Fu

Bot.etBull.
al. —Acad.
Patatin
Sin.promoter-like
(2001) 42: 231-241
sequence in Forever Young genes 231

Potato and tomato Forever Young genes contain class-I patatin

promoter-like sequences
Hongyong Fu1,*, Ji Du2,4, Junqi Song3, Jiming Jiang3, and William D. Park2,*
1
Institute of Botany, Academia Sinica, 128, Sec 2, Academy Rd., Nankang, Taipei, Taiwan 11529, Republic of China
2
Department of Biochemistry and Biophysics, Texas A & M University, College Station, Texas 77843, USA
3
Department of Horticulture, University of Wisconsin, Madison, Wisconsin 53706, USA
(Received December 21, 2000; Accepted July 3, 2001)

Abstract. Class-I patatin genes from potato, encoding the major storage protein in tubers, contain promoter repeat
sequences, which are critical for developmental and metabolic regulation. Previously, RFLP mapping indicated the
patatin genes of potato and tomato reside in orthologous loci near the end of the long arm of chromosome VIII.
Interestingly, a DNA sequence homologous to the promoter of the potato class-I patatin gene was mapped to the
middle of chromosome III in the tomato and potato genomes [Ganal et al., Mol. Gen. Genet. 225, 501-509 (1991)].
We isolated and characterized genomic clones containing the class-I Patatin Promoter-Like sequences (PPL) from
tomato, S. bulbocastanum, and S. tuberosum. Sequence analyses reveal that these PPL sequences are highly conserved,
as compared to the repeat sequence of the patatin promoter, particularly with respect to the critical regulatory cis-
elements. These PPL sequences are located upstream of the translational initiation site of Forever Young genes,
which encode proteins belonging to a large family of oxidoreductases with conserved structural motifs. The Forever
Young genes from tomato and S. bulbocastanum both contain eight exons and seven introns. Six of the introns are
uniquely large, in the range of 418~2,092 bp. Sequence conservation suggests that the class-I patatin repeat and the
PPL from Forever Young genes may have a direct phylogenetic relationship and may regulate expression of their
respective genes through common cis- and trans-factors.

Keywords: Forever Young; Oxidoreductase; Patatin; Potato; Promoter evolution; Tomato.

Introduction (Paiva et al., 1983). Besides being regulated

developmentally, the class-I genes are also regulated by
Patatin is a family of glycoproteins that have lipid acyl metabolic signal(s) derived from sucrose (Paiva et al., 1983;
hydrolase and transferase activities (Andrews et al., 1988) Rocha-Sosa et al., 1989; Wenzler et al., 1989; Jefferson et
and account for up to 40% of the total soluble protein in al., 1990). In contrast, patatins detected in roots and an-
potato tubers (Paiva et al., 1983). In potato, the patatins ther epidermal cells are primarily derived from class-II
are encoded by a gene family with ~10-15 members per genes (Pikaard et al., 1987; Mignery et al., 1988). Unlike
haploid genome. These genes can be divided in about class-I genes, class-II genes are not sucrose-inducible
equal numbers into two classes, class-I and class-II, based (Köster-Töpfer et al., 1989; Liu et al., 1991).
on the presence or absence of a 22-bp insertion in the 5´ Cis- and trans-factors responsible for developmental
UTR. Whereas these two classes of genes have con- and metabolic regulation of the class-I patatin genes from
served coding regions, the 5´ flanking sequences are potato have been examined extensively. An imperfect re-
highly diverged (Pikaard et al., 1987; Mignery et al., 1988). peat in the 5´ region of the class-I patatin promoter con-
The class-I genes encode the majority of tuber patatins tains separable cis-acting elements that are critical for
and have an essentially tuber-specific expression pattern “tuber-specific” and sucrose-inducible regulation. The
sequence can be divided into two sub-regions (box A and
box B), which are positioned from -552 to -514 and -626 to
4
Current address: Emory University, Atlanta, GA 30322, USA. -592, respectively, for the distal repeat (in referring to the
5
The amino acid and nucleotide sequence data reported for S. transcription start site as +1; Mignery et al., 1988). Mo-
bulbocastanum FEY, S. tuberosum FEY, Tomato FEY, and tifs within these repeat sequences were found to interact
Arabidopsis FEY3, will appear in the GenBank, EMBL and
with nuclear factors (Jefferson et al., 1990; Liu et al., 1990;
DDBJ databases under the accession numbers AF216836,
AF250031, AF216835 and AF217275, respectively. Grierson et al., 1994).
*Corresponding authors. H. Fu, Tel: 886-2-27823050 ext 422, Genetic and physical mapping analyses indicated the
Fax: 886-2-27827954, E-mail: hongyong@gate.sinica.edu.tw; patatin genes show syntenic chromosomal organization in
W.D. Park, Tel: 979-845-8868, Fax: 979-862-4471, E-mail: potato and tomato genomes and were mapped as a single
wdpark@tamu.edu cluster of loci near the end of the long arm of chromo-
232 Botanical Bulletin of Academia Sinica, Vol. 42, 2001

