HCV Kattariya paper

Journal of Viral Hepatitis, 2011, 18, e117–e125 doi:10.1111/j.1365-2893.2010.01379.x Correlation between mutations in the core and NS5A genes of hepatitis C virus genotypes 1a, 1b, 3a, 3b, 6f and the response to pegylated interferon and ribavirin combination therapy K. Kumthip,1 C. Pantip,1 P. Chusri,1 S. Thongsawat,2 A. OÕBrien,1 K. E. Nelson3 and N. Maneekarn1 1Department of Microbiology; 2Department of Internal Medicine, Faculty of Medicine, Chiang Mai University, Chiang Mai, Thailand; and 3Department of Epidemiology, Bloomberg School of Public Health, Johns Hopkins University, Baltimore, MD, USA Received June 2010; accepted for publication August 2010 SUMMARY. Several studies have reported correlation between mutations in core and NS5A proteins of hepatitis C virus (HCV) and response to interferon (IFN) therapy. In particular, mutations in NS5A protein have been shown to correlate with responsiveness to IFN treatment of HCV-1b in Japanese patients. This study investigated whether amino acid (aa) mutations in the core and NS5A proteins of HCV-1a, 1b, 3a, 3b and 6f correlated with the response to pegylated interferon (Peg-IFN) plus ribavirin (RBV) therapy in Thai patients. The entire sequences of core and NS5A of HCV from 76 HCV-infected patients were analysed in comparison with corresponding reference sequences. The data revealed that the number of aa mutations in fulllength NS5A, its C-terminus, IFN sensitivity-determining region, variable region 3 (V3) and V3 plus flanking region of HCV-1b NS5A protein were significantly higher in responders than in the treatment failure group (P = 0.010, INTRODUCTION Hepatitis C virus (HCV) infection remains a serious health problem worldwide. WHO estimates that about 180 million people, representing 3% of the worldÕs population, are Abbreviations: aa, amino acid; ALT, alanine aminotransferase; AST, aspartate aminotransferase; HCV, hepatitis C virus; IFN, interferon; Peg-IFN-a, pegylated interferon alpha; ISDR, IFN sensitivity-determining region; NS5A, nonstructural protein 5A; PKR, protein kinase R; PKRBD, protein kinase R binding domain; RBV, ribavirin; RT-PCR, reverse transcription-polymerase chain reaction; STAT, signal transducers and activator of transcription; SVR, sustained virological response; V3, variable region 3. Correspondence: Niwat Maneekarn, DVM, PhD, Department of Microbiology, Faculty of Medicine, Chiang Mai University, Chiang Mai 50200, Thailand. E-mail: nmaneeka@med.cmu.ac.th  2010 Blackwell Publishing Ltd 0.031, 0.046, 0.020 and 0.006, respectively). Similar results were found in a putative protein kinase R binding domain region in HCV-6f NS5A protein (P = 0.022). Moreover, specific aa substitutions in NS5A that appeared to be associated with responders or the treatment failure group were observed at positions 78 and 305 for HCV-1b (P = 0.028), 64 and 52 for HCV-1a (P = 0.033) and 6f (P = 0.045). Nevertheless, analysis of aa sequences of core protein revealed highly conserved sequences among HCV genotypes and no significant differences between the viruses from responders and the treatment failure group. Our findings indicate that mutations in aa residues of NS5A of HCV-1a, 1b and 6f correlated well with responsiveness to Peg-IFN and RBV combination therapy. Keywords: core, hepatitis C virus, mutations, NS5A, pegylated interferon, ribavirin. infected with HCV. About 130 million of HCV-infected patients are chronic HCV carriers and are at risk of developing liver cirrhosis and hepatocellular carcinoma. While a protective vaccine for HCV is not available, the combination of pegylated interferon alpha (Peg-IFN-a) and ribavirin (RBV) is the only approved treatment regimen for patients chronically infected with HCV[1]. However, the rate of patients who achieve a sustained virological response (SVR) is different depending on multiple factors, such as treatment regimens, disease-related factors, host factors and viral factors [2]. It is believed that both host and viral factors are the main factors that contribute to the outcome of IFN therapy. The HCV genotype is also a striking predictive parameter for SVR. Patients infected with HCV genotypes 1a and 1b show response rates of 38–52% whereas those infected with genotypes 2 and 3 achieve SVR rate up to 66–88% [3,4]. The core and NS5A proteins of HCV have been demonstrated e118 K. Kumthip et al. to inhibit the antiviral activity of IFN through interaction with cellular proteins, STAT1 and RNA-activated protein kinase (PKR), respectively [5–7]. The role of amino acid (aa) mutations within the functional regions of core and NS5A in correlation with the response to IFN-a-based therapy has also been reported by several groups of investigators. Initial data indicate that aa variations within the NS5A protein play a significant role in the response of HCV to IFN therapy [8]. A correlation between a high number of mutations in the IFN sensitivity-determining region (ISDR) and a SVR to IFN-a monotherapy in patients infected with HCV-1b was demonstrated in Japanese patients [9]. The strong correlation between ISDR mutations and treatment