activity measured from cell culture supernatants (arbitrary units). (B) Plots show fold changes in HIV-1 replication
levels in the activated CD4+ T cells in each subject between control (0.02 0.34) and exercise (0.29 0.38) sessions at 3 days post infection.
(C) The median fluorescence intensity (MFI) was determined for CD4 expression (Control: 0.46 1.6, Exercise: 0.61 1.5) following 3 days
stimulation with anti-CD3 and anti-CD28. Data are presented as fold change from baseline and visualized as spaghetti plots with each line
representing the change between paired samples; n = 10. *Indicates a statistically significant difference (P < 0.05) from the control session.
activated with CD3/CD28/CD2 beads. The levels of virus stimulated with various cytokines, including IL-7 or IL-13
replication were measured by quantification of RT activity (Unutmaz et al. 1999). These conditions are characterized
in cell supernatants collected at various days post infec- by increased metabolic activity and levels of RNA expres-
tion. Example data for one subject is shown in Figure 5A. sion equal to levels seen in the S phase of cell division
Overall, infection of unstimulated, quiescent CD4+ T cells (Korin and Zack 1998; Zack et al. 2013). Given that an
isolated from either the control or exercise session did acute bout of resistance exercise partially increased the
not produce any significant amount of virus replication, activation state of CD4+ T cells in the absence of stimuli,
nor were any differences between conditions observed. In we sought to investigate whether the cells isolated postex-
activated CD4+ T cells, the RT activity peaked on average ercise would support establishment of latent HIV-1 infec-
at 10 days post infection in cells from either the control tion. To assess this, the infected quiescent cells from both
or experiment sessions (Fig. 5A), then declined due to control and exercise sessions were reactivated at 14 dpi by
virus-induced cell death. The average fold change in RT treatment with CD3/CD28/CD2 activator beads and an
activity from pre-to-post exercise was calculated for each additional RT sample collected 3 days post stimulation
timepoint. At 3 days post infection, there was significantly (17 dpi) to measure for latent virus infection. No signifi-
greater levels of RT activity in the stimulated cells from cantly different levels of RT activity were observed
the postexercise condition compared to resting controls between either the control or exercise session, suggesting
(P = 0.03, Fig. 5B). Notably, there was no significant that exercise does not stimulate CD4+ T cells sufficiently
change in CD4 expression on cells isolated pre or post enough to support the establishment of HIV-1 latency in
the control and exercise session at the time of viral infec- CD4+ T cells (data not shown).
tion (P = 0.84, Fig. 5C). The Bayesian threshold estimate
indicates an 85.8% probability that the true parameter
Discussion
would be a greater than 10% increase in replication. Sum-
mary statistical data are shown in Table 1. The increased The present study examined the effect of resistance exer-
infection observed in cells obtained post exercise supports cise on CD4+ T cell activation and utilized a viral model
the hypothesis that there was increased metabolic activity to indirectly assess intracellular metabolic activity via viral
in CD4+ T cells following acute bouts of resistance exer- infection. The changes we observed in CD25 expression
cise. on non-stimulated cells suggest that resistance exercise
produces an effect on the activation state of CD4+ T cells
in previously untrained individuals. Furthermore, the
HIV-1 latent infection in quiescent CD4+ T-
Bayesian analyses suggest a similar exercise-induced
cells is not enhanced in cells isolated after
increase in CD25 expression in cells responding to stim-
an acute bout of resistance exercise
uli. Together, these findings indicate an increase in cell
HIV-1 preferentially infects activated CD4+ T cells, but it activation, which is also supported by the in vitro viral
has been shown that HIV-1 can infect quiescent cells par- model showing a significant increase in viral infection in
tially activated in the G1b phase of the cell cycle, or cells cells obtained postexercise.
58
Previous work from our laboratory using an acute bout expression on nonstimulated cells obtained postexercise
of moderate intensity aerobic and resistance exercise independently validated an increase in cellular activation.
demonstrated increased activation and proliferation of Combined, these data support the hypothesis that exercise
CD3+ cells following stimulation by either phytohemag- induces an increase in the activation state of CD4+ T
glutinin (PHA) or co-stimulation through CD28 (Siedlik cells.
et al. 2017). Field studies using elite athletes in competi- A primary limitation of this study, and of research in
tive trials already demonstrate evidence of increased lym- exercise immunology in general, centers on the external
phocyte proliferation following bouts of aerobic exercise validity of the results themselves; namely, there is no
(Bassit et al. 2000; Tossige-Gomes et al. 2014). To date, direct translation from the in vitro assessments to an
no studies have examined the effect of an acute bout of in vivo model. This is particularly relevant for the current
resistance training on T lymphocyte activation states and project given the use of virus replication as an outcome
only a few have examined the effect of resistance training measure. A previous study by Roubenoff et al. (1999)
on lymphocyte proliferative capacity (Dohi et al. 2001; investigated alterations in viral RNA concentrations in
Koch et al. 2001; Potteiger et al. 2001). As an example, plasma from HIV-1 infected patients participating in a
Potteiger et al. (2001) observed a statistically significant single bout of aerobic exercise. In their study, untrained,
decrease in lymphocyte proliferation in untrained subjects HIV-1 positive individuals completed a 15 min, 60 cm
following an acute bout of lower-limb resistance training. vertical step test at a cadence of 1 step/sec. They found
Notably, however, this study along with the field studies no significant increase in HIV RNA postexercise but spec-
mentioned above (Bassit et al. 2000; Tossige-Gomes et al. ulated that the lack of change might have been due to the
2014), quantified proliferation from mixed lymphocyte relatively high baseline viral loads in most of the subjects
populations. Moreover, there was no assessment of either (Roubenoff et al. 1999). Similar to the replication thresh-
CD69 or CD25 expression which complicates any com- old we observed at 10 dpi in vitro, the authors (Rouben-
parison with our results. Indeed, there is substantial off et al. 1999) suspected there was a “ceiling effect,” or
ambiguity in the existing literature, which we propose is maximum threshold in replication, that limited exercise-
derived from variability in methods, including lympho- induced changes. Notably, patients with undetectable
cyte isolation protocols and the use of various mitogenic levels of HIV-1 RNA at the start of the study showed
agents [Reviewed in (Siedlik et al. 2016; Campbell and increases in plasma HIV-1 RNA levels postexercise. That
Turner, 2018)]. In this project, we attempted to clarify result is consistent with the findings of the current study,
some of the ambiguity of previous studies by focusing on despite the fact that we assayed virus replication in cells
a specific lymphocyte subset (CD4+ T cells) and utilizing from healthy, uninfected individuals.
a biological model of infection to assess exercise-induced Compounding concerns related to in vitro versus
effects. The use of viral infection and replication as an in vivo models, the genetic diversity, environmental expo-
outcome metric for immune function may seem counter- sures, and health histories of individuals generate highly
intuitive, but reverse transcription and the process by varied immune states (Tsang 2015). The innate variability
which HIV integrates into the host genome is dependent in immune responses in human subjects tends to lead to
upon the metabolic machinery of the cell, providing a less conclusive results compared to animal models, curb-
unique physiological method to assess exercise-induced ing enthusiasm for results obtained from human research
alterations in CD4+ T cell metabolic state. (Davis 2008). The present study identified small, transient
Cells isolated following exercise sessions supported effects representative, in scale, of exercise-induced changes
enhanced replication of HIV-1, but statistical significance in immune function. In an effort to embrace the observed
was observed only at the second timepoint (3 dpi). This variation (Gelman and Carlin 2017), the results of Baye-
is likely because once infection is established, HIV-1 has a sian analyses are provided to illustrate the probability of
logarithmic growth rate until the maximum threshold of parameter values given the observed data. Bayesian meth-
virus replication is achieved (Ribeiro et al. 2010). In our ods provide a probability distribution for an estimate;
experiments, the maximum threshold was typically meaning, we can assign a probability to our best estimate
achieved prior to the 10 dpi timepoint (overall of the mean difference and all the possible values the
mean = 9.575 2.0 dpi). Given a constant MOI and no parameter may take (Buchinsky and Chadha 2017). This
difference in cell surface expression of CD4 between the Bayesian estimation provides more informative results
control and exercise conditions, the exponential growth about the magnitude of parameters and associated vari-
rate of the viruses likely erased any differences in initial ance beyond that of traditional frequentist statistics
infection by 7 dpi. Nevertheless, the significant difference (Kruschke 2013). Moreover, we believe that improved
at 3 dpi demonstrated enhanced infection of the cells iso- assessment and interpretation of variation in studies of
lated postexercise. The significant increase in CD25 human immune responses is needed as medicine shifts
59
toward personalized, precision care (Tsang 2015; Collins 2008.12.003. PubMed PMID: 19100694; PubMed Central
and Varmus 2015). PMCID: PMCPMC2905652.
Overall, these data support the hypothesis that an acute DeBoer, J., M. S. Wojtkiewicz, N. Haverland, Y. Li, E. Harwood, E.
bout of resistance exercise in untrained individuals gener- Leshen, et al. 2018. Proteomic profiling of HIV-infected T-cells
ates an increase in CD4+ T cell activation even in the by SWATH mass spectrometry. Virology 516:246–257. https://d
absence of stimulation. We also demonstrated the use of oi.org/10.1016/j.virol.2018.01.025. PubMed PMID: 29425767;
an in vitro viral model to quantify a physiological effect, PubMed Central PMCID: PMCPMC5836514.
arguing for the use of other pathogens to investigate exer- Dohi, K., A. M. Mastro, M. P. Miles, J. A. Bush, D. S. Grove,
cise-induced changes in immune cell subsets. Infectious S. K. Leach, et al. 2001. Lymphocyte proliferation in
models, when combined with other stimulation assays, response to acute heavy resistance exercise in women:
may help clarify the ambiguity in the current literature influence of muscle strength and total work. Eur. J. Appl.
regarding the effect of exercise on immunity. It is our Physiol. 85:367–373. PubMed PMID: 11560093.
hope, that future studies using these designs will help Gelman, A., and J. Carlin. 2017. Some natural solutions to the
advance translational research in exercise immunology p-value communication problem—and why they won’t
and ultimately lead to better informed prescription of work. J. Am. Stat. Assoc. 112:899–901. https://doi.org/10.
clinical exercise. 1080/01621459.2017.1311263.
Gowda, S. D., B. S. Stein, N. Mohagheghpour, C. J. Benike,
and E. G. Engleman. 1989. Evidence that T cell activation is
Conflict of Interest required for HIV-1 entry in CD4+ lymphocytes. J.
Immunol. 142:773–780. PubMed PMID: 2521508.
The authors report no conflict of interest.
Haff, G., and N. T. Triplett. 2016. Essentials of strength
References training and conditioning. 4th ed. Human Kinetics,
Champaign, IL.
Bassit, R. A., L. A. Sawada, R. F. Bacurau, F. Navarro, and L. Koch, A. J., J. A. Potteiger, M. A. Chan, S. H. Benedict, and B.
F. Costa Rosa. 2000. The effect of BCAA supplementation B. Frey. 2001. Minimal influence of carbohydrate ingestion
upon the immune response of triathletes. Med. Sci. Sports on the immune response following acute resistance exercise.
Exerc. 32:1214–1219. PubMed PMID: 10912884. Int. J. Sport Nutr. Exerc. Metab. 11:149–161. PubMed
Buchinsky, F. J., and N. K. Chadha. 2017. To P or Not to P: PMID: 11402249.
backing bayesian statistics. Otolaryngol. Head Neck Surg. Kohlmeier, J. E., M. A. Chan, and S. H. Benedict. 2006.
157:915–918. https://doi.org/10.1177/0194599817739260. Costimulation of naive human CD4 T cells through
PubMed PMID: 29192853. intercellular adhesion molecule-1 promotes differentiation to a
Campbell, J. P., and J. E. Turner. 2018. Debunking the myth memory phenotype that is not strictly the result of multiple
of exercise-induced immune suppression: redefining the rounds of cell division. Immunology 118:549–558. https://doi.
impact of exercise on immunological health across the org/10.1111/j.1365-2567.2006.02396.x. PubMed PMID:
lifespan. Front. Immunol. 9:648. https://doi.org/10.3389/f 16895560; PubMed Central PMCID: PMCPMC1782322.
immu.2018.00648. PubMed PMID: 29713319; PubMed Korin, Y. D., and J. A. Zack. 1998. Progression to the G1b
Central PMCID: PMCPMC5911985. phase of the cell cycle is required for completion of human
Chan, M. A., A. J. Koch, S. H. Benedict, and J. A. Potteiger. immunodeficiency virus type 1 reverse transcription in T
2003. Influence of carbohydrate ingestion on cytokine cells. J. Virol. 72:3161–3168. PubMed PMID: 9525642;
responses following acute resistance exercise. Int. J. Sport PubMed Central PMCID: PMCPMC109773.
Nutr. Exerc. Metab. 13:454–65. PubMed PMID: 14967869. Kruschke, J. K. 2013. Bayesian estimation supersedes the t test.
Chirathaworn, C., J. E. Kohlmeier, S. A. Tibbetts, L. M. J. Exp. Psychol. Gen. 142:573–603. https://doi.org/10.1037/
Rumsey, M. A. Chan, and S. H. Benedict. 2002. Stimulation a0029146. PubMed PMID: 22774788.
through intercellular adhesion molecule-1 provides a second Malek, T. R. 2008. The biology of interleukin-2. Annu. Rev.
signal for T cell activation. J. Immunol. 168:5530–5537. Immunol. 26:453–479. https://doi.org/10.1146/annurev.
PubMed PMID: 12023348. immunol.26.021607.090357. PubMed PMID: 18062768.
Cohen, J. 1992. A power primer. Psychol. Bull. 112:155–159. Manganaro, L., P. Hong, M. M. Hernandez, D. Argyle, L. C. F.
PubMed PMID: 19565683. Mulder, U. Potla, et al. 2018. IL-15 regulates susceptibility
Collins, F. S., and H. Varmus. 2015. A new initiative on of CD4(+) T cells to HIV infection. Proc. Natl. Acad. Sci.
precision medicine. N. Engl. J. Med. 372:793–795. https://d USA 115:E9659–E9667. https://doi.org/10.1073/pnas.
oi.org/10.1056/NEJMp1500523. PubMed PMID: 25635347; 1806695115. PubMed PMID: 30257946; PubMed Central
PubMed Central PMCID: PMCPMC5101938. PMCID: PMCPMC6187195.
Davis, M. M. 2008. A prescription for human immunology. Medzhitov, R. 2007. Recognition of microorganisms and
Immunity 29:835–838. https://doi.org/10.1016/j.immuni. activation of the immune response. Nature 449:819–826.
60
https://doi.org/10.1038/nature06246. PubMed PMID: Team, R. C. 2014. R: a language and environment for

