Original Article

Line probe assay for detection of rifampicin and isoniazid

resistant tuberculosis in Pakistan
Joveria Qais Farooqi,1 Erum Khan,2 Syed Muhammed Zaheer Alam,3 Asho Ali,4 Zahra Hasan,5 Rumina Hasan6
Department of Pathology Microbiology,1,4-6 School of Nursing,2 Aga Khan University Hospital.
Sales Agency Pakistan of Hain Lifescience, Gulistan-e-Jauhar, University Road, Karachi.3
Corresponding Author: Rumina Hasan. Email: rumina.hasan@aku.edu

Abstract
Objective: To assess the efficacy of a line-probe assay ∆ (LiPA) as rapid diagnostic test for early detection of
drug-resistant tuberculosis compared to conventional susceptibility methods in Pakistan.
Methods: Resistance to rifampicin (RIF) and isoniazid (INH) in 108 smear-positive pulmonary tuberculosis
samples was detected using a line-probe assay [GenoType® MTBDRplus (Hain Lifescience, GmbH, Nehren,
Germany)] at the clinical microbiology laboratory of Aga Khan University Hospital in May, 2009. Results were
compared with susceptibilities performed while using agar proportion.
Results: In comparison to the agar proportion method, the detection rate and specificity of resistance using
MTBDR plus was 92.5% and 98.2% for rifampicin, and 76.3% and 100% for isoniazid.
Mutations in codons 531 and 533 of rpoB gene (62%S531L) were responsible for 67.9% of rifampicin resistance.
S315T mutation of katG gene was detected in 55.9% and inhA promoter mutation at positions -15 (C15T) in
11.9% of isoniazid resistant isolates. Four phenotypically rifampicin-resistant and 14 isoniazid-resistant strains
were not detected by MTBDRplus. Sequencing these strains revealed mutations in 4 strains; 2 in rpoB gene
S531W, del518 and 2 in katG genesW300L, S315N. Hence, two phenotypic rifampicin-resistant and 13
phenotypic isoniazid-resistant strains were not detected by the commercial line probe assay.
Conclusion: The study showed that MTBDRplus had a high detection rate for rifampicin resistance. However,
additional probes need to be included in the assay to improve the detection of isoniazid-resistant mycobacterium
tuberculosis strains in Pakistan.
Keywords: Rifampicin, Isoniazid, Tuberculosis, MTBDRplus, Pakistan. (JPMA 62: 767; 2012)

Introduction common reported mutations. The World Health Organisation

recommended the use of line-probe assays (LiPA) for smear-
Tuberculosis is a major public health problem in
positive pulmonary specimens in a 2008 policy statement.5 It
Pakistan with an estimated prevalence of 355/100000 and a
also emphasised the need for their evaluation in different
mortality rate of 33/100000.1 Multi-drug resistant
epidemiological settings. GenoType® MTBDRplus is one
tuberculosis (MDR-TB), defined as mycobacterium
such commercially available assay which has been previously
tuberculosis (MTB) resistant to both isoniazid and rifampicin,
evaluated in Europe, South Africa, Far East and North
is a worldwide problem with an estimated 14 million cases in
America.6-10 While sensitivity of rifampicin resistance
2009.1 The rate of MDR-TB in Pakistan is reported to be
detection by this method has been reported to be as high as
between 1.8% of the new TB cases.2 94-100%, that for isoniazid has remained low with a reported
Rapid molecular methods for the diagnosis of range of 57-95%.4 Majority of this data has been reported
isoniazid and rifampicin resistance in MTB are based on the from regions mentioned above and some from China,
detection of genetic mutations. Mutation in the rpoB gene Thailand and Vietnam.8-10 There is, however, no information
encoding β-subunit of RNA polymerase is estimated to be on its performance in South Asia (Pakistan, Iran, India and
responsible for 95% of rifampicin resistance.3 Mutations in Bangladesh). Thus, there is a need for evaluation of this
katG, inhA, kasA, oxyR and ahpC result in isoniazid important tool in these TB endemic regions.
resistance with 60-90% of mutations attributed to codon 315 In a study of 62 MDR isolates from Pakistan Ali et al.
of katG, and in the promoter region of inhA.4 reported that 90% of RIF-resistant mutations were in the
Commercial assays for rapid detection of isoniazid mutational hot spot region of rpoB gene, while 77% of INH-
and rifampicin resistance rely on a selected number of resistant mutations were in the hot spot regions of katG gene

