REVIEW

family of proteins that carry functional domains

typical of nucleases, helicases, polymerases, and
polynucleotide-binding proteins (4). CRISPR,
CRISPR/Cas, the Immune System of in combination with Cas proteins, forms the
CRISPR/Cas systems. Six “core” cas genes have
Bacteria and Archaea been identified, including the universal markers
of CRISPR/Cas systems cas1 (COG1518) and
cas2 (COG1343, COG3512, occasionally in a
Philippe Horvath1* and Rodolphe Barrangou2* fused form with other cas genes). Besides the
cas1 to cas6 core genes, subtype-specific genes
Microbes rely on diverse defense mechanisms that allow them to withstand viral predation and exposure and genes encoding “repeat-associated mysteri-
to invading nucleic acid. In many Bacteria and most Archaea, clustered regularly interspaced short ous proteins” (RAMP) have been identified and
palindromic repeats (CRISPR) form peculiar genetic loci, which provide acquired immunity against grouped into subtypes functionally paired with
viruses and plasmids by targeting nucleic acid in a sequence-specific manner. These hypervariable loci particular CRISPR repeat sequences (4–8). The
take up genetic material from invasive elements and build up inheritable DNA-encoded immunity size of CRISPR repeats and spacers varies
over time. Conversely, viruses have devised mutational escape strategies that allow them to circumvent between 23 to 47 base pairs (bp) and 21 to 72 bp,
the CRISPR/Cas system, albeit at a cost. CRISPR features may be exploited for typing purposes, respectively. Generally, CRISPR repeat sequences
epidemiological studies, host-virus ecological surveys, building specific immunity against undesirable are highly conserved within a given CRISPR
genetic elements, and enhancing viral resistance in domesticated microbes. locus, but a large assortment of repeat sequences
has been shown across microbial species (1, 9).

Downloaded from http://science.sciencemag.org/ on January 14, 2018

icrobes have devised various strategies viral and plasmid sequences) and are often ad- Most repeat sequences are partially palindromic,

M that allow them to survive exposure to

foreign genetic elements. Although
outpopulated and preyed upon by abundant and
jacent to cas genes (CRISPR-associated) (Fig. 1).
cas genes encode a large and heterogeneous
having the potential to form stable, highly
conserved secondary structures (7). The number

ubiquitous viruses, microbes routinely survive,

csn1 - like cas1 cas2 cas7 CRISPR1
persist, and occasionally thrive in hostile and
competitive environments. The constant expo-
sure to exogenous DNA via transduction, con- L1 32 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1

