Citation: Molecular Therapy—Nucleic Acids (2015) 4, e268; doi:10.1038/mtna.2015.

42
Official journal of the American Society of Gene & Cell Therapy All rights reserved 2162-2531/15
www.nature.com/mtna

CCR5 Disruption in Induced Pluripotent Stem Cells Using

CRISPR/Cas9 Provides Selective Resistance of Immune
Cells to CCR5-tropic HIV-1 Virus
HyunJun Kang1, Petra Minder2, Mi Ae Park1, Walatta-Tseyon Mesquitta1, Bruce E Torbett2 and Igor I Slukvin1,3

The chemokine (C-C motif) receptor 5 (CCR5) serves as an HIV-1 co-receptor and is essential for cell infection with CCR5-tropic
viruses. Loss of functional receptor protects against HIV infection. Here, we report the successful targeting of CCR5 in GFP-
marked human induced pluripotent stem cells (iPSCs) using CRISPR/Cas9 with single and dual guide RNAs (gRNAs). Following
CRISPER/Cas9-mediated gene editing using a single gRNA, 12.5% of cell colonies demonstrated CCR5 editing, of which 22.2%
showed biallelic editing as determined by a Surveyor nuclease assay and direct sequencing. The use of dual gRNAs significantly
increased the efficacy of CCR5 editing to 27% with a biallelic gene alteration frequency of 41%. To ensure the homogeneity
of gene editing within cells, we used single cell sorting to establish clonal iPSC lines. Single cell-derived iPSC lines with
homozygous CCR5 mutations displayed the typical characteristics of pluripotent stem cells and differentiated efficiently into
hematopoietic cells, including macrophages. Although macrophages from both wild-type and CCR5-edited iPSCs supported
CXCR4-tropic virus replication, macrophages from CCR5-edited iPSCs were uniquely resistant to CCR5-tropic virus challenge.
This study demonstrates the feasibility of applying iPSC technology for the study of the role of CCR5 in HIV infection in vitro,
and generation of HIV-resistant cells for potential therapeutic applications.
Molecular Therapy—Nucleic Acids (2015) 4, e268; doi:10.1038/mtna.2015.42; published online 15 December 2015
Subject Category: Therapeutic proof-of-concept Gene insertion, deletion & modification

Intoduction transcription activator-like effector nucleases (TALENs) and

PiggyBac technology or clustered regularly interspaced
The chemokine receptor 5 (CCR5) binds RANTES (CCL5), short palindromic repeats (CRISPR)-associated protein-9
MIP1α (CCL3), and MIP1β (CCL4) cytokines1 and plays (Cas9) gene-editing systems combined with PiggyBac
an important role in mounting an inflammatory response to technology.6 Herein, we evaluated the efficacy of using
infection. The discovery that CCR5 serves as a coreceptor CRISPR/Cas9 to edit the CCR5 gene in iPSCs and com-
for R5-HIV-1 virus, coupled with the findings that individu- pared single with dual guide RNA (gRNA) strategies for
als lacking CCR5 are protected from HIV infection,2 led to CCR5 disruption to protect cells from HIV-1 using CCR5 for
the exploration of novel therapeutic strategies for HIV infec- entry. We found that the dual gRNA approach significantly
tion based on disruption of CCR5 function. Transplantation of increased the frequency of biallelic CCR5 gene editing
hematopoietic stem cells with a CCR5-Δ32 mutation to a leu- without compromising specificity. To ensure the homogene-
kemic, HIV-positive patient cured both HIV and leukemia,3,4 ity of gene editing within cells, we used single cell sorting to
thus underscoring the therapeutic power of CCR5-disrupted establish clonal iPSC lines. These cell lines maintained the
immune cells for resisting HIV-1, and importantly, contribut- typical characteristics of pluripotent stem cells and differ-
ing to a cure. Conversion of autologous human adult cells entiated efficiently into hematopoietic cells. Although prior
to induced pluripotent stem cells (iPSCs) provides a unique studies have demonstrated resistance of macrophages
opportunity to produce different types of gene-edited cells from CCR5-mutant iPSCs to CCR5-tropic virus,6 it remains
since iPSCs can be expanded for long periods of time ex unclear whether this resistance is due to the effect of CCR5
vivo, genetically modified using homologous recombination, mutation on macrophage development from iPSCs, thereby
clonally selected, and differentiated to almost any type of cell affecting their capacity to support any type of infection, or if
in the human body. Thus, iPSCs have emerged as a promis- this mutation confers a selective protection to CCR5-tropic
ing option for providing HIV-resistant immune cells for cellular viruses. In this study, we demonstrated that macrophages
therapies. from both wild-type and CCR5-edited iPSCs supported
Recently, successful disruption of CCR5 gene func- CXCR4-tropic virus replication. However, macrophages
tion has been reported in human pluripotent stem cells from CCR5-edited iPSCs were uniquely resistant to CCR5-
using zinc finger nucleases (ZFNs)5 and a combination of tropic virus challenge.

The last two authors are co-senior authors.

1
National Primate Research Center, University of Wisconsin Graduate School, Madison, Wisconsin, USA; 2Department of Molecular and Experimental Medicine, The
Scripps Research Institute, La Jolla, California, USA; 3Department of Pathology and Laboratory Medicine, University of Wisconsin Medical School, Madison, Wisconsin,
USA. Correspondence: Igor I Slukvin, Department of Pathology and Laboratory Medicine, University of Wisconsin, 1220 Capitol Court, Madison, Wisconsin 53715, USA.
E-mail: islukvin@wisc.edu and Bruce E Torbett, Department of Molecular and Experimental Medicine, The Scripps Research Institute, La Jolla, California 92037, USA.
E-mail: betorbet@scripps.edu
Keywords: CCR5; CRISPR/Cas9; hematopoietic cells; HIV; induced pluripotent stemcells
Received 29 September 2015; accepted 24 October 2015; published online 15 December 2015. doi:10.1038/mtna.2015.42
 CCR5 Disruption in iPSCs
Kang et al.
2