some VIII (Ganal et al., 1991). In these loci, patatin genes downstream sequences that flank the patatin-like region
exist at ~10-15 and ~3 copies in potato and tomato, for the isolated tomato clones. For upstream sequence
respectively. Whereas the chromosome VIII patatin loci amplification, the primer pair of the oligonucleotides, tn2
in tomato contain only class-II genes, the orthologous po- and a lEMBL3 vector-specific primer of either lL or lR,
tato loci have further evolved additional class-I genes. was used. For downstream sequence amplification, tn1
Interestingly, a DNA sequence homologous to the class- and either lL or lR was used. The 4.1-kb overlapping ge-
I patatin promoter was mapped to the middle of chromo- nomic fragment from T05, which was used to append the
some III in both the potato and tomato genomes. As final contiguous 11,472 bp sequence, was amplified by
tuber-bearing potato species, including the cultivated PCR using the primer pair, tn15 and lL, and the high fidel-
potato, are generally believed to have evolved recently ity pfuTurbo TM DNA polymerase (Stratagene). The se-
(Hawkes, 1990), an interesting possibility arises that the quences from 5´ to 3´ for the oligonucleotides tn1, tn2,
PPL sequence was recruited from chromosome III during tn15, lR and lL are GTTACTGGTTCTACCAGCG
the evolution of class-I patatin genes located in chromo- GTATCGG, CCGATACCGCTGGTAGAACCAGTAAC,
some VIII in potato. CACATGTAAACCATTCCATATG, CAGCGCACATGG
To examine this hypothesis, we isolated and character- TACAGCAAG, and CATGGTGTCCGACTTATGCCC,
ized genomic clones containing the class-I patatin pro- respectively.
moter-like sequence from tomato, a tuber-bearing wild
potato species Solanum bulbocastanum, and Solanum Isolation of PPL-Containing Genomic Clones
tuberosum. Sequences are highly conserved for these from Potato
PPL-containing genomic clones, except for two relatively The potato BAC library was constructed as described
diverged regions, including one located immediately up- by Song et al. (2000) using genomic DNA isolated from a
stream of the PPL sequence. This indicates these genomic diploid (2n=2x=24) potato species Solanum
clones are indeed from orthologous loci. The patatin pro- bulbocastanum (clone PT29, provided by Dr. J. P.
moter-like sequence contains regions that are highly con- Helgeson at the University of Wisconsin-Madison). The
served compared to the critical regulatory sequences of library consists of 23,808 clones with an average insert
potato class-I patatin genes. Interestingly, the PPL is lo- size of 155 kb in length and is equivalent to approximately
cated immediately upstream of a gene encoding Forever 3.7 haploid potato genomes. Screening of the library was
Young oxidoreductase (FEY). Our results support the hy- performed at reduced stringency (final washing at 65°C in
pothesis that the patatin repeat-like sequences in FEY 2 × SSC) using an ~8.0 kb DNA fragment as a probe, which
genes have a direct phylogenetic relationship with the was amplified by PCR from the tomato genomic clone T17
class-I patatin regulatory elements and that closely related using oligonucleotide primers tn1 and lL (Figure 1A).
cis- and trans-factors participate in regulating the expres- Four positive clones, 2J8, 2O9, 4M6, and 31A14 were ob-
sion of both FEY genes and class-I patatin genes. tained from screening the complete BAC library. The PPL-
containing genomic fragment from a cultivated potato
Materials and Methods species Solanum tuberosum (cultivar Russet Burbank) was
isolated by PCR using high fidelity pfuTurboTM DNA poly-
Construction and Screening of the Tomato l- merase and oligonucleotide primer pairs, which have se-
EMBL3 Genomic Library quences perfectly matched with the genomic sequences
of both tomato and S. bulbocastanum. The 5´ primer P5´
The tomato genomic library was constructed using the
is located 3,731 and 3,006-bp, respectively, upstream of the
l-EMBL3 vector (Stratagene, La Jolla, CA). Genomic DNA
initiation codon for FEY from S. bulbocastanum and
was isolated from young tomato leaves (cv. VFN-8) accord-
tomato, and the 3´ primer P3´ is located 84-bp downstream
ing to the method described by Rogers and Bendich (1988).
of the FEY start codon (Figure 1B). The sequences for
DNA was partially digested with Sau3AI and was size-frac-
the oligonucleotides P5´ and P3´ are: ggAAGCTTACC
tionated by centrifugation on a sucrose gradient
TTGGATGTGAATGTGAAAATATACC and GACCgg
(Sambrook et al., 1989). Ligation of fractionated DNA (~15
ATccAACCATCCTCGTAACCATTCCATCCATCC,
kb in length) into the BamHI site of the l vector and pack-
respectively.
aging were performed according to the manufacturer’s in-
structions (Stratagene). Escherichia coli CES200 was used
as the host for the recombinant l-EMBL3. Screening was DNA Sequence Analysis
performed as described by Sambrook et al. (1989) at re- The 11,472 bp tomato sequence was determined and
duced stringency (final washing at 60°C in 1 × SSC [0.1 M appended from a 10,832 bp sequence from T17 and an im-
NaCl, 0.015 M sodium citrate]) by using a DNA fragment mediate downstream 640 bp sequence derived from T05.
isolated from the class-I patatin promoter as a probe. The The upstream 10,832-bp sequence corresponds to a
probe fragment is from -685 to -90 relative to the transcrip- HindIII to PstI region in T17 (Figure 1A). To determine
tional start site of the patatin genomic clone pPS20 the 10,832-bp upstream sequence, overlapping restricted
(Mignery et al., 1988). Polymerase chain reactions using fragments from the T17 l-clone were subcloned into
the Vent polymerase (New England Biolabs, Beverly, MA) pBluescript (Stratagene). To determine the immediate
were performed to determine the sizes of upstream and downstream 640 bp sequence, a ~4.1 kb fragment overlap-
Fu et al. — Patatin promoter-like sequence in Forever Young genes 233

Figure 1. Genomic clones from tomato and potato containing patatin promoter-like sequences. (A) The restriction map of a tomato
genomic fragment containing patatin promoter-like sequence. Three characterized overlapping l genomic clones are shown above
the map. The mapped fragment was derived from clone T17 and T05. The locations for the analyzed restriction enzymes were not
determined downstream of the most 3´ XbaI site. Sizes in kilobase of regions flanking the PPL sequences for three genomic clones
were determined by PCR and are indicated by double arrow lines. Positions and orientations of the primer oligonucleotides used are
indicated by named bent arrows. The rectangular hatched box shown below the map is the location of the probe used previously for
RFLP mapping (Ganal et al., 1991). ND, size is not determined. (B) The restriction map of a genomic fragment from S. bulbocastanum
containing patatin promoter-like sequence. The fragment is appended from a ~23 kb PstI fragment and an overlapping 2.0 kb XbaI
fragment isolated from a BAC genomic clone. The schematic graph of black boxes and lines below the map represents a PPL-
containing genomic fragment isolated by PCR from Solanum tuberosum (lines indicate deletion as compared to S. bulbocastanum).
Arrows designate position and orientation of oligonucleotide primers used in the amplification reaction, and the names of the prim-
ers are indicated. The solid black and gray boxes indicate regions that have or have not been sequenced, respectively. The regions
that are highly homologous to the patatin regulatory sequence are indicated as open boxes. B, BamHI; E, EcoRI; H, HindIII; P, PstI;
S, SalI; Ss, SstI; X, XbaI.