jugation, and transformation have forced microbes T

to establish an array of defense mechanisms that

allow the cell to recognize and distinguish GTTTTTGTACTCTCAAGATTTAAGTAACTGTACAAC
incoming “foreign” DNA, from “self ” DNA
and to survive exposure to invasive elements.
CRISPR2
These systems maintain genetic integrity, yet pyrD cas1 cas2 cas6 csm1 csm2 csm3 csm4 csm5 csm6 pyrF
occasionally allow exogenous DNA uptake and U U
G U
conservation of genetic material advantageous U C
L2 35 34 33
U G
for adaptation to the environment. Certain strategies, T
G A
such as prevention of adsorption, blocking of U ·A
injection, and abortive infection, are effective G ·U
GATATAAACCTAATTACCTCGAGARGGGACGGAAAC U ·G
against viruses; other defense systems specifi- C ·G
cally target invading nucleic acid, such as the G ·U
CRISPR3 A ·U
restriction-modification system (R-M) and the serB csn1 cas1 cas2 csn2 ycxC G ·C
use of sugar-nonspecific nucleases. Recently, an A ·C
adaptive microbial immune system, clustered U ·A
L3 47 46 45 44 43 42 41 40 39 38 37 36 U ·A
regularly interspaced short palindromic repeats U ·A
(CRISPR) has been identified that provides U ·A
N N G ·C N N
acquired immunity against viruses and plasmids. GTTTTAGAGCTGTGTTGTTTCGAATGGTTCCAAAAC
CRISPR represents a family of DNA repeats
found in most archaeal (~90%) and bacterial CRISPR4
(~40%) genomes (1–3). Although the initial cas3 cse1 cse2 cse4 cas5e cse3 cas1 cas2-dnaQ
discovery of a CRISPR structure was made for-
tuitously in Escherichia coli in 1987, the acronym
was coined in 2002, after similar structures were L4 59 58 57 56 55 54 53 52 51 50 49 48
T
observed in genomes of various Bacteria and
Archaea (1). CRISPR loci typically consist of
1 kb GTTTTTCCCGCACACGCGGGGGTGATCCH
several noncontiguous direct repeats separated
by stretches of variable sequences called spacers Fig. 1. Overview of the four CRISPR/cas systems present in Streptococcus thermophilus DGCC7710. For
(which mostly correspond to segments of captured each system, gene organization is depicted on the top, with cas genes in gray, and the repeat-spacer
1 array in black. Below the gene scheme, the repeat and spacer (captured phage or plasmid nucleic acid)
Danisco France SAS, BP10, F-86220 Dangé-Saint-Romain,
France. 2Danisco USA, Inc., 3329 Agriculture Drive, Madison, content is detailed as black diamonds (T, terminal repeat) and white rectangles, respectively. Bottom
WI 53716, USA. line, consensus repeat sequence. L1 to L4, leader sequences. The predicted secondary structure of the
*To whom correspondence should be addressed. E-mail: CRISPR3 repeat is shown on the right. S. thermophilus CRISPR2, CRISPR3, and CRISPR4 systems are
philippe.horvath@danisco.com (P.H.), rodolphe.barrangou@ homologous to the CRISPR systems of Staphylococcus epidermidis (20), Streptococcus mutans (19), and
danisco.com (R.B.) E. coli (28), respectively.

www.sciencemag.org SCIENCE VOL 327 8 JANUARY 2010 167

REVIEW
of repeat-spacer units is documented to reach 375
(Chloroflexus sp. Y-400-fl), but most loci commonly
A Immunization
contain fewer than 50 units, as exemplified in
lactic acid bacteria genomes (8). Microbes may Virus
contain more than one CRISPR locus; up to 18
such loci have been identified in Methanocaldococcus
jannaschii, totaling more than 1% of the genome
(10). CRISPRs are typically located on the chromo- Viral Infection
some, although some have been identified on DNA
plasmids (11–13).
The CRISPR loci have highly diverse and Novel
hypervariable spacer sequences, even between Plasmid spacer
Cleavage
closely related strains (14–16), which were initially DNA
exploited for typing purposes. A variety of putative
Insertion of a novel
roles for CRISPR sequences was originally repeat-spacer unit
Cas
suggested, including chromosomal rearrangement, Conjugation complex
modulation of expression of neighboring genes,
L 5 4 3 2 1
target for DNA binding proteins, replicon par- csn1 cas1 cas2 csn2 T
titioning, and DNA repair (5). In 2005, three
CRISPR array
independent in silico studies reported homology
between spacer sequences and extrachromosomal

Downloaded from http://science.sciencemag.org/ on January 14, 2018

Acquired immunity against subsequent
elements, such as viruses and plasmids (11, 14, 15).
viral infection or plasmid transfer
This led to the hypothesis that CRISPR may B Immunity
provide adaptive immunity against foreign genetic Absence of PAM within the
elements (6). CRISPR array prevents autoimmunity
L 6 5 4 3 2 1
A Vast Spectrum of Immunity csn1 cas1 cas2 csn2 T