Results CCR5 locus targeting using dual gRNAs

CCR5 locus targeting using a single gRNA Recently, several CRISPR/Cas9 studies have reported that
A DF19-9-7T transgene-free fibroblast-derived iPSC line, the simultaneous use of dual gRNAs results in a much better
obtained using episomal vectors as previously described,7 targeting efficiency and specificity when compared with the
was utilized to generate hematopoietic derivatives. To track use of a single gRNA.9–12 Given that the activity of gRNA/
hematopoietic lineages in vitro derived from DF19-9-7T cells, Cas9 varies in different cell types,11,13 we next evaluated
we transfected the iPSCs with a Clover GFP plasmid. Follow- whether a dual gRNA strategy would be able to improve dis-
ing selection and screening of more than 20 cellular clones, ruption of the CCR5 locus in human iPSCs. We designed
we isolated a clone that retained GFP expression throughout CCR5 gRNA2 and gRNA3 with homology to genomic regions
all stages of hematopoietic differentiation, including mature that are ~500 bp downstream of the locus that was targeted
macrophages (Supplementary Figure S1) and subse- with gRNA1 and used the combinations gRNA1 with gRNA2,
quently used this clone for the generation of human iPSCs or gRNA3, to produce iPSC CCR5 mutants (Figure 2a).
with edited CCR5 alleles. Coincidently, gRNA2 that we designed was the same gRNA
To successfully alter CCR5 sufficiently to halt HIV-1 that Ye et al. used for their experiments.6 We found that com-
entry, a CCR5 CRISPR was developed with a single binatorial gRNA targeting was much more efficient for the
guide RNA (gRNA1), as previously reported8 (Table 1 and introduction of CCR5 editing when compared with a single
Figure 1a). The rationale for gRNA selection was that it gRNA. Using genomic DNA-PCR followed by sequenc-
must have homology to near the 5′ end of the open-read- ing (Figure 2b and Supplementary Figure S2), gRNA1/
ing frame of the CCR5 gene and should promote a frame- gRNA2 resulted in 30.8% mutated clones, whereas gRNA1/
shift of the entire CCR5 open-reading frame when active, gRNA3 resulted in 23.3% clones (Figure 2c). Approximately
thereby resulting in complete gene disruption. After trans- 40% of the mutant clones demonstrated biallelic mutations
fection of iPSCs with a single CCR5 gRNA1 and Cas9, (Figure 2c). Thus, dual gRNAs targeting and editing efficiency
288 colonies were selected and each cell colony was was two times greater than with a single gRNA system. As
analyzed by extraction of genomic DNA and amplification shown in Supplementary Figure S2, the use of dual gRNAs
of the CCR5 open-reading frame encompassing region targeting and editing resulted in ~500 bp deletions from the
followed by Surveyor nuclease assay (Figure 1b). We two gRNA combinations, with a cleavage site 3-nt upstream
found that 12.5% of the isolated iPSC colonies had evi- of the protospacer-adjacent motif sequence, 5′-NGG as
dence of CCR5 editing, of which 22.2% were found to be expected.14 Two clones, GFP-CCR5mut-hiPSC-Comb1-8
CCR5 biallelically edited (Figure 1c). Genomic sequenc- with a biallelic 517-nt deletion and GFP-CCR5mut-hiPSC-
ing further confirmed CCR5 gene disruption in the identi- Comb2-1 with a biallelic 551-nt deletion, were selected and
fied iPSCs clones. Single gRNA-targeting of CCR5 gene subjected to fluorescence-activated cell sorting–based auto-
varied from 1 to 19 nucleotide (nt) deletions, as well as mated single cell deposition to obtain GFP-CCR5mut-hiPSC-
substitutions resulting in a stop codon (Figure 1b). For Comb1-SC8 and GFP-CCR5mut-hiPSC-Comb2-SC1, both
further studies, two cell colonies were selected from the of which were single cell–derived iPSC lines. Both clonally
biallelic CCR5 disrupted iPSCs, GFP-CCR5mut-hiPSC-7 derived CCR5-edited cell lines retained pluripotency markers
with 7 bp- and 16 bp-mutations in each allele, and GFP- (Figure 2d), formed teratomas (Figure 2e), and displayed a
CCR5mut-hiPSC-8 with 10 bp- and 19 bp-mutations in normal karyotype (Figure 2f).
each allele. To ensure homogeneity, we generated clones
from both CCR5mut-iPSC lines using fluorescence-acti- Evaluation of off-targeting effects
vated cell sorting–based automated single cell deposition. The use of CRISPR/Cas9 for disrupting specific targets car-
The GFP-CCR5mut-hiPSC-SC7 and GFP-CCR5mut- ries a risk for off-target genomic mutations.15 To investigate
hiPSC-SC8 lines established from single cells retained potential off-target genomic events in our chosen CCR5-mut
expression of typical pluripotency markers (Figure 1d), iPSC clones, we selected 3-nt mismatch tolerance15,16 then
formed teratomas composed of the derivatives of all three utilized Cas-OFFinder,17 an online user-friendly software for
germ layers (Figure 1e), and maintained a normal karyo- mismatch off-target predictions, which identified 18, 12, and
type (Figure 1f). 22 potential off-target sites (OTSs) for gRNA1, gRNA2, and

Table 1 CCR5-targeting gRNAs and potential off-target sites

gRNAs gRNA1 gRNA2 gRNA3
Position in CDSa 30–52 548–570 582–604
Sequences of gRNAs TGACATCAATTATTATACATCGG CATACAGTCAGTATCAATTCTGG GACATTAAAGATAGTCATCTTGG
Sequences of potential TGACATCAcTTATTATgCATgGG KCNJ6 gATACAGTCAGTgTCAcTTCaGG ZMAT1-1b GACAaTAAAGAaAGcCATCTTGG CNNM2
OTSd with gene name TGACATaAATTATTcTACATgGG CNTNAP2 gATACAGTCAGTgTCAcTTCaGG ZMAT1-2b
CATACAGgtAGTATtAATTCaGG B3GNTL1
aATACAGTaAGTcTCAATTCaGG CEP85L
PAM sequences are displayed with underlines.
OTS, off-target sites; PAM, protospacer-adjacent motif.
a
Position 1 is the first nucleotide of the start codon, ATG. bThe exact same sequence is found from two location in exon 7 of the ZMAT1 gene, and numbers
were designated arbitrarily to distinguish two regions.

