Scribd Logo
Upload

Welcome to Scribd!

  • 189 views

    GATKwr12 3 IndelRealignment PDF

    Uploaded by

    Alexander Louis Smith
    Indel-based realignment improves variant discovery by locally realigning reads around known or putative insertion and deletion sites. This helps resolve misalignments caused by mappers being unable to properly handle indels near read ends. The GATK IndelRealigner tool performs realignment in two steps - the RealignerTargetCreator identifies regions needing realignment, then IndelRealigner performs the realignments. While newer variant callers may not require realignment, it can still improve base quality score recalibration and remains useful for some legacy tools.

    Copyright:

    © All Rights Reserved
    Download as PDF, TXT or read online from Scribd

    GATKwr12 3 IndelRealignment PDF

    Uploaded by

    Alexander Louis Smith
    189 views15 pages
    Indel-based realignment improves variant discovery by locally realigning reads around known or putative insertion and deletion sites. This helps resolve misalignments caused by mappers being unable to properly handle indels near read ends. The GATK IndelRealigner tool performs realignment in two steps - the RealignerTargetCreator identifies regions needing realignment, then IndelRealigner performs the realignments. While newer variant callers may not require realignment, it can still improve base quality score recalibration and remains useful for some legacy tools.

    Original Title

    GATKwr12-3-IndelRealignment.pdf

    Copyright

    © © All Rights Reserved

    Available Formats

    PDF, TXT or read online from Scribd

    Did you find this document useful?

    Is this content inappropriate?

    Indel-based realignment improves variant discovery by locally realigning reads around known or putative insertion and deletion sites. This helps resolve misalignments caused by mappers being unable to properly handle indels near read ends. The GATK IndelRealigner tool performs realignment in two steps - the RealignerTargetCreator identifies regions needing realignment, then IndelRealigner performs the realignments. While newer variant callers may not require realignment, it can still improve base quality score recalibration and remains useful for some legacy tools.

    Copyright:

    © All Rights Reserved
    Download as PDF, TXT or read online from Scribd
    Download as pdf or txt
    189 views15 pages

    GATKwr12 3 IndelRealignment PDF

    Uploaded by

    Alexander Louis Smith
    Indel-based realignment improves variant discovery by locally realigning reads around known or putative insertion and deletion sites. This helps resolve misalignments caused by mappers being unable to properly handle indels near read ends. The GATK IndelRealigner tool performs realignment in two steps - the RealignerTargetCreator identifies regions needing realignment, then IndelRealigner performs the realignments. While newer variant callers may not require realignment, it can still improve base quality score recalibration and remains useful for some legacy tools.

    Copyright:

    © All Rights Reserved
    Download as PDF, TXT or read online from Scribd
    Download as pdf or txt
    You are on page 1of 15

    talks

    Indel-based Realignment

    Improving the original alignments of the


    reads based on mul8ple sequence
    (re-)alignment
    You are here in the GATK Best Prac8ces workflow
    for germline variant discovery

    Data Pre-processing >> Variant Discovery >> Callset Refinement

    Raw Reads
    111 Analysis-Ready Var. Calling 111 Analysis-Ready SNPs
    Reads HC in ERC mode Variants & Indels

    Map to Reference Genotype Likelihoods


    Non-GATK

    BWA mem
    Genotype
    Mark Duplicates Refinement
    Variant
    & Sort (Picard) Joint Genotyping
    Annotation

    Indel Realignment Raw Variants SNPs Indels


    Variant Evaluation
    Base Recalibration
    Variant Recalibration look good?
    separately per variant type
    Analysis-Ready
    Reads
    Analysis-Ready
    SNPs Indels troubleshoot use in project
    Variants
    InDels = inser8on/dele8on

    Ref seq A G C T A G G G T C A G C T A G G G T C

    Sample seq A G C T A G G G T C A G C G G T C
    TC
    T

    Inser&on Dele&on
    The problem we want to fix

    Alignment by BWA
    Several consecu3ve
    “SNPs” only found on
    reads ending on the
    right of the
    homopolymer
    Several consecu3ve
    “SNPs” only found on
    reads ending on the
    le; of the
    homopolymer 7bp “T”
    homopolymer run

    A;er realignment

    Adding a
    1-bp inser3on
    brings sanity to
    the en3re
    alignment
    Why does this happen?

    •  Mappers cannot “see” indels near ends ref CATG


    of reads ins CA CCA TG
    •  Because mismatches are “cheaper” than a gap in this
    context
    del CA G
    Ref T A C C C A T T T T T T T C T A A A A G C T
    Missmatch =-1
    BWA C C A T T T T T T C T A A A A A C T
    Open gap = -3
    IR C C A – T T T T T T C T A A A A A C T

    þ  Local realignment around indels -> most parsimonious alignment

    þ  Improves accuracy of several downstream processing steps
    How do we iden8fy where realignment is needed?

    •  Known sites (e.g. dbSNP, 1000 Genomes)

    •  Indels seen in original alignments (in CIGARs)

    •  Sites where evidence suggests a hidden indel

    - Entropy calcula8on iden8fies “messy areas”


    How does the realignment algorithm work?