Vol. 62, No. 8, August 2012 767

with 1.6% in inhA promoter region.3 Indian reports of MDR positive for mycobacteria were tested for susceptibility to
strains in Delhi showed that rpoB and katG mutations were rifampicin (1.0 µg/ml) and isoniazid (0.2 and 1.0 µg/ml) by
variable, with S531L rpoB and S315T katG being agar proportion method. Susceptibility results were read at 2
predominant.11 and 3 weeks. All isolates were saved at -80?C.
Apart from rapid detection of MDR isolates, LiPAs LiPA was performed using GenoType® MTBDRplus
play a significant role in the detection of hetero-resistance; according to the manufacturer's instructions. Briefly, 0.5 ml
whereby both wild type and mutant genes are detected within of decontaminated AFB smear-positive sputum, TA or BAL
the same specimen. Hetero-resistance is a preliminary stage specimen was centrifuged, heat inactivated, sonicated and re-
towards full resistance.12 Its detection using conventional centrifuged. Supernatant (100µl) was saved as the extracted
drug susceptibility method is labour-intensive. Hence, LiPA DNA. Quality and quantity of DNA was assessed on
is definitely advantageous due to its rapid detection NanoDrop™ 1000 Spectrophotometer (Thermo Fischer
capacity.12,13 Scientific) before running multiplex-PCR on 5µl of DNA
using primers and de-oxyribonucleotide precursors provided
In the present study, sensitivity and specificity of
by Hain Lifescience (Nehren, Germany), as part of the kit.
LiPA (GenoType® MTBDRplus) in detecting RIF and INH
Amplicons were then hybridised to the DNA probe-labelled
resistant MTB strains from smear-positive pulmonary
strip provided in Genotype® MTBDRplus assay. The assay
samples from Pakistan were compared with the conventional
included conjugate, amplification and gene locus control for
susceptibility method. Frequencies of mutations in rpoB,
M. tuberculosis-complex, rpoB, katG and inhA.
katG and inhA genes in MTB detected within the study
isolates were analyzed and isolates showing hetero-resistance While interpretating the data, an isolate was
were identified. considered sensitive if all wild type probes tested positive and
there was no hybridisation with mutation detection probes.
Materials and Methods The absence of at least one wild type probe indicated
The Clinical laboratories of Aga Khan University resistance of the tested strain to the respective antibiotic.
Hospital (AKUH) receive specimens from all major cities of Hetero-resistance was defined when bands for both wild type
Pakistan; and the average volume of samples for TB smear and mutation probes were detected simultaneously in a
and cultures is around 200/week. The present cross-sectional specimen.12
study was conducted after due approval was obtained from Gene sequencing for katG and rpoB was also done.
the Ethics Review Committee at the Clinical Microbiology For the purpose, isolates giving discordant results between
Laboratory of AKUH in May 2009, involving 111 pulmonary phenotypic susceptibility and LiPA were revived on 7H10
samples (sputa, tracheal aspirates and bronchoalveolar lavage agar for re-testing by phenotypic method and nucleic acid
fluid) submitted for Acid Fast Bacilli (AFB) smear and sequencing. A loopful of bacteria was suspended in 300- µl of
culture. The samples were randomly selected based on AFB molecular grade water, heat inactivated, sonicated and
smear positivity. Smear-positive decontaminated pulmonary centrifuged. Supernatant was used as DNA template and
samples were simultaneously tested for LiPA and cultured for amplification was performed by using specific cycles14 on a
phenotypic drug susceptibility. Phenotypic results were used Perkin Elmer thermocycler. Primers (rpoB F:
as the gold standard. Of the total 111 samples, 108 results GACGACATCGACCACTTC, rpoB R:
were included in the final analysis. Three specimens were GGTCAGGTACACGATCTC, katG F:
excluded; one yielding a growth of non-TB mycobacteria, CCATGGCCGCGGCGGTCGACATT, katG R:
and two due to un-interpretable results. GTCAGTGGCCAGCATCGTCGGGGA) were for 81 base-
The pulmonary samples were decontaminated with pair hyper-variable region of rpoB, and codon 315 of katG
1% NALC/NaOH and centrifuged. Auramine-rhodamine gene. Amplicons were purified using the QIA quick Qiagen
fluorescent AFB smear was read and the specimen inoculated PCR purification kit. The purified amplicons were shipped to
onto Lowenstein-Jensen (LJ) slant and MGIT (Becton Macrogen Incorporated, South Korea for DNA sequencing.
Dickinson Diagnostic Instruments Systems, Sparks, MD, Sequencing results were analysed upon comparison with
USA) supplemented with oleic acid-albumin-dextrose- MTB wild type strains by BLAST software from the NCBI
catalase (OADC) and PANTA (polymyxin B, amphotericin web link (www.ncbi.nlm.nih.gov/BLAST). Amplicons of the
B, nalidixic acid, trimethoprim and azlocillin). Positive- three strains showing rare mutations; W300L of katG, 518
signalling MGITs were removed daily and sub-cultured on deletion and H526N of rpoB - were re-sequenced to confirm
7H10 agar while LJ slants were observed weekly for the presence of mutations.
mycobacterial growth. Mycobacterium tuberculosis was Descriptive analysis was performed using SPSS
identified by susceptibility to PNB 0.5 mg/ml. Cultures version 17.0.

