FEMS Microbiology Letters 244 (2005) 305–313

www.fems-microbiology.org

Whole-genome analysis of Leptospira interrogans to identify

potential vaccine candidates against leptospirosis
Marcia Gamberini a,1, Ricardo M. Gómez a,1,2, Marina V. Atzingen a,b,1,
Elizabeth A.L. Martins a, Silvio A. Vasconcellos c, Eliete C. Romero d,
Luciana C.C. Leite a, Paulo L. Ho a,e, Ana L.T.O. Nascimento a,b,*
a
Centro de Biotecnologia, Instituto Butantan, SãoPaulo, SP 05503-900, Brazil
b
Doutorado Interunidades em Biotecnologia, Instituto de Ciências Biomédicas, Universidade de SãoPaulo, SP, Brazil

Downloaded from http://femsle.oxfordjournals.org/ by guest on June 25, 2016

c
Faculdade de Medicina Veterinária e Zootecnia da Universidade de SãoPaulo, Brazil
d
Divisãode Biologia Médica, Instituto Adolfo Lutz, SãoPaulo, Brazil
e
Instituto de Biociências and Instituto de Quı́mica, Universidade de SãoPaulo, SP, Brazil

Received 11 January 2005; received in revised form 31 January 2005; accepted 2 February 2005

First published online 16 February 2005

Edited by M.Y. Galperin

Abstract

Leptospirosis is an important global human and veterinary health problem. Humans can be infected by exposure to chronically
infected animals and their environment. An important focus of the current leptospiral research is the identification of outer mem-
brane proteins (OMPs). Due to their location, leptospiral OMPs are likely to be relevant in host–pathogen interactions, hence their
potential ability to stimulate heterologous immunity. The existing whole-genome sequence of Leptospira interrogans serovar Copen-
hageni offers a unique opportunity to search for cell surface proteins. Predicted genes encoding potential surface proteins were
amplified from genomic DNA by PCR methodology and cloned into an Escherichia coli expression system. The partially purified
recombinant proteins were probed by Western blotting with sera from human patients diagnosed with leptospirosis. Sixteen pro-
teins, out of a hundred tested, were recognized by antibodies present in human sera. Four of these proteins were conserved among
eight serovars of L. interrogans and absent in the non-pathogenic Leptospira biflexa. These proteins might be useful for the diagnosis
of the disease as well as potential vaccine candidates.

2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Leptospira interrogans; Surface protein; Cloning and expression; Vaccine; Leptospirosis

1. Introduction

Leptospirosis, an emerging infectious disease, is a

worldwide zoonosis of human and veterinary concern.
*
Corresponding author. Tel.: +5511 37220019; fax: +5511 37261505. Caused by spirochaetes of the genus Leptospira, the dis-
E-mail address: tabet@butantan.gov.br (A.L.T.O. Nascimento). ease presents greater incidence in tropical and subtropi-
1
These authors contributed equally to this work.
2
Present address: Instituto de Bioquı́mica y Biologı́a Molecular,
cal regions [1,2]. The transmission of leptospirosis has
Facultad de Ciencias Exactas, Universidad Nacional de La Plata, been associated with exposure of individuals in close
Argentina. proximity to wild or farm animals [3]. Recently the

0378-1097/$22.00
2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.femsle.2005.02.004
306 M. Gamberini et al. / FEMS Microbiology Letters 244 (2005) 305–313

disease became prevalent in cities with sanitation prob- 2. Materials and methods
lems and large population of urban rodent reservoirs,
which contaminate the environment through their urine 2.1. Bacteria
[4]. The incidence of leptospirosis remains underesti-
mated in part due to the broad spectrum of signs and L. interrogans serovar Copenhageni sequenced strain
symptoms that patients may present. Children primarily (Fiocruz L1-130) was provided by Dr. A.I. Ko
show fever, vomiting, headache, diarrhea, abdominal (CPqGM/FIOCRUZ/MS). The strain was isolated as
and generalized muscle pain, whereas adults have fever, described [12]. L. interrogans serovars Canicola, Ict-
headache, anorexia, muscle pain and constipation [4,5]. erohaemorrhagiae, Copenhageni, Bratislava, Hardjo,
Five percent to 15% of the cases evolve more severely Autumnalis, Pomona, Pyrogenes, Grippotyphosa and
presenting hemorrhages with renal and hepatic failure, Leptospira biflexa serovar Patoc were maintained in
a condition known as WeilÕs syndrome [4], with a mor- one of our laboratories (S.A.V., Faculdade de Medicina
tality rate of 5–40%. Leptospirosis has also a great eco- Veterinária, Universidade de São Paulo, SP, Brazil).
nomic impact in the agricultural industry since the
disease affects the livestock inducing abortions, still- 2.2. In silico identification of surface proteins
births, infertility, reduced milk production and death
[3,4]. Protein coding genes from the L. interrogans genome