In 2007, it was shown in Streptococcus thermophilus Cascade Transcription

that during natural generation of phage-resistant (Cas complex)
variants, bacteria commonly alter their CRISPR Inactivation pre-crRNA
loci by polarized (i.e., at the leader end) incor- T
poration of CRISPR repeat-spacer units (Fig. 1) Targeting
(17, 18), consistent with observed spacer hyper- Processing
variability at the leader end of CRISPR loci in crRNAs
various strains (14, 16). The integrated sequences
were identical to those of the phages used in the
challenge, which suggested that they originate Interference
with the invading nucleic acid
from viral nucleic acid. To determine whether bearing a proto-spacer and PAM
CRISPR impacts phage resistance, spacer con-
tent was altered via genetic engineering, which CGGACGTGGT TGCTCGACTTGTTAAAAAAACTACTGAAGA T GGCGATGAA
showed that spacer addition can provide novel ······························
CAAAAC UGCUCGACUUGUUAAAAAAACUACUGAAGAGUUUUA
phage resistance, whereas spacer deletion could crRNA
result in loss of phage resistance (17). These
findings were confirmed in Streptococcus mutans, Fig. 2. Overview of the CRISPR/Cas mechanism of action. (A) Immunization process: After insertion of
where phage-resistant mutants acquired novel exogenous DNA from viruses or plasmids, a Cas complex recognizes foreign DNA and integrates a novel
CRISPR spacers with sequences matching the repeat-spacer unit at the leader end of the CRISPR locus. (B) Immunity process: The CRISPR repeat-spacer
phage genome, in vitro and in vivo (19). Although array is transcribed into a pre-crRNA that is processed into mature crRNAs, which are subsequently used as
the ubiquitous and predatory nature of phages may a guide by a Cas complex to interfere with the corresponding invading nucleic acid. Repeats are
explain the overwhelming representation of phage represented as diamonds, spacers as rectangles, and the CRISPR leader is labeled L.
sequences in CRISPR loci, CRISPR spacers can
also interfere with both plasmid conjugation and undergone horizontal transfer between genomes, of plasmids, prophages, transposons, and, per-
transformation, as shown in Staphylococcus notably differences observed in codon bias, GC haps, chromosomal sequences, studies should
epidermidis (20). Furthermore, several metage- content variability, their presence on mobile investigate whether CRISPR/Cas systems prefer-
nomic studies investigating host-virus populations genetic elements, the presence of neighboring entially target certain elements and could deter-
dynamics showed that CRISPR loci evolve in insertion sequence elements, and their variable mine whether they are symbiotic or mutually
response to viral predation and that CRISPR spacer presence and location in closely related genomes. exclusive with other defense systems.
content and sequential order provide insights This is in agreement with the lack of congruence
both historically and geographically (21–24). between the phylogenetic relation of various Idiosyncrasies of the CRISPR/Cas
The ability to provide defense against invading CRISPR elements and that of the organisms in Mechanism of Action
genetic elements seems to render CRISPR/Cas which they are found (8, 12). This horizontal The mechanism by which CRISPR provides re-
systems particularly desirable in hostile environ- gene transfer may be mediated by plasmids, sistance against foreign genetic elements is not
ments and may explain their propensity to be megaplasmids, and even prophages, all of which fully characterized (Fig. 2). Even so, the func-
transferred horizontally between sometimes dis- are documented to carry CRISPR loci (2). tional link between Cas and CRISPR repeats
tant organisms (12). There is extensive evidence Given the variety of defense systems in has been inferred from the congruence observed
that defense systems such as CRISPR have microbes and their role in controlling the presence between their sequence patterns. cas genes provide