ping with T17 was obtained from T05 by PCR using tn15 from 5´ to 3´ for the oligonucleotides AtFEY5´ and AtFEY3´
and lL as primers as well as the high fidelity pfuTurboTM are AG[cAtATG]AGTGACGAAACGACGTCATCTCC and
polymerase (Stratagene) and subcloned into pBluescript. TT[Gagctc]CTATTCGTGTTGTGCTCCATACCGGCATTG,
A 1,612 bp sequence, which had an overlapped 972 bp re- respectively. Lower case-letters are mutated bases for en-
gion identical to T17, was determined for the ~4.1 kb frag- gineering restriction sites to facilitate subsequent cloning.
ment from T05. To determine the 12,755-bp potato Bases in brackets are the engineered NdeI and SacI site,
sequence, the overlapping restricted fragments from the respectively.
BAC clone 31A14 were cloned into pBluescript. The 2,646-
bp PPL-containing genomic fragment from S. tuberosum Results
was cloned into pGEM-T vector (Promega, Madison, WI).
Sequences of both strands for each of the subcloned frag- Isolation of Tomato Genomic Clones Containing
ments were determined by primer walking using the
a Patatin Promoter-Like Sequence
dideoxy chain termination method and an automated DNA
sequencer (ABI 373, Applied Biosystems, Foster City, CA) We first screened for PPL-containing genomic clones
according to the manufacturer’s instruction. Sequence as- from a tomato l-EMBL3 library (1.0 × 106 plaque-forming
sembly and analyses were performed using programs from units). Nine tomato genomic clones (including T01, T03-
the University of Wisconsin Genetics Computer Group 05, T07-08, T15-17) were isolated using a DNA probe de-
(UW-GCG) software package (Deveraux et al., 1984). rived from the promoter of a potato class-I patatin gene
(pPS20; Mignery et al., 1988). The DNA probe contained
Isolation of Arabidopsis Forever Young cDNA both distal and proximal repeat sequences, critical for de-
velopmental and metabolic regulation of the patatin genes
The Arabidopsis Forever Young cDNA was isolated (Jefferson et al., 1990; Liu et al., 1990; Grierson et al., 1994).
from a flower cDNA library (Lansberg erecta; ABRC stock Results from restriction and sequencing analyses indicated
number CD4-6) by PCR using the primers, AtFEY5´ and that the isolated clones are overlapping and likely come
AtFEY3´ as well as the high fidelity pfuTurbo TM poly- from the same genetic locus (Figure 1A and data not
merase (Stratagene). The sequence for the Arabidopsis shown). To select tomato clones for sequence analysis,
cDNA was determined by primer walking. The sequences PCR reactions were performed to determine the lengths of
234 Botanical Bulletin of Academia Sinica, Vol. 42, 2001

sequences flanking the PPL sequence. Results for three fragment was subsequently isolated by PCR from S.
genomic clones are shown in Figure 1A. The T17 clone tuberosum, and its sequence was determined (Figure 1B).
has large 5´ and 3´ flanking regions, relative to the patatin
promoter-like region, of 10 kb and 8 kb in length, PPLs are Highly Homologous to the Class-I
respectively. In contrast, the T01 contains only ~2.5 kb Patatin Regulatory Sequences
3´ flanking sequence, and the T05 contains only ~2.5 kb
The isolated genomic clones from tomato, S.
5´ flanking sequence. To determine the patatin promoter-
bulbocastanum and S. tuberosum contain sequence re-
like sequence and to identify a possible adjacent gene, a
gions of 250-, 234-, and 247-bp, respectively, which are
contiguous 11,472 bp sequence was determined from T17
highly homologous to a 160-bp region (the distal repeat)
and T05. In this sequence, the 5´ 10,832-bp and the 3´
in the potato class-I patatin promoter (Figure 2A). Rela-
640-bp were derived from T17 and T05, respectively.
tive to the first base of the patatin translation initiation
codon, the conserved region in class-I promoters is located
Isolation of Potato Genomic Clones Containing between position -642 and -483. This region contains two
the Patatin Promoter-Like Sequence short sequences (box B and A, underlined in Figure 2A),
We isolated orthologous genomic clones from a diploid which also exist as an imperfect repeat (proximal repeat)
wild potato species, Solanum bulbocastanum, by screen- between -269 and -195 (Bevan et al., 1986; Mignery et al.,
ing a BAC genomic library using an 8 kb DNA probe de- 1988). The two repeat sequences in the class-I patatin pro-
rived from tomato T17 l-clone. Four positive clones were moter were shown previously to be critical for develop-
obtained from screening a total of 23,808 clones with an mental and metabolic regulation (Jefferson et al., 1990; Liu
average insert size of 155 kb, which are equivalent to ap- et al., 1990; Grierson et al., 1994). As described by Grierson
proximately 3.7 haploid potato genomes (Song et al., 2000). et al. (1994), these repeats contain sequences that bind to
One of the clones, 31A14, was further examined by DNA nuclear factors (BBBF and BABF for Box B Binding Fac-
blot analysis to identify a ~23 kb PstI fragment that cross- tor and Box A Binding Factor, respectively), and contain
hybridized with the T17 probe. As shown in Figure 1B, critical sequences for responding to sucrose induction
the restriction map for the BAC clone 31A14 was partially (SURF for Sucrose Responsive Factor) (Figure 2A).
determined, which includes the 23-kb PstI fragment and a The PPL sequences have been divided into six sub-re-
downstream overlapping 2.0-kb XbaI fragment. To deter- gions (I to VI), with regions III and V representing se-
mine the patatin promoter-like sequence and to identify a quences not found in the 160-bp region of the class-I
possible adjacent gene, the sequence of a 12,755-bp re- patatin promoter sequence. The sequence identity of PPL
gion was determined for the assembled PstI-XbaI fragment and the patatin promoter averages 93% when gaps are ex-
of 31A14 (Figure 1B). A 2,646 bp PPL-containing genomic cluded for calculation and is 61% with gap residues in-