Downloaded from http://femsle.oxfordjournals.org/ by guest on June 25, 2016

Currently available veterinarian vaccines are based sequence were identified using GeneMark and Glimmer
on inactivated whole cell or membrane preparations [14]. The PSORT program [15] (http://psort.nibb.ac.jp/)
of pathogenic leptospires. These types of vaccine con- was then used to predict the localization of the coded
fer protective responses through induction of antibod- proteins within the bacterium. Public and custom se-
ies against leptospiral lipopolysaccharide [6]. However, quence-specific search algorithms were used for identifi-
these vaccines fail to induce long-term protection cation of sequence motifs including signal peptides,
against infection and do not provide cross-protective lipoprotein cleavages sites and transmembrane domains
immunity against leptospiral serovars not included in (http://www.cbs.dtu.dk/services/TMHMM) [16] and
the vaccine preparation. There is a large number of (http://www.cbs.dtu.dk/services/SignalP) [17]. In addi-
pathogenic serovars (>200) which imposes a major tion, putative proteins, homologous to surface proteins
limitation to the production of a multi-serovar compo- previously characterized as virulence factors in other
nent vaccine and to the development of immunization organisms, were searched for by blast analysis (http://
protocols based on whole cell or membrane prepara- www.ncbi.nlm.nih.gov/BLAST/) [18]. In this work, the
tions. In humans, a prototype vaccine has been tested predicted coding sequences are referred to according
in China but children under 14 years were not pro- to their genome nomenclature, LIC [12].
tected [7]. A vaccine licensed for human is still long
awaited [4]. 2.3. Cloning, expression and purification
The advent of whole-genome sequencing has made
an impressive impact in the microbial field landscape. Cloning techniques were performed according to
The complete genomic sequence of Neisseria meningit- Sambrook et al. [19]. For the expression of the selected
idis serogroup B offered a new strategy for the identi- predicted coding sequences the Gateway (Invitrogen)
fication of vaccine candidates [8]. This landmark cloning and expression system was used. Each selected
approach, now called reverse vaccinology, has been DNA sequence was amplified by PCR from Leptospira
applied in the last few years revolutionizing the vac- genomic DNA using Pfx DNA polymerase (Invitrogen)
cine research area [9,10]. The design of vaccines is and primers specially designed following the manufac-
based on bioinformatic tools for the prediction of po- turer recommendations. In this system, the PCR prod-
tential antigens in silico, hence narrowing down the ucts are first cloned into pENTR TOPO vector
universe to be tested. In addition, this approach has (Invitrogen). The correct orientation is obtained by add-
the advantage of revealing proteins independently of ing four bases to the forward primer (CACC) which an-
their abundance and without the need of growing neals to a complementary overhang in the cloning vector
the microorganism in vitro [11]. (GTGG). In Table 1, there is a list of primers for PCR
In the present study, we describe 16 new leptospiral amplification of 17 coding sequences which became of
membrane-associated proteins selected from the genome special interest in this report. When necessary, DNA
of L. interrogans serovar Copenhageni [12,13]. The bands were extracted from agarose gel using Concert
rationale for the choice of these predicted coding se- purification system (Gibco BRL) following the manu-
quences is that surface-associated molecules are poten- factureÕs protocol. The sequence of the cloned leptospira
tial targets for inducing immune responses in animals DNA insert was confirmed by sequencing and trans-
and may serve as vaccines against disease and/or for ferred by recombination reaction by LR Clonase (Invit-
use in diagnostic tests. rogen) to the Escherichia coli expression vector
 M. Gamberini et al. / FEMS Microbiology Letters 244 (2005) 305–313 307

Table 1
Sequence of the primers employed for DNA amplification and molecular mass of native and expressed recombinant proteins
Gene id genome nomenclature* Primers for PCR amplification Molecular mass (kDa)
Native Recombinant
LIC10054 F: CACCACGTCTTGTGCGTCGGTAGAG 35.6 35.1
R: CCAAGTATTCTATTTATACGTCCGAG
LIC10091 F: CCATGGGACTCGAGACGCCTCCTCCTAAAGATCC 40.6 39.0
R: CTCCATGGTCATTTCAAAACTTCTACGGGGC
LIC10508 F: ACCATGGGATCCGCTCTTTTGGTTGATCCAGAG 23.0 18.5
R: GAATTCCTAACAACCAGGACCTTCACAT
LIC11947 F: CACCCCTTCGAGGTTGGAAATCG 20.1 22.8
R: AATCGATGGATCACGTTACG
LIC10561 F: CACCAAGAAGGATTCCAACGATGATG 33.1 32.0
R: TCTCCTGCTTGACAGCCGAC
LIC10765 F: CACCGAAAGTCCCGTAAGGTTCAAA 16.6 15.4
R: TGCAGGAGTTCCCACATTTTA
LIC11271 F: CACCAATCGACTTTTCACTGAGTTTCTT 30.9 29.2
R: CGAAAGTATCAAGAAGAACCGTA
LIC11574 F: CACCATCATTCCTTCGGGAAGTGAC 21.2 20.6
R: CCATTCTCTGTTGTTTGATCCC