168 8 JANUARY 2010 VOL 327 SCIENCE www.sciencemag.org

 REVIEW
CRISPR-encoded immunity, because inactivat- native mRNA) on a plasmid that allows ilarities with the vertebrate adaptive immune
ing the CRISPR1-associated cas7 gene (Fig. 1) conjugation despite the presence of a matching system, although CRISPR spacers are DNA-
impairs the ability of the host to integrate novel CRISPR spacer (20). Conversely, the Pyrococcus encoded and can be inherited by the progeny.
CRISPR spacers after phage exposure (17), CRISPR effector complex, a ribonucleoprotein
which suggests that it is necessary for recogniz- complex that consists of crRNA and Cas proteins, Circumventing CRISPR-Based Immunity
ing foreign nucleic acid and/or integrating the targets invader RNA by complementary-dependent Even though CRISPR can provide high levels
novel repeat-spacer unit. Cas1 appears to be a cleavage, in vitro (30). Given the large diversity of of phage resistance, a relatively small propor-
double-stranded DNA (dsDNA) endonuclease CRISPR/Cas systems in Bacteria and Archaea tion of viruses retain the ability to infect the
involved in the immunization process (25). It (4, 6), it is likely that both DNA and RNA may “immunized” host. These viral particles have
has also been proposed that Cas2 may act as a be targets. More information is needed to specifically mutated the proto-spacer (sequence
sequence-specific endoribonuclease that cleaves establish and understand what the functional within the invading nucleic acid that matches a
uracil-rich single-stranded RNAs (ssRNAs) differences are among distinct CRISPR/Cas CRISPR spacer), with a single point mutation
(26). The mechanistic steps involved in invasive systems. that allows the viruses to overcome immunity,
element recognition, novel repeat manufacturing, The initial hypothesis that CRISPR may which indicates that the selective pressure im-
and spacer selection and integration into the mediate microbial immunity via RNA interfer- posed by CRISPR can rapidly drive mutation
CRISPR locus remain uncharacterized. ence (RNAi) (6) is misguided. RNAi allows patterns in viruses (17, 18, 23). Analysis of
Although some Cas proteins are involved in eukaryotic organisms exposed to foreign ge- phage sequences adjacent to proto-spacers re-
the acquisition of novel spacers, others provide netic material to silence the invading nucleic vealed the presence of conserved sequences,
CRISPR-encoded phage resistance and interfere acid sequence before or after it integrates into called CRISPR motifs (13, 16, 18, 19, 33, 34),
with invasive genetic elements. Mechanistically, the host chromosome, and/or to subvert cellu- or proto-spacer adjacent motifs (PAMs) (35).
although defense is spacer-encoded, the infor- lar processes through a small interfering RNA Phages may also circumvent the CRISPR/Cas

Downloaded from http://science.sciencemag.org/ on January 14, 2018

mation that lies within the CRISPR repeat- guide (31). A key difference between RNAi system by mutating the CRISPR motif (18),
spacer array becomes available to the Cas and CRISPR-encoded immunity lies in the which indicates that it is involved in CRISPR-
machinery through transcription. The CRISPR enzymatic machinery involved. Although both encoded immunity. Additionally, CRISPR motif
leader, defined as a low-complexity, A/T-rich, are mediated by a guide RNA in an inhibitory mutation can result in loss of phage resistance
noncoding sequence, located immediately upstream ribonucleoprotein complex, only Dicer, Slicer, despite the presence of a matching CRISPR
of the first repeat, likely acts as a promoter for and the RNA-induced silencing complex (RISC) spacer (34). The absence of this motif in the
the transcription of the repeat-spacer array into a may have analogous counterparts (6, 30). CRISPR locus likely allows the system to act
CRISPR transcript, the pre-crRNA (13, 27). The Mechanistically, although the short RNA du- on the invading target DNA specifically and
full-length pre-crRNA is subsequently processed plexes at the core of RNAi are typically 21 to precludes an “autoimmune” response on the
into specific small RNA molecules that corre- 28 nt in length (32), crRNAs are larger, be- host chromosome (Fig. 2). Such a motif may
spond to a spacer flanked by two partial repeats cause they contain a CRISPR spacer (23 to not be necessary in CRISPR/Cas systems target-
(27–29). In E. coli, processing is achieved by a 47 nt) flanked by partial repeats. Also, RNA- ing RNA. Although proto-spacers seem to be
multimeric complex of Cas proteins named dependent transcription generating dsRNA and randomly located on phage genomes, a given
Cascade (CRISPR-associated complex for antiviral using the cleaved target RNA seen in RNAi CRISPR spacer may be acquired independently
defense), which specifically cleaves the pre-crRNA have not been characterized in the CRISPR/Cas by different lineages. It is thus tempting to spec-
transcript within the repeat sequence to generate systems. In other ways, the sequence-specific ulate that CRISPR motifs also play a key role in
small CRISPR RNAs, crRNAs (28). Similarly, in and adaptive CRISPR/Cas systems share sim- the selection of spacers.
Pyrococcus, Cas6 is an endoribonu- These mutations may have an
clease that cleaves the pre-crRNA impact on the amino acid sequence,
transcript into crRNA units that in- as either nonsynonymous mutations
clude a partial [8-nucleotide (nt)] re- Plasmids
or premature stop codons that trun-
Viruses
peat sequence at the 5′ end, as part of cate the viral protein (18). In addi-
the Cas-crRNA complex (27, 29, 30). tion to mutations, phages may also
The crRNAs seem to specifically DNA target circumvent CRISPR-encoded immu-
guide the Cas interference machinery nity via deletion of the target sequence
toward foreign nucleic acid mole- (18, 21). This perhaps indicates a
cules that match its sequence, which Immunity strong cost associated with circum-
leads ultimately to degradation of venting the CRISPR/Cas systems.
the invading element (30). The in- CRISPR/Cas systems Alternative strategies that allow
volvement of cas genes in CRISPR viruses to escape CRISPR, such as
Regulation
defense was originally demonstrated suppressors that could interfere with
when inactivating the CRISPR1- crRNAs biogenesis or Cas machin-
associated csn1-like gene (Fig. 1) RNA target ery remain uncovered. Defense tactics
resulted in loss of phage resistance employed by viruses to circumvent
despite the presence of matching Viruses Plasmids the CRISPR/Cas systems are yet
spacers (17). another critical difference between
The observation that CRISPR RNAi and CRISPR: Eukaryotic
spacers match both sense and Chromosomal sequences viruses may express inhibitors such
(including prophages, transposons…)
antisense viral DNA led to the as dsRNA-binding proteins that inter-
hypothesis that some CRISPR/Cas fere with the RNA silencing machin-
systems may target dsDNA, and ery (32), which are yet to be identified
this was confirmed by disruption Fig. 3. CRISPR interference. The CRISPR/Cas systems may target either DNA in response to CRISPR, whereas
of target DNA with an intron (the or RNA to interfere with viruses, plasmids, prophages, or other chromosom- microbial viruses specifically mutate
excision of which restores the ally encoded sequences. or recombine (21) the sequence