Figure 2. Comparison between patatin and the patatin promoter-like sequences. (A) Alignment of the class-I patatin 5´ region and
patatin promoter-like sequences. The aligned sequences are sub-divided into six regions indicated as I through VI. The coordinates
are referred to the translational initiation codons for either patatin or an adjacent gene containing the patatin promoter-like sequences
(see below). The repeat boxes B and A are indicated by a double-line and a thick line, respectively (Bevan et al., 1986). Sequences
involved in nuclear factor binding are indicated by brackets with arrows. Letters in reverse type are identical bases. BBBF, Box B
Binding Factor; BABF, Box A Binding Factor; SURF, Sucrose Responsive Factor. Patatin_D and Patatin_P indicate the distal and
proximal repeat sequences of the class-I patatin promoter, respectively. S. tub., Solanum tuberosum; S. bul., Solanum bulbocastanum.
(B) A phylogram showing the sequence similarity among the patatin and patatin promoter-like sequences. The phylogram was
generated by the UW-GCG computer programs Paupsearch and Paupdisplay, using the bootstrap analysis option. Sequence simi-
larities between distal and proximal patatin repeats, among PPL sequences, are indicated to the right. Sequence similarity of the
distal and proximal patatin repeat as compared to the PPL sequences are indicated to the left. Values indicate percent nucleotide
identity when gap residues are excluded or included (in parentheses) for calculation.
Fu et al. — Patatin promoter-like sequence in Forever Young genes 235

cluded (Figure 2). Cis-elements for BBBF and SURF bind-

ing are highly conserved in the patatin promoter-like se-
quences although sequences for BABF binding are
interrupted by insertion of region III (Figure 2A). An in-
sertion of 11-bp or a deletion of 7-bp was also found in
the distal SURF binding site for the PPL sequences from
tomato and S. tuberosum, respectively. In addition to the
homology of the patatin repeat sequence (box B and box
A), adjacent sequences are also highly conserved as com-
pared to the 160-bp patatin sequence (5´ part of region I,
regions II and VI).
As shown in Figure 2B, phylogenetic analysis revealed
that the patatin promoter-like sequences from tomato, S.
bulbocastanum and S. tuberosum are more similar to one
another than to either the 160-bp distal or the 75-bp proxi-
mal repeat from the potato class-I patatin promoter. The
Figure 3. Sequence comparison of genomic sequences contain-
patatin promoter-like sequences average 94.1% identity ing the patatin promoter-like sequence from S. bulbocastanum
when gap residues are excluded from calculation and 83.5 and tomato. Sequence similarity of corresponding genomic re-
% identity when gap residues are included. In contrast, gions containing the patatin promoter-like sequence from S.
when compared to the distal 160-bp patatin repeat, the bulbocastanum and tomato were analyzed by a dot-plot matrix
patatin promoter-like sequences average only 61.0% iden- using window and stringency of 21 and 18 residues, respectively.
tity when gap residues are calculated and 93.1% identity The 12,755 bp sequence of S. bulbocastanum (from HindIII to
when gap residues are excluded. Also, comparisons with XbaI) was compared to a corresponding 11,228 bp region (also
the proximal 75-bp patatin repeat show the patatin pro- from HindIII to XbaI) from the tomato sequence.
moter-like sequences average only 39.2% identity when
gap residues are calculated and 90.8% when excluded.
included. The two sequences have co-linear sequence
Sequence Comparison of PPL-Containing Loci similarity except for two large deletions (364-bp and 785-
from Tomato, S. bulbocastanum, and S. tuberosum bp) that exist upstream of the PPL in the S. tuberosum
genomic fragment. When compared to the tomato PPL-
Sequence similarity of the genomic regions containing
containing genomic clone, the genomic fragment from S.
the patatin promoter-like sequence from the S.
tuberosum is 87.8% identical when the gap residues are
bulbocastanum and tomato was analyzed by the dot-plot
excluded for calculation and is 65.1% identical when gap
method. The 12,755-bp sequence, which is from HindIII
residues are included. The region of least similarity be-
to XbaI (Figure 1B), from S. bulbocastanum was compared
tween the tomato and S. tuberosum genomic sequences
to a corresponding region from the tomato genomic clone.
is also immediately upstream of the PPL.
As shown in Figure 3, the two sequences are highly
similar. When gap residues are not included in the High sequence similarity indicates that the PPL-contain-
calculation, the two sequences are 91.3% identical. Only ing genomic clones from tomato, S. bulbocastanum, and
two regions show no sequence similarity. Interestingly, S. tuberosum are indeed from orthologous loci. In
the 5´ dissimilar region is located immediately upstream of agreement, the PPL sequence was confirmed to be located
the patatin promoter-like sequence. The 3´ dissimilar re- in chromosome III by fluorescent in situ hybridization (data
gion is primarily due to a ~700-bp insertion existing in the not shown) as predicted by previous RFLP mapping in
potato sequence. This insertion contains a 132-bp se- both tomato and potato (Ganal et al., 1991).
quence that is highly homologous to tomato SINE trans-
posable elements (SINE1-3) located in a gene encoding The Patatin Promoter-Like Sequences Reside Next
farnesyl-protein transferase b subunit (Rebatchouk and to the Forever Young Coding Sequence
Narita, 1997). The 132-bp sequence is flanked by 15-bp The patatin promoter-like sequences from tomato, S.
direct repeats, which likely represent the duplicated tar- bulbocastanum, and S. tuberosum, may regulate expres-
get site. The insertion in the S. bulbocastanum sequence sion of an adjacent gene. To identify the adjacent gene,
is located in the sixth intron of an adjacent gene (see the genomic sequences from potato and tomato were
below). searched against the databases. The search identified
The 2,646-bp PPL-containing genomic fragment from S. closely related cDNA and genomic sequences from rice,
tuberosum is also highly homologous to the genomic Medicago truncatula, and Arabidopsis, which encode an
clones from both tomato and S. bulbocastanum. Com- oxidoreductase gene, designated as Forever Young, FEY
pared to the PPL-containing genomic clone of S. (Callos et al., 1994; Wilson and Cooper, 1994). The FEY
bulbocastanum, the genomic fragment from S. tuberosum cDNAs from rice and Medicago were truncated at the 5´
is 93.1% identical when the gap residues are excluded for end. Furthermore, the sequence of the only likely full-
calculation and is 60.9% identical when gap residues are length FEY cDNA from Arabidopsis (designated here as
236 Botanical Bulletin of Academia Sinica, Vol. 42, 2001