Downloaded from http://femsle.oxfordjournals.org/ by guest on June 25, 2016

LIC12518 F: CACCCCGTGTTCTTTTGGTTTAGAT 15.8 15.9
R: TTCCAACAAATCGAATCATCT
LIC13131 F: CACCACGTCTCAAAGTTACGCTTCAG 23.0 21.9
R: TTCTCACCATCCAGCTCGG
LIC10380 F: CACCATGGGCGCTTTTAATCGG 20.9 21.9
R: CGGAACTAGGGAACTTTTCAAC
LIC12099 F: CACCACCAATGTGTTTGGTATAGCG 52.7 53.8
R: CAGCGTTTTGTGATAAAATTAAC
LIC12228 F: CACCAAACCTGGATATGGAATGGC 17.3 18.4
R: TACAGAGGTAGAAGCGTTAGAAG
LIC13306 F: CACCTTTGCACAATCCAAAGAGAAATG 20.1 21.2
R: TCATTTCCGAACCGGATGAC
LIC10191 F: CACCGAGCCTTCAACGCAAGAGCAA 18.7 20.6
R: AACGTAAGACGTTGAGTTGCCACA
LIC13008 F: CACCATGCGTGCTGTCAGTAGAGAAAC 15.3 15.2
R: GTCGACATTGGCAGAATTTACG
LIC11352 F: CACCGGTGCTTTCGGTGGTCTG 29.6 30.2
R: ATTACTTAGTCGCGTCAGAAGC
*
LIC: Leptospira interrogans Copenhageni.

pDEST17. The vector containing the correct DNA se- eluted with 5 vol. of the same buffer but with 1 M imid-
quence was cloned into E. coli BL21(DE3) (Novagen) azole. Eluted fractions were analyzed by SDS-PAGE,
for protein expression as previously described [20]. The through 12–15% (wt/vol) acrylamide concentration
production of recombinant proteins was achieved by according to the expected molecular mass of the
the addition of isopropyl b-D-thiogalactoside (IPTG) proteins.
to the medium. The pDEST17 vector allows the expres-
sion of recombinant proteins with 6 · His-tag at the N- 2.4. Mice antisera against recombinant proteins
terminus. Most of the assays were performed in high
throughput scale with 96 samples each round. The first Groups of 5, 6–8 weeks female BALB/c mice, (Insti-
screening to check the protein expression was done by tute Butantan, São Paulo, SP, Brazil) were immunized
SDS-PAGE with total protein extracts from each clone. subcutaneously with approximately 15 lg of each re-
Proteins from expressing clones were purified from the combinant protein with complete FreundÕs adjuvant.
pellets of the cell extracts, by solubilization in 8 M urea, After 21 days, mice were boosted with the same amount
followed by metal affinity chromatography using QIAfil- of protein in incomplete FreundÕs adjuvant. Twenty-
ter 96 plates Ni–nitrilotriacetic acid resin superflow eight days following the booster the animals were bled
(Qiagen) as described by the manufacturer. In brief, and immune titers were determined by antibody capture
contaminants were washed away with 10 vol. of binding endpoint enzyme-linked immunosorbent assay (ELISA).
buffer, 20 mM Tris, 500 mM NaCl, containing 5 or 20 The control group was inoculated with PBS and
mM imidazole. Recombinant protein samples were adjuvant.
308 M. Gamberini et al. / FEMS Microbiology Letters 244 (2005) 305–313

2.5. Recognition of recombinant proteins by sera from been deposited in the GenBank database under Acces-
leptospirosis patients sion Nos. AE016823 and AE016824. The accession
numbers for public data base for each protein sequence
Cell pellets of induced bacteria as well as purified pro- analyzed in this work are listed in Table 2. The proteins
teins were separated by 12–15% SDS-PAGE and electro can also be accessed by the genome nomenclature for
transferred to nitrocellulose membrane for Western the gene locus, LIC number (Leptospira interrogans
blotting assay. Membranes were blocked with PBS con- Copenhageni).
taining 0.1% Tween 20 (PBS-T) and 5% nonfat dry milk;
after which they were incubated with individual human
serum (microscopic agglutination test – MAT – titre of
25,000, Instituto Adolfo Lutz, Sao Paulo, SP, Brazil) 3. Results
from convalescent patients diagnosed with leptospirosis
at 1:100 dilution. Goat anti-human IgG peroxidase-con- 3.1. Identification of vaccine candidates from the
jugate was used as secondary antibody at 1:1000 dilution leptospiral genome: in silico analysis
in PBS-T. Proteins reacting with the antisera were de-
tected by reaction with DAB and H2O2 or with ECL Our rationale for the selection of the predicted coding
Kit (Amersham). sequences is that surface associated molecules are poten-