17943118. statistical computing. R Foundation for Statistical
Mueller, D. L., M. K. Jenkins, and R. H. Schwartz. 1989. Computing, Vienna, Austria.
Clonal expansion versus functional clonal inactivation: a Testi, R., J. H. Phillips, and L. L. Lanier. 1989. Leu 23
costimulatory signalling pathway determines the outcome of induction as an early marker of functional CD3/T cell
T cell antigen receptor occupancy. Annu. Rev. Immunol. antigen receptor triggering. Requirement for receptor cross-
7:445–480. https://doi.org/10.1146/annurev.iy.07.040189. linking, prolonged elevation of intracellular [Ca++] and
002305. PubMed PMID: 2653373. stimulation of protein kinase C. J Immunol. 142:1854–1860.
Newton, A. H., and S. H. Benedict. 2014. Low density PubMed PMID: 2466079.
lipoprotein promotes human naive T cell differentiation Tossige-Gomes, R., V. O. Ottone, P. N. Oliveira, D. J. S.
to Th1 cells. Hum. Immunol. 75:621–628. https://doi. Viana, T. l. Ara ujo, F. J. Gripp, and et al. 2014.
org/10.1016/j.humimm.2014.04.017. PubMed PMID: Leukocytosis, muscle damage and increased lymphocyte
24768899. proliferative response after an adventure sprint race. Braz. J.
Nieman, D. C., D. A. Henson, C. S. Sampson, J. L. Herring, J. Med. Biol. Res. 47:492–498. PubMed PMID: 24676476;
Suttles, M. Conley, et al. 1995. The acute immune response PubMed Central PMCID: PMC4086176.
to exhaustive resistance exercise. Int. J. Sports Med. 16:322– Tsang, J. S. 2015. Utilizing population variation, vaccination,
328. https://doi.org/10.1055/s-2007-973013. PubMed PMID: and systems biology to study human immunology. Trends
7558530. Immunol. 36:479–493. https://doi.org/10.1016/j.it.2015.06.
Potteiger, J. A., M. A. Chan, G. G. Haff, S. Mathew, C. A. 005. PubMed PMID: 26187853; PubMed Central PMCID:
Schroeder, M. D. Haub, et al. 2001. Training status PMCPMC4979540.
influences T-cell responses in women following acute Tzachanis, D., E. M. Lafuente, L. Li, and V. A. Boussiotis.
resistance exercise. J. Strength Cond. Res. 15:185–191. 2004. Intrinsic and extrinsic regulation of T lymphocyte
PubMed PMID: 11710403. quiescence. Leuk Lymphoma. 45:1959–1967. https://doi.org/
Ribeiro, R. M., L. Qin, L. L. Chavez, D. Li, S. G. Self, and A. 10.1080/1042819042000219494. PubMed PMID: 15370239.
S. Perelson. 2010. Estimation of the initial viral growth rate Unutmaz, D., V. N. KewalRamani, S. Marmon, and D. R.
and basic reproductive number during acute HIV-1 Littman. 1999. Cytokine signals are sufficient for HIV-1
infection. J. Virol. 84:6096–6102. https://doi.org/10.1128/JVI. infection of resting human T lymphocytes. J. Exp. Med.
00127-10. PubMed PMID: 20357090; PubMed Central 189:1735–1746. PubMed PMID: 10359577; PubMed Central
PMCID: PMCPMC2876646. PMCID: PMCPMC2193071.
Roubenoff, R., P. R. Skolnik, A. Shevitz, L. Snydman, A. Walsh, N. P., M. Gleeson, D. B. Pyne, D. C. Nieman, F. S.
Wang, S. Melanson, et al. 1999. Effect of a single bout of Dhabhar, R. J. Shephard, et al. 2011. Position statement.
acute exercise on plasma human immunodeficiency virus Part two: maintaining immune health. Exerc. Immunol.
RNA levels. J. Appl. Physiol. 86:1197–1201. https://doi.org/ Rev. 17:64–103 PubMed PMID: 21446353.
10.1152/jappl.1999.86.4.1197. PubMed PMID: 10194203. Walsh, N. P., M. Gleeson, R. J. Shephard, M. Gleeson, J. A.
Siedlik, J. A., S. H. Benedict, E. J. Landes, J. P. Weir, J. P. Woods, N. C. Bishop, et al. 2011. Position statement. Part
Vardiman, and P. M. Gallagher. 2016. Acute bouts of one: immune function and exercise. Exerc. Immunol. Rev.
exercise induce a suppressive effect on lymphocyte 17:6–63 PubMed PMID: 21446352.
proliferation in human subjects: a meta-analysis. Brain Yusuf, I., and D. A. Fruman. 2003. Regulation of quiescence in
Behav. Immun. 56:343–351. https://doi.org/10.1016/j.bbi. lymphocytes. Trends Immunol. 24:380–386. PubMed PMID:
2016.04.008. PubMed PMID: 27103377. 12860529.
Siedlik, J. A., J. A. Deckert, S. H. Benedict, A. Bhatta, A. J. Zack, J. A., S. J. Arrigo, S. R. Weitsman, A. S. Go, A. Haislip,
Dunbar, J. P. Vardiman, et al. 2017. T cell activation and and I. S. Chen. 1990. HIV-1 entry into quiescent primary
proliferation following acute exercise in human subjects is lymphocytes: molecular analysis reveals a labile, latent viral
altered by storage conditions and mitogen selection. J. structure. Cell 61:213–222. PubMed PMID: 2331748.
Immunol. Methods 446:7–14. https://doi.org/10.1016/j.jim. Zack, J. A., A. M. Haislip, P. Krogstad, and I. S. Chen. 1992.
2017.03.017. PubMed PMID: 28366645. Incompletely reverse-transcribed human immunodeficiency
Stevenson, M., T. L. Stanwick, M. P. Dempsey, and C. A. virus type 1 genomes in quiescent cells can function as
Lamonica. 1990. HIV-1 replication is controlled at the level intermediates in the retroviral life cycle. J. Virol. 66:1717–
of T cell activation and proviral integration. EMBO J. 1725. PubMed PMID: 1371173; PubMed Central PMCID:
9:1551–1560. PubMed PMID: 2184033; PubMed Central PMCPMC240919.
PMCID: PMCPMC551849. Zack, J. A., S. G. Kim, and D. N. Vatakis. 2013. HIV
Tanaka, H., K. D. Monahan, and D. R. Seals. 2001. Age- restriction in quiescent CD4(+) T cells. Retrovirology. 10:37.
predicted maximal heart rate revisited. J. Am. Coll. Cardiol. https://doi.org/10.1186/1742-4690-10-37. PubMed PMID:
37:153–156. PubMed PMID: 11153730. 23557201; PubMed Central PMCID: PMCPMC3626626.
61
FULL PAPER
www.advancedscience.com
Modularly Programmable Nanoparticle Vaccine Based on