768 J Pak Med Assoc

 Results 5.7% RIF-resistant MTB strains, followed by H526Y (3.8%)
and combined H526Y, S531L in 1.9% of the tested strains.
A total of 111 AFB smear-positive decontaminated
Twenty-four percent (13/53) RIF-resistant strains had
pulmonary samples were tested with GenoType®
mutations that could not be identified specifically. Missing
MTBDRplus. Three specimens were excluded; one yielding
bands on the wild type region of these strains but no
a growth of non-tuberculous mycobacteria, and two due to
hybridisation with mutation probes suggested resistance due
un-interpretable results. This left 108 results for the final
to mutations other than those included in this assay. One RIF-
analysis (107 sputa, 1 BAL). Of these, 56 were from females
sensitive strain showed mutation H526Y.
(female/male ratio was 1.08). Age ranged from 10 to 86 years
(Mean 33.67 ±15.59 years). Isoniazid (INH) resistance due to katG mutation
S315T (AGC
ACC) was found in 55.9% of INH-resistant
While phenotypic proportion method identified
MTB; 11.8% had mutation -15 (C
T) of inhA promoter
49.1% and 54.6% of the 108 strains as resistant to RIF and
region (Table-2). One strain showed S315T (AGC
AAC)
INH respectively (Table-1), using the LiPA, the
mutation of katG gene.
corresponding resistance rates were 47.2% and 41.7%.
MTBDRplus failed to detect 3.7% (n=3) of RIF and 23.7% Four strains failed to show resistance pattern on
(n=14) INH-resistant strains. MTBDRplus assay, but were detected resistant to rifampicin
by phenotypic method. Twenty-four percent (14/59) of
Five strains identified as sensitive to both RIF and
phenotypically INH-resistant strains did not show any
INH by MTBDRplus assay failed to grow on culture and
reaction with the mutation probes.
could not be verified by the phenotypic method. However, the
MTBDRplus findings were supported by the positive Four samples showed hetero-resistance; two with
response to first-line anti-tuberculous drugs in these patients. katG mutations at S315T, one with rpoB mutation at D516V,
and one with multiple mutations at H526Y and S531L of
The most common genetic mutation conferring RIF
rpoB gene. All the four tested resistant by phenotypic drug
resistance was S531L of rpoB gene, detected in 62.3% of
susceptibility testing.
RIF-resistant strains (Table-2). The next most frequent rpoB
mutation encountered was D516V which was detected in DNA sequencing analysis (Table-3) of the rpoB gene

Table-1: Comparison of LiPA and phenotypic susceptibility for INH and RIF resistance.