Downloaded from http://femsle.oxfordjournals.org/ by guest on June 25, 2016

tial targets for inducing immune responses in the host
2.6. Recognition of proteins from leptospiral extracts by [8–11]. These sequences could be identified in the gen-
sera from mice immunized with recombinant proteins ome database by one or more sequence motifs com-
monly found in known surface proteins from other
Bacterial cultures of several leptospiral serovars were bacteria. A primary screening was performed using the
centrifuged and the cell pellets were resuspended and Psort program [http://psort.nibb.ac.jp/] to identify puta-
washed three times by centrifugation with PBS contain- tive proteins with predicted cellular localization from
ing 5 mM MgCl2. The cell pellets were then resuspended the inner to the outer bacterial membrane. Genes encod-
in PBS containing 10% SDS and a sample from each ing proteins with known cytoplasmic functions were ex-
serovar sample was applied on a 10% SDS-PAGE. Pro- cluded. In addition, we searched for exportation signal
teins were transferred to nitrocellulose membrane and peptides, transmembrane domains, lipoprotein signa-
probed with serum obtained from mice immunized with tures and homologies to known surface proteins [12].
each of the recombinant proteins. The in silico approach resulted in a large number of
genes covering 20% of the total number of predicted
2.7. Nucleotide sequence Accession Numbers proteins in the genome. From these sequences we fo-
cused the selection mainly on hypothetical, unknown
The sequences of the two chromosomes of L interro- proteins, having either signal peptide sequences or lipo-
gans serovar Copenhageni strain Fiocruz L1-130 have box motifs [12].
Table 2
Name, feature and accession number of the proteins reactive to sera of leptospirosis patients
Locus id Protein name* Feature Protein Accession No.
**
LIC10054 MPL36 Lipoprotein, probable AAS68691
LIC10091 LipL40 Lipoprotein, probable** AAS68725
LIC10508 LipL23 Lipoprotein, probable** AAS69129
LIC11947 LipL22 Lipoprotein, probable** AAS70529
LIC10561 OMPL31 Leptospira conserved hypothetical protein** AAS69182
LIC10765 MPL17 Leptospira conserved hypothetical protein AAS69382
LIC11271 OMPL30 Leptospira conserved hypothetical protein AAS69877
LIC11574 OMPL22 Leptospira conserved hypothetical protein AAS70170
LIC12518 OMPL16 Leptospira conserved hypothetical protein AAS71083
LIC13131 MPL21 Leptospira conserved hypothetical protein AAS71676
LIC10380 OMPL21 Conserved hypothetical protein AAS69003
LIC12099 LipL53 Conserved hypothetical protein** AAS70670
LIC12228 OMPL17 Conserved hypothetical protein AAS70800
LIC13306 OMPL20 Conserved hypothetical protein AAS71848
LIC10191 OMPAL21 Membrane protein, peptidoglycan associated (OmpA-like)** AAS68819
LIC13008 OMPL15 Hypothetical protein AAS71558
LIC11352 LipL32 Lipoprotein LipL32 AAS69953
*
MP, Lip and OMP stand for membrane protein, lipoprotein and outer membrane protein, respectively; OMPA stands for OMPA-like domain; L,
refers to Leptospira, while the numbers are related to the molecular mass of the protein.
**
Probable lipoproteins according to criteria described in Nascimento et al. [12] and Haake [22].
 M. Gamberini et al. / FEMS Microbiology Letters 244 (2005) 305–313 309

3.2. Cloning and expression of vaccine candidates 3.3. Screening recombinant proteins for reactivity with
leptospiral antisera
Oligonucleotides for PCR amplifications (Table 1)
were designed from the genome without the signal Purified proteins were screened for reactivity by immu-
peptide sequences, which typically contain 18–28 noblotting with pooled sera from patients diagnosed with
nucleotides, as described in experimental procedures. leptospirosis. The recombinant lipoprotein LipL32 was
From 206 selected coding sequences (see Table 1, sup- used as a positive control since it was shown to be immu-
plementary data), more than 97% were amplified. The nogenic and highly conserved among Leptospira patho-
correct sequences were confirmed by DNA sequencing genic serovars [20,21]. A total of 16 proteins out of a
and 175 genes (84%) were successfully cloned into hundred tested were recognized by sera from leptospiro-
pENTR. The DNA inserts were transferred by recom- sisÕs convalescent patients (Fig. 3). Table 2 summarizes
bination from pENTR to pDEST17 expression vector. features of these sera-reactive recombinant proteins.
This E. coli vector expresses the recombinant proteins
with six histidine residues at the N-terminus which al- 3.4. Features of the proteins recognized by antibodies
lows a rapid purification of the protein by metal che-
lating chromatography. We have expressed and The recombinant proteins listed in Table 2 were rec-
purified 150 recombinant proteins with this system. ognized by human sera from patients diagnosed with