Molecular Therapy—Nucleic Acids

 CCR5 Disruption in iPSCs
Kang et al.
3

a b

lo 1

lo 2

lo 3

lo 4

lo 5
#6
gRNA1

#
+

e
ne

ne

ne

ne

ne
n
on

on

lo
C

C
CCR5-CDS

343 bp
290 bp
gRNA1

c
# Clones # (%) Total # (%) Biallelic mutant clones
assayed mutant clones among total mutant clones

288 36 (12.5) 8 (22.2)

d SC7 SC8
e
ML
OCT4 C
PA

NE
NE

NANOG

Endoderm and ectoderm Mesoderm and ectoderm

SOX2

1 2 3 4 5

SSEA4
6 7 8 9 10 11 12

TRA-1-81 13 14 15 16 17 18

19 20 21 22 X Y

Figure 1 Generation of CCR5-mut iPSC cell lines using single gRNA. (a) Schematic diagram of the target site of the gRNA1 in CCR5
gene. Protospacer-adjacent motif sequence is written in bold, and the target sequence of gRNA1 is underlined. (b) Detection of gRNA1/
Cas9-promoted CCR5 gene alterations. Surveyor nuclease assay was used to detect mutations caused by gRNA1/Cas9 system. The exact
sequence of the CCR5 mutation was determined by direct sequencing of multiple individual bacterial colonies transformed with T vector with
subcloned PCR product from the indicated iPSC lines. (c) Editing efficiency of single gRNA/Cas9. (d) Flow cytometric analysis of CCR5-mut
iPSCs established following single cell sorting. Plots depict isotype control (open) and specific antibody (gray) histograms. (e) Teratoma assay
shows derivatives of all three germ layers. C, cartilage; ML, melanocytes, NE, rosettes of neural epithelium; PA, pancreatic acininar cells.
(f) Karyotype of CCR5-mut iPSCs.

gRNA3, respectively. Among the OTSs theoretically possible sequencing are warranted to evaluate potential off-target
within the genome, several OTSs were chosen for evalu- genomic alterations. As reported, in vitro cleavage and deep
ation based on their potential impact on physical genomic sequencing was able to identify off-target cutting by gRNA,18
positions, such as potential promoter, exon, and intron dis- which was not detected using T7E1 assay in prior studies.8
ruptions (Table 1). However, utilizing the Surveyor nuclease
assay to identify potential OTSs mutations, we failed to iden- Hematopoietic differentiation of CCR5mut-iPSCs
tify genomic alterations at the OTSs selected for evaluation To determine whether iPSCs with an altered CCR5 gene
(Figure 3). Although genomic alterations were not identi- retain the capacity to differentiate into the blood cells,
fied in our limited study, further studies utilizing full genomic we evaluated the hematopoietic differentiation efficacy of

www.moleculartherapy.org/mtna
 CCR5 Disruption in iPSCs
Kang et al.
4

a d Comb1-SC8 Comb2-SC1

OCT4
gRNA2
gRNA1
517 nt

CCR5-CDS

551 nt
gRNA3

NANOG
b
#1

#2

#3

#4

#5

#6

#7

#8
e

e
n

n
lo

lo

lo

lo

lo

lo

lo

lo
C

SOX2
1,200 bp
1,000 bp

500 bp

SSEA4
c
gRNA # clones # (%) total # (%) biallelic mutant
combina- assayed mutant clones clones among total

TRA-1-81
tion mutant clones

Comb1
gRNA1/2 120 37 (30.8) 15 (40.5)

Comb2
gRNA1/3 120 28 (23.3) 12 (42.8)
f

e 1 2 3 4 5

ML RE

6 7 8 9 10 11 12
NE
C

13 14 15 16 17 18
RE

Ectoderm Mesoderm and endoderm

19 20 21 22 X Y

Figure 2 Generation of CCR5-mut iPSC cell lines using two gRNAs. (a) Schematic diagram of the CCR5 genomic target sites and genetic
distances of the combinatorial gRNAs; combination 1 (Comb1) is gRNA1 and gRNA2, and Comb2 is gRNA1 and gRNA3. (b) Detection of
large deletion caused by dual gRNAs/Cas9 cleavage. Genomic DNA-PCR analysis shows unaffected (1,265 bp), monoallelic (1,265 and
736 bp), and biallelic deletion (736 bp) of genomic alterations in clones isolated after transfection with Comb2-dual gRNAs/Cas9 plasmids.
Representative eight clones out of 120 clones obtained from dual gRNAs targeting are shown. (c) Editing efficiency of dual gRNA/Cas9.
(d) Flow cytometric analysis of CCR5-mut iPSCs established following single cell isolation. Plots depict isotype control (open) and specific
antibody (gray) histograms. (e) Teratoma assay shows derivatives of all three germ layers. C, cartilage; ML, melanocytes; NE, rosettes of neural
epithelium; RE, respiratory epithelium. (f) Karyotype of CCR5-mut iPSCs.

generated iPSC lines in coculture with OP9 stroma.19,20 As whether single or dual gRNA was used for genomic disrup-
shown in Figure 4, CCR5mut-iPSCs generated CD34+CD43+ tion (Figure 4b). Using a protocol established in our lab,21,22
hematopoietic progenitors with efficiency similar to that we generated macrophages from all cell lines for phenotypic
of paternal GFP-iPSCs (Figure 4a). Established cell lines evaluation. As shown in Figure 4c,d, macrophages obtained
also showed comparable clonogenic potential regardless of from both lines displayed typical macrophage morphology

Molecular Therapy—Nucleic Acids

 CCR5 Disruption in iPSCs
Kang et al.
5

a NL4-3 demonstrated fulminating viral infections within 3 days

-hiPSC-Comb1-SC8

-hiPSC-Comb2-SC1
(Figure 5c,d). Taken together, these results demonstrate that

GFP-CCR5mut

GFP-CCR5mut

GFP-CCR5mut

GFP-CCR5mut
CCR5-gene disrupted macrophages successfully generated

-hiPSC-SC7

-hiPSC-SC8
from CCR5 gene altered iPSCs were protected from CCR5-
Con +

Con −

tropic HIV-1 challenge.

KCNJ6

Discussion

CNTNAP2 Genetic modification of iPSCs is an attractive strategy to pro-

duce gene-corrected and gene-modified cells for research
and clinical purposes. In the context of generating methodol-
ogy and lines for clinical studies, it is imperative to precisely
modify the desired cellular genomic site without any accom-
b c panying off-target alteration(s) in the genome that might
B3GNTL1