Figure 5. Exon and intron organization of FEY genes from S.

bulbocastanum, tomato, and Arabidopsis. Exons and introns
of Forever Young genes from S. bulbocastanum, tomato and
Arabidopsis are drawn schematically to scale. Black boxes and
lines indicate exons and introns, respectively. Numbers above
or below corresponding exons and introns indicate lengths in
bp. For the first and last exons, the lengths shown contain only
the coding regions. The bar above the potato FEY indicates the
position of the 132-bp SINE element.

AtFEY1; Callos et al., 1994) has a number of mismatched

residues with two Arabidopsis Forever Young genomic
sequences, designated here as AtFEY2 (Callos et al., 1994)
and AtFEY3 (accession number, AL035602) from the same
species. The primary concern is a single base pair
deletion, which exists only in the Arabidopsis FEY1 cDNA
but not in AtFEY2, AtFEY3 or any of the other character-
ized FEY genes from other species including rice,
Medicago, tomato, S. bulbocastanum and S. tuberosum.
A single base pair deletion was also found near the stop
codon in AtFEY2. To clarify this, we isolated an appar-
ently full-length Arabidopsis FEY3 cDNA from a flower
cDNA library (Figure 4). The sequence of the Arabidopsis
FEY3 cDNA is identical to the overlapped exons (exon 1
to 4) of the FEY3 genomic sequence. The designated
translational initiation codon for the AtFEY3 cDNA is very
likely to be correct because it is the nearest ATG immedi-
ately upstream of the conserved sequence in Arabidopsis
FEY3 cDNA as compared to all other FEY sequences. In
addition, an in frame stop codon was found immediately
upstream of the putative start codon.
The junctions of all exons and introns for the potato
and tomato FEY genes were easily identified, by compar-
ing their sequences to that of the Arabidopsis AtFEY3
cDNA (Figure 5). Except for the last intron (intron 7), ab-
sent in Arabidopsis FEY2, the presence and location of
Figure 4. Nuceotide and deduced amino acid sequence of an all introns are completely conserved in FEY genes from
Arabidopsis Forever Young cDNA, AtFEY3. The Arabidopsis tomato and S. bulbocastanum. Both sizes and sequences
FEY3 cDNA was isolated from a cDNA library by PCR using of the corresponding introns from S. bulbocastanum and
a high fidelity polymerase. Mismatched residues as compared tomato FEY genes are highly conserved. The only excep-
to AtFEY1, AtFEY2 (Callos et al., 1994), or both are indicated tion is the sixth intron of S. bulbocastanum, in which a
by solid arrows, open arrows, and open arrow heads, ~0.7 kb insertion including a SINE element was found. The
respectively. The substituted bases or deletion (H) in AtFEY1 patatin promoter-like sequence is located 23-bp upstream
and AtFEY2 are indicated. The truncated positions of 5´ end of the translational initiation codon of the FEY genes from
for the rice and Medicago FEY cDNAs are indicated by arrows.
Brackets with arrows indicate the wrong annotated start codons
both tomato and S. bulbocastanum. Similarly, PPL in S.
for the Arabidopsis FEY1 and FEY2 and for the Medicago FEY tuberosum also appears to reside 23-bp upstream of the
cDNA. The solid triangles indicate intron positions determined Forever Young gene. The PPL-containing genomic frag-
by comparison with a FEY genomic sequence (Callos et al., ment isolated from S. tuberosum contains most of the first
1994). exon of FEY gene and was found by PCR to have the rest
Fu et al. — Patatin promoter-like sequence in Forever Young genes 237

Table 1. Homology of the derived amino acid sequences of FEY genes from various speciesa.
Tomato Arabidopsis Rice Medicago
S. bulbocastanum 98.4 (99.0) 74.5 (80.4) 72.1 (79.9) 79.8 (86.3)
Tomato 74.5 (80.4) 73.0 (80.5) 80.1 (86.6)
Arabidopsis 67.8 (76.2) 72.0 (81.3)
Rice 74.8 (82.6)
a
Percent amino acid sequence identity or similarity (in parenthesis) was determined by UW-GCG Bestfit program.

of the FEY gene attached immediately downstream (data

not shown).
High sequence conservation among the FEY genes from
various species indicates these genes are likely homologs.
As shown in Table 1, the FEY genes from tomato and S.
bulbocastanum are 98.4% and 99.0% identical and similar
in amino acid sequence, respectively. Also, the FEY genes
from S. bulbocastanum and tomato are on average 75.7%
and 82.4% identical and similar, respectively, when com-
pared to the FEY genes from Arabidopsis, rice, and
Medicago. In addition, FEY genes from Arabidopsis,
Medicago and rice have an average of 71.5% and 80.0%
sequence identity and similarity.