Downloaded from http://femsle.oxfordjournals.org/ by guest on June 25, 2016

A representative set of SDS-PAGE containing cell ex- leptospirosis. They are all predicted to be membrane
tracts from induced E. coli BL21(DE3) cultures proteins with a signal peptide of 20–36 amino acids, as
expressing the recombinant proteins is shown in Fig. indicated by the software described in Bendtsen et al.
1. Based on the results obtained with the immune as- [17]. Seven of these proteins (indicated by ** in Table
says (see below), 16 proteins were found to be of spe- 2) are probably new leptospiral lipoproteins according
cial interest and the data related to them are to the criteria previously described [12,22]. The signal
highlighted along this report. Some of these proteins peptides regions are characterized by a higher propor-
are indicated in Fig. 1. tion of hydrophobic amino acids, a lipoprotein signal
The majority of the recombinant proteins were peptidase and a cysteine to be lipidated [22]. No specific
found to be insoluble in the pellets of bacterial cell ly- function could be attributed to these putative lipopro-
sates, as evaluated by SDS-PAGE (not shown). The teins. LIC10054 encodes a rare lipoprotein domain to
inclusion bodies were isolated, urea-solubilized and which homologs were already found in other microor-
purified by metal affinity. The purified proteins were ganisms according to GeneBank database [http://
grouped according to their molecular mass and ana- www.ncbi.nlm.nih.gov/BLAST/] [18]. Interestingly, the
lyzed by SDS-PAGE. A representative set of these gels protein named OMPL15 (LIC13008) did not match
is shown in Fig. 2, in which numbered lanes refer to any sequence in the available protein databases and
proteins reactive to sera of leptospirosis patients (see should be considered for further studies on protein func-
below). tion. The protein encoded by LIC10191 has been

Fig. 1. Protein expression analysis by SDS-PAGE. Representative gels showing the cell extracts of BL21(DE3) E. coli transformed with different
expression vectors. Proteins are assembled according to their expected molecular mass. Lane numbers refer to sera-reactive proteins: (1) OMPL16, (2)
OMPL15, (3) MPL17, (4) LipL22, (5) OMPL31 and (6) LipL53. M indicates the protein molecular mass marker.
310 M. Gamberini et al. / FEMS Microbiology Letters 244 (2005) 305–313

Downloaded from http://femsle.oxfordjournals.org/ by guest on June 25, 2016

Fig. 2. Purification of recombinant proteins. Representative SDS-PAGE containing samples of purified proteins obtained by high throughput metal
affinity chromatography purification system. Proteins are assembled in the gels according to their expected molecular mass. Lane numbers refer to
sera-reactive proteins: (1) OMPL15, (2) MPL17, (3) OMPL16, (4) OMPL30, (5) MPL21, (6) OMPL21, (7) LipL22, and (8) OMPL22. M indicates the
protein molecular mass marker.

recently characterized from L. interrogans serovar Man- ize the conservation of the selected proteins we em-
ilae, strain UP-MMC, as a novel lipoprotein with an ployed protein extracts from several L. interrogans
OmpA domain [23]. Three proteins out of the 16 were serovars: Canicola, Icterohaemorrhagiae, Copenhageni,
found to be hypothetical proteins conserved among Bratislava, Hardjo, Autumnalis, Pomona, Pyrogenes,
other microorganisms, while five were hypothetical pro- Grippotyphosa and the nonpathogenic strain L. biflexa
teins conserved only among Leptospira species (Table 2), serovar Patoc. Cell extracts were prepared from cultures
according to the currently available databases. of the different serovars and Western blot analysis was
performed with polyclonal sera from mice immunized
3.5. Conservation of antigenic proteins among leptospiral with each recombinant protein. The serological cross-
serovars reactivity showed a high degree of conservation among
four out of 10 proteins tested (Fig. 4). Interestingly,
Protein expression in the most prevalent pathogenic none of these four proteins were present in the non-
serovars of L. interrogans is an important requirement pathogenic L. biflexa strain, suggesting that they may
for leptospiral vaccine candidates. In order to character- be relevant for pathogenesis. Most of the proteins reac-