Resistance LiPA Phenotypic method Sensitivity* of Specificity* of

rates n (%) n (%)` LiPA (n) LiPA (n)

RIF 51 (47.2) 53 (49.1) 92.5% 98.2%

INH 45 (41.75) 59 (54.6) 76.3% 100%
Hetero-resistance 4 (3.7) - - -
Note: Overall agreement rate was 84.26% (91/108). (LiPA: Line probe assay, LiPA: Line Probe Assay. RIF: Rifampicin, INH: isoniazid.

Table-2: Frequencies of rpoB, katG and inhA mutations detected through LiPA.

LiPA probes Mutation Site n (%) Specific Mutation detected n (%)

rpoB
WT 8 531, 533 36 (67.9)
MUT 3 S531L 33 (62.3)
WT 3, 4 513-6, 516-8 6 (11.3)
MUT 1 D516V 3 (5.7)
WT 2, 3 510-3, 513-6 4 (7.5)
WT 7 526 3 (5.6)
MUT 2A H526Y 2 (3.8)
WT 1, 2, 8 505-9,510-3, 531,533 1 (1.9)
katG
WT 315 39 (66.1)
MUT1 S315T (ACG
ACC) 33 (55.9)
MUT 2 S315T (ACG
AAC) 1 (1.7)
inhA regulatory sequence
WT 1 -15,-16 7 (11.9)
MUT 1 -15 (C
T) 6 (10.2)
Note: 12 out of 53 RIF-resistant strains showed loss of wild type but no known mutations.

Vol. 62, No. 8, August 2012 769

Table-3: rpoB and katG gene mutations identified in hot spot regions that reported from Europe, Africa, USA and Southeast
of five MTB strains.
Asia4,8,10,15 but comparable to data published from China.9
Strain Number rpoB mutations This could be due to the prevalence of similar strains within
this region as supported by the detection of common
Codon number 516 mutations among the MTB isolates from these countries.
517 518 519//...//525 526 527……..…530 531 532//
Amino acids Mutation in the rpoB gene is responsible for majority
D Q N N T H K L S A of RIF resistance in MTB.3 Most of our isolates showed
83 (del518) CTGGTCTTG//…//TGGGTGTTC… mutation at codon S531L of rpoB gene, consistent with
GACAGCCGC//…. D Q  N T H K
L S A previous reports from Pakistan,3 other countries in the Eastern
135 (S531W) CTGGTCTTGTTG//…//TGGGTGTTC… Mediterranean Region,16,17 Fareast9,10 and South Africa.7
GACACCCGC//… D Q N N T H K
L W A Mutation rates in the rpoB gene D516V and H526Y
137 (H526N)C T G G T C T T G T T G / / … / / T G G T T G T T C … were much lower in our study compared to rates of 44% and
GACAGCCGC//… D Q N N T N K 15% respectively reported from Europe.18 Higher mutation
L S A
rates in rpoB codon 526 are also reported from India (19%),
Strain Number katG mutations Pakistan (22.5%) and Iran (45.6%).3,19,20 This difference may
be due to smaller sample sizes and different methodologies
Codon number 298 299 300 301//...//313 314 315 316//… used to detect mutation in these studies.
Amino acids L G W K I T S G
139 (S315N) AACCCGACCTTC//…//TAGTGGTTGCCG//… The present study identified 11 strains with multiple
L G W K I T N G mutations in the Rifampicin Resistance Determining Region
143 (W300L) AACCCGAACTTC//…//TAGTGGTCGCCG//…
L G L K I T S G
(RRDR). Multiple mutations in rpoB gene have been
NOTE: Nucleotides in bold denote mutations found in resistant clinical strains of
reported previously from other regions in Asia.21 Such
MTB compared to MTB H37Rv. Nucleotides underlined denote mutations in multiple mutations are associated with high-level resistance
phenotypically susceptible clinical MTB isolate compared to H37Rv.  = Deletion to RIF.20
S531W mutation of rpoB gene detected through
Table-4: Discrepant phenotypic and genotypic results based on rpoB sequencing of RIF-resistant isolate, but not by MTBDRplus,
and katG testing of strains.
is a rare mutation which has been associated with MDR-TB
Gene Mutation n LiPA Phenotypic susceptibility outbreak.22 This mutation lies within the hot spot region
covered by probe WT 8 of MTBDRplus for rpoB codon 531
rpoB del518 1 Sensitive Resistant and should have been detected by the assay. The fact that it
H526N 1 Resistant Sensitive
S531W 1 Sensitive Resistant was not detected highlights the limitation of LiPA.
katG S315N 1 Sensitive Resistant Another rpoB mutation not detected by LiPA was a
W300L 1 Sensitive Resistant
deletion at rpoB 518. This region of the rpoB gene is situated
Note: Sequencing established that 2 RIF-resistant and 13 INH-resistant strains did not
have mutations in the hot spot regions of rpoB and katG genes covered by LiPA. between two probes (WT 4 and 5) and, thus, can be missed due
to their overlap. Deletion at rpoB 518 is a rare mutation and has
previously been reported as missed by another line probe test,
illustrated that one RIF-resistant strain had a deletion at
the Inno-LiPA Rif.TB, (Innogenetics, Belgium).23 Deletion at
codon 518 and another at codon 531. The results were further
518 has also been reported from other Asian countries.24 One
compared with genotypic and phenotypic data obtained from
the strains (Table-4) and it was found that certain resistance of our phenotypic RIF-susceptible strains showed an H526Y
was not detected by LiPA. One phenotypic RIF-susceptible mutation in rpoB gene confirmed by DNA sequencing. Silent
strain which revealed rpoB mutation H526Y on LiPA was mutations within the RRDR of the rpoB gene have been
confirmed on DNA sequencing. katG mutations, S315N and reported,21 though codon 526 mutations are very strongly
W300L were identified in one INH-resistant isolate each. associated with RIF resistance. However, Van Deun et al report
Thus, in 13 INH-resistant and two RIF-resistant isolates in mutations at codon 526 in Bangladeshi strains which tested
our study sample, no mutations in katG codon 315 and 81 bp susceptible on growth-based susceptibility method and were
hot spot region of rpoB were found on DNA sequencing. classified as probably resistant.25
The assay failed to detect 23.7% of isoniazid resistant
Discussion strains in our samples, lowering the detection rate of MDR-
The sensitivity of line-probe assay for detection of TB, resistant to both RIF and INH, to just 71.7%. Isoniazid
rifampicin resistance varies from region to region. In our resistance detection rate of 76% in our sample is consistent
study, sensitivity was found to be 92.5%, that is, lower than with a sensitivity of 78.5% for the assay reported from China,