Polyethyleneimine for Personalized Cancer Immunotherapy
Jutaek Nam, Sejin Son, Kyung Soo Park, and James J. Moon*
1. Introduction
Nanoparticles (NPs) can serve as a promising vaccine delivery platform for
improving pharmacological property and codelivery of antigens and Therapeutic cancer vaccination aims to
adjuvants. However, NP-based vaccines are generally associated with activate and augment antitumor T cell
immunity by providing antigenic and
complex synthesis and postmodification procedures, which pose technical
costimulatory signals to professional
and manufacturing challenges for tailor-made vaccine production. Here, antigen-presenting cells (APCs).[1] In par-
modularly programmed, polyethyleneimine (PEI)-based NP vaccines are ticular, neoantigens, produced by genetic
reported for simple production of personalized cancer vaccines. Briefly, PEI is alterations occurring in a tumor- and
conjugated with neoantigens by facile coupling chemistry, followed by patient-specific manner, can be highly
immunogenic as neoantigens are entirely
electrostatic assembly with CpG adjuvants, leading to the self-assembly of
absent in normal cells, thus bypassing
nontoxic, sub-50 nm PEI NPs. Importantly, PEI NPs promote activation and central T cell tolerance.[2] Thus, amplifying
antigen cross-presentation of antigen-presenting cells and cross-priming of neoantigen-specific T cells using cancer
neoantigen-specific CD8+ T cells. Surprisingly, after only a single intratumoral vaccines offers a promising strategy for
injection, PEI NPs with optimal PEGylation elicit as high as ≈30% improving immunogenicity and selectivity
neoantigen-specific CD8+ T cell response in the systemic circulation and of cancer vaccines.[3] Indeed, neoantigen
vaccines based on peptides have recently
sustain elevated CD8+ T cell response over 3 weeks. PEI-based nanovaccines
generated promising clinical outcomes in
exert potent antitumor efficacy against pre-established local tumors as well as small cohorts of patients.[4] Although these
highly aggressive metastatic tumors. PEI engineering for modular initial clinical trials provide strong rationale
incorporation of neoantigens and adjuvants offers a promising strategy for for further development of neoantigen can-
rapid and facile production of personalized cancer vaccines. cer vaccines, these initial studies employing
free soluble vaccines exhibited limited ef-
ficiency at generating neoantigen-specific
T cells, potentially due to rapid clearance
of free antigens upon in vivo administration and poor codelivery
of antigens and adjuvants to APCs.[5]
Dr. J. Nam, Dr. S. Son Nanoparticle (NP)-based delivery systems have several advan-
Department of Pharmaceutical Sciences
Biointerfaces Institute tages for cancer vaccination, including improved pharmacologi-
University of Michigan cal properties, targeted delivery, and controlled and localized re-
Ann Arbor, MI 48109, USA lease of immunomodulatory agents for efficient modulation of
K. S. Park specific immune cells.[6] Various functional NPs based on lipo-
Department of Biomedical Engineering somes, polymers, lipoprotein nanodiscs, and inorganic NPs have
Biointerfaces Institute
been employed to improve innate immune stimulation and in-
University of Michigan
Ann Arbor, MI 48109, USA duction of antitumor T cell responses,[7] including personalized
Prof. J. J. Moon neoantigen cancer vaccines.[8] However, many NP-based vaccines
Department of Pharmaceutical Sciences generally involve complex synthesis steps and postmodification
Department of Biomedical Engineering of NPs, thus presenting technical and manufacturing challenges.
Biointerfaces Institute On the other hand, it is desirable to streamline the manufactur-
University of Michigan
Ann Arbor, MI 48109, USA ing process of neoantigen-based vaccines so that simple, scalable,
E-mail: moonjj@umich.edu affordable production with short turnaround time is feasible for
practical neoantigen-based cancer vaccination in the clinic.[9]
The ORCID identification number(s) for the author(s) of this article Here, we designed a programmable neoantigen cancer vac-
can be found under https://doi.org/10.1002/advs.202002577 cine that allows simple and facile modular assembly of defined
© 2021 The Authors. Advanced Science published by Wiley-VCH GmbH. antigens and adjuvants by exploiting the versatile functionality
This is an open access article under the terms of the Creative Commons of polyethyleneimine (PEI) (Figure 1). Furthermore, we sought
Attribution License, which permits use, distribution and reproduction in to perform systemic investigation on PEI-based vaccine system
any medium, provided the original work is properly cited.
for promoting cellular uptake of neoantigens, activation of APCs,
DOI: 10.1002/advs.202002577 and cross-priming of neoantigen-specific T cell responses. Our
Adv. Sci. 2021, 8, 2002577 2002577 © 2021 The Authors. Advanced Science published by Wiley-VCH GmbH
62
www.advancedsciencenews.com www.advancedscience.com
Figure 1. Schematic illustration of PEI-based nanovaccine. PEI was sequentially modified with PEG and neoantigens via amide and disulfide bond,
respectively. Then, polycationic PEI conjugates were self-assembled with polyanionic CpG adjuvants through electrostatic interaction to form neoantigen
nanovaccine. Diverse types of antigens and adjuvants can be incorporated into the complex allowing flexible and modular design for personalized cancer
vaccines. The nanovaccine can increase the cellular uptake of neoantigens and adjuvants by APCs and promote activation and antigen cross-presentation
to effectively cross-prime antigen-specific T cells for robust antitumor immunity and antitumor efficacy.
vaccine consists of PEI-antigen conjugates and CpG adjuvants amount of the cross-linker and CSS-Adpgk was varied to ad-
that form compact nano-condensates through electrostatic in- just the density of Adpgk peptide, and the PEI–Adpgk conju-
teraction between polycationic PEI and polyanionic CpG. PEI- gates were analyzed by gel permeation chromatography (GPC)
antigen is composed of neoantigen peptides conjugated to PEI (Figure 2A). PEI–Adpgk conjugates displayed strong absorption
via a disulfide bond that can be readily cleaved in the highly peaks for Adpgk peptide at ≈15 min, which was absent in plain
reductive intracellular environment, thereby promoting cross- PEI (labeled as PEI–Adpgk(0)). When the conjugates were treated
presentation by APCs.[8b,d] Subsequently, PEI-antigen conjugates with dithiothreitol (DTT) reducing agent, the elution time of
are incubated with CpG to self-assemble into nano-sized parti- PEI–Adpgk conjugates was delayed by ≈0.9 min, and their peaks
cles for efficient codelivery of antigens and adjuvants to APCs coeluted with free CSS-Adpgk + DTT. These results demon-
– a prerequisite step for optimal T cell priming.[10] Our ap- strated successful conjugation of Adpgk peptide via reduction-
proach to exploit the intrinsic charge property can avoid complex sensitive bond, which would allow for the release of intact pep-
chemical and structural modifications and preserve immunolog- tides in a reducing environment. We prepared PEI–Adpgk conju-
ical activities of antigens and adjuvants to achieve maximum gates with Adpgk/PEI molar ratios of 2, 13, and 30, as determined
potency.[11] Importantly, we show polyethyleneglycol (PEG) mod- from the standard curve of CSS-Adpgk + DTT and concentration
ification as a simple yet powerful strategy to improve the PEI- of Adpgk released from DTT treatment of PEI–Adpgk (Figure S1,
based nanovaccine for cellular uptake, activation, and antigen Supporting Information). We could not obtain higher Adpgk con-
cross-presentation of APCs, while eliminating inherent cytotoxi- jugation as it caused precipitation due to poor solubility in aque-
city associated with PEI. The optimized nanovaccines elicited ro- ous medium. Since APCs are the first line of immune cells that
bust priming of antigen-specific CD8+ T cells and exerted strong vaccine formulations should engage for priming antitumor T cell
antitumor efficacy against pre-established local and metastatic tu- response, we examined PEI–Adpgk conjugates for potential cy-
mors, demonstrating their potential for personalized cancer im- totoxicity in bone marrow-derived dendritic cells (BMDCs) (Fig-
munotherapy. ure 2B). As PEI is known to be cytotoxic,[12] BMDCs incubated
with plain PEI and PEI–Adpgk conjugates exhibited similar lev-
2. Results els of cytotoxicity although we observed slightly reduced cytotox-
icity for PEI–Adpgk conjugates with Adpgk/PEI ratio ≥ 13.
2.1. PEGylation Reduces Cytotoxicity of PEI–Adpgk Conjugates We sought to reduce the cytotoxicity of PEI–Adpgk by employ-
and Produces Sub-50 nm CpG Complex ing PEGylation. PEG–PEI–Adpgk conjugates were synthesized
by unsaturated conjugation of methoxy poly(ethyleneglycol) pro-
We prepared PEI-antigen conjugates by employing an amine-to- pionic acid N-hydroxysuccinimide (methoxy-PEG-NHS) to a por-
sulfhydryl cross-linker that bridges PEI and cysteine-modified tion of the primary amine of PEI, followed by the cross-linker and
peptides through a reducible disulfide bond. As for the choice CSS-Adpgk conjugation as above. For the systemic investigation,
of antigen, we employed Adpgk peptide which is a neoantigen we varied the degree of PEGylation by adjusting the stoichiometry
identified in murine MC38 colon carcinoma.[3b] Specifically, the of PEG:PEI to 5:1, 10:1, 15:1, or 20:1. The efficiency of PEG conju-
primary amine of PEI was grafted with the cross-linker to create gation was nearly 100% for all cases as calculated from the unre-
pyridyldithiol functional groups to which CSS-Adpgk was con- acted free amine groups quantified using 2,4,6-trinitrobenzene
jugated to form PEI–Adpgk via disulfide linkage. The feeding sulfonic acid (data not shown).[13] PEG–PEI–Adpgk conjugates
63
Figure 2. Synthesis and characterization of PEI conjugates and CpG-containing nanovaccines. A–D) GPC spectra of A) PEI–Adpgk conjugates and C)
PEG–PEI–Adpgk conjugates measured before and after 10 × 10−3 m DTT treatment, and B, D) their dose-dependent cytotoxicity toward BMDCs assessed
after 24 h incubation. The number denotes number of conjugated Adpgk per PEI for PEI–Adpgk conjugates and number of grafted PEG per PEI for PEG-
PEI–Adpgk conjugates. E) Zeta potential and F) hydrodynamic size of nanovaccines formed by adding CpG to PEG–PEI–Adpgk conjugates with varying
weight ratio. G) TEM images of nanovaccines formulated at a weight ratio of 2 taken after 2% uranyl acetate staining for visualization of their morphology.
Scale bars = 200 nm. The data show mean ± s.d. (n = 5). **P < 0.01 and ****P < 0.0001, analyzed by two-way ANOVA with Bonferroni multiple
comparisons post-test.
were also confirmed using GPC spectra, which showed simi- drance of PEG. PEGylation dramatically improved biocompati-
lar ≈1 min peak shift after DTT treatment (Figure 2C), indi- bility of PEI–Adpgk conjugates with PEG/PEI ≥ 15 exhibiting
cating stable conjugation of Adpgk peptides via disulfide link- no cytotoxicity up to 100 µg mL−1 and rather promoting cel-
age. The ratio of Adpgk:PEI was calculated to be 46, 43, 37, and lular proliferation to some extent (Figure 2D). PEGylation was
33 for PEG(5)-, PEG(10)-, PEG(15)-, PEG(20)-PEI–Adpgk conju- mainly responsible for the reduced cytotoxicity although Adpgk
gates, respectively. The more PEG grafted, the smaller number conjugation also partially contributed to it (Figure S2, Supporting
of Adpgk was conjugated to PEI, probably due to the steric hin- Information).
64
We next investigated PEG–PEI–Adpgk conjugates formulated conjugates, compared with their respective free polymer form
with CpG. The cationic PEI in PEG–PEI–Adpgk can allow elec- (Figure 3B), and in particular, PEG(0)–PEI–Adpgk exhibited the
trostatic assembly and condensation of anionic CpG, confining greatest extent of decrease than others (Figure 3C). Nevertheless,
antigens and adjuvants into nanoparticles (NPs). NPs were for- compared with soluble Adpgk + CpG, the nanovaccine formu-
mulated by rapid mixing and 1 min incubation of CpG with PEG– lation markedly enhanced cellular uptake of CpG (Figure 3D),
PEI–Adpgk conjugates at weight ratios of PEG–PEI–Adpgk/CpG with 30–40-fold increase by PEG(5) NPs; 15–30-fold increase by
ranging 0.5–3. CpG had a zeta potential of −60 mV from its phos- PEG(10) and PEG(15) NPs; and 2–3-fold increase by PEG(0) and
phorothioate backbone units; as the feed amount of PEG–PEI– PEG(20) NPs (Figure 3E). Confocal microscopy images taken af-
Adpgk increased, the zeta potential of PEG–PEI–Adpgk/CpG ter 24 h incubation confirmed significant cellular uptake of both
NPs gradually increased toward more positive values (Figure 2E). PEI–Adpgk conjugates and CpG for PEG(5), PEG(10), and PEG
As CpG was added to PEG(0)–PEI–Adpgk and PEG(5)–PEI– (15) NPs (Figure 3F). In addition, we observed colocalization of
Adpgk, they underwent complete charge conversion to positive PEI–Adpgk conjugates and CpG in the endolysosomal compart-