www.sciencemag.org SCIENCE VOL 327 8 JANUARY 2010 169

REVIEW
corresponding to the CRISPR spacer or that of defense mechanisms have their advantages and 3. J. van der Oost, M. M. Jore, E. R. Westra, M. Lundgren,
the PAM. caveats, the accumulation and combination of S. J. Brouns, Trends Biochem. Sci. 34, 401 (2009).
4. D. H. Haft, J. Selengut, E. F. Mongodin, K. E. Nelson,
The impact of CRISPR on phage genomes is different systems would increase the selective PLOS Comput. Biol. 1, e60 (2005).
illustrated by extensive genome recombination pressure on invading elements and, consequently, 5. K. S. Makarova, L. Aravind, N. V. Grishin, I. B. Rogozin,
events observed in environmental phage populations could increase the chances of host survival by E. V. Koonin, Nucleic Acids Res. 30, 482 (2002).
in response to CRISPR (21). This contrasts with using multiple hurdles. 6. K. S. Makarova, N. V. Grishin, S. A. Shabalina, Y. I. Wolf,
E. V. Koonin, Biol. Direct 1, 7 (2006).
the fact that acquisition of novel CRISPR spacers Because CRISPR spacers correspond to 7. V. Kunin, R. Sorek, P. Hugenholtz, Genome Biol. 8, R61
does not seem to have a fitness cost for the host, prior episodes of phage and plasmid exposure, (2007).
apart from maintaining the CRISPR/Cas system as they provide a historical and geographical— 8. P. Horvath et al., Int. J. Food Microbiol. 131, 62
active. although limited—perspective as to the origin (2009).
9. I. Grissa, G. Vergnaud, C. Pourcel, BMC Bioinformatics 8,
Although it seems intuitive that CRISPR loci and paths of a particular strain, which may be 172 (2007).
should not be able to expand indefinitely (21, 36), used for ecological and epidemiological studies. 10. R. K. Lillestøl, P. Redder, R. A. Garrett, K. Brügger,
little is known about the parameters that define Many intrinsic aspects of CRISPR-based immu- Archaea 2, 59 (2006).
the optimal and maximum size of a CRISPR nity have provided avenues for industrial 11. F. J. Mojica, C. Díez-Villaseñor, J. García-Martínez,
E. Soria, J. Mol. Evol. 60, 174 (2005).
locus. Also, the fitness cost of CRISPR ex- applications, including exploiting hypervariabil-
12. J. S. Godde, A. Bickerton, J. Mol. Evol. 62, 718 (2006).
pansion in the host should be compared with ity for typing purposes, driving viral evolution, 13. R. K. Lillestøl et al., Mol. Microbiol. 72, 259 (2009).
that of CRISPR evasion in the virus populations, predicting and modulating virus resistance in 14. C. Pourcel, G. Salvignol, G. Vergnaud, Microbiology 151,
so as to determine whether prey or predators domesticated microbes, and performing natural 653 (2005).
incur the higher evolutionary cost of this genetic genetic tagging of proprietary strains. The in- 15. A. Bolotin, B. Quinquis, A. Sorokin, S. D. Ehrlich,
Microbiology 151, 2551 (2005).
warfare. heritable nature of the CRISPR spacer content 16. P. Horvath et al., J. Bacteriol. 190, 1401 (2008).
Although CRISPR loci primarily evolve via provides potential for perennial use of industrial 17. R. Barrangou et al., Science 315, 1709 (2007).