770 J Pak Med Assoc

though not from South Africa.7,9 A probable explanation for was supported through grants from the Joint Pakistan-US
this could be a difference in the prevalent strains in different Academic and Research Program HEC/MoST/USAID.
regions and their associated mutations. Conversely, high
prevalence of Beijing strains in China, as opposed to Central References
Asian Strain-1 in Pakistan and India,3,9,11 does not seem to 1. World Health Organization. WHO Report 2010 Global Tuberculosis Control.
Geneva: WHO. (Online). (Cited 2010 Dec 20). Available from URL:
affect the spectrum of rpoB and katG mutations in the region. http://www.who.int/tb/publications/global_report/2010/en/index.html.
Earlier study on INH-resistant strains from Pakistan 2. Javaid A, Hasan R, Zafar A, Ghafoor A, Pathan A, Rab A, et al. Prevalence of
primary multidrug resistance to anti-tuberculosis drugs in Pakistan. Int J
reported 63% mutation at codon 315 of katG mutation.3 This Tuberculosis and Lung Dis 2008; 12: 326-31.
is lower than the rate of this mutation detected in our study 3. Ali A, Hasan Z, Moatter T, Tanveer M, Hasan R. M. tuberculosis Central Asian
(66.1%). This difference can be attributed to a smaller sample Strain 1 MDR isolates have more mutations in rpoB and katG genes compared
with other genotypes. Scand J Infect Dis 2009; 41: 37-44.
size and a different methodology used in the previous study. 4. Ling DI, Zwerling AA, Pai M. GenoType MTBDR assays for the diagnosis of
Our rates, however, fell within the wide range of S315T multidrug-resistant tuberculosis: a meta-analysis. Eur Respir J 2008; 32: 1165-74.
mutation rates (54 to 92%) quoted in studies from China, 5. World Health Organization. Molecular line probe assays for rapid screening of
patients at risk of multidrug-resistant tuberculosis (MDR-TB). Geneva: WHO.
Vietnam and Egypt.10,17,26 Additionally, Ali et al detected (Online) (Cited 2011 Apr 15). Available from URL:
inhA promoter region mutation in only 1/62 MDR isolates http://www.who.int/tb/features_archive/policy_statement.pdf.
tested, while this study identified 11.9% of INH-resistant 6. Miotto P, Piana F, Penati V, Canducci F, Migliori GB, Cirillo DM. Use of
genotype MTBDR assay for molecular detection of rifampin and isoniazid
isolates with mutation at this locus. Wu et al from China have resistance in Mycobacterium tuberculosis clinical strains isolated in Italy. J Clin
reported similar rates of inhA mutation at 17%.26 Microbiol 2006; 44: 2485-91.
7. Barnard M, Albert H, Coetzee G, O'Brien R, Bosman ME. Rapid molecular
Among the phenotypic INH-resistant strains, one was screening for multidrug-resistant tuberculosis in a high-volume public health
found with W300L and another with S315N mutation upon laboratory in South Africa. Am J Respir Crit Care Med 2008; 177: 787-92.
katG sequencing. Though codon 300 of katG lies beyond the 8. Anek-Vorapong R, Sinthuwattanawibool C, Podewils LJ, McCarthy K,
Ngamlert K, Promsarin B, et al. Validation of the GenoType MTBDRplus assay
hot spot of mutations, W300L has been reported as a rare for detection of MDR-TB in a public health laboratory in Thailand. BMC Infect
mutation in MTB strains from Myanmar.15 Sequencing for Dis 2010; 10: 123.
katG mutations in our samples confirmed that 13/14 INH- 9. Huang WL, Chen HY, Kuo YM, Jou R. Performance assessment of the
GenoType MTBDRplus test and DNA sequencing in detection of multidrug-
resistant strains which were not detected by MTBDRplus did resistant Mycobacterium tuberculosis. J Clin Microbiol 2009; 47: 2520-4.