response has been confirmed by several studies, and the results may be used as a predictive index of response to IFN therapy in Japanese patients [10–12]. Furthermore, mutations around variable region 3 (V3) within the carboxy-terminal part of the NS5A protein were found to be correlated with treatment response [13–16]. In addition to NS5A, substitutions of aa residues found in the core region of HCV-1b, at positions 70 and/or 91, were shown to be a significant factor associated with nonresponsiveness to IFN and RBV combination therapy [17,18]. However, most of the studies have been carried out mainly on HCV-1b genotype while the information of other genotypes is still limited. In Thailand, the HCV genotypes currently circulating are genotypes 1, 3 and 6 and each of them comprised about 30% of the population [19]. In the present study, we investigated the correlation between mutations in the entire sequences of core and NS5A of HCV genotypes 1a, 1b, 3a, 3b and 6f and the clinical outcome in patients treated with Peg-IFN-a and RBV combination therapy in Thai patients. MATERIALS AND METHODS Patients, treatment regimens and HCV genotypes Serum samples were collected from HCV-infected patients who visited Chiang Mai University Hospital during August 2003 to December 2009 and stored at )70 C until use. The patients were chronically infected with HCV as indicated by anti-HCV positivity. These patients were treated with 180 lg/week of Peg-IFN-a-2a (Pegasys; Hoffmann-La Roche, Nutley, NJ, USA) or 1.5 lg/kg/week of Peg-IFN-a-2b (Pegintron; Schering-Plough, Innishannon, County Cork, Ireland) in combination with RBV (800–1200 mg/day). The patients infected with HCV genotypes 1 and 6 were treated for 48 weeks whereas those infected with genotype 3 were treated for 24 weeks according to the protocol of the Thailand Consensus Recommendations for Management of Chronic Hepatitis C virus 2005. HCV genotype was initially identified by reverse hybridization assay (InnoLiPATM HCV II; Innogenetics, Gent, Belgium) and confirmed with reverse transcription-polymerase chain reaction and nucleotide sequencing. A total of 76 patients (38 infected with HCV-1, 25 with HCV-3 and 13 with 6f) who had completed treatment were included in this study. Definition of response The sera were collected before, during and at the end of treatment, and at 6 months after treatment. The pretreatment sera were tested for HCV viral load by the branched DNA assay (Quantiplex HCV RNA assay kit; Chiron Corporation, Emeryville, CA, USA), and the viral load was concomitantly monitored during the course of treatment. The sera collected at the end of treatment and at 6 months afterwards were also tested for the presence of viral RNA to assign the types of response to the Peg-IFN-a and RBV therapy. The patients were classified into three groups based on the presence of viral RNA at both time points. Responders were designated as patients who had undetectable HCV RNA in the sera (<600 IU/mL) at the end of therapy and at the 6 months follow-up visit and nonresponders those who had detectable HCV RNA at both time points. If HCV RNA was undetectable at the completion of therapy but could be detected at 6 months posttreatment, these patients were considered as relapsers. Viral RNA extraction and reverse transcription Viral RNA was extracted from 140 lL of serum by using a commercial kit (QIAamp Viral RNA Mini Kit; Qiagen, Hilden, Germany) according to the manufacturerÕs protocol. The viral RNA was heated at 65 C for 5 min and for reverse transcription by using 0.5 lL (200 U/lL) of SuperScript III reverse transcriptase (Invitrogen Life Technologies, Carlsbad, CA, USA) and 0.5 lL (40 U/lL) of RNase inhibitor with antisense primer 3UTR1 (5¢-ACATGATCTGCAGAGAGGCC3¢, nucleotide (nt) positions 9646-9627) for synthesis of full-length HCV genome cDNA. Reverse transcription was performed at 50 C for 60 min, and then the reverse transcriptase enzyme was inactivated at 70 C for 15 min. Amplification of full-length core and NS5A genes Nested and semi-nested polymerase chain reaction (PCR) were used to amplify the core and NS5A genes from fulllength cDNA by using Phusion High-Fidelity DNA Polymerase (Finnzymes, Espoo, Finland). Full-length core was first amplified using outer sense primer CEF and antisense primer EAP (Table 1). The PCR mixture consisted of 5 lL of 5 · Phusion HF buffer containing 7.5 mM MgCl2, 0.5 lL of 10 mm dNTPs, 1.25 lL of primer CEF (10 lm), 1.25 lL of primer EAP (10 lm), 0.25 lL of Phusion High-Fidelity DNA Polymerase (2U/lL) and 2.5 lL of cDNA template. RNasefree water was added to the above reaction mixture to make a final volume of 25 lL. The reaction mixture was initially activated at 98 C for 30 s and PCR amplification was performed for 35 cycles according to the following profiles: denaturation at 98 C for 10 s, annealing at 55 C for 30 s,  2010 Blackwell Publishing Ltd Core and NS5A of HCV genotypes 1, 3, 6 and Peg-IFN plus RBV e119 Table 1 Sequences of primers used for amplification of full-length core and NS5A genes Primer name Primer sets CEF EAP CIF IAP Primer sets 5A1F NS5A1R 5A1F2 Primer