See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/7561717

Application of the Synechococcus nirA Promoter To Establish an Inducible

Expression System for Engineering the Synechocystis Tocopherol Pathway

Article  in  Applied and Environmental Microbiology · November 2005

DOI: 10.1128/AEM.71.10.5678-5684.2005 · Source: PubMed

CITATIONS READS

44 546

7 authors, including:

Qungang Qi Ming Hao

Bayer CropScience Hokkaido University
26 PUBLICATIONS   1,427 CITATIONS    11 PUBLICATIONS   665 CITATIONS   

SEE PROFILE SEE PROFILE

Steven Slater Susan R Baszis Falkler

University of British Columbia - Vancouver Monsanto Company
88 PUBLICATIONS   3,575 CITATIONS    5 PUBLICATIONS   698 CITATIONS   

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Gamma tocopherol methyltransferase sequencing View project

All content following this page was uploaded by Qungang Qi on 29 July 2014.

The user has requested enhancement of the downloaded file.

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Oct. 2005, p. 5678–5684 Vol. 71, No. 10
0099-2240/05/$08.00⫹0 doi:10.1128/AEM.71.10.5678–5684.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Application of the Synechococcus nirA Promoter To Establish an

Inducible Expression System for Engineering the
Synechocystis Tocopherol Pathway
Qungang Qi,1 Ming Hao,2 Wing-on Ng,3† Steven C. Slater,3‡ Susan R. Baszis,1
James D. Weiss,1 and Henry E. Valentin1*
Monsanto Co., 700 Chesterfield Parkway West, Chesterfield, Missouri 630171; Monsanto Co., 800 N. Lindbergh Blvd.,
St. Louis, Missouri 631672; and Cereon Genomics, 45 Sidney St., Cambridge, Massachusetts 024923
Received 30 January 2005/Accepted 28 April 2005

Tocopherols are important antioxidants in lipophilic environments. They are synthesized by plants and some
photosynthetic bacteria. Recent efforts to analyze and engineer tocopherol biosynthesis led to the identification
of Synechocystis sp. strain PCC 6803 as a well-characterized model system. To facilitate the identification of the
rate-limiting step(s) in the tocopherol biosynthetic pathway through the modulation of transgene expression,
we established an inducible expression system in Synechocystis sp. strain PCC 6803. The nirA promoter from
Synechococcus sp. strain PCC 7942, which is repressed by ammonium and induced by nitrite (S.-I. Maeda et al.,
J. Bacteriol. 180:4080–4088, 1998), was chosen to drive the expression of Arabidopsis thaliana p-hydroxyphe-
nylpyruvate dioxygenase. The enzyme catalyzes the formation of homogentisic acid from p-hydroxyphenylpyru-
vate. Expression of this gene under inducing conditions resulted in up to a fivefold increase in total tocopherol
levels with up to 20% of tocopherols being accumulated as tocotrienols. The culture supernatant of these
cultures exhibited a brown coloration, a finding indicative of homogentisic acid excretion. Enzyme assays,
functional complementation, reverse transcription-PCR, and Western blot analysis confirmed transgene ex-
pression under inducing conditions only. These data demonstrate that the nirA promoter can be used to control
transgene expression in Synechocystis and that homogentisic acid is a limiting factor for tocopherol synthesis
in Synechocystis sp. strain PCC 6803.