not harbour mutations at codon 315, the locus targeted by 10. Huyen MN, Tiemersma EW, Lan NT, Cobelens FG, Dung NH, Sy DN, et al.
MTBDRplus. Resistance in such strains may be due to Validation of the GenoType MTBDRplus assay for diagnosis of multidrug
resistant tuberculosis in South Vietnam. BMC Infect Dis 2010; 10: 149.
mutations in regions other than codon 315 of katG (W300L
11. Stavrum R, Myneedu VP, Arora VK, Ahmed N, Grewal HMS. In-depth
in one of our isolates) or positions -15, -16 and -8 in the inhA molecular characterization of Mycobacterium tuberculosis from New Delhi-
promoter region; or because of mutations in genes not predominance of drug resistant isolates of the 'modern'(TbD1?) type. PloS One
2009; 4: e4540.
represented on the test strip, such as ahpC, kasA, oxyR, and
12. Hofmann-Thiel S, van Ingen J, Feldmann K, Turaev L, Uzakova GT,
ndh, as suggested by Miotto et al and Anek-Vorapong et al.8,18 Murmusaeva G, et al. Mechanisms of heteroresistance to isoniazid and rifampin
Further studies are required to assess the presence and rates of Mycobacterium tuberculosis in Tashkent, Uzbekistan. Eur Respir J 2009; 33:
of mutations within these genes so that they may be included 368-74.
13. Rinder H. Hetero-resistance: an under-recognised confounder in diagnosis and
in rapid assays for the detection of INH resistance. therapy? J Med Microbiol 2001; 50: 1018-20.
14. Ahmad S, Fares E, Araj G, Chugh T, Mustafa A. Prevalence of S315T mutation
Conclusion within the katG gene in isoniazid-resistant clinical Mycobacterium tuberculosis
isolates from Dubai and Beirut. Int J Tuberculosis and Lung Dis 2002; 6: 920-6.
The line-probe assay, GenoType® MTBDRplus, for 15. Valvatne H, Syre H, Kross M, Stavrum R, Ti T, Phyu S, et al. Isoniazid and
rapid detection of anti-mycobacterial resistance detected only rifampicin resistance-associated mutations in Mycobacterium tuberculosis
76.3% of INH-resistant MTB strains. The detection rate of RIF isolates from Yangon, Myanmar: implications for rapid molecular testing. J
Antimicrob Chemother 2009; 64: 694-701.
resistance was >90%. This indicates the limitation of LiPA for 16. Ozkutuk N, Gazi H, Surucuoglu S, Gunduz A, Ozbakkaloglu B.
use in this region, and the need for additional probes to Characterization of rpoB mutations by line probe assay in rifampicin-resistant
improve the sensitivity of the assay for local strains in Pakistan. Mycobacterium tuberculosis clinical isolates from the Aegean region in Turkey.
Jpn J Infect Dis 2007; 60: 211.
17. Amina A, Hassan EG, Mohammad Z, mashad Noha E, Ehab B, Amal F.
Acknowledgements Genotypic detection of rifampicin and isoniazid resistant Mycobacterium
We would like to thank Sana Jafri, Akbar Kanji, tuberculosis strains by DNA sequencing: a randomized trial. Ann Clin
Microbiol Antimicrob 2009; 8.
Maqboola Dojki and the AKUH Clinical Microbiology 18. Miotto P, Saleri N, Dembelé M, Ouedraogo M, Badoum G, Pinsi G, et al.
Laboratory for their technical support. Molecular detection of rifampin and isoniazid resistance to guide chronic TB
patient management in Burkina Faso. BMC Infect Dis 2009; 9: 142.
Sources of Support: 19. Mani C, Selvakumar N, Narayanan S, Narayanan PR. Mutations in the rpoB
gene of multidrug-resistant Mycobacterium tuberculosis clinical isolates from
Hain Lifescience provided free of charge Genotype India. J Clin Microbiol 2001; 39: 2987-90.
MTBDRplus® kits and reagents for this research. This study 20. Bahrmand AR, Titov LP, Tasbiti AH, Yari S, Graviss EA. High-level rifampin