sets 5A3aF NS5A3R 5A3F 5A3aR Primer sets 5A3F NS5A3R 5A3bR Primer sets NS5A6F 5A6fR 5A6fF Polarity for core External Sense Antisense Internal Sense Antisense for NS5A; HCV genotype External Sense Antisense Internal Sense for NS5A; HCV genotype External Sense Antisense Internal Sense Antisense for NS5A; HCV genotype External Sense Antisense Internal Antisense for NS5A; HCV genotype External Sense Antisense Internal Sense Sequence (5¢ fi 3¢) Position (nt)* Primer specificity CTTGTGGTACTGCCTGATAGG CGTAGGGGACCAGTTCATCATCAT GCCTGATAGGGTGCTTGCGAGTG GTTCATCATCATATCCCATGCCAT 280–300 1328–1305 291–313 1316–1293 Conserved Conserved Conserved Conserved GGGCAGTGCARTGGATGAACCGGC GTCCAGAACTTGCAGTCTGTCA TCCCCCACGCACTATGTGCC 6073–6096 7784–7763 6129–6148 Genotype-specific primer Genotype-specific primer Genotype-specific primer GTACAGTGGATGAACAGGC AAGGTAACCTTCTTCTG CRCACTATGTYC CCGAGAGCG GGCAGTTTCTCYTCCTCAGCACT 6094–6112 7795–7779 6136–6156 7666–7644 Subtype-specific primer Genotype-specific primer Genotype-specific primer Subtype-specific primer CRCACTATGTYC CCGAGAGCG AAGGTAACCTTCTTCTG CAACGAATTCCTGAGTGGACTGATAG 6136–6156 7795–7779 7725–7700 Genotype-specific primer Genotype-specific primer Subtype-specific primer CAGTGGATGAACAGRCTVATAG GCGCTGCGTGACGTTGTTGAGT ACAAAGATACTCAGCTCCCTCACC 6084–6105 7753–7732 6171–6194 Genotype-specific primer Subtype-specific primer Subtype-specific primer primer primer primer primer 1 3a 3b 6f HCV, hepatitis C virus. *Nucleotide positions are according to HCV reference strains : H77 (accession no. NC_004102) for 1a; HCV-J (accession no. D90208) for 1b; NZL1 (accession no. D17763) for 3a; HCV-Tr (accession no. D49374) for 3b; and C-0044 (accession no. DQ835760) for 6f. and extension at 72 C for 30 s with a final extension at 72 C for 10 min. At the end of the cycling, the reaction mixture was kept at 4 C. The second amplification was performed with inner sense primer CIF and antisense primer IAP (Table 1) using the same PCR cycling condition as described earlier. Full-length NS5A was amplified by using the set of primers shown in Table 1. Two rounds of PCR amplification for genotypes 1 and 6 were performed for 35 cycles according to the following profiles: denaturation at 98 C for 10 s, annealing at 55 C for 30 s, and extension at 72 C for 1 min with a final extension at 72 C for 10 min. For genotypes 3a and 3b, the amplification cycle was the same as those for genotypes 1 and 6 except for the annealing temperatures which were 48 C for 30 s and 53 C for 30 s for the first and second amplification, respectively. The amplified PCR products were purified by using the QIAquick PCR Purification Kit (Qiagen) and then subjected to direct nucleotide sequencing. Nucleotide sequencing and sequence analysis The purified PCR products of core and NS5A were sequenced using a dye terminator sequencing kit (BigDye Terminator v3.1 Cycle Sequencing Kit; Applied Biosystems, Foster city, CA, USA) and an ABI 310 DNA Sequencer (Applied Bio 2010 Blackwell Publishing Ltd systems). The sense and antisense sequencing primers for full-length core and NS5A were the same sets as used for the second-round PCR amplification. The nucleotide sequences obtained from direct sequencing of the purified PCR products were edited manually based on the sequencing trace profile to correct the sequences through the programs FinchTV (Geospiza) and BioEdit Sequence Alignment Editor (Tom Hall, Ibis Therapeutics), and then nucleotide sequences were translated into amino acid sequences using the BioEdit program. Multiple alignments of deduced amino acid sequences were performed with ClustalX (Conway Institute UCD Dublin). Amino acid substitutions were determined by comparison with reference sequences from each genotype: accession numbers NC_004102 (H77) for HCV-1a, D90208 (HCV-J) for HCV-1b, D17763 (NZL1) for HCV-3a, D49374 (HCV-Tr) for HCV-3b and DQ835760 (C-0044) for HCV-6f. Nucleotide sequence accession numbers The nucleotide sequences for core and NS5A of HCV genotypes 1a, 1b, 3a, 3b and 6f reported in this study have been submitted to GenBank under the accession numbers GQ913854 to GQ913864 and HM041973 to HM042037 for core and GQ913865 to GQ913874 and HM042038 to HM042096 for NS5A. e120 K. Kumthip et al. Statistical analysis Statistical analyses were performed using the SPSS software (SPSS Inc., Chicago, IL, USA) to analyse the correlations between the mutations of amino acid sequences in the core and NS5A genes of HCV and the clinical outcomes of HCVinfected patients treated with Peg-IFN-a and RBV. Nonparametric tests, Mann–Whitney U and Kruskal–Wallis tests, were used to determine the difference in the number of mutations in the core and NS5A proteins between two (responders and treatment failure group) or three (responders, nonresponders and relapsers) groups of patients with different clinical outcomes in response to Peg-IFN-a and RBV treatment. The chi-square and FisherÕs exact probability tests were used to determine the correlation between specific point mutations that occurred in the core and NS5A proteins and clinical outcome in the patients. A P-value of <0.05 