ZMAT1-2

ZMAT1-1
CEP85L

CNNM2
promote harmful effects. Even at low rates, off-target altera-
Con +

Con +

tions in rare cells are transmissible to progeny and may hin-

der cell survival, proliferation, and differentiation and could
lead to a growth advantage and eventual malignant trans-
formation. Genome editing in iPSCs allows the opportunity
to significantly reduce or eliminate risks associated with off-
target mutations; iPSCs, in contrast to hematopoietic stem
GFP-CCR5mut-hiPSC-Comb1-SC8 GFP-CCR5mut-hiPSC-Comb2-SC1 and many progenitor cells isolated from individuals, can be
cloned and expanded after genetic modification and thor-
Figure 3 Surveyor nuclease assay for potential off-target oughly analyzed for genomic integrity, which may be neces-
mutation in selected CCR5-mut iPSC clones. Several genomic
off-target sites were predicted by Cas-OFFinder, online software; the sary for therapeutic applications.
Surveyor nuclease assay shows no off-target genomic alterations Several studies have reported successful CCR5 modifica-
during the gRNA/Cas9-mediated CCR5 editing. (a) Two predicted tion in human cells using TALENs,23–25 ZFNs,26 and CRISPR/
OTSs for gRNA1. (b) Four predicted OTSs for gRNA2. (c) One Cas9.6,8,11,27,28 With regard to strategies for genomic modifica-
predicted OTSs for gRNA3. Con+: amplified DNA fragment mixture
with only single base substitution provided by Surveyor Mutation
tion, the CRISPR/Cas9 system is convenient, flexible, and
Detection Kit (Transgenomics), Con-: amplified DNA product from more readily produced than TALEN and ZFN, since it uti-
parental GFP-iPSC cell line. lizes a fixed nuclease and requires the design of only 20-nt
sequence-matching gRNAs. Moreover, CRISPRs/Cas9 do
and expressed markers associated with macrophages, CD4, not necessitate de novo engineering of proteins for each
CD45, HLA-DR, and CD14, while retaining GFP expression. genomic target, as do TALENs and ZFNs, thereby making it
easier for multiplex genome engineering.29 It has also been
Selective resistance of CCR5mut macrophages to CCR5 reported that the CRISPR/Cas9 system can provide a high
tropic HIV-1 specificity of genomic editing and low off-target effects.30–32
The aim of our study was to generate CCR5-gene disrupted In this study, single or dual gRNA-guided Cas9 systems
iPSCs that when differentiated to hematopoietic cells would were employed to target and edit the CCR5 gene in iPSCs.
be resistant to CCR5-tropic HIV infection. Macrophages When a single gRNA was used, the editing efficiency was
obtained from GFP-CCR5mut-hiPSC-SC7 and GFP- 12.5%. This efficiency is comparable to that of Cho et al.,
CCR5mut-hiPSC-SC8 lines (generated using single gRNA) 10–18%, where the same gRNA, gRNA1, was used to target
or GFP-CCR5mut-hiPSC-Comb1-SC8 and GFP-CCR5mut- the genome in HEK293T cells.8 Ye et al.6 showed a much
hiPSC-Comb2-SC1 (generated using dual combination higher editing efficiency of CCR5 in hiPSCs, 25%, which may
gRNAs) were challenged with the HIV-1 R5-tropic isolates be attributed to the small number of clones analyzed or the
BaL-1 and SF162 at relatively high amounts, 350–400 pg/ different sequence of gRNA used, given targeting efficiency
culture, to evaluate protection from infection. To control for is mostly gRNA specific.33
HIV-1 specificity, the X4-tropic isolates, LAI and NL4-3, were Our findings demonstrate that a dual gRNA approach
utilized. Post exposure to HIV, supernatants were collected resulted in at least double the CCR5-editing activity in hiP-
for up to 20 days and evaluated for viral infection and replica- SCs of a single gRNA, thereby implying that the use of dual
tion by determination of p24 amounts. As shown in Figure 5, gRNA has superior editing activity when compared to single
R5-tropic virus replication, as judged by p24 production, was gRNA. Our results are consistent with several studies that
observed in parental macrophages after viral exposure within have reported the use of dual gRNAs resulting in higher edit-
3 days. In contrast, macrophages derived from the four iPSCs ing efficiency in the mouse embryo,12 HEK293 and HCT116
lines with CCR5 gene alterations did not demonstrate detect- cells9, primary human CD4+ T cells, and CD34+ hematopoi-
able p24 activity (assay sensitivity to 10 pg/ml p24) post- etic stem and progenitor cells,11 as well as Caenorhabditis
exposure to either CCR5-tropic HIV isolate (Figure 5a,b). elegans.34 Importantly, the use of dual gRNAs yielded a much
However, macrophages from all iPSC lines, irrespective of higher frequency of biallelic mutations (Figures 1c and 2c).
CCR5 alterations, exposed to the X4-tropic viruses LAI and Also, while the single gRNA elicited random insertions or

www.moleculartherapy.org/mtna
 CCR5 Disruption in iPSCs
Kang et al.
6

a 30 CD43+ hematopoietic progenitor

16.5 10.7 23.2 73.1 2.92

% of CD43+ cells
20

CD235aCD41a
10
CD43

CD43
69.3 3.41 5.81 18.2
0
CD34 SSC CD45

1
ta

SC

SC

C
en

-S

-S
r

b1

b2
Pa
b

om

om
200 E

C
G
M
GM
150
GEMM
c
CFUs/104 cells

100

50

0
l

1
ta

SC

SC

C
en

-S

-S
r

b1

b2
Pa

om

om
C

d 66.5

78.9

81

72

74.8
SSC

FSC CD45 CD14 HLA-DR CD4 GFP

Figure 4 Hematopoietic differentiation and generation of macrophages from CCR5mut iPSCs. (a) Multipotent hematopoietic
progenitors generated from parental and CCR5mut-hiPSCs. No significant differences were observed in the hematopoietic
differentiation efficiency of parental and CCR5mut-hiPSCs. SC7, GFP-CCR5mut-SC7-; SC8, GFP-CCR5mut-SC8-; Comb1-SC8,
GFP-CCR5mut Comb1-SC8-; Comb2-SC1, GFP-CCR5mut-Comb2-SC1-derived CD43+ hematopoietic progenitors. (b) Colony-forming
potential of hematopoietic progenitors generated from parental and CCR5mut-hiPSCs. (c) Morphology of macrophages generated from
parental and CCR5mut-hiPSCs. (d) Flow cytometric analysis of macrophage-specific markers and GFP expression in macrophages
generated from parental and CCR5mut-hiPSCs. From the top row, parental-, GFP-CCR5mut-SC7-, GFP-CCR5mut-SC8-, GFP-
CCR5mut-Comb1-SC8-, GFP-CCR5mut-Comb2-SC1-derived macrophages. Plots depict isotype control (open) and specific antibody
(gray) histograms.