Vol. 62, No. 8, August 2012 771

 resistance correlates with multiple mutations in the rpoB gene of pulmonary tuberculosis isolates from New York City. J Clin Microbiol 1997; 35: 1281-3.
tuberculosis isolates from the Afghanistan border of Iran. J Clin Microbiol 2009; 24. Prammananan T, Cheunoy W, Taechamahapun D, Yorsangsukkamol J,
47: 2744-50. Phunpruch S, Phdarat P, et al. Distribution of rpoB mutations among multidrug-
21. Ramasoota P, Pitaksajjakul P, Phatihattakorn W, Pransujarit V, Boonyasopun J. resistant Mycobacterium tuberculosis (MDRTB) strains from Thailand and
Mutations in the rpoB gene of rifampicin-resistant Mycobacterium tuberculosis development of a rapid method for mutation detection. Clin Microbiol Infect
strains from Thailand and its evolutionary implication. Southeast Asian J Trop 2008; 14: 446-53.
Med Public Health 2006; 37: 136-47. 25. Van Deun A, Barrera L, Bastian I, Fattorini L, Hoffmann H, Kam K, et al.
22. Jenkins C, Claxton AP, Shorten RJ, McHugh TD, Gillespie SH. Rifampicin Mycobacterium tuberculosis strains with highly discordant rifampin
resistance in tuberculosis outbreak, London, England. Emerg Infect Dis 2005; susceptibility test results. J Clin Microbiol 2009; 47: 3501-6.
11: 931-4. 26. Wu X, Lu Y, Zhang J, Liang J, Li H, Zhang G, et al. Detection of the mutations
23. Cooksey RC, Morlock GP, Glickman S, Crawford JT. Evaluation of a line probe in katG 315 and inhA-15 of Mycobacterium tuberculosis strains isolated
assay kit for characterization of rpoB mutations in rifampin-resistant Mycobacterium fromChinese patients. Chin Med J (Engl) 2006; 119: 230-3.

772 J Pak Med Assoc