Fig. 3. Recognition of recombinant proteins by leptospirosis human serum. Proteins blotted into nitrocellulose membranes were probed with serum
(1:100 dilution) from individual covalescent patient diagnosed with leptospirosis (microscopic agglutination test – MAT – titre of 25,000, Instituto
Adolfo Lutz, Sao Paulo, SP, Brazil). Anti-human IgG-peroxidase conjugate was used as the secondary antibody and the bands were developed with
DAB/H2O2. Lanes: 1. LipL32 (30.2); 2. LipL40 (39.0); 3. LipL23 (18.5); 4. OMPL20 (21.2); 5. OMPL15 (15.2); 6. OMPL31 (32.0); 7. OMPL16 (15.9);
8. LipL53 (53.8); 9. MPL21(21.9); 10. MPL17 (15.4); 11. OMPL22 (20.6); 12. OMPL21 (21.9); 13. OMPL30 (29.2); 14. OMPL17 (18.4); 15. LipL22
(22.8); 16. MPL36 (35.1) and 17. OMPAL21 (20.6). Numbers in parenthesis are the molecular mass of the recombinant proteins. M indicates the
protein molecular mass marker.
 M. Gamberini et al. / FEMS Microbiology Letters 244 (2005) 305–313 311

Downloaded from http://femsle.oxfordjournals.org/ by guest on June 25, 2016

Fig. 4. Conservation of proteins among pathogenic leptospires. Whole cell lysates were prepared from representative strains of L. interrogans
serovars. Proteins from the lysates were separated by electrophoresis, transferred into nitrocellulose membranes and probed with mice antisera raised
against the recombinant proteins, as indicated by protein name and LIC number. Serovars in lanes are: 1. Canicola; 2. Icterohaemorrhagiae; 3.
Copenhageni; 4. Bratislava; 5. Hardjo; 6. Autumnalis; 7. Pomona; 8. Pyrogenes; 9. Grippotyphosa; 10. L. biflexa sv Patoc; 11. respective purified
recombinant protein (positive control).

tive with human leptospirosis serum shared roughly infection [4]. Although surface-associated proteins that
comparable expression levels among the different sero- play a role in virulence have not been yet identified, it
vars tested, but LIC10508 and LIC10561 were more is assumed that they may mediate interactions that en-
variable. able entry and dissemination through host tissues. Puta-
tive outer membrane proteins would be accessible to the
immune response during host infection and therefore,
4. Discussion constitute targets for immune protection through mech-
anisms such as antibody-dependent phagocytosis and
Considering that L. interrogans has an AT rich gen- killing mediated by complement. In this regard, a major
ome, with a 35% G + C content, [12], which imposes cer- limitation in the field of leptospirosis has been to iden-
tain difficulties for primer design, it was above tify membrane associated proteins through conventional
expectations to have amplified more than 97% of the biochemical and molecular methods. For instance, be-
206 coding sequences, as well as to have expressed and fore the complete genome sequence of a leptospira was
purified more than 80% of the cloned products. By known, only 10 lipoproteins had been characterized
screening with immune sera from leptospirosis patients through isolation of membrane fractions [24–29]. Using
16 proteins were identified as potential vaccine candi- the genome approach, we have identified 174 novel
dates or to be used in diagnosis. The fact that these pro- putative lipoproteins [12]. In addition, the identified lep-
teins react with infected human sera not only shows tospiral proteins may also have diagnostic applications.
their immune reactive properties, but also strongly sug- At present, rapid and efficient diagnostic tests are not
gests that these proteins are expressed in the course of available for use in human and veterinary leptospirosis
human infection. Interestingly, one of them (OMPL15) [1,2,4]. A proportion of these membrane proteins will
did not match at all any protein sequence in the public be antigens expressed during infection and should be
databases and deserves further studies to characterize recognized by the host immune system. Therefore, they
its origin and function. may serve as the basis to develop antigen-capture detec-
The central mechanism in pathogenesis of leptospiro- tion strategies or recombinant protein-based serologic
sis, as in other spirochetal diseases such as Lyme disease tests.
and syphilis, is the ability of the pathogens to dissemi- Our results corroborate previous studies showing the
nate widely within the host during the early stage of advantages of using whole genome approach [10,11] for
312 M. Gamberini et al. / FEMS Microbiology Letters 244 (2005) 305–313