at weight ratio > 1, while the conjugates with PEG ≥ 10 re- ments.
mained nearly neutral. These results suggest charge compensa- Having shown the robust uptake of nanovaccine, we next in-
tion of CpG by PEG–PEI–Adpgk conjugates by electrostatic as- vestigated activation and antigen presentation of BMDCs. We
sembly and passivation of their surface by the nonionic PEG examined nanovaccine-mediated activation of Toll-like receptor
layer. Complete CpG condensation appeared to occur at the PEG– (TLR)-9 using a HEK-Blue TLR-9 reporter cell line. When incu-
PEI–Adpgk/CpG weight ratio of 2, based on the zeta potential bated with HEK-Blue TLR-9 cells, PEG–PEI–Adpgk conjugates
measurement. As shown by the dynamic light scattering (DLS) induced only baseline signal, whereas CpG promoted strong ac-
measurements, the hydrodynamic (HD) size of NPs generally tivation of HEK-Blue TLR-9 cells, indicating TLR-9 activation by
did not change at PEG–PEI–Adpgk/CpG weight ratio ≥ 2, and CpG (Figure 4A, B). Whereas PEG(0) NPs showed only a baseline
at the weight ratio of 2, PEG(0)-, PEG(5)-, PEG(10)-, PEG(15)-, response, PEGylation of NPs significantly elevated TLR9 activa-
and PEG(20)-PEI–Adpgk conjugates formed NPs with HD size tion, with PEG ≥ 10 inducing stronger response than free CpG.
of 158 ± 19, 47 ± 18, 35 ± 16, 25 ± 7, and 20 ± 6 nm, respectively Next, we examined how NP formulation impacts antigen pre-
(Figure 2F). The negative correlation between PEG density and sentation by BMDCs. To study this, we employed a model anti-
HD size suggests that PEG passivation promotes formation of gen, SIINFEKL peptide, which is an immunodominant MHC-
small NPs by enhancing their colloidal stability, which is in line I epitope from ovalbumin. PEG-PEI-SIINFEKL conjugates were
with previous reports.[14] We confirmed NP formation with trans- synthesized and confirmed using GPC analysis as in Figure 2
mission electron microscopy (Figure 2G), which showed the size (Figure S3, Supporting Information). SIINFEKL nanovaccines
profiles in alignment with the DLS measurements. formulated with CpG at a weight ratio of 2 were incubated with
Overall, PEGylation significantly reduced cytotoxicity of PEI– BMDCs for 24 h, and BMDCs were analyzed for maturation
Adpgk conjugates and stabilized their CpG nanocomplex, and antigen presentation. Upregulation of CD40, CD80, CD86
thereby generating sub-50 nm NPs with a nearly neutral surface costimulatory marker on BMDCs (Figure 4C; Figure S4, Sup-
charge. The approach presented here allows the synthesis of well- porting Information) followed a similar pattern as PEG density-
defined PEI-antigen conjugates using facile conjugation chem- dependent increase in TLR-9 activation (Figure 4B), suggesting
istry. Subsequently, NPs can be readily produced in a few minutes CpG-mediated BMDC activation. In addition, PEG density also
by simple mixing and brief incubation with molecularly-defined affected antigen presentation on BMDCs, as measured by mono-
adjuvants. Thus, the PEI-based NP system offers a promising clonal antibody against SIINFEKL/H-2kb (pMHC) complex (Fig-
manufacturing strategy for on-demand production of personal- ure 4D). NPs with higher PEG density generally increased anti-
ized cancer vaccines with a quick turnaround. Based on the zeta gen presentation, with PEG(15) NPs inducing 8.4-fold higher
potential and HD size measurements, we chose NPs formed at pMHC level than soluble SIINFEKL + CpG (Figure 4D). Confo-
the PEG–PEI–Adpgk:CpG weight ratio of 2:1 for the subsequent cal microscopy also confirmed robust pMHC display on BMDCs
studies. treated with PEG(15) NPs, compared with soluble SIINFEKL +
CpG control (Figure 4E). In addition, pMHC was mainly local-
ized on the cell surface without much overlap with late endo-
2.2. PEGylation Enhances Cellular Uptake of CpG Nanocomplex somes/lysosomes stained with lysosomal associated membrane
and Promotes Activation and Antigen Presentation of BMDCs In protein 1 (LAMP-1) (Figure 4E). As PEI-antigen conjugates and
Vitro CpG were mainly localized in endo-lysosomes (Figure 3F), these
results suggest that the nanovaccine promotes intracellular de-
Next, we sought to investigate how PEGylation impacts on the in- livery of antigens and CpG and the subsequent steps of cross-
teractions between nanovaccines and BMDCs. PEG–PEI–Adpgk presentation, including the intracellular processing of peptide
conjugates and CpG were separately tagged with distinct fluo- antigen, MHC-loading of epitopes, and trafficking of pMHC to
rophores, formulated into NPs, incubated with BMDCs, and vi- the cell surface.[16] Without CpG, PEG-PEI-SIINFEKL conjugates
sualized to track cellular uptake of each components over time. in the form of free polymers exhibited decreased CD80, CD86,
The doses of PEG–PEI–Adpgk and CpG were fixed at 2 and CD40, and pMHC expression as the PEG density was increased
1 µg mL−1 , respectively. PEGylation decreased cellular uptake of (Figure S5, Supporting Information), possibly due to the de-
PEI–Adpgk conjugates (without CpG), likely due to the antifoul- creased cellular uptake. This is an opposite trend from the case of
ing and stealth feature of PEG (Figure 3A).[15] CpG-mediated nanovaccines, which suggests a unique beneficial role of PEGy-
NP complexation decreased cellular uptake of PEG–PEI–Adpgk lation for nanovaccine. Overall, PEGylation on PEI-antigen/CpG
65
Figure 3. Uptake of nanovaccines by BMDCs. A–C) Time lapse uptake of PEG–PEI–Adpgk conjugates in the form of A) free polymer or B) their nanovac-
cines formulated by adding CpG measured over 3 days, and C) corresponding fold change in the uptake of PEG–PEI–Adpgk conjugates after CpG
addition. D) Time lapse uptake of CpG and E) corresponding fold change in CpG uptake by nanovaccines, compared to soluble Adpgk + CpG. F) Con-
focal microscope images of BMDCs after 24 h incubation with soluble Adpgk + CpG or nanovaccine samples. Scale bar = 50 µm. The data show mean
± s.d. (n = 6). ***P < 0.001 and ****P < 0.0001, analyzed by two-way ANOVA with Bonferroni multiple comparisons post-test.
66
Figure 4. Induction of TLR9-mediated immune stimulation and antigen cross-presentation by nanovaccines. A,B) HEK-Blue TLR9 cells were incubated
with A) free polymer form of PEG–PEI–Adpgk conjugates or B) their nanovaccines with CpG, and induction of TLR9 signaling cascade was quantified
using 650 nm absorbance. Upregulation of C) CD40 and D) SIINFEKL/H-2Kb expression by BMDCs after 24 h incubation with SIINFEKL + CpG or
SIINFEKL nanovaccines. E) Confocal microscope images of BMDCs incubated with SIINFEKL + CpG or PEG(15) NP of SIINFEKL nanovaccine. Scale
bar = 50 µm. The data show mean ± s.d. (n = 6). *P < 0.05, ***P < 0.001, and ****P < 0.0001, analyzed by one-way ANOVA with Bonferroni
multiple comparisons post-test.
nanovaccines plays a vital role in cellular uptake, adjuvant activity, tightly organized in a confined volume, and thus provides a suit-
and antigen cross-presentation, and high PEG density are gener- able biological model for studying complex cellular interactions.
ally favored for activation of DCs. Adpgk nanovaccine was tested in a murine tumor model of MC38
colon carcinoma.[3b] We established MC38 colon carcinoma sub-
cutaneously on the right flank of C57BL/6 mice, and vaccines
2.3. PEGylation Reduces Tumor Retention of Nanovaccine but composed of Adpgk peptides and Alexa Fluor 647 (AF647)-tagged
Elicits Strong Immune Activation in Local Tumor-Draining Lymph CpG were administered directly into tumors. The fluorescence
Nodes In Vivo intensity of AF647-CpG measured ex vivo after 24 h revealed
that PEG(0) and PEG(5) NPs enhanced tissue retention of CpG
Next, we investigated PEGylation-dependent cellular uptake of (Figure 5A), probably due to positive surface charges (Figure 2E).
nanovaccines in vivo. Tumor tissue consists of a variety of cells Flow cytometry-based analysis of tumor tissues indicated that
67
Figure 5. Tumor retention of the nanovaccine and immune activation in tumor-draining LNs. A) Tumor retention of vaccines composed of various forms
of Adpgk peptides and AF647-CpG was visualized using ex vivo IVIS imaging after 24 h of intratumoral injection. Quantitative analysis of B) CpG+ cells
and C) corresponding MFI of CpG in CpG+ cells in tumors. D–K) Tumor-draining inguinal LNs were analyzed for the number and activation of D-G)
DCs and H–K) macrophages. The data show mean ± s.d. (n = 5). *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001, analyzed by one-way
ANOVA with Bonferroni multiple comparisons post-test.
PEG(5) NPs were broadly distributed in a larger population of macrophages in TDLNs (Figure 5I,J), resulting in a decreased ra-
cells, whereas cellular uptake of PEG(0) NPs was mainly re- tio of M2/M1-like macrophages (Figure 5K).[18] We observed sim-
stricted to a small subset of cells that internalized NPs to a greater ilar activation of DCs and macrophages in tumor-draining axil-
extent (Figure 5B,C). PEG(0) NPs appeared to be rapidly captured lary LNs, but not in contralateral non-tumor-draining inguinal or
by cells at the injection site with limited distribution in the tu- axillary LNs (Figures S8 and S9, Supporting Information). These
mor tissues, whereas PEG(5) NPs exhibited increased distribu- results show that a high degree of PEGylation potentiates the per-
tion within the tumor tissues, probably due to the PEG passi- formance of nanovaccines upon cellular entry despite the reduc-
vation layer. CpG was mainly internalized by tumor cells and tion in direct cellular association, which is in agreement with in
macrophages regardless of the formulations (Figure S6, Support- vitro results.
ing Information).
Tumor-draining lymph nodes (TDLNs) are critical sites where
T-cells are primed for immune activation against tumors.[17] 2.4. Antitumor Immune Response of Nanovaccine against
Therefore, we analyzed DCs and macrophages in inguinal Pre-Established Local Tumor
TDLNs after intratumoral administration of NPs. First, we con-
firmed that AF647 conjugation did not compromise the adjuvan- Having shown the robust activation of DCs and macrophages
ticity of CpG using BMDCs in vitro (Figure S7, Supporting In- in TDLNs, we next examined the potency of nanovaccines for
formation). PEG(15) and PEG(20) NPs enriched DCs in TDLNs priming antitumor T cell response. C57BL/6 mice were subcu-
and elevated their expression of CD40, CD80, and CD86 cos- taneously inoculated with MC38 cells, administered with Adpgk
timulatory markers (Figure 5D–G). In contrast, PEG(0), PEG(5), nanovaccines or soluble Adpgk + CpG on day 9 via intratu-
and PEG(10) NPs induced weaker activation of DCs in TDLNs moral injection, and analyzed for antitumor immune responses
(Figure 5D–G), suggesting that PEG density on NPs plays a cru- (Figure 6A). PEGylated nanovaccines induced robust priming of
cial role in DC activation in TDLNs. Similar PEG-dependency antigen-specific CD8+ T cells in the systemic circulation, as mea-
was observed for the number of macrophages in TDLNs (Fig- sured by Adpgk tetramer staining of peripheral blood mononu-
ure 5H), with PEG(15) and PEG(20) NPs significantly increas- clear cells (PBMCs) after 7 days of vaccination (Figure 6B). Sur-
ing macrophages compared with PEG(0) NPs. Compared with prisingly, with only a single injection, PEG(15) and PEG(20) NPs
PBS and PEG(0) NP, PEGylated NPs as well as the soluble vac- elicited potent neoantigen-specific CD8+ T cell responses against
cine group upregulated CD86 and downregulated CD206 on Adpgk, with 5–6-fold higher tetramer+ CD8+ T cells than soluble
68
Figure 6. Antitumor immune response of nanovaccine against pre-established local tumors. A) Schematic of treatment regimen. B,C) Adpgk-specific
CD8+ T cells in blood were analyzed after B) intratumoral injection of various vaccine formulations or C) administration of Adpgk + CpG versus PEG(15)
NP via different routes of vaccination. MC38 tumor-bearing mice were treated by intratumoral administration of Adpgk + CpG versus PEG(15) NP on day
9, and D) tumor growth and E) animal survival were monitored. F) Adpgk-specific CD8+ T cells in blood observed over 3 weeks after single immunization.
Tumor microenvironment analysis for the frequency of G) CD8+ T cells and H) Adpgk-specific CD8+ T cells, mean fluorescence intensity (MFI) of I)
perforin and J) granzyme in total CD8+ T cells. The data show mean ± s.d. (n = 5). *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001,
analyzed by one-way (B,C,G,H,I,J) or two-way (D,F) ANOVA with Bonferroni multiple comparisons post-test, or by E) log-rank (Mantel–Cox) test.
Adpgk + CpG (19 ± 4.5 and 17 ± 9.4% vs 3.3 ± 2.5%, P < 0.0001, and considerations, we chose intratumoral administration with
Figure 6B). In contrast, PEG(5) and PEG(10) NPs induced com- PEG(15) NPs for the subsequent antitumor efficacy studies.
parable CD8+ T cell responses with soluble Adpgk + CpG, while C57BL/6 mice were inoculated with MC38 tumor cells on day