FEYs Belong to a Superfamily of Oxidoreductase

Genes
A large set of sequences was identified from database
searches for the derived amino acid sequences of FEY
genes from both S. bulbocastanum and tomato. These
sequences include protochlorophyllide oxidoreductases,
alcohol dehydrogenases, ribitol dehydrogenases, and
ketoreductases from various prokaryote and eukaryote
species. Many of these sequences are derived from vari-
ous genome projects. As shown in Figure 6, phylogenetic
analyses place these sequences into distinct groups.
Alignment analyses of a representative member from each
branch identified six conserved structural motifs as shown
in Figure 7. Five of these motifs are conserved with mo-
tifs of a known protein fingerprint designated as GDHRDH
(for glucose/ribitol dehydrogenase; Yamada and Saier,
1987).

Figure 6. A phylogram showing the amino acid sequence relationships for a family of related oxidoreductases. A collection of
related peptide sequences were identified from databases and analyzed by Paupsearch and Paupdisplay programs (UW-GCG). Ab-
breviations for species: Atha, Arabidopsis thaliana; Bnap, Brassica napus; Cele, Caenorhabditis elegans; Csat, Cucumis sativas;
Hsap, Homo sapiens; Hvul, Hordeum vulgare; Lesc, Lycopersicon esculentum; Mlep, Mycobacterium tuberculosis; Mmus, Mus
musculus; Mpal, Marchantia paleacea; Mtru, Medicago truncatula; Mtub, Mycobacterium tuberculosis; Osat, Oryza sativa; Pbor,
Plectonema boryanum; Psat, Pisum sativum; Ptae, Pinus taeda; Sant, Streptomyces antibioticus; Scoe, Streptomyces coelicolor; Sliv,
Streptomyces lividans; Speu, Streptomyces peucetius; Spom, Schizosaccharomyces pombe; Stre, Streptomyces; Sbul, Solanum
bulbocastanum; Syne, Synechocystis; Taes, Triticum aestivum. Accession numbers for the analyzed sequences: Atha F17A8.100,
CAB38642; Atha FEY, AF217275; Atha POR1-1, P21218; Atha POR1-2, AAC49043; Atha POR2, AAB97702; Atha RID1, AAC23625;
Atha RID2, AAB63619; Atha RID3, CAA20464; Bnap RID1, S42651; Cele C01G8.3, AAB37640; Cele C15H11, CAB02732; Cele
DC2; AAD14726; Cele E04F6, AAA68362; Cele K10H10.3, CAB05779; Cele K10H10.6, CAB05784; Csat POR, S20941; Hsap
CGI-82, AAD34077; Hvul POR, P13653; Lesc FEY, AF216835; Mlep, RVMLCB1450.07, CAA16249; Mmus UBE-1b, BAA82657;
Mpal POR, BAA31693; Mtru FEY, L22766; Mtub RV0068, CAA16249; Mtub RV0303, CAB09592; Mtub RV0439c, CAA17396;
Mtub RV2263, CAA17300; Osat FEY, AF093628; Osat RID2, BAA83360; Pbor POR, BAA25993; Psat POR, S20941; Ptae POR,
S30169; Sant Q03326, Q03326; Scoe SCJ9A.14, CAB53275; Scoe SCJ9A.19c, CAB53280; Sliv S19842, S19842; Speu dnrU,
AAD04717; Spom SPCC736.13, CAA19277; Stre sp. C5 U43704.1, AAB08016; Sbul FEY, AF216836; Syne sp. PCC6803 POR,
BAA10580; Taes POR, S39394.
238 Botanical Bulletin of Academia Sinica, Vol. 42, 2001

Figure 7. Alignment of amino acid sequences of a family of related oxidoreduactases. The amino acid sequences of FEY gene from
S. bulbocastanum (Sbul FEY) are aligned with sequences of a representative member from each branch of the family of the oxi-
doreductase genes (Figure 6). The six conserved regions identified are underlined and indicated as motifs I through VI. The first five
regions contain subsequences, which correspond to the first five elements of a previously identified protein fingerprint named
GDHRDH (Yamada and Saier, 1987) specified by double lines. The right border of motif II includes a highly conserved NNAGI
sequence. The Tyrosine residue in YXXXK of motif IV is important for subunit binding. Motif I contains critical residues, which
may be involved in binding to the cofactor NADPH (Armstrong et al., 1995). Species abbreviation and accession numbers for the
aligned sequences are the same as in Figure 6.
Fu et al. — Patatin promoter-like sequence in Forever Young genes 239