Downloaded from http://science.sciencemag.org/ on January 14, 2018

polarized addition of novel spacers at the leader microbes. Alternatively, the ability of CRISPR/ 18. H. Deveau et al., J. Bacteriol. 190, 1390 (2008).
end of the locus after phage exposure, internal Cas systems to impede the transfer of particular 19. J. R. van der Ploeg, Microbiology 155, 1966 (2009).
20. L. A. Marraffini, E. J. Sontheimer, Science 322, 1843
spacer deletions have also been reported, likely nucleic acid sequences (such as phage or plasmid (2008).
occurring via homologous recombination be- DNA) into a host might be exploited via genetic 21. A. F. Andersson, J. F. Banfield, Science 320, 1047
tween CRISPR repeats (1, 16, 18). Perhaps this engineering to specifically preclude the dissemi- (2008).
allows the host to limit the expansion of the nation of undesirable genetic elements, such as 22. V. Kunin et al., Genome Res. 18, 293 (2008).
23. J. F. Heidelberg, W. C. Nelson, T. Schoenfeld, D. Bhaya,
CRISPR locus so that the relative size of the antibiotic-resistance markers and genes harmful N. Ahmed, PLoS ONE 4, e4169 (2009).
locus does not increase to a detrimental level. to humans and other living organisms. It may 24. N. L. Held, R. J. Whitaker, Environ. Microbiol. 11, 457
The propensity of spacers located at the trailer also be designed to limit the intracellular spread (2009).
end (opposite to the leader end) to be deleted of mobile genetic elements such as insertion se- 25. B. Wiedenheft et al., Structure 17, 904 (2009).
26. N. Beloglazova et al., J. Biol. Chem. 283, 20361
preferentially would mitigate the loss of fitness quences and transposons. In addition to providing
(2008).
associated with the deletion, because ancestral immunity, CRISPR/Cas systems that target RNA 27. C. Hale, K. Kleppe, R. M. Terns, M. P. Terns, RNA 14,
spacers would arguably provide resistance have the potential to affect the transcript stability 2572 (2008).
against viruses that were historically, but are of chromosomal elements (Fig. 3). 28. S. J. Brouns et al., Science 321, 960 (2008).
not currently, present in the environment. The Although significant progress has been made 29. J. Carte, R. Wang, H. Li, R. M. Terns, M. P. Terns,
Genes Dev. 22, 3489 (2008).
combination of locus expansion via spacer in the last few years, many mechanistic aspects 30. C. R. Hale et al., Cell 139, 945 (2009).
acquisition and contraction via spacer loss, in remain uncovered, notably vis-à-vis the immu- 31. C. C. Mello, D. Conte Jr., Nature 431, 338 (2004).
the context of rapid evolution in space and time nization process (key elements involved in 32. G. Meister, T. Tuschl, Nature 431, 343 (2004).
because of viral predation, which generate a spacer selection and integration between repeats 33. S. A. Shah, N. R. Hansen, R. A. Garrett, Biochem. Soc.
Trans. 37, 23 (2009).
high level of spacer polymorphism, suggests and/or possible involvement of degenerate 34. E. Semenova, M. Nagornykh, M. Pyatnitskiy,
that CRISPR loci undergo dynamic and rapid infectious particles in building immunity) and I. I. Artamonova, K. Severinov, FEMS Microbiol. Lett. 296,
turnover on evolutionary time scales (16, 21, 36). the interference mechanism (other cellular 110 (2009).
Indeed, in microbes with an active system, components involved). Also, more knowledge 35. F. J. Mojica, C. Díez-Villaseñor, J. García-Martínez,
C. Almendros, Microbiology 155, 733 (2009).
CRISPR loci have been shown to be the most is desirable regarding the elements necessary to 36. G. W. Tyson, J. F. Banfield, Environ. Microbiol. 10, 200
hypervariable genomic regions (21). have functional CRISPR/Cas systems and the (2008).
basis for the absence of CRISPR in 60% of 37. We thank our colleagues P. Boyaval, C. Fremaux,
Applications and Future Directions Bacteria. D. Romero, and E. Bech Hansen for their support and
scientific contributions, and S. Moineau, V. Siksnys, and
A priori, the concurrent presence of distinct
References and Notes J. Banfield for their insights and expertise. This work was
defense systems against foreign genetic elements supported by Danisco A/S. P.H. and R.B. have submitted
1. R. Jansen, J. D. Embden, W. Gaastra, L. M. Schouls, Mol.
in Bacteria and Archaea seems inefficient and Microbiol. 43, 1565 (2002). patent applications relating to various uses of CRISPR.
redundant, although it might reflect functional 2. R. Sorek, V. Kunin, P. Hugenholtz, Nat. Rev. Microbiol. 6,
preferences and increased fitness. Because all 181 (2008). 10.1126/science.1179555