indicates a statistically significant difference. RESULTS Pretreatment characteristics of patients and clinical outcome in response to Peg-IFN-a plus RBV therapy The baseline characteristics of patients and the response to therapy are summarized in Table 2. Seventy-six patients with chronic HCV infection were included in this study. Sixteen patients were infected with HCV-1a, 22 with HCV1b, 21 with HCV-3a, 4 with HCV-3b and 13 with HCV-6f. These patients had a mean age of 50.8 ± 8.0 years; range from 27 to 76 years (data not shown) and 49 were male. Most of the patients had high levels of alanine aminotransferase (ALT; >42 U/L) and aspartate aminotransferase (AST; >37 U/L). Of 76 patients, 56 were responders, 8 were nonresponders, and 12 were relapsers. It was interesting to note that a high proportion of nonresponders (71.4%) and relapsers (83.3%) had high viral loads (>500 000 IU/mL) when compared to responders (48.1%). The difference was statistically significant (P = 0.049). The data implied that patients with high viral loads were prone to unsuccessful treatment. However, the levels of ALT and AST in responders, nonresponders and relapsers were more or less the same. Analysis of full-length amino acid sequences of NS5A protein of HCV in pretreatment sera The number of nonresponders and relapsers included in this study was relatively small compared to the number of responders (Table 2). However, the frequency and pattern of aa mutations in the ISDR, protein kinase R binding domain (PKRBD) and V3 regions in NS5A obtained from nonresponders and relapsers were very similar. Therefore, for the purpose of aa mutation analysis in correlation with clinical outcome, the numbers of nonresponders and relapsers were combined together as a treatment failure group to compare with the responder group. The data shown in Table 3 revealed that the mean number of aa mutations in fulllength NS5A, its C-terminus, ISDR, V3 and V3 plus flanking regions of HCV-1b obtained from responders were significantly higher than those from the treatment failure group (nonresponders and relapsers) with P-values of 0.010, 0.031, 0.046, 0.020 and 0.006, respectively. In the fulllength NS5A, responders had 25–51 aa mutations while the treatment failure group had 24–29 aa mutations. The number of aa mutations in the ISDR and V3 regions was also higher in responders than in the treatment failure group. The viruses from responders revealed 1–11 aa mutations in Table 2 Baseline characteristics and factors associated with clinical outcome in HCV-infected patients treated with Peg-IFN-a and ribavirin combination therapy Characteristics and HCV genotypes Responders Nonresponders Relapsers P-value Number of patients (%) Age (years) Gender (M/F) Patients with high level of ALT > 42 U/L (%) Patients with high level of AST > 37 U/L (%) HCV RNA > 500 000 IU/mL (%) HCV genotypes (number) 1a (16) 1b (22) 3a (21) 3b (4) 6f (13) 56 (73.7) 50.3 ± 7.6 34/22 81.3 84.8 48.1 8 (10.5) 51.0 ± 7.9 7/1 100 100 71.4 12 (15.8) 53.2 ± 10.3 8/4 88.9 88.9 83.3 – 0.519 0.289 0.428 0.666 0.049 12 17 17 3 7 2 2 2 0 2 2 3 2 1 4 – – – – – ALT, alanine aminotransferase (normal range 7–42 U/L); AST, aspartate aminotransferase (normal range 3–37 U/L); F, female; M, male; HCV, hepatitis C virus; Peg-IFN-a, pegylated interferon alpha. Age is expressed as mean ± standard deviation (SD). Significant factor associated with clinical outcomes is identified by univariate analysis.  2010 Blackwell Publishing Ltd  2010 Blackwell Publishing Ltd 27.8 ± 6.6 25.3 ± 2.2 0.693 34.8 ± 8.5 25.8 ± 2.5 0.010 23.9 ± 6.6 22.5 ± 5.7 0.831 38.0 ± 7.1 38.0 1.000 19.1 ± 5.4 16.2 ± 3.3 0.566 0.67 ± 0.8 0.56 ± 0.7 0.340 3.9 ± 2.1 3.2 ± 1.3 0.474 2.1 ± 1.4 1.0 ± 0.8 0.128 14.0 ± 1.7 13.0 0.637 2.0 ± 1.0 0.5 ± 0.8 0.023 = 4) = 5) = 4) = 1) = 6) Full-length NS5A (aa 1973– 2419) 7.7 ± 1.8 8.4 ± 2.6 0.449 16.0 ± 1.4 18.0 0.221 12.4 ± 2.7 12.0 ± 1.6 0.788 10.9 ± 2.6 8.2 ± 2.5 0.054 11.3 ± 2.5 12.5 ± 1.7 0.353 N-terminus of NS5A (aa 1973–2208) 11.4 ± 5.2 7.8 ± 1.5 0.246 22.0 ± 5.6 20.0 1.000 11.4 ± 4.9 11.0 ± 4.5 0.830 23.9 ± 6.8 17.6 ± 1.8 0.031 16.6 ± 4.6 13.5 ± 1.9 0.168 C-terminus of NS5A (aa 2209– 2419) 2.9 ± 2.2 1.2 ± 0.5 0.076 2.5 ± 2.1 1.0 0.480 1.1 ± 1.5 1.8 ± 2.2 0.361 3.3 ± 2.7 1.2 ± 0.5 0.046 1.4 ± 1.1 1.0 ± 0 0.553 ISDR (aa 2209– 2248) 3.6 ± 2.7 1.4 ± 2.6 0.022 7.0 ± 4.2 5.0 1.000 4.3 ± 1.7 5.0 ± 2.7 0.658 7.6 ± 4.4 5.0 ± 1.0 0.224 3.0 ± 1.9 1.5 ± 0.6 0.064 PKRBD (aa 2209– 2274) 5.0 ± 2.2 4.0 ± 1.0 0.557 5.0 ± 2.8 4.0 1.000 4.3 ± 2.0 3.0 ± 1.4 0.258 6.1 ± 1.4 4.6 ± 0.6 0.020 3.4 ± 2.2 2.0 ± 0.8 0.169 V3 (aa 2353– 2379) ND ND ND 8.0 ± 1.9 5.4 ± 0.9 0.006 9.0 ± 2.8 7.3 ± 1.5 0.260 V3 plus flanking (aa 2332–2385) IFN, interferon; ISDR, IFN sensitivity-determining region; ND, not determine; PKRBD, protein kinase R binding domain; V3, variable region 3; HCV, hepatitis C virus. *Treatment failure refers to nonresponders and relapsers, which failed to eliminate the virus at 6 months posttreatment follow-up. Significant differences between responders and treatment failure group as determined by Mann–Whitney U test, P < 0.05. Genotype 1a Responders (n = 