Discussion sequence for the class-I patatin repeat may have been de-
rived from this locus. Interestingly, the sequence imme-
The class-I patatin genes produce approximately 40% diately upstream of the patatin promoter-like sequence is
of the total protein in potato tubers, but are not normally actually one of the two most diverged regions between
expressed in other tissues. Since most close relatives of the potato and tomato FEY genes. Furthermore, the sec-
potatoes, such as tomato and pepper, do not have tubers, ond most diverged region in FEY genes contains a SINE
the evolution of the “tuber-specific” class-I patatin genes transposable element (Figure 3 and 5).
represents a very interesting biological question. A high The patatin promoter-like sequences in tomato, S.
degree of synteny has previously been shown between bulbocastanum, and S. tuberosum are located immediate
the chromosomes of potato and tomato and that all of the upstream of sequences highly homologous to genes en-
patatin coding sequences in both species map to a single coding Forever Young oxidoreductase from Arabidopsis,
region near the end of chromosome VIII (Ganal et al., 1991). rice, and Medicago truncatula (Callos et al., 1994; Wil-
This same region also contains class-II patatin promoter son and Cooper, 1994). High-level sequence similarity
sequences in both tomato and potato. However, the lo- strongly indicates the tomato and S. bulbocastanum se-
cation for the sequence homologous to the class-I pro- quences encode FEY homologs and may be able to carry
moter differs. In potato, sequences homologous to class-I out a similar reduction reaction on unknown but specific
patatin promoters mapped to the end of chromosome VIII substrate(s) in vivo. In Arabidopsis, interruption of FEY
at the same locus as patatin structural genes, as expected. gene by a T-DNA insertion caused defects in development
However, sequences homologous to class-I patatin pro- of shoot apical meristem (Callos et al., 1994). The in vivo
moter (PPL) also mapped near the middle of chromosome substrate(s) of Forever Young reductase thus may play
III to a locus that lacked patatin structural genes. In an important function in shoot meristem development. The
tomato, sequences homologous to the class-I patatin pro- related sequences and the conserved structural motifs
moter were found only at the corresponding locus on chro- identified (Figure 6 and 7) are likely to provide clues for
mosome III. An interesting possibility is that PPL future identification of the in vivo substrates for the For-
sequences on chromosome III involved in the regulation ever Young reductase.
of other genes were duplicated and recruited during the
Many of the sequence elements in the class-I patatin
evolution of the class-I patatin genes in potato. To exam-
promoter, which are critical for binding to nuclear factors
ine this, we have isolated and characterized genomic clones
and for developmental and metabolic responses (Grierson
containing patatin promoter-like sequences from tomato,
et al., 1994), are conserved in the patatin promoter-like se-
S. bulbocastanum, and S. tuberosum. Fluorescent in situ
quence of the FEY genes from tomato, S. bulbocastanum,
hybridization (data not shown) confirmed the chromosome
and S. tuberosum. These include the two sub-repeat
III location of the PPL sequences in potato. We found
sequences, box A and box B, in class-I patatin promoter
that the PPL sequences are highly conserved with the criti-
and the adjacent sequences (regions I, II, IV, and VI; Fig-
cal regulatory sequences of the class-I patatin genes from
ure 2A), which contain many cis-elements with binding
potato. The PPL sequences reside upstream of Forever
activities for nuclear factors. However, unique insertion
Young genes, which share high sequence similarity to a
sequences exist in the patatin promoter-like sequences
large set of sequences encoding oxidoreductases, includ-
(region III and V). The identification of conserved cis-el-
ing protochlorophyllide oxidoreductase (e.g., Armstrong
ements in the PPL sequences from FEY genes suggests
et al., 1995). Sequence conservation suggests the class-I
that these conserved sequences may mediate expression
patatin promoter and the PPL sequence have a direct phy-
of the FEY genes through closely related transcription fac-
logenetic relationship. In addition, the PPL may regulate
tors like the class-I patatin genes. However, a few regions
expression of Forever Young through common cis- and
in the PPL sequence, corresponding to cis-elements of
trans-factors with the class-I patatin genes.
class-I patatin promoter, are interrupted by insertion or
Since it is generally believed that the evolution of tu- deletion. The expected combinatorial action of these se-
ber-bearing potato species is a relatively recent event quences and associated trans-factors may ultimately yield
(Hawkes, 1990), the tuber-specific and sucrose-inducible a different expression pattern for the FEY genes as com-
class-I patatin genes are also likely to have evolved pared to the class-I patatin genes in potato.
recently. Recruitment of the critical repeat sequences,
The class-I patatin promoter-like sequences in FEY
which exist in 1-3 copies in characterized class-I patatin
genes from tomato, S. bulbocastanum, and S. tuberosum
genes, is likely an important step during the evolution of
are located 23-bp immediately upstream of the translational
the tuber-specific patatin genes. Phylogenetic analyses
initiation codon and very likely reside in the 5´ UTR
show that the PPL sequences located in FEY genes from
regions. Alternatively, the sequence may reside in a leader
tomato, S. bulbocastanum, and S. tuberosum are more simi-
intron located in the 5´ UTR. Important regulatory se-
lar to one another than to the critical repeat sequences in
quences located in regions other than 5´ flanking regions
class-I patatin genes from potato. This indicates a dupli-
such as exons, introns, or 3´ flanking regions are not with-
cation event of the ancestor sequence for PPL, and the
out precedents (e.g., Larkin et al., 1993; Fu et al., 1995a,b;
class-I patatin repeat likely occurred before the separation
Dickey et al., 1998). To address the actual functions of
of potato and tomato. The PPL locus may actually be the
the PPL sequences, we have initiated cis-element shuf-
direct descendant of the ancestral sequence. A duplicated
240 Botanical Bulletin of Academia Sinica, Vol. 42, 2001