PEG(0) NP had barely detectable response (Figure 6B). 0, and a single intratumoral injection of PEG(15) NP was given
Based on strong CD8+ T cell response induced by PEG(15) on day 9. PEG(15) NP effectively suppressed tumor growth (Fig-
NPs, we focused on PEG(15) NPs and examined how the route ure 6D) and eliminated established tumors in 60% mice, lead-
of immunization impacts T cell responses. After 9 days of MC38 ing to significant survival benefit compared with other groups
tumor inoculation, tumor-bearing mice were administered with (P < 0.01, Figure 6E). In contrast, soluble Adpgk + CpG had
PEG(15) NPs via intratumoral, subcutaneous (s.c.), or intra- only a modest effect with all treated mice succumbing to tu-
venous (i.v.) routes, which resulted in elicitation of 14 ± 3.1, 6.9 ± mors before day 50. Importantly, a single intratumoral admin-
5.6, and 5.8 ± 7.4% Adpgk-specific CD8+ T cell response, respec- istration of PEG(15) NP led to potent, systemic antitumor CD8+
tively, on day 16 (Figure 6C). In contrast, soluble Adpgk + CpG T cell response, achieving up to ≈30% Adpgk-tetramer+ CD8+ T
induced only 2–4% CD8+ T cell responses regardless of the in- cell response and sustaining elevated CD8+ T cell response over
jection routes. Intratumoral vaccination can be a promising can- 3 weeks (P < 0.05, Figure 6F), whereas the soluble vaccine group
cer immunotherapy as it can elicit strong antitumor immunity induced weak and transient CD8+ T cell response.
without overt systemic exposure of the vaccines. In fact, there Systemically activated CD8+ T cells need to migrate and infil-
are currently a number of clinical trials evaluating direct intratu- trate into the tumor bed in order to recognize and eradicate can-
moral injection of immunotherapies.[19] Based on these results cer cells.[20] To investigate tumor homing and cytotoxic activity of
69
CD8+ T cells, we analyzed the tumor microenvironment after 7 ysis of splenocytes using interferon (IFN)-𝛾𝛾 enzyme-linked im-
days of PEG(15) NP treatment. PEG(15) NPs promoted tumor in- munospot (ELISPOT) assay showed that PEI-M27 NP and PEI-
filtration of CD8+ T cells (Figure 6G), with significantly increased M27/M30 NP significantly enhanced antigen-specific T cell re-
frequency of Adpgk-specific CD8+ T cells (28 ± 9.0%), represent- sponses against MHC-I-restricted M27 and MHC-II-restricted
ing 14- and 3.2-fold increases over PBS and soluble Adpgk + M30 neoepitopes (Figure 7C,E,F). Soluble formulations induced
CpG, respectively (Figure 6H). Although soluble Adpgk + CpG markedly lower antigen-specific T cell responses. These results
slightly elevated the frequency of CD8+ T cells in the tumor mi- suggested that CD8+ T cell response against M27 neoepitope was
croenvironment, only a small subset of intratumoral CD8+ T cells largely sufficient for suppressing local B16F10 tumors, whereas
was specific to Adpgk peptide, with no statistical difference from systemic inhibition of metastasis required both antitumor CD8+
that of PBS-treated mice (Figure 6G,H). Intratumoral CD8+ T and CD4+ T cells. Interestingly, soluble-M27/M30 treatment
cells primed with PEG(15) NPs had high expression levels of per- induced splenomegaly indicative of systemic inflammation,[5a]
forin and granzyme (Figure 6I,J), indicating their cytotoxic po- whereas PEI-M27/M30 NP and all other treatments showed no
tential. On the other hand, we observed minimal activation of change, compared to the PBS control (Figure 6G).
CD4+ T cells and NK cells (Figure S10, Supporting Information). Overall, these results demonstrate that nanovaccines tailored
Taken together, these results demonstrate that the nanovaccines for eliciting a broad spectrum of T cell responses against multi-
can induce a robust and durable antitumor response by promot- ple neoepitopes could effectively treat highly aggressive local and
ing clonal expansion and tumor infiltration of antitumor CD8+ T metastatic tumors, while mitigating acute systemic side effects
cells. associated with soluble vaccine treatment.
3. Discussion
2.5. Nanovaccine against Highly Aggressive and Metastatic
Tumor Model PEI has been widely exploited as a gene transfection agent as
it can form positively charged nanoscale complex with DNA
Finally, we sought to evaluate the therapeutic potential of the or RNA oligonucleotides to promote their cellular uptake and
nanovaccines using B16F10 melanoma, which is a highly ag- expression.[21] In addition, PEI can stimulate immune activation
gressive model with poor immunogenicity. To mimic late stage, by triggering release of “danger signals” or “damage-associated
advanced cancer, we established B16F10 melanoma in both s.c. molecular patterns” as the result of cellular stress and damage
flank and lung tissues; C57BL/6 mice were inoculated with 3 × caused by its cytotoxic actions.[12,22] The ability of PEI to induce
105 B16F10 cells at s.c. flank as well as 4 × 105 B16F10 cells inherent immune stimulation and efficient cellular transfection
via i.v. administration, leading to the establishment of s.c. flank encouraged its development for vaccine applications associated
tumor and lung metastatic nodules (Figure 7A). Antitumor effi- with the delivery of protein- or DNA-based antigens. However,
cacy of nanovaccines was examined against both local tumors and previous studies mostly utilized PEI-based vaccines for treating
disseminated metastases after the vaccine formulations were ad- infectious disease with antibody response,[23] while a handful of
ministered directly into the s.c. flank tumors only. As this model cancer applications indicated sub-optimal intrinsic adjuvanticity
is highly aggressive, we vaccinated animals three times on days 7, of PEI for eliciting antitumor T cell response.[24] This has been
10, and 13. In addition, we utilized recently reported neoantigens attributed in part to type 2 T helper cell (Th2)-biased immune
identified in B16F10 cells, namely MHC I-restricted M27 and activation by PEI, which triggers inflammasome activation and
MHC II-restricted M30 neoepitopes, in order to study the effect humoral immunity rather than cellular immunity—a crucial cri-
of combining MHC-I epitope with MHC-II epitope.[3a] PEG(15)- terion for successful cancer vaccination.[23a,b] In addition, trans-
PEI-M27 and PEG(15)-PEI-M30 were synthesized following the fection of host bystander cells and subsequent cytotoxicity by PEI
established protocol and confirmed using high-performance liq- have been reported to activate T cells against self-antigens, poten-
uid chromatography (Figure S11, Supporting Information). CpG tially causing immune-related adverse events.[22b,25] In this work,
was added to PEG(15)-PEI-M27 or the mixture of PEG(15)-PEI- we sought to take advantage of the versatile functionality of PEI
M27 and PEG(15)-PEI-M30 conjugates, leading to the formation for delivery of antigens and adjuvants, while eliminating inher-
of PEI-M27 NP and PEI-M27/M30 NP, respectively. Both PEI ent cytotoxicity of PEI that has hampered cancer vaccine appli-
NPs exhibited similar HD size and zeta potential with nearly neu- cations. Here, we have shown that PEGylation of PEI formula-
tral surface charge; HD size was measured as 29 ± 8.6 nm and tions significantly decreased cytotoxicity of PEI, while also im-
27 ± 8.2 nm, and zeta potential 6.0 ± 4.7 mV and −1.7 ± 3.9 mV proving the performance of PEI to deliver exogenous Th1-favored
for PEI-M27 NP and PEI-M27/M30 NP, respectively. CpG adjuvant along with neoantigens in a spatiotemporally con-
Both PEI-M27 NP and PEI-M27/M30 NP treatment groups po- certed manner. The optimized PEI-based nanovaccines gener-
tently inhibited the growth of primary s.c. flank tumors compared ated robust antigen-specific T cells with a magnitude significantly
with PBS (P < 0.01, Figure 7B) although their antitumor effects greater than previously reported PEI-based vaccines,[23–24] sug-
were not statistically significant from the soluble vaccine group, gesting new engineering opportunities of PEI-based vaccines for
probably due to the aggressive nature of this B16F10 model. Im- personalized cancer immunotherapy.
portantly, PEI-M27/M30 NP treatment exerted potent systemic PEG conjugation completely abolished cytotoxicity of PEI at
antitumor efficacy against B16F10 metastasis, leading to a signif- stoichiometry of PEG/PEI ≥ 15, which is in line with previous
icantly decreased number of lung metastatic nodules by day 17 reports.[14a,26] In addition, PEG can serve as a uncharged spacer
(Figure 7C,D). In contrast, all other treatment groups had simi- unit that provides steric stabilization, decreases nonspecific cel-
lar number of lung metastatic nodules as the PBS control. Anal- lular uptake, and improves in vivo performance for PEI and its
70
Figure 7. Antitumor immune response of nanovaccine against highly aggressive, disseminated B16F10 melanoma. A) Schematic of treatment reg-
imen. B) Tumor growth curves of subcutaneous flank B16F10 tumors. C) Representative images of lungs and ELISPOT wells. ELISPOT assay was
performed after restimulation of splenocytes with M27 or M30. Quantitative analysis of D) lung tumor nodules and ELISPOT counts against E) M27
or F) M30 performed on day 17. G) Weight and images of spleens for assessement of splenomegaly. Scale bars = 1 cm. The data show mean ±
s.d. (n = 8). *P < 0.05, **P < 0.01, and ***P < 0.001, analyzed by D–G) one-way or B) two-way ANOVA with Bonferroni multiple comparisons
post-test.
71
Figure 8. Summary of the impact of PEGylation on PEG-PEI-Ag formulation, in vitro DC activation, and in vivo immune activation.
nano-complex.[27] PEGylation allowed for the formation of sub- We speculate that PEGylation serves multi-purposes; surface-
50 nm small NPs that significantly enhanced uptake of antigen displayed PEG reduces nonspecific cellular uptake while inner
and adjuvant by APCs. In particular, the uptake of CpG was PEG layer is thought to facilitate dissociation of the nanocom-
greatly improved by the nanovaccine formulation, which could plexes in the sub-cellular compartments. Efficient liberation of
be attributed to gaining positive charges from the PEI-antigen compactly packed nanocomplexes within target cellular compart-
conjugate; in return, this caused decreased cellular uptake of PEI- ments is a prerequisite for immune activation, serving as a cru-
antigen conjugate with the loss of positive charges. Nonetheless, cial factor that governs the efficacy of nanovaccines and antitu-
compared with non-PEGylated PEI-antigen/CpG nanocomplex, mor T cell responses.[28] Nonetheless, there exists an optimal
PEGylated PEI-antigen/CpG nanovaccines increased uptake of level of PEGylation for balancing cellular uptake and unpack-
both antigen and adjuvant, presumably due to PEG-mediated ing of nanocomplexes, as demonstrated by comparable in vitro
surface passivation and enhanced colloidal stability. More im- and in vivo immune activation and T cell responses induced by
portantly, the degree of PEGylation had a significant impact on PEG(15) NP and PEG(20) NP (Figures 4–6) despite significant
immunological activity of nanovaccines, with higher PEG gen- lower cellular uptake of PEG(20) NP (Figure 3). In contrast, cel-
erally potentiating the vaccine efficacy regardless of the extent lular uptake was directly associated with the activity of non-CpG-
of cellular uptake. In vitro, this was clearly demonstrated with complexed free PEI-antigen polymers, with PEGylation decreas-
PEG(20) NP. Compared with NP formed with lower PEG densi- ing cellular uptake and subsequent activation and antigen pre-
ties, PEG(20) NP induced the least cellular uptake of PEI-antigen sentation of BMDCs in vitro (Figure 3A; Figure S5, Supporting
and adjuvant (Figure 3); nevertheless, PEG(20) NP promoted ro- Information). Overall, these results suggest that immunologi-
bust TLR-9 signaling (Figure 4B), upregulation of costimulatory cal activity of nanovaccine is mainly limited by steric restriction
markers (Figure 4C), and antigen cross-presentation by DCs (Fig- of antigens and adjuvants, which could be improved by PEGy-
ure 4D). A similar observation was made in our in vivo studies. lation that facilitates unpacking and liberation of antigens and
Activation of DCs and macrophages in TDLNs (Figure 5D–K) was adjuvants from the nanocomplex. The impact of PEGylation on
increased with higher degree of PEGylation although PEGylation the various aspects of formulation and performance of PEI-based
reduced cellular association of NPs in the tumor tissues (Fig- vaccine is summarized in Figure 8.
ure 5A–C). PEG can not only passivate the surface of nanovac- The optimized nanovaccines allowed a greater amount of anti-
cines but also insert a charge-inert layer during the assembly gens and adjuvants to gain entry into cells than soluble vac-
of PEI-antigen and CpG that weakens electrostatic interaction. cines, suggesting that the NP formulation promotes endocytosis/
72
phagocytosis by DCs.[29] We found that nanovaccines were lo- 5. Experimental Section