    1. Find the best alternate consensus sequence that, together with the
    reference, best fits the reads in a pile (maximum of 1 indel)

    Ref: AAGAGTAG AAGAGTAG


    Read pile consistent
    with the reference
    Three adjacent
    Realigning sequence
    SNPs
    determines AAG---AGTAG
    which is Read pile consistent
    be`er with a 3bp inser8on

    2. Score for alternate consensus = total sum of quality scores of mismatching bases

    3. If best alternate consensus is sufficiently be`er than the original alignments


    (using LOD score threshold) -> accept proposed realignment
    Indel Realignment steps/tools

    •  Iden8fy what regions


    need to be realigned

    ➔  RealignerTargetCreator

    •  Perform the actual


    realignment

    ➔  IndelRealigner

    RealignerTargetCreator

    Known Sites

    Input BAM RealignerTargetCreator Target Intervals

    java –jar GenomeAnalysisTK.jar \ •  Pre-processing step to find intervals


    –T RealignerTargetCreator \
    –R human.fasta \ that may need realignment
    –I original.bam \
    •  Input BAM file not necessary if
    –known indels.vcf \
    IndelRealigner
    –o realigner.intervals processing only at known indels

    •  Using a list of known indels will both


    speed up processing and improve
    Realigned BAM
    accuracy, but is not required
    IndelRealigner
    Input BAM Known Sites Target Intervals

    IndelRealigner •  A`empts realignment at


    RealignerTargetCreator target
    intervals
    •  Must use same input file(s) used in
    Realigned BAM RealignerTargetCreator step
    •  Processing op8ons
    -  Only at known indels: much faster,
    accurate for ~90-95% of indels
    -  At indels seen in the original BAM
    java –jar GenomeAnalysisTK.jar \
    alignments: the recommended
    –T IndelRealigner \ mode
    –R human.fasta \ -  Using full Smith-Waterman
    –I original.bam \ realignment: most accurate, but
    –known indels.vcf \ heavy computa8onal cost and not
    –targetIntervals realigner.intervals \
    –o realigned.bam
    really necessary with the new techs
    This is what a realigned BAM looks like

    Before Aier
    Old data
    (lower quality)

    New data
    (higher quality)

    DePristo, M., Banks, E., Poplin, R. et. al, A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat Gen.
    Can I see the effects of realignment?

    •  Indel Realigner changes the CIGAR string of realigned reads


    but maintains the original CIGAR (with OC tag)

    -> Can grep for realigned regions and view in genome browser (IGV)
    20GAVAAXX100126:1:67:10041:180738 99 20 10011431 70 87M1D14M = 10011720 390

    TTAAATGTGTTTATCTATTGTTCTACTATTCAGTTACCTGATTATAAAATCAAAGATTATTTCATGAAACTCAGTACCCCTTCAGGGAAAAAAAAA
    AAAAT

    HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH
    HHHHHHHHHGGGGGGGG X0:i:1 X1:i:0 MC:Z:101M OC:Z:101M PG:Z:MarkDuplicates RG:Z:20GAV.1 XG:i:0 AM:i:37
    NM:i:1 SM:i:37 XM:i:1 XO:i:0

    BQ:Z:@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
    @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@cccddc``a`^\[Y MQ:i:60 XT:A:
    Is realignment s8ll necessary with latest soiware?

    •  Variant callers with reassembly step (HaplotypeCaller, MuTect 2, Platypus)


    do not require indel realignment

    •  BUT poten8al improvement for Base Quality Score Recalibra8on when run
    on realigned BAM files (ar8factual SNPs are replaced with real indels).

    •  Also s8ll useful for legacy tools


    –  Unified Genotyper
    –  MuTect 1
    You are here in the GATK Best Prac8ces workflow
    for germline variant discovery

    Data Pre-processing >> Variant Discovery >> Callset Refinement

    Raw Reads
    111 Analysis-Ready Var. Calling 111 Analysis-Ready SNPs
    Reads HC in ERC mode Variants & Indels

    Map to Reference Genotype Likelihoods


    Non-GATK

    BWA mem
    Genotype
    Mark Duplicates Refinement
    Variant
    & Sort (Picard) Joint Genotyping
    Annotation

    Indel Realignment Raw Variants SNPs Indels


    Variant Evaluation
    Base Recalibration
    Variant Recalibration look good?
    separately per variant type
    Analysis-Ready
    Reads
    Analysis-Ready
    SNPs Indels troubleshoot use in project
    Variants
    talks

    Further reading
    h`p://www.broadins8tute.org/gatk/guide/best-prac8ces

    h`p://www.broadins8tute.org/gatk/guide/ar8cle?id=38

    h`ps://www.broadins8tute.org/gatk/gatkdocs/
    org_broadins8tute_gatk_tools_walkers_indels_IndelRealigner.php

    h`ps://www.broadins8tute.org/gatk/gatkdocs/
    org_broadins8tute_gatk_tools_walkers_indels_RealignerTargetCreator.php

    You might also like