12) Treatment failures* (n P-value Genotype 1b Responders (n = 17) Treatment failures* (n P-value Genotype 3a Responders (n = 17) Treatment failures* (n P-value Genotype 3b Responders (n = 3) Treatment failures* (n P-value Genotype 6f Responders (n = 7) Treatment failures* (n P-value HCV genotype and clinical outcome Full-length core (aa 1–191) Table 3 Number of amino acid mutations (mean ± SD) within the core and NS5A proteins of HCV-1a, 1b, 3a, 3b and 6f in responders and the treatment failure group in comparison with those of corresponding reference strains Core and NS5A of HCV genotypes 1, 3, 6 and Peg-IFN plus RBV e121 e122 K. Kumthip et al. Table 4 Amino acid substitutions in NS5A of HCV in pretreatment sera obtained from patients with different clinical outcomes in response to Peg-IFN-a and ribavirin combination therapy HCV genotypes and aa substitution site Genotype 1a A at position 64 Genotype 1b R at position 78 R at position 305 Genotype 6f V at position 52 Responders (%) Treatment failure* (%) P-value Odds ratio (95% confidence interval) 9.1 75.0 0.033 30.0 (1.410–638.2) 6.3 6.3 60.0 60.0 0.028 0.028 22.5 (1.510–335.3) 22.5 (1.510–335.3) 0 60.0 0.045 NA A, alanine; NA, not available; R, arginine; V, valine; HCV, hepatitis C virus; Peg-IFN-a, pegylated interferon alpha. *Treatment failure refers to nonresponders and relapsers which failed to eliminate the virus at 6 months posttreatment follow-up. Significant differences between responders and treatment failure group as determined by FisherÕs exact probability test, P < 0.05. the ISDR and 4–9 in V3, while the treatment failure group had 1–2 and 4–5 mutations in the ISDR and V3, respectively (data not shown). In addition, a higher rate of aa mutations in responders in comparison with those from the treatment failure group was also observed in the V3 and flanking sequences (aa positions 2332–2385) and the C-terminal end of NS5A; responders had 6–12 aa mutations in V3 plus flanking region and 16–36 aa mutations in the C-terminus, whereas those from the treatment failure group had 4–6 and 15–20 mutations, respectively (data not shown). However, the number of aa mutations observed in the N-terminus and PKRBD regions of NS5A of HCV-1b was not significantly different between the two groups. Overall, the results indicated that HCV-1b with a higher number of aa mutations in several regions of NS5A appeared to respond to treatment. Similar analysis was performed in HCV-1a, 3a, 3b and 6f. The results showed that the mean number of aa mutations in the putative PKRBD of HCV-6f obtained from responders was also significantly higher than those from the treatment failure group (P = 0.022, Table 3). The responders had 2–8 mutations whereas the treatment failure group 1–2 mutations. Nevertheless, the number of aa mutations in several regions of NS5A was not significantly different between HCV-1a, HCV-3a and HCV-3b genotypes obtained from responders and the treatment failure group. In addition to determination of the total number of aa mutations in several regions of NS5A, we had also analysed whether any specific aa residues at particular positions in the NS5A were associated with response or treatment failure. For HCV-1b, we found a significant difference in aa mutation at positions 78 and 305 between responders and the treatment failure group with a P-value of 0.028 at both positions. At positions 78 and 305, most of the treatment failure group had arginine (60.0%) as opposed to only 6.3% in responders (Table 4). The difference was also observed at position 64 of HCV-1a and at position 52 of HCV-6f (P = 0.033 and 0.045, respectively). The NS5A of most viruses obtained from treatment failure cases had alanine at position 64 (75%) and valine at position 52 (60%) while those from responders contained alanine at position 64 in 9.1%, of cases and no responders had valine at position 52. The data suggested that specific aa substitutions observed in the NS5A proteins of HCV-1a, 1b and 6f might be associated with the responsiveness of the virus to the treatment. However, this association was not observed in HCV-3a and 3b genotypes. Analysis of full-length amino acid sequences of core protein of HCV in pretreatment sera Similar to the analysis of the NS5A protein, full-length aa sequences of core protein of HCV from responders and the treatment failure group were also analysed in comparison with corresponding reference sequences of genotypes 1a, 1b, 3a, 3b and 6f. It was found that the core protein of the circulating HCV genotypes was relatively highly conserved compared to the reference strains. Only a small number of mutations were observed over the entire sequence of core; 0–2 residues for HCV-1a, 1–8 for 1b, 0–5 for 3a and 0–3 for 6f, except for HCV-3b in which 12–15 aa mutations were observed. In addition, the number of mutations in the core protein of the viruses from responders were not significantly different from those obtained from the treatment failure group, with the exception of HCV-6f where the mean number of mutations in the core protein was significantly higher in the viruses obtained from responders compared to the treatment failure group (P = 0.023). Furthermore, it should be noted that there was no specific aa substitution in the core protein of HCV-1a, 1b, 3a, 3b and 6f that seemed to be associated with responders or the treatment failure groups.  