cated in endo-lysosomal compartments (Figure 3F), leading to
efficient triggering of the TLR-9 signaling pathway and licens- Reagents and Instruments: Polyethyleneimine (PEI, branched, Mw
25000), 3-(2-pyridyldithio)propionic acid N-hydroxysuccinimide ester
ing of DCs for antitumor T cell responses (Figure 4).[30] PEI (SPDP) were obtained from Sigma-Aldrich. Methoxy poly(ethyleneglycol)
has been known to mediate endosomal escape and cytosolic propionic acid N-hydroxysuccinimide (Methoxy-PEG-NHS, Mw 5000) was
drug delivery by trapping endosomal protons, termed proton purchased from Nanocs. CpG1826 was obtained from Integrated DNA
sponge effect.[31] We speculate that the amount of PEI used for Technology. Antigen peptides used in this study were synthesized by
in vitro study (2 µg mL−1 ) was not sufficient to induce endoso- Genemed Synthesis, which include epitopes of ovalbumin peptide SIIN-
mal rupture via proton sponge effect. Nonetheless, we observed FEKL and CSSSIINFEKL, neo-epitopes of MC38 colon carcinoma ASMT-
NMELM (Adpgk) and CSSASMTNMELM (CSS-Adpgk), neo-epitopes of
efficient cross-presentation of endo-lysosomally delivered anti-
B16F10 melanoma LCPGNKYEM (M27), VDWENVSPELNSTDQ (M30),
gens (Figure 4D,E). Thus, PEI NP-mediated synchronous de- and CSSVDWENVSPELNSTDQ (CSS-M30). All other reagents were re-
livery of antigen and CpG to the endo-lysosomal compartment ceived from Fisher scientific unless otherwise indicated. UV–Vis absorp-
could efficiently license DCs for cross-priming of T cells. We tion and fluorescence spectra were obtained using BioTek synergy neo mi-
speculate that PEI NP-mediated antigen processing and MHC croplate reader. GPC and HPLC were performed using Shimadzu HPLC
class I presentation occurs in endocytic compartments via vac- system equipped with TSKgel G3000SWxl column (Tosoh Bioscience LLC)
and Jupiter® C18 LC Column (Phenomenex), respectively. TEM images
uolar pathways,[32] which could be further augmented by endo-
were acquired using JEOL 1400-plus. Hydrodynamic size and zeta poten-
somal TLR signaling[10a] and phagosomal MHC I delivery.[33] In- tial were measured using Zetasizer Nano ZSP (Malvern Panalytical). Flow
deed, clonal expansion of antigen-specific CD8+ T cells elicited cytometry was performed using ZE5 Cell Analyzer (Bio-Rad) and the data
by nanovaccines of varying PEG density (Figure 6B) followed were analyzed using FlowJo 10.5 software.
the pattern of activation and maturation of DCs examined in Preparation of PEI Conjugates and Nanovaccines: For PEI–Adpgk,
vitro (Figure 4C) and in vivo (Figure 5E–G), supporting the 10 mg of PEI dissolved in 1 mL DMSO was mixed with SPDP crosslinker
link between DCs and T cells. Soluble vaccine induced signif- and stirred for 3 h, followed by the addition of CSS-Adpgk. The
amount of SPDP/CSS-Adpgk was 1.3/1.1, 3.2/2.9, 6.4/5.8 µmol for PEI–
icantly lower antigen-specific CD8+ T cells than the nanovac- Adpgk(2), PEI–Adpgk(13), PEI–Adpgk(30), respectively. After overnight re-
cine (Figures 6 and 7) despite substantial induction of costim- action, PEI–Adpgk(2) remained dispersed while PEI–Adpgk(13) and PEI–
ulatory markers on DCs (Figure 5). This suggests that soluble Adpgk(30) formed off-white particulates. To get rid of unreacted SPDP
vaccines, which suffer from limited codelivery of antigens and and CSS-Adpgk, the crude mixture of PEI–Adpgk(2) was dialyzed 3 times
adjuvants to the endo-lysosomes (Figure 3D–F), have a poor anti- against deionized (DI) water using Amicon ultra 10 kDa Mw cutoff cen-
gen cross-presentation as a major limitation for cancer vaccines trifugal filters, while PEI–Adpgk(13) and PEI–Adpgk(30) were washed 3
times with DMSO by successive centrifugations. For PEG-PEI-antigen, PEI
(Figure 4D).[10] We speculate that antigen availability may also
was first conjugated with Methoxy-PEG-NHS at varying stoichiometry, fol-
be linked to the superiority of intratumoral vaccination to other lowed by antigen conjugation using SPDP crosslinker. Briefly, 5 mg of PEI
administration routes (Figure 6C). Serving as an in situ anti- dissolved in 1 mL DMSO was reacted overnight with 5, 10, 15, 20 mg of
gen source, tumor tissue could supply endogenous tumor anti- Methoxy-PEG-NHS for PEG(5)-PEI, PEG(10)-PEI, PEG(15)-PEI, PEG(20)-
gens that could be captured by or drained together with the vac- PEI, respectively. The conjugation was quantified by measuring primary
cines after intratumoral injection, increasing antigen availability amine contents of PEI using 2,4,6-trinitrobenzene sulfonic acid accord-
ing to the manufacturer’s instruction. Then, SPDP/antigens were reacted
for vaccine-primed DCs.[34] Intratumoral injection of nanovac-
as above with their amounts at 6.4/5.8 µmol. Antigen peptides employed
cines can also offer safe cancer immunotherapy by mitigating for PEG-PEI-antigen conjugates include CSS-Adpgk, CSSSIINFEKL, M27,
the systemic inflammation associated with the soluble vaccine and CSS-M30. In some cases, 130 µg of Alexa Fluor® 488 NHS Ester
(Figure 7G). With the optimal formulation and administration (AF488-NHS, Invitrogen) was added along with SPDP for fluorophore la-
route, the nanovaccine developed in this study elicited remark- beling of PEI. The crude mixtures were remained dispersed and purified
able CD8+ T cell responses and exerted robust antitumor ef- by 3 rounds of dialysis using Amicon ultra 10 kDa Mw cutoff centrifugal
ficacy in multiple murine tumor models, including advanced filters. The final products were freeze-dried and then re-dispersed in DI
water at 5 or 2 mg mL−1 . For fluorophore labeling of CpG, 5′ phosphate
metastatic melanoma. group of CpG was first tethered with ethylenediamine via the 1-ethyl-3-
(3-dimethylaminopropyl)carbodiimide coupling reaction in methyl imida-
zole buffer, followed by reaction with Alexa Fluor® 647 NHS Ester (AF647-
NHS, Invitrogen) as described before.[35] For the construction of nanovac-
cine, 15 µg of CpG dispersed in 50 µl PBS was quickly added to 7.5, 15, 30,
4. Conclusion or 45 µg of PEI conjugates diluted in 50 µl PBS for weight ratio of PEI con-
jugate/CpG 0.5, 1, 2, 3, repectively. The solutions were vigorously mixed
We have developed a personalized cancer vaccine based on PEI for 1 min at room temperature and stored at 4 °C before use.
that allows nanoscale assembly of neoantigens and adjuvants In Vitro Cell Experiments: BMDCs were collected from C57BL/6 mice
with facile chemical modification and simple electrostatic inter- and maintained in the medium of RPMI 1640 supplemented 10% fe-
action. The nanovaccine promoted activation and antigen cross- tal bovine serum, 1% penicillin–streptomycin, 20 ng mL−1 granulocyte
presentation of APCs with efficient codelivery of immunologi- macrophage colony-stimulating factor (Genscript), and 50 × 10−6 m 𝛽𝛽-
cally active neoantigens and adjuvants, eliciting robust antitumor mercaptoethanol according to the literature.[36] Immature BMDCs were
plated at a density of 1 × 105 cells/well in 96 well plates and incubated
T cell immunity and antitumor efficacy against pre-established
overnight at 37 °C under 5% CO2 . For the cytotoxicity study, BMDCs were
local and metastatic tumors. Our approach allows modular in- incubated with PEI–Adpgk conjugates or CSS-Adpgk for 24 h, with the
corporation of neoantigens and ajuvants for rapid and facile pro- dose at 1, 5, 10, 20, 50, 100 µg mL−1 . Then, Cell Counting Kit-8 solu-
duction of potent cancer nanovaccines. Our approach outlined tion was added to each well of the plate according to manufacturer’s in-
here may offer a promising strategy for personalized cancer vac- struction (Dojindo Laboratories, Japan). After 2 h, absorbance at 450 nm
cination. was measured using a microplate reader to calculate relative viability as
73
the ratio of the absorbance to the nonsample treated cells. For the cel- F4/80-APC (BioLegend, No. 123116), CD86-PE/Cy7 (BD Biosciences, No.
lular uptake study, BMDCs were incubated with PEI–Adpgk/AF488 con- 560582), CD206-APC/Cy7 (BioLegend, No. 321120) for CD11b+F4/80+
jugates or their NPs with CpG-AF647 at dose of 20 µg mL−1 PEI conju- macrophages. All flow cytometry was performed after suspending cells in
gates (10 µg mL−1 for free Adpgk) and/or 10 µg mL−1 CpG. At the in- DAPI solution for counting only DAPI-negative live and intact cells.
dicated time points, cells were collected, washed with FACS buffer (1% In Vivo Cancer Therapy: For MC38 tumor study, C57BL/6 mice were
BSA in PBS), and then subjected to flow cytometry for measuring fluo- subcutaneously inoculated with 5 × 105 MC38 cells into the right flank
rescence signals. To visualize cellular localization, BMDCs were grown and randomly sorted for treatment after 9 days. The mice were intra-
onto 12 mm glass coverslips in 24 well plates at a density of 5 × 105 tumorally administered with 50 µl PBS solution of Adpgk vaccine for-
cells/well and treated with samples as above for 24 h. Cells were fur- mulations at the dose of 30 µg PEI–Adpgk conjugates (equivalent of
ther incubated with Hoechst 33342 (5 µg mL−1 , Invitrogen) and Lyso- 10 µg for free Adpgk) and 15 µg CpG. In some cases, samples were
tracker Red DND-99 (100 nM, Invitrogen) for 30 min for the staining of administered into tail-base subcutaneous site for subcutaneous injec-
nuclei and endolysosomes, respectively. Then, cells were fixed with 4% tion or tail-vein for intravenous injection (100 µl in PBS). For anal-
formaldehyde in PBS and mounted on slide glass using ProLong™ Di- ysis of neoantigen-specific CD8+ T cells in systemic circulation, sub-
amond Antifade Mountant (Invitrogen) for confocal microscopy (Nikon mandibular bleeding was performed at the indicated time points and
A1Rsi). For TLR-9 signaling study, HEK-blue TLR-9 cells (Invivogen) were PBMCs were collected after removing red blood cells using ACK lysis
treated with PEI–Adpgk conjugates or their NPs at the dose of 2 µg mL−1 buffer. PBMCs were incubated with CD16/32 FcR blocking antibody and
PEI conjugates and 1 µg mL−1 CpG in HEK-Blue Detection medium. Af- then stained with Adpgk peptide-MHC tetramer tagged with PE (H-2Db -
ter 8 h, absorbance at 650 nm was measured using a microplate reader restricted ASMTNMELM, NIH Tetramer Core Facility) and anti-CD8-APC
to analyze induction of TLR-9 signaling in the cells, with the correction (BD Biosciences, No. 553035). For analysis of tumor infiltrating lympho-
of the sample effect by subtracting the absorbance of samples without cytes, tumor tissues were collected 7 days after sample administration,
TLR-9 cells. For the analysis of activation and antigen cross-presentation, cut into small pieces, treated with 1 mg mL−1 of collagenase type IV
BMDCs were incubated with PEI-SIINFEKL conjugates or their NPs for 24 and 0.1 mg mL−1 of DNase I in RPMI for 30 min at 37 °C, and filtered
h, with the dose at 2 µg mL−1 PEI conjugates or free SIINFEKL and 1 µg through a 70-µm strainer. Then, the cell suspension was washed with
mL−1 CpG. Cells were collected, washed with FACS buffer, incubated with FACS buffer, incubated with CD16/32 FcR blocking antibody, and stained
CD16/32 FcR blocking antibody (Invitrogen, No. 14016186) for 10 min, with the following antibody-fluorophore conjugates; Perforin-FITC (In-
and then stained with antibody-fluorophore conjugates including CD80- vitrogen, No. 11939280), Granzyme-PE/Cy7 (Invitrogen, No. 25889882),
FITC (BD Biosciences, No. 553768), CD86-PE/Cy7 (BD Biosciences, No. CD45-PerCP/Cy5.5 (Invitrogen 45045182), Adpgk peptide-MHC tetramer-
560582), CD40-APC (Invitrogen, No. 17040182) and SIINFEKL/H-2kb -PE PE, CD8-APC for CD8+ T cells, Perforin-FITC, Granzyme-PE/Cy7, CD45-
(Invitrogen, No. 12574382) for 30 min at room temperature. After was- PerCP/Cy5.5, NK1.1-PE (Invitrogen, 12594182) for NK cells, and CD45-
ing with FACS buffer, cell were analyzed using flow cytometry. To visualize PerCP/Cy5.5, Foxp3-PE/Cy7 (Invitrogen, No. 25577382) CD4-APC (Invitro-
antigen cross-presentation, BMDCs were grown onto 12 mm glass cov- gen, No. 17004282) for CD4+ T cells and CD4+ Foxp3+ Tregs. Flow cytom-
erslips in 24 well plates at a density of 5 × 105 cells/well, treated with etry was performed after suspending cells in DAPI solution and gating out
samples for 24 h, and further incubated with Hoechst 33342 for 30 min. DAPI-positive populations. For B16F10 tumor study, C57BL/6 mice were
Then, cells were incubated with CD16/32 FcR blocking antibody, permeabi- injected with 3 × 105 B16F10 cells subcutaneously into the right flank and
lized with Cytofix/Cytoperm Fixation/Permeabilization Solution (BD Bio- 4 × 105 B16F10 cells intravenously into tail vein, for locally established
sciences), and antibody-stained with SIINFEKL/H-2kb -biotin (Invitrogen, tumors and lung metastasis, respectively. The subcutaneous tumors were
No. 13574381) and LAMP1-AF488 (Invitrogen, No. 53107182). After fur- subjected to intratumoral administration of samples in 50 µl PBS, with the
ther staining with streptavidin-AF594 (Molecular Probes, No. S32356), dose at 15 µg PEI-M27 conjugate (equivalent of 3.5 µg for free M27) and
cells were washed with PBS and mounted on slide glass using ProLong™ 7.5 µg CpG for M27 vaccine and 15 µg PEI-M27 conjugate, 15 µg PEI-M30
Diamond Antifade Mountant for confocal microscopy. conjugate (equivalent of 5.5 µg for free M30), and 15 µg CpG for M27/M30
In Vivo Tumor Retention and Lymph Node Draining Studies: Animals vaccine. Animals were randomly sorted on day 7 and received samples ev-
were cared for following the federal, state, and local guidelines. The Uni- ery 3 days for total 3 times, followed by euthanization on day 17 for the
versity of Michigan, Ann Arbor is an AAALAC international accredited in- analysis of splenocyte ELISPOT and lung metastasis. For ELISPOT assay,
stitution, and all work conducted on animals was in accordance with and spleens were ground with the rubber end of a syringe, filtered through a
approved by the Institutional Animal Care and Use Committee (IACUC) 70-µm strainer, and treated with ACK lysis buffer for removing red blood
with the protocol # PRO00008587. Female C57BL/6 mice (5–6 weeks) cells. The obtained splenocytes were plated at 2 × 105 cells/well in 96-
were purchased from Jackson Laboratory (USA). C57BL/6 mice were sub- well PVDF plates pre-coated with IFN-𝛾𝛾 antibody (BD Biosciences), and
cutaneously inoculated with 5 × 105 MC38 cells into the right flank and re-stimulated overnight with 10 µg mL−1 of M27 or M30 peptide. Then,
randomly sorted for treatment after 9 days when tumor size reached ap- the wells were sequentially treated with biotinylated-secondary antibody,
proximately 5 mm. The mice were administered intratumorally with 50 µl streptavidin alkaline phosphatase, and AEC Substrate (BD Biosciences).
PBS solution of Adpgk vaccine formulations with CpG-AF647 at the dose The developed spots were counted using AID iSpot Reader (AID GmbH,
of 30 µg PEI–Adpgk conjugates (equivalent of 10 µg for free Adpgk) and Germany). For the analysis of lung metastasis, lungs were excised, fixed
15 µg CpG. For the analysis of tumor retention, tumors were excised 24 overnight in 4% formaldehyde, and then B16F10 lung tumor nodules were
h after sample administration and their fluorescence intensity was mea- enumerated manually. The sizes of locally established tumors were mea-
sured using IVIS optical imaging system (Caliper Life Sciences). For up- sured twice a week using a digital caliper, and the tumor volume was es-
take in a cellular level, tumors were cut into small pieces, incubated with 1 timated by ellipsoidal calculation as V = (width)2 × length × 1/2. The
mg mL−1 of collagenase type IV and 0.1 mg mL−1 of DNase I in RPMI for mice were euthanized when the tumors reached the maximum permitted
30 min at 37 °C, and filtered through a 70-µm strainer. The obtained sin- size (1.5 cm in any dimension) or ulcerations occurred.
gle cell suspension was washed with FACS buffer, and their fluorescence Statistical Analysis: For animal studies, the mice were randomized to
signal was measured using flow cytometry. For the analysis of DCs and match similar average volume of the locally established tumors. The data
macrophages in lymph node, inguinal and axillary lymph nodes were col- show mean ± s.d. (n = 5–8). Data were approximately normally dis-
lected 24 h after sample administration, ground with the rubber end of tributed and variance was similar between the groups. Statistical analysis
a syringe, and filtered through a 70-µm strainer. The cell suspension was was performed with Prism 8.1.0 software (GraphPad Software) by one-
washed with FACS buffer, incubated with CD16/32 FcR blocking antibody, way or two-way ANOVA with Bonferroni multiple comparisons post-test.
and stained with the following antibody-fluorophore conjugates; CD80- Statistical significance for survival curve was calculated by the log-rank
FITC (BD Biosciences, No. 553768), CD40-PE (Invitrogen, No. 12040183), (Mantel–Cox) test. All data were included for the statistical analysis with
CD86-PE/Cy7 (BD Biosciences, No. 560582), CD11c-APC (BioLegend, No. the significance indicated as *P < 0.05, **P < 0.01, ***P < 0.001, and
117309) for CD11c+ DCs, and CD11b-PE (Invitrogen, No. 12011282), ****P < 0.0001.
74
Supporting Information 2017, 547, 222; c) N. Hilf, S. Kuttruff-Coqui, K. Frenzel, V. Bukur, S.