170 8 JANUARY 2010 VOL 327 SCIENCE www.sciencemag.org

CRISPR/Cas, the Immune System of Bacteria and Archaea
Philippe Horvath and Rodolphe Barrangou

Science 327 (5962), 167-170.

DOI: 10.1126/science.1179555

CRISPR Defenses
Prokaryotes can be infected by parasites and pathogens and, like eukaryotes, have evolved systems to protect
themselves. Horvath and Barrangou (p. 167) review a recently discovered prokaryotic ''immune system'' characterized
by CRISPR−−clustered regularly interspaced short palindromic repeats−−found in most archaeal and many bacterial
species. CRISPR loci harbor short sequences captured from viruses and invasive genetic elements. These sequences

Downloaded from http://science.sciencemag.org/ on January 14, 2018

are transcribed, and the RNA is cleaved into short CRISPR RNAs (crRNAs) by one of a family of CRISPR-associated
(cas) proteins. These crRNAs direct other cas family proteins to homologous nucleic acid targets to effect their
destruction. Through its ability to impede the spread of specific nucleic acid sequences, the CRISPR/Cas systems might
be exploited to block the dissemination of antibiotic-resistance markers.

ARTICLE TOOLS http://science.sciencemag.org/content/327/5962/167

SUPPLEMENTARY http://science.sciencemag.org/content/suppl/2010/01/05/327.5962.167.DC1
MATERIALS

RELATED file:/content
CONTENT

REFERENCES This article cites 36 articles, 10 of which you can access for free
http://science.sciencemag.org/content/327/5962/167#BIBL

PERMISSIONS http://www.sciencemag.org/help/reprints-and-permissions

Use of this article is subject to the Terms of Service

Science (print ISSN 0036-8075; online ISSN 1095-9203) is published by the American Association for the Advancement of
Science, 1200 New York Avenue NW, Washington, DC 20005. 2017 © The Authors, some rights reserved; exclusive
licensee American Association for the Advancement of Science. No claim to original U.S. Government Works. The title
Science is a registered trademark of AAAS.