Scribd Logo
Upload

Welcome to Scribd!

  • 39 views

    Transcription and Translation

    Uploaded by

    Genesis Flores
    1) Transcription is the process by which genetic information encoded in DNA is copied onto messenger RNA (mRNA). 2) Translation is the process by which the information encoded in mRNA is used to assemble a protein at a ribosome. 3) During transcription, RNA polymerase uses DNA as a template to produce mRNA, which then leaves the nucleus. During translation, the mRNA binds to a ribosome where transfer RNA (tRNA) and the genetic code are used to translate the mRNA into a polypeptide chain or protein.

    Copyright:

    © All Rights Reserved
    Download as PDF, TXT or read online from Scribd

    Transcription and Translation

    Uploaded by

    Genesis Flores
    39 views24 pages
    1) Transcription is the process by which genetic information encoded in DNA is copied onto messenger RNA (mRNA). 2) Translation is the process by which the information encoded in mRNA is used to assemble a protein at a ribosome. 3) During transcription, RNA polymerase uses DNA as a template to produce mRNA, which then leaves the nucleus. During translation, the mRNA binds to a ribosome where transfer RNA (tRNA) and the genetic code are used to translate the mRNA into a polypeptide chain or protein.

    Original Description:

    biología

    Original Title

    transcripción

    Copyright

    © © All Rights Reserved

    Available Formats

    PDF, TXT or read online from Scribd

    Did you find this document useful?

    Is this content inappropriate?

    1) Transcription is the process by which genetic information encoded in DNA is copied onto messenger RNA (mRNA). 2) Translation is the process by which the information encoded in mRNA is used to assemble a protein at a ribosome. 3) During transcription, RNA polymerase uses DNA as a template to produce mRNA, which then leaves the nucleus. During translation, the mRNA binds to a ribosome where transfer RNA (tRNA) and the genetic code are used to translate the mRNA into a polypeptide chain or protein.

    Copyright:

    © All Rights Reserved
    Download as PDF, TXT or read online from Scribd
    Download as pdf or txt
    39 views24 pages

    Transcription and Translation

    Uploaded by

    Genesis Flores
    1) Transcription is the process by which genetic information encoded in DNA is copied onto messenger RNA (mRNA). 2) Translation is the process by which the information encoded in mRNA is used to assemble a protein at a ribosome. 3) During transcription, RNA polymerase uses DNA as a template to produce mRNA, which then leaves the nucleus. During translation, the mRNA binds to a ribosome where transfer RNA (tRNA) and the genetic code are used to translate the mRNA into a polypeptide chain or protein.

    Copyright:

    © All Rights Reserved
    Download as PDF, TXT or read online from Scribd
    Download as pdf or txt
    You are on page 1of 24

    Transcription and Translation

    Protein Structure

     Made up of amino acids


     Polypeptide- string of amino acids
     20 amino acids are arranged in
    different orders to make a variety of
    proteins
     Assembled on a ribosome
    Questions to be answered today

     How do we get from the bases


    found in DNA to amino acids?
     How do we get from a bunch of
    amino acids to proteins?
    Replication

    DNA

    •DNA double helix unwinds


    •DNA now single-stranded
    •New DNA strand forms using
    complementary base pairing (A-T, C-G)
    •Used to prepare DNA for cell division
    •Whole genome copied/replicated
    Transcription and Translation: An
    Overview (aka the Central Dogma)

    DNA
    Transcription

    RNA
    Translation

    Protein
    RNA vs. DNA
    DNA RNA
     Double stranded  Single stranded
     Deoxyribose sugar  Ribose sugar
     Bases: C,G A,T  Bases: C,G,A,U

    Both contain a sugar, phosphate, and base.


    Transcription
     RNA forms base
    pairs with DNA
     C-G
     A-U
     Primary transcript-
    length of RNA that
    results from the
    process of
    transcription
    TRANSCRIPTION

    ACGATACCCTGACGAGCGTTAGCTATCG
    UGCUAUGGGACU
    Major players in transcription

     mRNA- type of
    RNA that
    encodes
    information for
    the synthesis of
    proteins and
    carries it to a
    ribosome from
    the nucleus
    Major players in transcription
     RNA polymerase-
    complex of
    enzymes with 2
    functions:
     Unwind DNA
    sequence
     Produce primary
    transcript by
    stringing together
    the chain of RNA
    nucleotides
    mRNA Processing
     Primary transcript
    is not mature
    mRNA
     DNA sequence has
    coding regions
    (exons) and non-
    coding regions
    (introns)
     Introns must be
    removed before
    primary transcript
    is mRNA and can
    leave nucleus
    Transcription is done…what now?

    Now we have mature mRNA


    transcribed from the cell’s DNA. It
    is leaving the nucleus through a
    nuclear pore. Once in the
    cytoplasm, it finds a ribosome so
    that translation can begin.

    We know how mRNA is made, but


    how do we “read” the code?
    Translation

     Second stage of protein production


     mRNA is on a ribosome
    Ribosomes

     2 subunits, separate in cytoplasm


    until they join to begin translation
     Large
     Small
     Contain 3 binding sites
     E
     P
     A
    Translation

     Second stage of protein production


     mRNA is on a ribosome
     tRNA brings amino acids to the
    ribosome
    tRNA
     Transfer RNA
     Bound to one
    amino acid on one
    end
     Anticodon on the
    other end
    complements
    mRNA codon
    tRNA Function

     Amino acids must be in the correct


    order for the protein to function
    correctly
     tRNA lines up amino acids using
    mRNA code
    Reading the DNA code

     Every 3 DNA bases pairs with 3


    mRNA bases
     Every group of 3 mRNA bases
    encodes a single amino acid
     Codon- coding triplet of mRNA
    bases
    How many bases code for each
    amino acid?
     1 base = 1 amino acid
     41 =

     2 bases = 1 amino acid


     42 =

     3 bases = 1 amino acid


     43 =
    The Genetic Code
    ACGATACCCTGACGAGCGTTAGCTATCG
    UGCUAUGGGACUG
    Which codons code for which
    amino acids?

     Genetic code- inventory of linkages


    between nucleotide triplets and the
    amino acids they code for proteins
     A gene is a segment of RNA that
    brings about transcription of a
    segment of RNA
    Transcription vs. Translation Review

    Transcription Translation
     Process by which  Process by which
    genetic information
    information encoded in mRNA
    encoded in DNA is is used to
    copied onto assemble a protein
    messenger RNA at a ribosome
     Occurs in the  Occurs on a
    nucleus Ribosome
     DNA mRNA  mRNA protein

    You might also like