Stevanović, C. Gouttefangeas, M. Platten, G. Tabatabai, V. Dutoit, S.
Supporting Information is available from the Wiley Online Library or from H. van der Burg, P. thor Straten, F. Martínez-Ricarte, B. Ponsati, H.
the author. Okada, U. Lassen, A. Admon, C. H. Ottensmeier, A. Ulges, S. Kreiter,
A. von Deimling, M. Skardelly, D. Migliorini, J. R. Kroep, M. Idorn,
J. Rodon, J. Piró, H. S. Poulsen, B. Shraibman, K. McCann, R. Men-
Acknowledgements drzyk, M. Löwer, M. Stieglbauer, C. M. Britten, D. Capper, M. J. P. Wel-
ters, J. Sahuquillo, K. Kiesel, E. Derhovanessian, E. Rusch, L. Bunse,
J.N. and S.S. contributed equally to this work. This work was supported C. Song, S. Heesch, C. Wagner, A. Kemmer-Brück, J. Ludwig, J. C.
in part by NIH (Grant Nos. R01EB022563, R01AI127070, R01CA210273, Castle, O. Schoor, A. D. Tadmor, E. Green, J. Fritsche, M. Meyer, N.
R01DK125087, and U01CA210152), MTRAC for Life Sciences Hub, and Pawlowski, S. Dorner, F. Hoffgaard, B. Rössler, D. Maurer, T. Wein-
Emerald Foundation. J.J.M. was supported by DoD/CDMRP Peer Re- schenk, C. Reinhardt, C. Huber, H.-G. Rammensee, H. Singh-Jasuja,
viewed Cancer Research Program (Grant No. W81XWH-16-1-0369) and U. Sahin, P.-Y. Dietrich, W. Wick, Nature 2019, 565, 240; d) D. B. Ke-
NSF CAREER Award (Grant No. 1553831). K.S.P. acknowledges finan- skin, A. J. Anandappa, J. Sun, I. Tirosh, N. D. Mathewson, S. Li, G.
cial support from the UM TEAM Training Program (DE007057 from
Oliveira, A. Giobbie-Hurder, K. Felt, E. Gjini, S. A. Shukla, Z. Hu, L.
NIDCR). The authors acknowledge the NIH Tetramer Core Facility (con-
Li, P. M. Le, R. L. Allesøe, A. R. Richman, M. S. Kowalczyk, S. Abdel-
tract HHSN272201300006C) for provision of MHC-I tetramers. Opinions
rahman, J. E. Geduldig, S. Charbonneau, K. Pelton, J. B. Iorgulescu, L.
interpretations, conclusions, and recommendations are those of the au-
thor and are not necessarily endorsed by the Department of Defense. The Elagina, W. Zhang, O. Olive, C. McCluskey, L. R. Olsen, J. Stevens, W.
authors thank Marisa Aikins for critical review of the manuscript. J. Lane, A. M. Salazar, H. Daley, P. Y. Wen, E. A. Chiocca, M. Harden,
N. J. Lennon, S. Gabriel, G. Getz, E. S. Lander, A. Regev, J. Ritz, D.
Neuberg, S. J. Rodig, K. L. Ligon, M. L. Suvà, K. W. Wucherpfennig,
N. Hacohen, E. F. Fritsch, K. J. Livak, P. A. Ott, C. J. Wu, D. A. Reardon,
Conflict of Interest Nature 2019, 565, 234.
[5] a) H. Liu, K. D. Moynihan, Y. Zheng, G. L. Szeto, A. V. Li, B. Huang,
The authors declare no conflict of interest.
D. S. Van Egeren, C. Park, D. J. Irvine, Nature 2014, 507, 519; b) G.
Zhu, G. M. Lynn, O. Jacobson, K. Chen, Y. Liu, H. Zhang, Y. Ma, F.
Zhang, R. Tian, Q. Ni, S. Cheng, Z. Wang, N. Lu, B. C. Yung, Z. Wang,
Keywords L. Lang, X. Fu, A. Jin, I. D. Weiss, H. Vishwasrao, G. Niu, H. Shroff,
D. M. Klinman, R. A. Seder, X. Chen, Nat. Commun. 2017, 8, 1954.
cancer vaccines, immunotherapy, nanoparticles, neoantigens
[6] J. Nam, S. Son, K. S. Park, W. Zou, L. D. Shea, J. J. Moon, Nat. Rev.
Mater. 2019, 4, 398.
Received: July 8, 2020 [7] a) G. M. Lynn, R. Laga, P. A. Darrah, A. S. Ishizuka, A. J. Balaci, A. E.
Revised: October 30, 2020 Dulcey, M. Pechar, R. Pola, M. Y. Gerner, A. Yamamoto, C. R. Buech-
Published online: January 6, 2021 ler, K. M. Quinn, M. G. Smelkinson, O. Vanek, R. Cawood, T. Hills,
O. Vasalatiy, K. Kastenmüller, J. R. Francica, L. Stutts, J. K. Tom, K.
A. Ryu, A. P. Esser-Kahn, T. Etrych, K. D. Fisher, L. W. Seymour, R. A.
Seder, Nat. Biotechnol. 2015, 33, 1201; b) A.de Titta, M. Ballester, Z.
[1] S. H. van der Burg, R. Arens, F. Ossendorp, T. van Hall, C. J. M. Melief, Julier, C. Nembrini, L. Jeanbart, A. J. van der Vlies, M. A. Swartz, J. A.
Nat. Rev. Cancer 2016, 16, 219. Hubbell, Proc. Natl. Acad. Sci. USA 2013, 110, 19902; c) J. J. Moon,
[2] a) T. N. Schumacher, R. D. Schreiber, Science 2015, 348, 69; b) L. H. Suh, A. Bershteyn, M. T. Stephan, H. Liu, B. Huang, M. Sohail,
Scheetz, K. S. Park, Q. Li, P. R. Lowenstein, M. G. Castro, A. Schwen- S. Luo, S. H. Um, H. Khant, J. T. Goodwin, J. Ramos, W. Chiu, D. J.
deman, J. J. Moon, Nat. Biomed. Eng. 2019, 3, 768. Irvine, Nat. Mater. 2011, 10, 243.
[3] a) S. Kreiter, M. Vormehr, N. van de Roemer, M. Diken, M. Löwer, [8] a) L. M. Kranz, M. Diken, H. Haas, S. Kreiter, C. Loquai, K. C. Reuter,
J. Diekmann, S. Boegel, B. Schrörs, F. Vascotto, J. C. Castle, A. D. M. Meng, D. Fritz, F. Vascotto, H. Hefesha, C. Grunwitz, M. Vormehr,
Tadmor, S. P. Schoenberger, C. Huber, Ö. Türeci, U. Sahin, Nature Y. Hüsemann, A. Selmi, A. N. Kuhn, J. Buck, E. Derhovanessian, R.
2015, 520, 692; b) M. Yadav, S. Jhunjhunwala, Q. T. Phung, P. Lupar- Rae, S. Attig, J. Diekmann, R. A. Jabulowsky, S. Heesch, J. Hassel,
dus, J. Tanguay, S. Bumbaca, C. Franci, T. K. Cheung, J. Fritsche, T. P. Langguth, S. Grabbe, C. Huber, Ö. Türeci, U. Sahin, Nature 2016,
Weinschenk, Z. Modrusan, I. Mellman, J. R. Lill, L. Delamarre, Na- 534, 396; b) R. Kuai, L. J. Ochyl, K. S. Bahjat, A. Schwendeman, J. J.
ture 2014, 515, 572. Moon, Nat. Mater. 2017, 16, 489; c) G. M. Lynn, C. Sedlik, F. Baharom,
[4] a) P. A. Ott, Z. Hu, D. B. Keskin, S. A. Shukla, J. Sun, D. J. Bozym, W. Y. Zhu, R. A. Ramirez-Valdez, V. L. Coble, K. Tobin, S. R. Nichols, Y.
Zhang, A. Luoma, A. Giobbie-Hurder, L. Peter, C. Chen, O. Olive, T. A. Itzkowitz, N. Zaidi, J. M. Gammon, N. J. Blobel, J. Denizeau, P. de
Carter, S. Li, D. J. Lieb, T. Eisenhaure, E. Gjini, J. Stevens, W. J. Lane, I. la Rochere, B. J. Francica, B. Decker, M. Maciejewski, J. Cheung, H.
Javeri, K. Nellaiappan, A. M. Salazar, H. Daley, M. Seaman, E. I. Buch- Yamane, M. G. Smelkinson, J. R. Francica, R. Laga, J. D. Bernstock,
binder, C. H. Yoon, M. Harden, N. Lennon, S. Gabriel, S. J. Rodig, D. L. W. Seymour, C. G. Drake, C. M. Jewell, O. Lantz, E. Piaggio, A. S.
H. Barouch, J. C. Aster, G. Getz, K. Wucherpfennig, D. Neuberg, J. Ishizuka, R. A. Seder, Nat. Biotechnol. 2020, 38, 320; d) C. Xu, J. Nam,
Ritz, E. S. Lander, E. F. Fritsch, N. Hacohen, C. J. Wu, Nature 2017, H. Hong, Y. Xu, J. J. Moon, ACS Nano 2019, 13, 12148.
547, 217; b) U. Sahin, E. Derhovanessian, M. Miller, B.-P. Kloke, P. Si- [9] U. Sahin, Ö. Türeci, Science 2018, 359, 1355.
mon, M. Löwer, V. Bukur, A. D. Tadmor, U. Luxemburger, B. Schrörs, [10] a) J. M. Blander, R. Medzhitov, Nat. Immunol. 2006, 7, 1029; b) S.
T. Omokoko, M. Vormehr, C. Albrecht, A. Paruzynski, A. N. Kuhn, Nierkens, M. H. den Brok, R. P. M. Sutmuller, O. M. Grauer, E. Ben-
J. Buck, S. Heesch, K. H. Schreeb, F. Müller, I. Ortseifer, I. Vogler, nink, M. E. Morgan, C. G. Figdor, T. J. M. Ruers, G. J. Adema, Cancer
E. Godehardt, S. Attig, R. Rae, A. Breitkreuz, C. Tolliver, M. Suchan, Res. 2008, 68, 5390.
G. Martic, A. Hohberger, P. Sorn, J. Diekmann, J. Ciesla, O. Waks- [11] a) E. R. Kandimalla, L. Bhagat, D. Yu, Y. Cong, J. Tang, S. Agrawal,
mann, A.-K. Brück, M. Witt, M. Zillgen, A. Rothermel, B. Kasemann, Bioconjugate Chem. 2002, 13, 966; b) M. R. Putta, F.-G. Zhu, D. Wang,
D. Langer, S. Bolte, M. Diken, S. Kreiter, R. Nemecek, C. Gebhardt, L. Bhagat, M. Dai, E. R. Kandimalla, S. Agrawal, Bioconjugate Chem.
S. Grabbe, C. Höller, J. Utikal, C. Huber, C. Loquai, Ö. Türeci, Nature 2010, 21, 39.
75
[12] S. M. Moghimi, P. Symonds, J. C. Murray, A. C. Hunter, G. Debska, [23] a) F. Wegmann, K. H. Gartlan, A. M. Harandi, S. A. Brinckmann, M.
A. Szewczyk, Mol. Ther. 2005, 11, 990. Coccia, W. R. Hillson, W. L. Kok, S. Cole, L.-P. Ho, T. Lambe, M. Puthia,
[13] S. L. Snyder, P. Z. Sobocinski, Anal. Biochem. 1975, 64, 284. C. Svanborg, E. M. Scherer, G. Krashias, A. Williams, J. N. Blattman,
[14] a) H. Petersen, P. M. Fechner, A. L. Martin, K. Kunath, S. Stolnik, P. D. Greenberg, R. A. Flavell, A. E. Moghaddam, N. C. Sheppard, Q.
C. J. Roberts, D. Fischer, M. C. Davies, T. Kissel, Bioconjugate Chem. J. Sattentau, Nat. Biotechnol. 2012, 30, 883; b) N. C. Sheppard, S. A.
2002, 13, 845; b) M. Ogris, G. Walker, T. Blessing, R. Kircheis, M. Brinckmann, K. H. Gartlan, M. Puthia, C. Svanborg, G. Krashias, S. C.
Wolschek, E. Wagner, J. Controlled Release 2003, 91, 173; c) M. Ogris, Eisenbarth, R. A. Flavell, Q. J. Sattentau, F. Wegmann, Int. Immunol.
S. Brunner, S. Schüller, R. Kircheis, E. Wagner, Gene Ther. 1999, 6, 2014, 26, 531; c) E. V. Grant, M. Thomas, J. Fortune, A. M. Klibanov,
595; d) M. Kursa, G. F. Walker, V. Roessler, M. Ogris, W. Roedl, R. N. L. Letvin, Eur. J. Immunol. 2012, 42, 2937; d) M. Bivas-Benita, L.
Kircheis, E. Wagner, Bioconjugate Chem. 2003, 14, 222. Bar, G. O. Gillard, D. R. Kaufman, N. L. Simmons, A.-H. Hovav, N. L.
[15] a) J. S. Suk, Q. Xu, N. Kim, J. Hanes, L. M. Ensign, Adv. Drug Delivery Letvin, J. Virol. 2010, 84, 5764; e) M. Rodrigo Garzón, P. Berraondo,
Rev. 2016, 99, 28; b) J. Nam, N. Won, J. Bang, H. Jin, J. Park, S. Jung, J. Crettaz, L. Ochoa, M. Vera, J. J. Lasarte, A. Vales, N. Van Rooijen,
S. Jung, Y. Park, S. Kim, Adv. Drug Delivery Rev. 2013, 65, 622. J. Ruiz, J. Prieto, J. Zulueta, G. González-Aseguinolaza, Vaccine 2005,
[16] F. Veglia, V. A. Tyurin, D. Mohammadyani, M. Blasi, E. K. Duper- 23, 1384; f) B.-S. Shim, S.-M. Park, J.-S. Quan, D. Jere, H. Chu, M. K.
ret, L. Donthireddy, A. Hashimoto, A. Kapralov, A. Amoscato, R. An- Song, D. W. Kim, Y.-S. Jang, M.-S. Yang, S. H. Han, Y.-H. Park, C.-S.
gelini, S. Patel, K. Alicea-Torres, D. Weiner, M. E. Murphy, J. Klein- Cho, C.-H. Yun, BMC Immunol. 2010, 11, 65.
Seetharaman, E. Celis, V. E. Kagan, D. I. Gabrilovich, Nat. Commun. [24] a) Y.-F. Ma, Y.-W. Yang, Eur. J. Pharm. Sci. 2010, 40, 75; b) Z. Sun, B.
2017, 8, 2122. Liu, X. Ruan, Q. Liu, Mol. Med. Rep. 2014, 10, 2657.
[17] L. Jeanbart, M. Ballester, A. de Titta, P. Corthésy, P. Romero, J. A. [25] a) R. N. Palumbo, X. Zhong, C. Wang, J. Controlled Release 2012, 157,
Hubbell, M. A. Swartz, Cancer Immunol. Res. 2014, 2, 436. 86; b) R. M. Steinman, M. C. Nussenzweig, Proc. Natl. Acad. Sci. USA
[18] a) S. Aras, M. R. Zaidi, Br. J. Cancer 2017, 117, 1583; b) J. M. Jaynes, R. 2002, 99, 351.
Sable, M. Ronzetti, W. Bautista, Z. Knotts, A. Abisoye-Ogunniyan, D. [26] H. Petersen, P. M. Fechner, D. Fischer, T. Kissel, Macromolecules 2002,
Li, R. Calvo, M. Dashnyam, A. Singh, T. Guerin, J. White, S. Ravichan- 35, 6867.
dran, P. Kumar, K. Talsania, V. Chen, A. Ghebremedhin, B. Karanam, [27] M. Jäger, S. Schubert, S. Ochrimenko, D. Fischer, U. S. Schubert,
A. Bin Salam, R. Amin, T. Odzorig, T. Aiken, V. Nguyen, Y. Bian, J. C. Chem. Soc. Rev. 2012, 41, 4755.
Zarif, A. E. de Groot, M. Mehta, L. Fan, X. Hu, A. Simeonov, N. Pate, [28] N. P. Gabrielson, D. W. Pack, Biomacromolecules 2006, 7, 2427.
M. Abu-Asab, M. Ferrer, N. Southall, C.-Y. Ock, Y. Zhao, H. Lopez, S. [29] C. C. Norbury, Immunology 2006, 117, 443.
Kozlov, N. de Val, C. C. Yates, B. Baljinnyam, J. Marugan, U. Rudloff, [30] a) T. Kawai, S. Akira, Immunity 2011, 34, 637; b) L. A. J. O’Neill, D.
Sci. Transl. Med. 2020, 12, eaax6337; c) T. M. Raimondo, D. J. Mooney, Golenbock, A. G. Bowie, Nat. Rev. Immunol. 2013, 13, 453.
Proc. Natl. Acad. Sci. USA 2018, 115, 10648; d) Q. Li, A. Shen, Z. [31] a) S. Yang, S. May, J. Chem. Phys. 2008, 129, 185105; b) A. Akinc,
Wang, RSC Adv. 2020, 10, 16537. M. Thomas, A. M. Klibanov, R. Langer, The J. Gene Med. 2005, 7,
[19] a) A. Marabelle, L. Tselikas, T. de Baere, R. Houot, Ann. Oncol. 2017, 657.
28, xii33; b) M. A. Aznar, N. Tinari, A. J. Rullán, A. R. Sánchez-Paulete, [32] O. P. Joffre, E. Segura, A. Savina, S. Amigorena, Nat. Rev. Immunol.
M. E. Rodriguez-Ruiz, I. Melero, J. Immunol. 2017, 198, 31. 2012, 12, 557.
[20] D. S. Chen, I. Mellman, Immunity 2013, 39, 1. [33] P. Nair-Gupta, A. Baccarini, N. Tung, F. Seyffer, O. Florey, Y.
[21] a) O. Boussif, F. Lezoualc’h, M. A. Zanta, M. D. Mergny, D. Scherman, Huang, M. Banerjee, M. Overholtzer, P. A. Roche, R. Tampé, B. D.
B. Demeneix, J. P. Behr, Proc. Natl. Acad. Sci. USA 1995, 92, 7297; Brown, D. Amsen, S. W. Whiteheart, J. M. Blander, Cell 2014, 158,
b) U. Lungwitz, M. Breunig, T. Blunk, A. Göpferich, Eur. J. Pharm. 506.
Biopharm. 2005, 60, 247. [34] S. Nierkens, M. H. den Brok, T. Roelofsen, J. A. L. Wagenaars, C. G.
[22] a) C. Shen, J. Li, Y. Zhang, Y. Li, G. Shen, J. Zhu, J. Tao, Int. J. Nanomed. Figdor, T. J. Ruers, G. J. Adema, PLoS One 2009, 4, 8368.
2017, 12, 5443; b) K. Regnström, E. G. E. Ragnarsson, M. Köping- [35] J. Nam, S. Son, J. J. Moon, Cell Mol. Bioeng. 2017, 10, 341.
Höggård, E. Torstensson, H. Nyblom, P. Artursson, Gene Ther. 2003, [36] M. B. Lutz, N. Kukutsch, A. L. J. Ogilvie, S. Rößner, F. Koch, N. Ro-
10, 1575. mani, G. Schuler, J. Immunol. Methods 1999, 223, 77.
76
StarBright Dyes for flow cytometry
StarBright Dyes are unique fluorescent nanoparticles conjugated
to Bio-Rad’s highly validated immunology antibodies. Developed
specifically for flow cytometry, StarBright Dyes have narrow excitation
and emission spectra and give you exceptional brightness without the
need for a special buffer. StarBright Dyes are currently available for use
with violet, blue, and ultraviolet lasers.
Explore StarBright Dyes at bio-rad-antibodies.com/StarBrightDyes
#ScienceForward