Vitamin E is a collective term that refers to the biological with phytyldiphosphate (PDP) derived from the 2C-methyl-D-
activity of a group of eight natural amphipathic compounds: ␣-, erythritol 4-phosphate (MEP)-pathway, for the formation of
␤-, ␥-, and ␦-tocopherol and ␣-, ␤-, ␥-, and ␦-tocotrienol (Fig. 2-methyl-6-phytylbenzoquinol (Fig. 1). Tocotrienols are syn-
1). Tocotrienols can be distinguished from their corresponding thesized when geranylgeranyl diphosphate replaces PDP in the
tocopherols by the presence of three isolated double bonds in prenylation reaction of HGA, resulting in the formation of
their prenyl side chains. These compounds are synthesized by 2-methyl-6-geranylgeranylbenzoquinol. Therefore, the avail-
plants and certain photosynthetic bacteria and are well recog- ability of HGA has an impact on tocopherol and tocotrienol
nized as effective oxygen radical scavengers in lipophilic envi- biosynthesis. The cyanobacterium Synechocystis sp. strain PCC
ronments such as oils and the lipid bilayer of biological mem- 6803 has been used as a model organism for elucidating the
branes (3, 4). In photosynthetic organisms, tocopherols are mechanisms of critical biological processes such as photosyn-
suggested to function as membrane-associated antioxidants thesis (14, 16), metabolic engineering of fatty acid saturation,
and as constituents of the chloroplast membranes (17, 18, 27, and zeaxanthin biosynthesis (2, 21). A common strategy to
41). ␣-Tocopherol is an essential component in the mamma- define the rate-limiting steps of a biosynthetic pathway exper-
lian diet and has the highest vitamin E activity among the imentally is to modulate expression of specific pathway en-
isomers described above (3). Because of these health benefits zymes and then monitor the corresponding changes of inter-
and biological functions, there is considerable interest in en- mediates and end products. In this setting, it is advantageous to
gineering tocopherol biosynthesis to increase tocopherol levels use inducible promoters for the controlled expression of target
and optimize their composition in agricultural crops. genes.
The regulation and rate-limiting reactions in tocopherol bio- Cyanobacteria are prokaryotic organisms that perform oxy-
synthesis are currently poorly understood. The first committed genic photosynthesis through the operation of a photosynthetic
reaction of tocopherol biosynthesis is the prenylation of ho- system very much like that present in the chloroplasts of higher
mogentisic acid (HGA), derived from the shikimate pathway, plants. They preferentially use inorganic carbon, nitrogen, and
mineral salts for growth. Nitrate and ammonium are excellent
nitrogen sources for cyanobacteria (11). Nitrate is taken up
* Corresponding author. Mailing address: Monsanto Co., Calgene into the cells and reduced to ammonium by sequential action
Campus, 1920 5th St., Davis, CA 95616. Phone: (530) 792-2136. Fax: of nitrate reductase and nitrite reductase. The genes encoding
(530) 792-2454. E-mail: henry.e.valentin@monsanto.com. the nitrate transporter (nrtABCD) (29), nitrate reductase
† Present address: Civil and Environmental Engineering, 318 Cam-
pus Dr., E250, Stanford University, Stanford, CA 94305.
(narB) (32), and nitrite reductase (nirA) (22) form the nir
‡ Present address: The Biodesign Institute, Arizona State Univer- operon (nirA-nrtABCD-narB) in Synechococcus sp. strain PCC
sity, Mail Zone 4501, Tempe, AZ 85287. 7942 (38). In all cyanobacteria tested to date, transcription of

5678
VOL. 71, 2005 nirAp AS INDUCIBLE PROMOTER IN SYNECHOCYSTIS SP. 5679

FIG. 1. Schematic drawing of the tocopherol biosynthetic pathway. Abbreviations: DMAPP, dimithylallyldiphosphate; ChlP, geranylgeranyl-
diphosphate reductase; Hpd, p-hydroxyphenylpyruvate dioxygenase; IPP, isopentenyldiphosphate; MEP, methylerythritol phosphate; TyrA, bi-
functional chorismate mutase and prephenate dehydrogenase; Vte1, tocopherol cyclase; Vte2, homogentisate phytyltransferase; Vte3, 2-methyl-
6-phytylbenzoquinol methyltransferase; Vte4, ␥-tocopherol methyltransferase.