2010 Blackwell Publishing Ltd Core and NS5A of HCV genotypes 1, 3, 6 and Peg-IFN plus RBV DISCUSSION The basis for response or nonresponse of chronic HCV infection to IFN-a and RBV therapy has been documented to be associated with various factors, host and viral factors, including HCV genotype [2,20,21]. It is well established that HCV genotype 1 is more resistant to IFN treatment than genotypes 2 and 3 [3,4,22]. HCV genotype 1 is predominant worldwide and has become a target for study of IFN-resistance. However, very few data are available for other HCV genotypes. The present study investigated the correlation between mutations in the core and NS5A genes of various HCV genotypes, including 1a, 1b, 3a, 3b and 6f, with different clinical outcomes in Thai patients treated with PegIFN-a and RBV. According to EnomotoÕs studies [8,9], a high number of aa mutations in the ISDR of HCV-1b correlated with the response to IFN monotherapy. Most recently, additional studies conducted in Japan [23] and Taiwan [24] have provided more data to support this notion. However, contradictory data have been reported from European and United States investigators [25–27]. The discrepancy may be explained, at least in part, by host and viral factors. It is well documented that host factors, particularly the race of subjects is also an important factor contributing to HCV treatment responsiveness. Comparative studies of the efficacy of Peg-IFN and RBV treatment in African-Americans (AA) vs Caucasian-Americans (CA) demonstrated that AA with HCV-1 infection showed SVR rate significantly lower (19–28%) than CA (39–52%) [28,29]. Regarding viral factors, the HCV strains of the same genotype circulating in different geographical areas may differ in a fine-tuned genetic background. In fact, it has been demonstrated by meta-analysis of ISDR sequences that the prevalence of wild-, intermediateand mutant types of ISDR sequences of HCV-1b differ significantly between the viruses isolated from 655 Japanese patients (44.1%, 37.6% and 18.3%) and those from 525 European patients (24.8%, 63.4% and 11.8%), respectively [30]. The present study also revealed that the number of aa mutations within the ISDR of HCV-1b obtained from Thai patients was significantly correlated with the response to Peg-IFN-a and RBV combination therapy (P = 0.046) (Table 3). Our results are in good agreement with those reported from Japan, which investigated HCV-1b infected Japanese patients [8–12]. The agreement of our data with those of Japanese investigators, in contrast to those from Europe and the United States, might be explained by the viruses circulating in Thailand having greater genetic similarity to those from Japan than those circulating in Europe and the United States. The lower frequency of detection of ISDR mutant types in Europe may lead to a negative correlation between ISDR mutations and IFN response as observed in virus strains circulating in Europe [12]. It is interesting to point out that the percentage of ISDR mutant types detected in our study in Thai patients was 27.3% and in Japanese patients 18.3%, which are significantly higher  2010 Blackwell Publishing Ltd e123 than the 11.8% in the European strains [30]. Additionally, the ethnicity of the patients, Asian vs Caucasian, may also play a role in the observed discrepancy of the response to IFN and RBV treatment between the viruses obtained from patients in Japan and Thailand vs those from Europe and the United States. Accordingly, mutations in the ISDR might be more relevant in predicting response to IFN therapy in Thai patients and patients in other Asian countries. One mechanism that has been proposed to explain the resistance to IFN of HCV genotype 1b is the interaction of the NS5A protein with antiviral protein PKR which results in blocking PKR activity [5,6]. Regarding the ISDR, multiple mutations in the ISDR may result in a conformational change in NS5A protein structure and thereby impairing the interaction between NS5A and PKR. This would allow the PKR to play a role in inhibiting viral protein synthesis and virus replication and finally leading to SVR. By the same token, more mutations in other regions within the NS5A protein may affect the structure and/or biological functions of NS5A in inhibiting IFN activity. As in the case of genotype 3, it has been reported that the NS5A protein does not repress PKR function [31]. The data are in line with our study that there was no correlation between mutations in the NS5A protein of HCV3 and clinical outcome. Furthermore, several studies demonstrated that aa substitution in the core and NS5A regions are associated with responsiveness to IFN therapy. It has been proposed that patients infected with HCV-1b who had aa mutations in NS5A at positions 2209, 2216 and 2227 more frequently achieve SVR than those without mutations at these positions [11]. In addition, mutations at positions 70 and/or 91 of the core protein have also been suggested to be correlated with responsiveness to IFN and RBV combination therapy [17,18,23,32]. In the present study, the association of aa substitution at specific positions in the core and NS5A proteins with response to Peg-IFN-a and RBV treatment have also been investigated. We did not find a difference between the viruses obtained from responders (patients who achieved SVR) and those from the treatment failure group at aa positions described previously. Nevertheless, we found that aa substitution at positions 78 (K2050R) and 305 (K2277R) within the NS5A protein of HCV-1b, and positions 52 (I2023V) and 64 (T2056A) of HCV-6f and 1a, were significantly correlated with treatment failure (P = 0.028, 0.028, 0.033 and 0.045, respectively). The NS5A is a membrane-associated protein and is an active component of the HCV replicase with a pivotal role as a regulator of HCV replication. The protein consists of three domains and contains an unconventional zinc binding motif within the N-terminal domain. Mutations disrupting either the membrane anchor or the zinc binding domain of NS5A are lethal for RNA replication [33,34]. In our study, we found mutations in the N-terminus of NS5A at aa residues 52, 64 and 78, which are located in the zinc binding domain (aa 39–80). It is likely that these mutations may affect the function of NS5A, particularly, zinc coordination which in e124 K. Kumthip et al. turn may reduce the overall replication fitness of the HCV strains. However, the precise mechanistic effect of these amino acid substitutions on protein function remains to be elucidated. The higher number of mutations in the core region of HCV6f was also highly associated with responsiveness to Peg-IFN-a and RBV treatment. Similar to NS5A, the HCV core protein has been reported to inhibit the antiviral activity of IFN through interaction with cellular protein, STAT1, which is the protein involving in the Jak-STAT signalling cascade [7]. The higher number of mutations that occurred in the core region may affect the inhibitory function of the protein on the IFN signalling pathway. However, we could not find specific mutation(s) that may be responsible for IFN-responsiveness. In conclusion, the present study revealed that mutations of amino acids found in the NS5A protein of HCV-1a, 1b and 6f are significantly correlated with responsiveness to PegIFN-a and RBV combination therapy in Thai patients. The data provide a better understanding of the correlation between mutations in the core and NS5A proteins of various HCV genotypes and responsiveness to IFN and RBV combination therapy. ACKNOWLEDGEMENTS This study was jointly supported by the Royal Golden Jubilee (RGJ) PhD Program under the Thailand Research Fund (TRF), the National Research Council of Thailand (NRCT), the Faculty of Medicine and the Graduate School of Chiang Mai University, Chiang Mai, Thailand. REFERENCES 1 Weigand K, Stremmel W, Encke J. Treatment of hepatitis C virus infection. World J Gastroenterol 2007; 13: 1897–1905. 2 Pawlotsky JM. Mechanisms of antiviral treatment efficacy and failure in chronic hepatitis C. Antiviral Res 2003; 59: 1–11. 3 Hadziyannis SJ, Sette H Jr, Morgan TR et al. Peginterferonalpha2a and ribavirin combination therapy in chronic hepatitis C: a randomized study of treatment duration and ribavirin dose. Ann Intern Med 2004; 140: 346–355. 4 Zeuzem S, Hultcrantz R, Bourliere M et al. Peginterferon alfa-2b plus ribavirin for treatment of chronic hepatitis C in previously untreated patients infected with HCV genotypes 2 or 3. J Hepatol 2004; 40: 993–999. 5 Gale MJ, Korth MJ, Tang NM et al. Evidence that hepatitis C virus resistance to interferon is mediated through repression of the PKR protein kinase by the nonstructural 5A protein. Virology 1997; 30: 217–227. 6 Gale MJ, Korth MJ, Katze MG. Repression of the PKR protein kinase by the hepatitis C virus NS5A protein: a potential mechanism of interferon resistance. Clin Diagn Virol 1998; 10: 157–162. 7 Lin W, Kim SS, Yeung E et al. Hepatitis C virus core protein blocks interferon signaling by interaction with the STAT1 SH2 domain. J Virol 2006; 80: 9226–9235. 8 Enomoto N, Sakuma I, Asahina Y et al. Comparison of fulllength sequences of interferon-sensitive and resistant hepatitis C virus 1b: sensitivity to interferon is conferred by amino acid substitutions in the NS5A region. J Clin Invest 1995; 96: 224–230. 9 Enomoto N, Sakuma I, Asahina Y et al. Mutations in the nonstructural protein 5A gene and response to interferon in patients with chronic hepatitis C virus 1b infection. N Engl J Med 1996; 334: 77–81. 10 Chayama K, Tsubota A, Kobayashi M et al. Pretreatment virus load and multiple amino acid substitutions in the interferon sensitivity-determining region predict the outcome of interferon treatment in patients with chronic genotype 1b hepatitis C virus infection. Hepatology 1997; 5: 745–749. 11 Watanabe H, Enomoto N, Nagayama K et al. Number and position of mutations in the interferon (IFN) sensitivitydetermining region of the gene for nonstructural protein 5A correlate with IFN efficacy in hepatitis C virus genotype 1b infection. J Infect Dis 2001; 183: 1195– 1203. 