Molecular Therapy—Nucleic Acids

 CCR5 Disruption in iPSCs
Kang et al.
7

a b
1,000 R8-BaL 200 SF162

800
150

p24 (pg/ml)
p24 (pg/ml)

600
100
400 GFP-parental
GFP-parental
GFP-CCR5mut-SC7 GFP-CCR5mut-SC8
GFP-CCR5mut-SC8 50 GFP-CCR5mut-SC7
200 GFP-CCR5mut-Comb1-SC8 GFP-CCR5mut-Comb1-SC8
GFP-CCR5mut-Comb2-SC1 GFP-CCR5mut-Comb2-SC1
0 0
0 3 7 10 0 3 7 10
Days post-infection with R8-BaL Days post-infection with SF162

c d
300 1,400
LAI NL4-3

250 1,200

1,000
200
p24 (pg/ml)

p24 (pg/ml) 800

150
600 GFP-parental
GFP-parental
100 GFP-CCR5mut-SC7
GFP-CCR5mut-SC7 400
GFP-CCR5mut-SC8
GFP-CCR5mut-SC8
50 GFP-CCR5mut-Comb1-SC8
GFP-CCR5mut-Comb1-SC8 200
GFP-CCR5mut-Comb2-SC1
GFP-CCR5mut-Comb2-SC1
0 0
0 3 7 10 0 3 7 10
Days post-infection with LAI Days post-infection with NL4-3

Figure 5 HIV challenge of iPSC derived CCR5mut macrophages. Macrophages derived from the parental and CCR5mut iPSC-derived
macrophages were challenged with (a) A R5-tropic R8-Bal (three independent experiments), (b) a R5-tropic SF162 (two independent
experiments), (c) A X4-tropic LAI (two independent experiments), or (d) A X4-tropic NL4-3 (two independent experiments) HIV-1. On the
designated days post-infection, supernatants were collected and analyzed for p24 antigen by an enzyme-linked immunosorbent assay.

deletions among the clones evaluated, the same combination differentiation of iPSCs, consistent with the published reports
of dual gRNAs gave rise to the same size deletions in all of that genetic alterations within the CCR5 locus presumably
the clones analyzed, as predicated with the cleavage at 3-nt have no significant effect on the cellular development in
upstream from the protospacer-adjacent motif sequence.14 humans, macaques, and mice.2,42,43 We have found that mac-
Given the lack of knowledge concerning the significant rophages from both wild and CCR5mut iPSCs remained sus-
phenotypic consequences of CCR5 defects, preclinical stud- ceptible to infection with X4-tropic HIV-1 virus. Macrophages
ies and clinical trials were initiated to disrupt CCR5 function derived from wild-type iPSCs were susceptible to R5-tropic
in human primary CD34+ hematopoietic stem and progenitor virus, whereas macrophages from all CCR5mut cells were
cells,11,35–38 primary CD4+ T cells,11,26 and human iPSCs.6,39 resistant to CCR5 viral challenge. This protective effect was
These published studies confirmed the successful genera- observed in macrophages from all CCR5mut iPSCs regard-
tion of HIV-1–resistant immune cells following disruption of less of nt deletion amounts, indicating that even small dis-
CCR5 gene function by various genetic methodologies. How- ruptions within the CCR5 gene are sufficient to provide HIV
ever, the incomplete protection from HIV-1 infection using resistance.
shRNA-mediated knockdown strategy,37,39 the potential for In summary, our study demonstrates that the CCR5 gene
mutagenesis from integrated viral vectors required for con- editing can be successfully and efficiently accomplished in
stitutive shRNA expression for knockdown function,37,39 loss hiPSCs. Importantly, we demonstrated that clonal selection
of HSPCs engraftment potential due to transduction toxicity,40 could be applied to iPSCs to ensure homogeneity of CRISPR/
concerns about the competitive disadvantage of transduced Cas9 genomic editing and potentially to eliminate clones with
cells,11,26,35 and the potential off-target damage by ZFNs26,36,41 deleterious off-target effects. The macrophages derived from
all remain central issues that must be resolved to advance the CCR5mut-hiPSCs are resistant to HIV-1 CCR5-tropic
the translation of genome-modified autologous stem cell viruses, thus implying that hematopoietic stem cells derived
therapy to the clinic. from the iPSCs are useful for continued studies for transla-
In this study, we have shown that genomic editing of the tion to HIV patient therapy. In this context, the generation of
CCR5 gene does not alter pluripotency or hematopoietic CCR5mut-hiPSCs in the background of GFP-marked cells