the nir operon is repressed by ammonium (20, 38). In contrast, NdeI-digested pCER7, resulting in the formation of pCER11. Promoter se-
the presence of nitrate in the culture medium enhances mRNA quence integrity was confirmed by DNA sequence analysis. The amplified region
possesses an NtcB-binding site (an inverted repeat with a LysR motif,
levels of the nir operon (12, 23, 24). This is further evidenced
TGCAN5TGCA), an NtcA-binding site (a palindromic structure with a con-
by discovering the requirement of the nitrate-promoted NtcB served sequence signature, GTAN8TAC), and a TAN3T sequence fitting the ⫺10
transcription factor for regulation of nir operon transcription box of the Escherichia coli ␴70 consensus promoter. This DNA segment has been
in cyanobacteria (1, 12, 13, 19, 24, 38, 39). We hypothesized showed to retain full responsiveness to nitrogen and transcription activity (24).
that the nirA promoter of Synechococcus can be used as a tight To provide a selection marker for the transcription unit (nirAp plus MCS), the
gentamicin resistance cassette (Gmr) from pUCGM (35) was cleaved as a SmaI-
inducible system for controlling transgene expression in Syn-
fragment, gel purified, and ligated into HindIII-digested and T4 DNA poly-
echocystis. Furthermore, by substitution of ammonium with merase-blunt-ended pCER11. The resulting plasmids were screened and those
nitrate for activation of the promoter this system would pro- that carried the Gmr cassette in the opposite orientation to the nirA promoter
duce a minimal perturbation on the cellular processes in Syn- were selected and designated pCER12. Transcription terminators for the above
echocystis. Several studies have provided evidence that p-hy- expression cassettes were cloned from pHP45␻ (30). They were PCR amplified
droxyphenylpyruvate dioxygenase (Hpd) limits tocopherol from pHP45␻ by using the primer pHP45-1 (5⬘-TAGGCCTGGATGACCTTT
TGAATGACC-3⬘). The Omega cassette is flanked by two identical transcription
biosynthesis in plants (10, 15, 31, 42, 43). We reasoned, there- terminators. The terminators are inverted relative to each other. The primer
fore, that transgenic expression of Arabidopsis thaliana hpd anneals to both terminators and extends outward during PCR. The final PCR
(hpdAt) under nirA promoter control would be an excellent product has the two terminators at the ends plus the rest of the plasmid (minus
model for developing a controlled Synechocystis expression the spectinomycin cassette). The resulting PCR product was ligated to the blunt-
system and to demonstrate tocopherol pathway engineering in ended XhoI- and EcoRI-digested Gmr::nirAp::MCS fragment of pCER12. This
yielded the plasmid pCER18, which carries the final transcription module
Synechocystis.
(Gmr::nirAp::MCS). The transcription module was excised with EcoRI, and the
ends were filled in with T4 DNA polymerase. This DNA fragment was ligated to
MATERIALS AND METHODS the 5.8-kb HincII-HincII fragment of plasmid RSF1010 (34), resulting in the new
Construction of a nirAp-based expression plasmid. Custom multiple cloning expression vector pCER20 (Fig. 2). RSF1010 and its derivatives replicate auton-
sites (MCS) were made by annealing the primers MCS2 (5⬘-AAGGCCTGACA omously in cyanobacteria of the genera Synechococcus and Synechocystis (25, 28).
TATGTCGCGGCCGCTCTAGATTTAAATACTAGTCCCGGGCTAGCGA All enzymes used were purchased from New England Biolabs (Beverly, MA).
GCTCT-3⬘) and MCS2-rev.comp (5⬘-AGAGCTCGCTAGCCCGGGACTAGT Construction of a Synechocystis hpdAt expression vector. For convenience of
ATTTAAATCTAGAGCGGCCGCGACATATGTCAGGCCTT-3⬘). The an- subsequent cloning steps, a DNA fragment containing multiple cloning sites
nealed primers were cloned into the EcoRV site of pBluescript SK(⫹) (Strat- (5⬘-GCGGCCGCGGGCCCTGATCATCTAGAGTCGACGGCCGGCCGAA
agene, La Jolla, CA), yielding the plasmid pCER7. TTCGCGGCCGCTCTAGA-3⬘) was inserted into NotI- and XbaI-digested
A 166-bp fragment upstream of the nirA operon was amplified by PCR from pCER20. The resulting plasmid, designated pMON36546, was used as a vector
the genomic DNA of Synechococcus sp. strain PCC 7942 by using the primer pair control. To generate a nirAp::hpdAt expression vector, the full-length of hpdAt was
nirA1 (5⬘-TAGGCCTTCCCTCTCAGCTCCAAAAAGT-3⬘) and nirA3 (5⬘-CT PCR amplified from pMON36596 (43) (forward primer 5⬘-TGCTCTAGAACA
TGAGCCATATGTCCATCTGCCTAACA-3⬘). Underlined bases in the primer CAGGAGGACAGCCATGGGCCACCAAAACGCC-3⬘ and reverse primer 5⬘-
sequence indicate StuI and NdeI restriction sites that were added at the 5⬘ and ATAAGAATGCGGCCGCAAGCTTGTCGACTTCATCCCACTAACTGTTT
3⬘ termini of the nirA promoter element, respectively. The PCR product harbor- G-3⬘). The Shine-Dalgarno sequence and ATG start codon are underlined in the
ing nirAp was digested with StuI and NdeI, gel purified, and ligated into StuI- and forward primer. The resulting PCR fragment was XbaI and NotI digested and
5680 QI ET AL. APPL. ENVIRON. MICROBIOL.