fling experiments between class-I patatin repeat sequences Hawkes, J.G. 1990. The Potato: Evolution, Biodiversity, and
and the Forever Young PPL sequences using promoter- Genetics Resources. Smithsonian Institution Press,
reporter gene fusion and transgenic approaches. Washington, D.C.
Jefferson, R., A. Goldsbrough, and M. Bevan. 1990. Transcrip-
Acknowledgements. This work was supported by funds from tional regulation of a patatin-I gene in potato. Plant Mol.
the National Science and Technology Program for Agricultural Biol. 14: 995-1006.
Biotechnology from Academia Sinica and the National Science Köster-Töpfer M., W.B. Frommer, M. Rocha-Sosa, S. Rosahl,
Council (8905A02), from a U. S. Department of Agriculture J. Schell, and L. Willmitzer. 1989. A class II patatin pro-
Competitive Grant No. 92-37301-7788, and from a Heritage moter is under developmental control in both transgenic
Prize to H.F from the Li Foundation, CA, USA. We thank potato and tobacco plants. Mol. Gen. Genet. 219: 390-396.
Mingchu Lee, Clarissa Hew, Yenfen Lee, and Yun-Chi Tang for Larkin, J.C., D.G. Oppenheimer, S. Pollock, and M.D. Marks.
technical support and Dr. Charles M. Papa for his critical read- 1993. Arabidopsis GLABROUS1 gene requires downstream
ing of this manuscript. sequences for function. Plant Cell 5: 1739-1748.
Liu, X.J., S. Prat, L. Willmitzer, and W.B. Frommer. 1990. Cis
regulatory elements directing tuber-specific and sucrose-in-
Literature Cited ducible expression of a chimeric class I patatin promoter/
Andrews, D.L., B. Beames, M.D. Summers, and W.D. Park. GUS-gene fusion. Mol. Gen. Genet. 223: 401-406.
1988. Characterization of the lipid acyl hydrolase activity Liu, X.-J., M. Rocha-Sosa, S. Hummel, L. Willmitzer, and W.
of the major potato (Solanum tuberosum) tuber protein, B. Frommer. 1991. A detail study of the regulation and evo-
patatin, by cloning and abundant expression in a lution of the two classes of patatin genes in Solanum
baculovirus vector. Biochem. J. 252: 199-206. tuberosum L. Plant Mol. Biol. 17: 1139-1154.
Armstrong, G.A., S. Runge, G. Frick, U. Sperling, and K. Apel. Mignery, G.A., C.S. Pikaard, and W.D. Park. 1988. Molecular
1995. Identification of NADPH:protochlorophyllide oxi- characterization of the patatin multigene family of potato.
doreductase A and B: A branched pathway for light-de- Gene 62: 27-44.
pendent chlorophyll biosynthesis in Arabidopsis thaliana. Paiva, E.P., R.M. Lister, and W.D. Park. 1983. Induction and
Plant Physiol. 108: 1505-1517. accumulation of the major potato tuber protein, patatin.
Bevan, M.W., R. Barker, A. Goldsbrough, M. Jarvis, T. Plant Physiol. 71: 161-168.
Kavanagh, and G. Iturriaga. 1986. The structure and tran- Pikaard, C.S., J.S. Brusca, D.J. Hannapel, and W.D. Park. 1987.
scription start site of a major potato tuber protein gene. The two classes of genes for the major tuber protein,
Nucl. Acids. Res. 14: 4625-4638. patatin, are differentially expressed in tubers and roots.
Callos, J.D., M. DiRado, B. Xu, F.J. Behringer, B.M. Link, and Nucleic Acids Res. 15: 1979-1994.
J.I. Medford. 1994. The forever young gene encodes an oxi- Rebatchouk, D. and J.O. Narita. 1997. Foldback transposable
doreductase required for proper development of the elements in plants. Plant Mol. Biol. 34: 831-835.
Arabidopsis vegetative shoot apex. Plant J. 6: 835-847. Rocha-Sosa, M., U. Sonnewald, W. Frommer, M. Stratmann, J.
Deveraux, J., P. Haberberli, and O. Smithies. 1984. A compre- Schell, and L. Willmitzer. 1989. Both developmental and
hensive set of sequence analysis programs for the VAX. metabolic signals activate the promoter of a class I patatin
Nucleic Acids Res. 12: 387-395. gene. EMBL J. 8: 23-29.
Dickey, L.F., M.E. Petracek, T.T. Nguyen, E.R. Hansen, and Rogers, S. and A.J. Bendich. 1988. Extraction of DNA from plant
W.F. Thompson. 1998. Light regulation of Fed-1 mRNA tissues. In S.B. Gelvin, D.P.S. Verma and R.A. Schilperoort
requires an element in the 5´ untranslated region and corre- (eds.), Plant Molecular Biology Manual, Kluwer Academic
lates with differential polyribosome association. Plant Cell Publishers, Dordrecht, pp. A6:1-10.
10: 475-484. Sambrook, J., E.F. Fritsch, and T. Maniatis. 1989. Molecular
Fu, H., S. Kim, and W.D. Park. 1995a. High-level tuber expres- Cloning: A Laboratory Manual 2nd edn. Cold Spring Har-
sion and sucrose inducibility of a potato Sus4 sucrose syn- bor Laboratory Press, Cold Spring Harbor.
thase gene require 5´ and 3´ flanking sequences and the leader Song, J., F. Dong, and J. Jiang. 2000. Construction of a bacte-
intron. Plant Cell 7: 1387-1394. rial artificial chromosome library for potato molecular cy-
Fu, H., S. Kim, and W.D. Park. 1995b. A potato Sus3 sucrose togenetics research. Genome 43: 199-204.
synthase gene contains a context-dependent 3´ element and Wenzler, H.C., G.A. Mignery, L.M. Fisher, and W.D. Park.
a leader intron with both positive and negative tissue-spe- 1989. Analysis of a chimeric class I patatin-GUS gene in
cific effects. Plant Cell 7: 1395-1403. transgenic potato plants: high level expression in tubers and
Ganal, M., M.W. Bonierbale, M.S. Roeder, W.D. Park, and S. sucrose-inducible expression in cultured leaf and stem
D. Tanksley. 1991. Genetic and physical mapping of the explants. Plant Mol. Biol. 12: 41-50.
patatin genes in potato and tomato. Mol. Gen. Genet. 225: Wilson, R.C. and J.B. Cooper. 1994. A nodulin cDNA with ho-
501-509. mology to protochlorophyllide reductase. Plant Physiol.
Grierson, C., J.-S. Du, M.T. Zabala, K. Beggs, C. Smith, M. 104: 289-290.
Holdsworth, and M. Bevan. 1994. Separate cis sequences Yamada, M. and M.H. Saier. 1987. Glucitol-specific enzymes
and trans factors direct metabolic and developmental regu- of the phosphotransferase system in E. coli- Nucleotide se-
lation of a potato tuber storage protein gene. Plant J. 5: quence of the GUT operon. J. Biol. Chem. 262: 5455-5463.
815-826.
Fu et al. — Patatin promoter-like sequence in Forever Young genes 241

Forever Young class-I patatin

William D. Park

Department of Biochemistry and Biophysics, Texas A & M University

Department of Horticulture, University of Wisconsin
Current address: Emory University, Atlanta

patatin class-I
cis-elements RFLP patatin

patatin Ganal et al., Mol. Gen. Genet. 225, 501-509 (1991)

S. tuberosum S. bulbocastanum class-I patatin
PPL class-I Patatin Promoter-Like sequences PPL
patatin cis-elements PPL Forever Young
S. bulbocastanum Forever Young
exons introns introns 418~2,092 bp
class-I patatin Forever Young PPL
cis- trans-

Forever Young patatin