www.moleculartherapy.org/mtna
 CCR5 Disruption in iPSCs
Kang et al.
8

in our studies will facilitate the assessment of CCR5mut ROCKi were detached 1 hour prior to nucleofection by TrypLE
hematopoietic cells in appropriate animal models for future Select (Life Technologies, Grand Island, NY) and singlized
studies. Although a naturally occurring CCR5 mutation pro- by pipetting. 5 × 105 of the singlized cells were resuspended
tects humans from HIV infection, the lack of CCR5 is also in 100 μl of Human Stem Cell Nucleofector Solution 1 con-
associated with an increased susceptibility to West Nile taining 18 μl Supplement 1 solution and 15 μg of Cas9 and
Virus infection,44 and other infections, including Toxoplasma 2.5 μg of single gRNA or 5.0 μg of one of the combination
gondii, Mycobacterium tuberculosis, Herpes Simplex Virus, of two gRNAs and transfected according to manufacturer’s
Trypanosoma cruzi, Cryptococcus neoformans, Chlamydia instruction (Lonza). After transfection, cells were replated
trachomatis, Listeria, and Plasmodium (reviewed in ref. 45). onto a Matrigel-coated six-well plate with mTeSR1 containing
Thus, since CCR5mut-hiPSC lines can produce unlimited 10 μmol/l ROCKi and placed in an incubator at 37 °C with 5%
numbers of CCR5-deficient hematopoietic and immune cells, CO2. Fresh mTeSR1 (WiCell, Madison, WI) medium was pro-
our stable lines, and the CRISPR/Cas9 methodology, will vided every day. Four to five days later, colonies were picked
be useful for interrogating the role of CCR5 not only in HIV up and expanded. To select CCR5-mut iPSC clones, genomic
pathogenesis, but in other infectious diseases as well. DNA from the iPSC colonies was extracted using Quick-DNA
Universal Kit (Zymo Research, Irvine, CA) and assayed by
Surveyor nuclease assay (Transgenomic, Omaha, NE) with
Materials and Methods
single gRNA-targeted clones and PCR with dual gRNA-tar-
geted clones. To identify and confirm the biallelic mutations
iPSC culture and generation of GFP-marked iPSCs. In this
from the selected mutant clones, PCR products containing
study, we used the transgene-free human iPSC cell line
the target region from each CCR5-mut iPSC were cloned into
DF19-9-7T, which was obtained using episomal vectors.7
T vectors (Promega, Madison, WI) and transformed into bac-
iPSCs were maintained on mouse embryonic fibroblasts
teria. T vectors from at least four bacterial colonies for each
(MEFs) or Matrigel as previously described.7,46 The clover
CCR5-mut iPSC line were sequenced. Selected CCR5mut-
GFP-targeting vector was generated by PCR amplification
iPSCs were single cell sorted using FASCAria to ensure
from the pcDNA3-Clover (Addgene plasmid 40259), and the
the derivation of iPSCs with homogenous genetic mutations
fragment was subsequently inserted into the XbaI and NheI
within the CCR5 locus and then expanded on MEFs. To con-
sites of the pRMCE-EF1 vector. In addition, an antibiotics-
firm pluripotency, cell surface staining was performed with
resistant cassette T2A-puromycin was inserted into NheI and
anti-SSEA4 (Stemgent, Cambridge, MA) and anti-TRA-1–81
MluI sites of pRMCE-EF1-Clover GFP vector. iPSCs grow-
(Stemgent, MA) antibodies, and with antibodies against plu-
ing on Matrigel were detached by using TrypLE (Life Tech-
ripotent factors, OCT4, NANOG, and SOX2 (all from BD Bio-
nologies, Grand Island, NY) for 6 minutes and were washed
sciences, Franklin Lakes, NJ). For intracellular staining, cells
with mTeSR1 (StemCell Technologies, Vancouver, Canada)
were fixed and permeated using Cytofix buffer and cold Perm
culture medium. 1 × 106 cells were resuspended in 100 μl
Buffer III (both from BD Bioscience), respectively, accord-
Amaxa Human Stem Cell Nucleofector Kit 2 reagent (Lonza,
ing the manufacturer’s instruction. After being washed, cells
Basel, Switzerland). After addition of 3 μg DNA, iPSCs were
were stained with anti-OCT4, anti-NANOG, and anti-SOX2
exposed to a single pulse (B16 program for human stem
and then analyzed by flow cytometry.
cells) using Amaxa Nucleofector II (Lonza). The electropor-
ated cells were resuspended with mTeSR1 culture medium
Hematopoietic differentiation of iPSCs and generation of
supplemented with 10 μmol/l of Y-27632 Rho kinase inhibi-
macrophages. To induce hematopoietic differentiation, iPSCs
tor (ROCKi; Tocris, Bristol, UK), plated in a six-well plate on
maintained on MEFs were collected and co-cultured with OP9,
Matrigel and cultured in mTeSR1 growth medium. Puromycin
as previously described in detail.48 Flow cytometry was used
selection (1 μg/ml; Sigma-Aldrich, St Louis, MO) was started
to analyze the generation of the CD34+CD43+ hematopoietic
3 days after electroporation. After 10–14 days, 20 GFP-pos-
progenitors. Colony-forming potential of the generated hema-
itive surviving colonies were picked and expanded in each
topoietic progenitors was tested in MethoCult GF+ complete
well of a 12-well plate. Following analysis of hematopoietic
methylcellulose medium with fetal bovine serum and hemato-
differentiation, two clones with constitutive GFP expression at
poietic cytokines (SCF, G-CSF, GM-CSF, IL-3, IL-6, and EPO;
all stages of differentiation, including mature macrophages,
StemCell Technologies, Vancouver, Canada). Subsequently,
were selected for further studies.
iPSC-derived hematopoietic progenitors were differentiated
into macrophages following exposure to M-CSF (Shenan-
Construction of CCR5-targeting vectors and generation of doah Biotechnology, Warwick, PA) and IL-1β (Shenandoah
CCR5-mutant iPSCs. JDS246 coding mammalian codon- Biotechnology), as described previously.21 Generated macro-
optimized Cas9 and MLM3636 containing the U6 promoter phages were evaluated by flow cytometry using CD4, CD45,
and tracrDNA were acquired from Addgene (Addgene plas- HLA-DR, and CD14 antibodies (BD Biosciences).
mids 43861 and 43860 from Keith Joung). With a general
rule for designing gRNA,47 two gRNA sequences were manu- Off-target analysis. Cas-OFFinder17 was employed to
ally searched and designed for target sequences near the find potential OTSs with limitation of three-base mis-
delta 32 region, while one gRNA from Cho et al.’s report was matched sequences. From the resulting off-targets, OTSs
used.8 These gRNAs were PCR amplified and then inserted only in gene-coding regions were selected and Surveyor
downstream of U6 polymerase III promoter in MLM3636. nuclease assayed (Surveyor Mutation Detection Kit;
iPSCs growing on Matrigel in mTeSR1 medium with 10 μmol/l Transgenomics).