the identification of novel vaccine antigens at a reason- H.R., Tuomanen, E., Gayle, A., Brewah, Y.A., Walsh, W.,
able cost and time compared with traditional strategies. Barren, P., Lathigra, R., Hanson, M., Langermann, S., Johnson,
S. and Koenig, S. (2001) Use of a whole genome approach to
We believe this work represents an important contri- identify vaccine molecules affording protection against Strepto-
bution to the leptospiral field. The proteins described coccus pneumoniae infection. Infect. Immun. 69, 1593–1598.
herein may certainly be exploited for the establishment [10] Rappuoli, R. (2001) Reverse vaccinology, a genome-based
of a much-needed kit for diagnosis of leptospirosis. Fur- approach to vaccine development. Vaccine 19, 2688–2691.
thermore, these proteins may provide an optimal basis [11] Adu-Bobie, J., Capecchi, B., Serruto, D., Rappuoli, R. and Pizza,
M. (2003) Two years into reverse vaccinology. Vaccine 21, 605–
for the development of a new and effective vaccine that 610.
would help reduce the burden of leptospirosis. [12] Nascimento, A.L.T.O., Ko, A.I., Martins, E.A., Monteiro-Vito-
rello, C.B., Ho, P.L., Haake, D.A., Verjovski-Almeida, S.,
Hartskeerl, R.A., Marques, M.V., Oliveira, M.C., Menck, C.F.,
Leite, L.C., Carrer, H., Coutinho, L.L., Degrave, W.M., Dellag-
Acknowledgements ostin, O.A., El-Dorry, H., Ferro, E.S., Ferro, M.I., Furlan, L.R.,
Gamberini, M., Giglioti, E.A., Goes-Neto, A., Goldman, G.H.,
This work has benefited from Grants from FAPESP, Goldman, M.H., Harakava, R., Jeronimo, S.M., Junqueira-de-
CNPq, PADCT-FINEP and Fundação Butantan. Azevedo, I.L., Kimura, E.T., Kuramae, E.E., Lemos, E.G.,
Lemos, M.V., Marino, C.L., Nunes, L.R., de Oliveira, R.C.,
Pereira, G.G., Reis, M.S., Schriefer, A., Siqueira, W.J., Sommer,
P., Tsai, S.M., Simpson, A.J., Ferro, J.A., Camargo, L.E.,