12 Murayama M, Katano Y, Nakano I et al. A mutation in the interferon sensitivity-determining region is associated with responsiveness to interferon-ribavirin combination therapy in chronic hepatitis patients infected with a Japan-specific subtype of hepatitis C virus genotype 1B. J Med Virol 2007; 79: 35–40. 13 Nousbaum J, Polyak SJ, Ray SC et al. Prospective characterization of full-length hepatitis C virus NS5A quasispecies during induction and combination antiviral therapy. J Virol 2000; 74: 9028–9038. 14 Veillon P, Payan C, Gaudy C, Goudeau A, Lunel F. Mutation analysis of ISDR and V3 domains of hepatitis C virus NS5A region before interferon therapy with or without ribavirin. Pathol Biol 2004; 52: 505–510. 15 El-Shamy A, Sasayama M, Nagano-Fujii M et al. Prediction of efficient virological response to pegylated interferon/ ribavirin combination therapy by NS5A sequences of hepatitis C virus and anti-NS5A antibodies in pre-treatment sera. Microbiol Immunol 2007; 51: 471–482. 16 El-Shamy A, Nagano-Fujii M, Sasase N, Imoto S, Kim SR, Hotta H. Sequence variation in hepatitis C virus nonstructural protein 5A predicts clinical outcome of pegylated interferon/ribavirin combination therapy. Hepatology 2008; 48: 38–47. 17 Akuta N, Suzuki F, Sezaki H et al. Association of amino acid substitution pattern in core protein of hepatitis C virus genotype 1b high viral load and non-virological response to interferon-ribavirin combination therapy. Intervirology 2005; 48: 372–380. 18 Akuta N, Suzuki F, Sezaki H et al. Predictive factors of virological non-response to interferon-ribavirin combination therapy for patients infected with hepatitis C virus of genotype 1b and high viral load. J Med Virol 2006; 78: 83–90. 19 Theamboonlers A, Chinchai T, Bedi K, Jantarasamee P, Sripontong M, Poovorawan Y. Molecular characterization of hepatitis C virus (HCV) core region in HCV- infected Thai blood donors. Acta Virol 2002; 46: 169–173.  2010 Blackwell Publishing Ltd Core and NS5A of HCV genotypes 1, 3, 6 and Peg-IFN plus RBV 20 Hofmann WP, Zeuzem S, Sarrazin C. Hepatitis C virusrelated resistance mechanisms to interferon alpha-based antiviral therapy. J Clin Virol 2005; 32: 86–91. 21 Chung RT, Tai AW. Treatment failure in hepatitis C: mechanisms of non-response. J Hepatol 2009; 50: 412– 420. 22 Mangia A, Santoro R, Minerva N et al. Peginterferon alfa-2b and ribavirin for 12 vs 24 weeks in HCV genotype 2 or 3. N Engl J Med 2005; 352: 2609–2617. 23 Hayashi K, Katano Y, Ishigami M et al. Mutations in the core and NS5A region of hepatitis C virus genotype 1b and correlation with response to pegylated interferon- alpha 2b and ribavirin combination therapy. J Viral Hepat 2010; doi: 10.1111/j.1365-2893.2010.01305.x. 24 Chen TM, Huang PT, Wen CF, Tung JN, Chow KC, Chen YP. Reappraisal of the importance of mutations in the NS5APKR-binding domain of hepatitis C-1b virus in the era of optimally individualized therapy. J Viral Hepat 2010; doi: 10.1111/j.1365-2893.2010.01287.x. 25 Zeuzem S, Lee JH, Roth WK. Mutations in the nonstructural 5A gene of European hepatitis C virus isolates and response to interferon alfa. Hepatology 1997; 25: 740– 744. 26 Duverlie G, Khorsi H, Castelain S et al. Sequence analysis of the NS5A protein of European hepatitis C virus 1b isolates and relation to interferon sensitivity. J Gen Virol 1998; 79: 1373–1381. 27 Chung RT, Monto A, Dienstag JL, Kaplan LM. Mutations in the NS5A region do not predict interferon-responsiveness in  2010 Blackwell Publishing Ltd View publication stats 28 29 30 31 32 33 34 e125 American patients infected with genotype 1b hepatitis C virus. J Med Virol 1999; 58: 353–358. Conjeevaram HS, Fried MW, Jeffers LJ et al. Peginterferon and ribavirin treatment in African American and Caucasian American patients with hepatitis C genotype 1. Gastroenterology 2006; 131: 470–477. Howell CD, Dowling TC, Paul M et al. Peginterferon pharmacokinetics in African American and Caucasian American patients with hepatitis C virus genotype 1 infection. Clin Gastroenterol Hepatol 2008; 6: 575–583. Pascu M, Martus P, Höhne M et al. Sustained virological response in hepatitis C virus type 1b infected patients is predicted by the number of mutations within the NS5AISDR: a meta-analysis focused on geographical differences. Gut 2004; 53: 1345–1351. Castelain S, Khorsi H, Roussel J et al. Variability of the nonstructural 5A protein of hepatitis C virus type 3a isolates and relation to interferon sensitivity. J Infect Dis 2002; 185: 573–583. Okanoue T, Itoh Y, Hashimoto H et al. Predictive values of amino acid sequences of the core and NS5A regions in antiviral therapy for hepatitis C: a Japanese multi-center study. J Gastroenterol 2009; 44: 952–963. Tellinghuisen TL, Marcotrigiano J, Gorbalenya AE, Rice CM. The NS5A protein of hepatitis C virus is a zinc metalloprotein. J Biol Chem 2004; 279: 48576–48587. Moradpour D, Brass V, Penin F. Function follows form: the structure of the N-terminal domain of HCV NS5A. Hepatology 2005; 42: 732–735.