Molecular Therapy—Nucleic Acids

 CCR5 Disruption in iPSCs
Kang et al.
9

Karyotyping and teratoma assay. Karyotypes from the 7. Yu, J, Hu, K, Smuga-Otto, K, Tian, S, Stewart, R, Slukvin, II et al. (2009). Human induced
pluripotent stem cells free of vector and transgene sequences. Science 324: 797–801.
CCR5mut-iPSC colonies were tested by standard G-banded 8. Cho, SW, Kim, S, Kim, JM and Kim, JS (2013). Targeted genome engineering in human
and SKY spectral karyptyping.49 For teratoma formation, cells with the Cas9 RNA-guided endonuclease. Nat Biotechnol 31: 230–232.
CCR5mut-iPSCs were harvested from days 3–5 of MEF 9. Ho, TT, Zhou, N, Huang, J, Koirala, P, Xu, M, Fung, R et al. (2015). Targeting non-coding
feeder culture and resuspended with 100 μl of 30% Matrigel RNAs with the CRISPR/Cas9 system in human cell lines. Nucleic Acids Res 43: e17.
10. Li, JF, Zhang, D and Sheen, J (2015). Targeted plant genome editing via the CRISPR/Cas9
in DMEM/F12 basal media. The cells were injected s.c. into technology. Methods Mol Biol 1284: 239–255.
the hind leg of NOD.Cg-PrkdcscidIl2rgtm1wjl/SzJ mice (The 11. Mandal, PK, Ferreira, LM, Collins, R, Meissner, TB, Boutwell, CL, Friesen, M et al. (2014).
Jackson Laboratory, Bar Harbor, ME) and teratomas formed Efficient ablation of genes in human hematopoietic stem and effector cells using CRISPR/
Cas9. Cell Stem Cell 15: 643–652.
were collected at 8–12 weeks. 12. Zhou, J, Wang, J, Shen, B, Chen, L, Su, Y, Yang, J et al. (2014). Dual sgRNAs facilitate
CRISPR/Cas9-mediated mouse genome targeting. FEBS J 281: 1717–1725.
HIV-1 challenge of iPSC-derived macrophages. iPSC-derived 13. Sander, JD and Joung, JK (2014). CRISPR-Cas systems for editing, regulating and
targeting genomes. Nat Biotechnol 32: 347–355.
macrophages were seeded at a density of 4 × 104 cells per
14. Jinek, M, Chylinski, K, Fonfara, I, Hauer, M, Doudna, JA and Charpentier, E (2012).
48-well plate the day before infection. The cells were infected A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.
with 350–400 pg of R5-tropic viruses BaL-1 or SF162 or Science 337: 816–821.
X4-tropic viruses LAI or NL4-3 for 6 hours in the presence of 15. Lin, Y, Cradick, TJ, Brown, MT, Deshmukh, H, Ranjan, P, Sarode, N et al. (2014). CRISPR/
Cas9 systems have off-target activity with insertions or deletions between target DNA and
6 μg/ml polybrene. Cells were washed intensively with media guide RNA sequences. Nucleic Acids Res 42: 7473–7485.
and cultured for the desired time. On various days post- 16. Wu, X, Scott, DA, Kriz, AJ, Chiu, AC, Hsu, PD, Dadon, DB et al. (2014). Genome-wide
infection, tissue culture supernatants were collected and binding of the CRISPR endonuclease Cas9 in mammalian cells. Nat Biotechnol 32:
670–676.
supernatants taken on days 0, 3, 7, and 10 were analyzed 17. Bae, S, Park, J and Kim, JS (2014). Cas-OFFinder: a fast and versatile algorithm that
for p24 with an HIV antigen enzyme-linked immunosorbent searches for potential off-target sites of Cas9 RNA-guided endonucleases. Bioinformatics
assay kit (AbLinc, Rockville, MD) according to the manufac- 30: 1473–1475.
tures instructions. Experiments were performed in triplicate, 18. Cho, SW, Kim, S, Kim, Y, Kweon, J, Kim, HS, Bae, S et al. (2014). Analysis of off-target
effects of CRISPR/Cas-derived RNA-guided endonucleases and nickases. Genome Res
BaL-1, or duplicate SF-162, LAI, or NL4-3. 24: 132–141.
19. Choi, KD, Yu, J, Smuga-Otto, K, Salvagiotto, G, Rehrauer, W, Vodyanik, M et al. (2009).
Supplementary Material Hematopoietic and endothelial differentiation of human induced pluripotent stem cells.
Stem Cells 27: 559–567.
Figure S1. Establishment of GFP-expressing hiPSC line and 20. Vodyanik, MA, Bork, JA, Thomson, JA and Slukvin, II (2005). Human embryonic stem
cell-derived CD34+ cells: efficient production in the coculture with OP9 stromal cells and
its hematopoietic differentiation. analysis of lymphohematopoietic potential. Blood 105: 617–626.
Figure S2. Validation of mutations in CCR5 gene. 21. Choi, KD, Vodyanik, M and Slukvin, II (2011). Hematopoietic differentiation and production
of mature myeloid cells from human pluripotent stem cells. Nat Protoc 6: 296–313.
22. Choi, KD, Vodyanik, MA and Slukvin, II (2009). Generation of mature human
Acknowledgments. We thank Mitchell Probasco for cell
myelomonocytic cells through expansion and differentiation of pluripotent stem cell-derived
sorting, T. Nakano for providing the OP9 bone marrow stro- lin-CD34+CD43+CD45+ progenitors. J Clin Invest 119: 2818–2829.
mal cell line, and Mathew Raymond for editorial assistance. 23. Mock, U, Machowicz, R, Hauber, I, Horn, S, Abramowski, P, Berdien, B et al. (2015).
This work was supported by funds from the National Institute mRNA transfection of a novel TAL effector nuclease (TALEN) facilitates efficient knockout
of HIV co-receptor CCR5. Nucleic Acids Res 43: 5560–5571.
of Health (R01HL116221, U01HL099773, P51OD011106, 24. Mussolino, C, Alzubi, J, Fine, EJ, Morbitzer, R, Cradick, TJ, Lahaye, T et al. (2014). TALENs
and P30AI036214) and The Charlotte Geyer Foundation. facilitate targeted genome editing in human cells with high specificity and low cytotoxicity.
H.K. generated and characterized CCR5-mut iPSCs, ana- Nucleic Acids Res 42: 6762–6773.
25. Miller, JC, Tan, S, Qiao, G, Barlow, KA, Wang, J, Xia, DF et al. (2011). A TALE nuclease
lyzed their hematopoietic differentiation potential, produced architecture for efficient genome editing. Nat Biotechnol 29: 143–148.
macrophages, interpreted experimental data, made figures, 26. Tebas, P, Stein, D, Tang, WW, Frank, I, Wang, SQ, Lee, G et al. (2014). Gene editing
and contributed to paper writing; P.M. performed HIV infection of CCR5 in autologous CD4 T cells of persons infected with HIV. N Engl J Med 370:
studies; M.A.P. generated GFP-iPSC line. W.-T.M. assisted in 901–910.
27. Li, C, Guan, X, Du, T, Jin, W, Wu, B, Liu, Y et al. (2015). Inhibition of HIV-1 infection of
hematopoietic differentiation of iPSCs and macrophage pro- primary CD4+ T-cells by gene editing of CCR5 using adenovirus-delivered CRISPR/Cas9.
duction. B.E.T. and I.S. developed the concept, led and su- J Gen Virol 96: 2381–2393.
pervised studies, analyzed and interpreted data, and wrote 28. Fine, EJ, Appleton, CM, White, DE, Brown, MT, Deshmukh, H, Kemp, ML et al. (2015).
Trans-spliced Cas9 allows cleavage of HBB and CCR5 genes in human cells using
the manuscript. compact expression cassettes. Sci Rep 5: 10777.
29. Cong, L, Ran, FA, Cox, D, Lin, S, Barretto, R, Habib, N et al. (2013). Multiplex genome
1. Samson, M, Labbe, O, Mollereau, C, Vassart, G and Parmentier, M (1996). Molecular engineering using CRISPR/Cas systems. Science 339: 819–823.
cloning and functional expression of a new human CC-chemokine receptor gene. 30. Smith, C, Gore, A, Yan, W, Abalde-Atristain, L, Li, Z, He, C et al. (2014). Whole-genome
Biochemistry 35: 3362–3367. sequencing analysis reveals high specificity of CRISPR/Cas9 and TALEN-based genome
2. Broder, CC and Collman, RG (1997). Chemokine receptors and HIV. J Leukoc Biol 62: editing in human iPSCs. Cell Stem Cell 15: 12–13.
20–29. 31. Suzuki, K, Yu, C, Qu, J, Li, M, Yao, X, Yuan, T et al. (2014). Targeted gene correction
3. Allers, K, Hütter, G, Hofmann, J, Loddenkemper, C, Rieger, K, Thiel, E et al. (2011). minimally impacts whole-genome mutational load in human-disease-specific induced
Evidence for the cure of HIV infection by CCR5Δ32/Δ32 stem cell transplantation. Blood pluripotent stem cell clones. Cell Stem Cell 15: 31–36.
117: 2791–2799. 32. Veres, A, Gosis, BS, Ding, Q, Collins, R, Ragavendran, A, Brand, H et al. (2014). Low
4. Hütter, G, Nowak, D, Mossner, M, Ganepola, S, Müssig, A, Allers, K et al. (2009). Long- incidence of off-target mutations in individual CRISPR-Cas9 and TALEN targeted human
term control of HIV by CCR5 Delta32/Delta32 stem-cell transplantation. N Engl J Med 360: stem cell clones detected by whole-genome sequencing. Cell Stem Cell 15: 27–30.
692–698. 33. Hsu, PD, Scott, DA, Weinstein, JA, Ran, FA, Konermann, S, Agarwala, V et al. (2013). DNA
5. Yao, Y, Nashun, B, Zhou, T, Qin, L, Qin, L, Zhao, S et al. (2012). Generation of CD34+ cells targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol 31: 827–832.
from CCR5-disrupted human embryonic and induced pluripotent stem cells. Hum Gene 34. Chen, X, Xu, F, Zhu, C, Ji, J, Zhou, X, Feng, X et al. (2014). Dual sgRNA-directed gene
Ther 23: 238–242. knockout using CRISPR/Cas9 technology in Caenorhabditis elegans. Sci Rep 4: 7581.
6. Ye, L, Wang, J, Beyer, AI, Teque, F, Cradick, TJ, Qi, Z et al. (2014). Seamless modification 35. Holt, N, Wang, J, Kim, K, Friedman, G, Wang, X, Taupin, V et al. (2010). Human
of wild-type induced pluripotent stem cells to the natural CCR5Δ32 mutation confers hematopoietic stem/progenitor cells modified by zinc-finger nucleases targeted to CCR5
resistance to HIV infection. Proc Natl Acad Sci USA 111: 9591–9596. control HIV-1 in vivo. Nat Biotechnol 28: 839–847.