Infectious Diseases v05

Uploaded by

Copyright:

Available Formats

Infectious Diseases v05

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Infectious Diseases v05

Uploaded by

Copyright:

Available Formats

Advanced Flow Cytometry

for Infectious Diseases

To learn more, visit bio-rad.com/cellanalysis

Adapting to the Coronavirus Pandemic:

26 COVER IMAGE © BIO-RAD

A Mouse Model of Sublethal

Flow cytometry is a technology that provides rapid multi-parametric analy-

Wiley & Sons, Inc.

INTRODUCTION cancer biology, and infectious disease moni-

Current Protocols in Immunology 5.1.1–5.1.11, February 2018

Current Protocols in Immunology

Current Protocols in Immunology

Current Protocols in Immunology

Current Protocols in Immunology

Laser Dichroic filter Bandpass filter Fluorochromes

Current Protocols in Immunology

Current Protocols in Immunology

Current Protocols in Immunology

Quantitative flow cytometry DATA ANALYSIS

Current Protocols in Immunology

production. An example of gating is in Mathematically, t-SNE is similar to PCA,

Current Protocols in Immunology

Current Protocols in Immunology

Adapting to the Coronavirus Pandemic: Building and

Cytometry Part A  99A: 90–99, 2021

Cytometry Part A  99A: 90–99, 2021

Auditability was achieved through recording processes RULES ON RESULTS REPORTING

Building a SARS-CoV-2 diagnostic pipeline in a SRL

Cytometry Part A  99A: 90–99, 2021

Building a SARS-CoV-2 diagnostic pipeline in a SRL

TASK MANUAL STEP ELECTRONIC ALTERNATIVE

Cytometry Part A  99A: 90–99, 2021

Building a SARS-CoV-2 diagnostic pipeline in a SRL

Cytometry Part A  99A: 90–99, 2021

Building a SARS-CoV-2 diagnostic pipeline in a SRL

Cytometry Part A  99A: 90–99, 2021

Leptospirosis is a zoonotic disease caused by pathogenic Leptospira species

Current Protocols in Microbiology e127, Volume 59

We describe a mouse model of sublethal leptospirosis that produces consistent mea-

Basic Protocol 1: Culture and maintenance of virulent Leptospira

Current Protocols in Microbiology

Basic Protocol 2: Infection of mice through a physiologic route, and collection of

Basic Protocol 3: Analysis of pathogenesis after Leptospira infection

CULTURE AND MAINTENANCE OF VIRULENT LEPTOSPIRA BASIC

Current Protocols in Microbiology

Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, cat. no.D2650-100ML)

14-ml round-bottom tube (Thermo Fisher Scientific, cat. no.150268)

Current Protocols in Microbiology

Quantification and determination of viability

Quantification of live Leptospira by DFM

No. of bacteria/ml = (avg. of 5 squares) × 25 × dilution factor × 50,000. Nair and

Current Protocols in Microbiology

Freezing a culture of Leptospira

Current Protocols in Microbiology

INFECTION OF MICE THROUGH A PHYSIOLOGIC ROUTE AND

Current Protocols in Microbiology

BASIC INFECTION OF MICE VIA TRANSDERMAL ABRASION

ALTERNATE CONJUNCTIVAL (CJ) INFECTION

Current Protocols in Microbiology

NASAL MUCOSA (NM) INFECTION ALTERNATE

Cytometry Part A 99A: 90–99, 2021

Cytometry Part A 99A: 90–99, 2021

Cytometry Part A 99A: 90–99, 2021

Cytometry Part A 99A: 90–99, 2021

Cytometry Part A 99A: 90–99, 2021

Cytometry Part A 99A: 90–99, 2021