Downloaded from http://femsle.oxfordjournals.org/ by guest on June 25, 2016

Appendix A. Supplementary data Kitajima, J.P., Setubal, J.C. and Van Sluys, M.A. (2004)
Comparative genomics of two Leptospira interrogans serovars
reveals novel insights into physiology and pathogenesis. J.
Supplementary data associated with this article can Bacteriol. 186, 2164–2172.
be found, in the online version, at doi:10.1016/ [13] Nascimento, A.L.T.O., Verjovski-Almeida, S., Van Sluys, M.A.,
j.femsle.2005.02.004. Monteiro-Vitorello, C.B., Camargo, L.E., Digiampietri, L.A.,
Harstkeerl, R.A., Ho, P.L., Marques, M.V., Oliveira, M.C.,
Setubal, J.C., Haake, D.A. and Martins, E.A.L. (2004) Genome
features of Leptospira interrogans serovar Copenhageni. Braz. J.
References Med. Biol. Res. 37, 459–477.
[14] Delcher, A.L., Harmon, D., Kasif, S., White, O. and Salzberg,
[1] Levett, P.N. (2001) Leptospirosis. Clin. Microbiol. Rev. 14, 296– S.L. (1999) Improved microbial gene identification with GLIM-
326. MER. Nucleic Acids Res. 27, 4636–4641.
[2] Levett, P.N. (2003) Usefulness of serologic analysis as a predictor [15] Nakai, K. and Kanehisa, M. (1991) Expert system for predicting
of the infecting serovar in patients with severe leptospirosis. Clin. protein localization sites in gram-negative bacteria. Proteins 11,
Infect. Dis. 36, 447–452. 95–110.
[3] Bharti, A.R., Nally, J.E., Ricaldi, J.N., Matthias, M.A., Diaz, [16] Krogh, A., Larsson, B., von Heijne, G. and Sonnhammer, E.L.
M.M., Lovett, M.A., Levett, P.N., Gilman, R.H., Willig, M.R., (2001) Predicting transmembrane protein topology with a Hidden
Gotuzzo, E. and Vinetz, J.M. (2003) Peru-United States Lepto- Markov model: application to complete genomes. J. Mol. Biol.
spirosis Consortium, Leptospirosis: a zoonotic disease of global 305, 567–580.
importance. Lancet Infect. Dis. 3, 757–771. [17] Bendtsen, J.D., Nielsen, H., von Heijne, G. and Brunak, S. (2004)
[4] Faine, S., Adler, B., Bolin, C. and Perolat, P. (1999) Leptospira Improved prediction of signal peptides: SignalP 3.0. J. Mol. Biol.
and Leptospirosis, 2nd edn. MediSci, Melbourne, Australia. 340, 783–795.
[5] Plank, R. and Dean, D. (2000) Overview of the epidemiology, [18] Altschul, F.F., Madden, T.L., Schäffer, A.A., Zhang, J.,
microbiology, and pathogenesis of Leptospira spp. in humans. Zhang, Z., Miller, W. and Lipman, D.J. (1997) Gapped
Microbes Infect. 2, 1265–1276. BLAST and PSI-BLAST: a new generation of protein
[6] de la Pena-Moctezuma, A., Bulach, D.M., Kalambaheti, T. and database search programs. Nucleic Acids Res. 25 (17),
Adler, B. (1999) Comparative analysis of the LPS biosynthetic 3389–3402.
loci of the genetic subtypes of serovar Hardjo: Leptospira [19] Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular
interrogans subtype Hardjoprajitno and Leptospira borgpetersenii Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor
subtype Hardjobovis. FEMS Microbiol. Lett. 177, 319–326. Laboratory Press, Plainview, NY.
[7] Zhuo, J.T., Wang, S.S. and Lan, W.L. (1995) A discussion on [20] Dey, S., Mohan, C.M., Kumar, T.M., Ramadass, P., Nainar,
setting up target age group for imunization against leptospirosis. A.M. and Nachimuthu, K. (2004) Recombinant LipL32 antigen-
Zhonghua Liu Xing Bing Xue Za Zhi 16, 228–230. based single serum dilution ELISA for detection of canine
[8] Pizza, M., Scarlato, V., Masignani, V., Giuliani, M.M., Arico, B., leptospirosis. Vet. Microbiol. 103, 99–106.
Comanducci, M., Jennings, G.T., Baldi, L., Bartolini, E., Capec- [21] Haake, D.A., Suchard, M.A., Kelley, M.M., Dundoo, M., Alt,
chi, B., Galeotti, C.L., Luzzi, E., Manetti, R., Marchetti, E., D.P. and Zuerner, R.L. (2004) Molecular evolution and mosai-
Mora, M., Nuti, S., Ratti, G., Santini, L., Savino, S., Scarselli, cism of leptospiral outer membrane proteins involves horizontal
M., Storni, E., Zuo, P., Broeker, M., Hundt, E., Knapp, B., Blair, DNA transfer. J. Bacteriol. 186, 2818–2828.
E., Mason, T., Tettelin, H., Hood, D.W., Jeffries, A.C., Saunders, [22] Haake, D.A. (2000) Spirochaetal lipoproteins and pathogenesis.
N.J., Granoff, D.M., Venter, J.C., Moxon, E.R., Grandi, G. and Microbiology 146, 1491–1504.
Rappuoli, R. (2000) Identification of vaccine candidates against [23] Koizumi, N. and Watanabe, H. (2003) Molecular cloning and
serogroup B meningococcus by whole-genome sequencing. Sci- characterization of a novel leptospiral lipoprotein with OmpA
ence 287, 1816–1820. domain. FEMS Microbiol. Lett. 226, 215–219.
[9] Wizemann, T.M., Heinrichs, J.H., Adamou, J.E., Erwin, A.L., [24] Haake, D.A., Chao, G., Zuerner, R.L., Barnett, J.K., Barnett, D.,
Kunsch, C., Choi, G.H., Barash, S.C., Rosen, C.A., Masure, Mazel, M., Matsunaga, J., Levett, P.N. and Bolin, C.A. (2000)
 M. Gamberini et al. / FEMS Microbiology Letters 244 (2005) 305–313 313

The leptospiral major outer membrane protein LipL32 is a [27] Haake, D.A., Mazel, M.K., McCoy, A.M., Milward, F., Chao,
lipoprotein expressed during mammalian infection. Infect. G., Matsunaga, J. and Wagar, E.A. (1999) Leptospiral outer
Immun. 68, 2276–2285. membrane proteins OmpL1 and LipL41 exhibit synergistic
[25] Haake, D.A., Martinich, C., Summers, T.A., Shang, E.S., immunoprotection. Infect. Immun. 67, 6572–6582.
Pruetz, J.D., McCoy, A.M., Mazel, M.K. and Bolin, C.A. [28] Shang, E.S., Exner, M.M., Summers, T.A., Martinich, C.,
(1998) Characterization of leptospiral outer membrane lipopro- Champion, C.I., Hancock, R.E. and Haake, D.A. (1995) The
tein LipL36: downregulation associated with late-log-phase rare outer membrane protein, OmpL1, of pathogenic Leptospira
growth and mammalian infection. Infect. Immun. 66, 1579– species is a heat-modifiable porin. Infect. Immun. 63, 3174–3181.
1587. [29] Shang, E.S., Summers, T.A. and Haake, D.A. (1996) Molecular
[26] Haake, D.A. and Matsunaga, J. (2002) Characterization of the cloning and sequence analysis of the gene encoding LipL41, a
leptospiral outer membrane and description of three novel surface-exposed lipoprotein of pathogenic Leptospira species.
leptospiral membrane proteins. Infect. Immun. 70, 4936–4945. Infect. Immun. 64, 2322–2330.

Downloaded from http://femsle.oxfordjournals.org/ by guest on June 25, 2016