www.moleculartherapy.org/mtna
 CCR5 Disruption in iPSCs
Kang et al.
10

36. Li, L, Krymskaya, L, Wang, J, Henley, J, Rao, A, Cao, LF et al. (2013). Genomic editing of 45. Telenti, A (2009). Safety concerns about CCR5 as an antiviral target. Curr Opin HIV AIDS
the HIV-1 coreceptor CCR5 in adult hematopoietic stem and progenitor cells using zinc 4: 131–135.
finger nucleases. Mol Ther 21: 1259–1269. 46. Amit, M, Carpenter, MK, Inokuma, MS, Chiu, CP, Harris, CP, Waknitz, MA et al. (2000).
37. Liang, M, Kamata, M, Chen, KN, Pariente, N, An, DS and Chen, IS (2010). Inhibition Clonally derived human embryonic stem cell lines maintain pluripotency and proliferative
of HIV-1 infection by a unique short hairpin RNA to chemokine receptor 5 delivered potential for prolonged periods of culture. Dev Biol 227: 271–278.
into macrophages through hematopoietic progenitor cell transduction. J Gene Med 12: 47. Mali, P, Yang, L, Esvelt, KM, Aach, J, Guell, M, DiCarlo, JE et al. (2013). RNA-guided
255–265. human genome engineering via Cas9. Science 339: 823–826.
38. Wang, W, Ye, C, Liu, J, Zhang, D, Kimata, JT and Zhou, P (2014). CCR5 gene disruption 48. Vodyanik, MA and Slukvin, II (2007). Hematoendothelial differentiation of human
via lentiviral vectors expressing Cas9 and single guided RNA renders cells resistant to embryonic stem cells. Curr Protoc Cell Biol Chapter 23: Unit 23.6.
HIV-1 infection. PLoS One 9: e115987. 49. Schröck, E, du Manoir, S, Veldman, T, Schoell, B, Wienberg, J, Ferguson-Smith, MA
39. Kambal, A, Mitchell, G, Cary, W, Gruenloh, W, Jung, Y, Kalomoiris, S et al. (2011). et al. (1996). Multicolor spectral karyotyping of human chromosomes. Science 273:
Generation of HIV-1 resistant and functional macrophages from hematopoietic stem 494–497.
cell-derived induced pluripotent stem cells. Mol Ther 19: 584–593.
40. Hollis, RP, Nightingale, SJ, Wang, X, Pepper, KA, Yu, XJ, Barsky, L et al. (2006). Stable
gene transfer to human CD34(+) hematopoietic cells using the Sleeping Beauty
transposon. Exp Hematol 34: 1333–1343.
41. Pattanayak, V, Ramirez, CL, Joung, JK and Liu, DR (2011). Revealing off-target cleavage
specificities of zinc-finger nucleases by in vitro selection. Nat Methods 8: 765–770. This work is licensed under a Creative Commons
42. Kuziel, WA, Dawson, TC, Quinones, M, Garavito, E, Chenaux, G, Ahuja, SS et al. (2003). Attribution-NonCommercial-ShareAlike 4.0 International
CCR5 deficiency is not protective in the early stages of atherogenesis in apoE knockout
mice. Atherosclerosis 167: 25–32.
License. The images or other third party material in this article are
43. Chen, Z, Kwon, D, Jin, Z, Monard, S, Telfer, P, Jones, MS et al. (1998). Natural infection included in the article’s Creative Commons license, unless indicated
of a homozygous delta24 CCR5 red-capped mangabey with an R2b-tropic simian otherwise in the credit line; if the material is not included under the
immunodeficiency virus. J Exp Med 188: 2057–2065.
Creative Commons license, users will need to obtain permission from
44. Lim, JK, Louie, CY, Glaser, C, Jean, C, Johnson, B, Johnson, H et al. (2008). Genetic
deficiency of chemokine receptor CCR5 is a strong risk factor for symptomatic West Nile the license holder to reproduce the material. To view a copy of this
virus infection: a meta-analysis of 4 cohorts in the US epidemic. J Infect Dis 197: 262–265. license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/
Supplementary Information accompanies this paper on the Molecular Therapy–Nucleic Acids website (http://www.nature.com/mtna)

Molecular Therapy—Nucleic Acids