NaOH (pH 8.0). For growth on solid media, BG110NH4⫹ medium containing
1.5% (wt/vol) agar (Difco) was used. Plasmids replicating autonomously in Syn-
echocystis were transformed into Synechocystis sp. strain PCC 6803 via triparental
mating (9), and transformants were selected on medium supplemented with
kanamycin at 25 ␮g ml⫺1 and/or gentamicin at 10 ␮g ml⫺1. Conjugated cells were
spread on a 0.45-␮m-pore-size cellulose nitrate membrane filter (Whatman) and
placed on nonselective solid ammonium medium, incubated for 24 h as described
above, and transferred to selective ammonium medium plates. Resistant colonies
were used to inoculate 2 ml of liquid BG110NH4⫹ medium supplemented with
gentamicin (and/or kanamycin) and incubated for 2 days. These cultures served
as precultures for the final 150-ml liquid cultures. Cell density in the 150-ml
cultures was monitored spectrophotometrically (SpectraMAX; Molecular De-
vices) at 730 nm (A730). Cells were harvested when the A730 of the cell culture
reached 0.4 to 0.5 by 10 min of centrifugation at 25°C and 3,500 ⫻ g. The cell
pellet was washed with 20 ml of BG110 and resuspended in 150 ml of fresh nitrate
(BG110NO3⫺) or ammonium (BG110NH4⫹) medium. For promoter activation,
cells were subsequently grown under the light and temperature conditions de-
scribed above. Cell samples were harvested at various time intervals to measure
tocopherol and tocotrienol content, gene expression, and enzyme activity.
Analysis of hpdAt transcript by reverse transcription-PCR (RT-PCR). Nitrate
(BG110NO3⫺) or ammonium (BG110NH4⫹) medium-grown Synechocystis har-
vested from three representative cultures was ground in liquid nitrogen. Total
RNA was isolated as previously described (26), and any contaminating DNA was
removed by treatment with RQ1-RNase-free DNase (Promega, Madison, WI).
Three micrograms of total RNA for each sample was reverse transcribed to
generate cDNA in two 50-␮l reactions by using an Omniscript RT kit according
to the manufacturer’s recommendations (QIAGEN, Inc., Valencia, CA). An
aliquot of cDNA corresponding to 200 ng of total RNA was subjected to 23
cycles of PCR with primers 5⬘-TTCCTTCGTCGCCTCCTATCG-3⬘ (forward)
and 5⬘-ACTCCTTGATCTGATCATCGC-3⬘) (reverse), resulting in the ampli-
fication of a 600-bp fragment internal to the hpdAt gene. The reaction was done
FIG. 2. Plasmid map of the inducible cyanobacterial expression under the following thermocycle conditions: 5 min of incubation at 95°C, fol-
vector pCER20. The expression of target gene(s) is under the tran- lowed by 23 cycles of 1 min at 95°C, 1 min of annealing at 56°C, and a 2-min
scriptional control of the nitrite reductase promoter, nirAp. The aacC extension at 72°C. The amount of amplified DNA was estimated by DNA gel
gene, which confers resistance to gentamicin, serves as the selection electrophoresis with ethidium bromide staining.
marker. Bracketing nirAp and the selection marker are two transcrip- Tocopherol and tocotrienol analyses. Tocopherols for WT and recombinant
tional terminators (TT) from the plasmid, pHP45␻. The origin of Synechocystis strains were measured by a normal-phase high-pressure liquid
replication (oriV) and replication proteins (repABC), as well as the chromatography (HPLC) as described previously (33), but lyophilized cell pellets
origin of transfer (oriT) are derived from the broad-host-range plasmid were used instead of fresh harvested cells. Tocotrienol content was analyzed by
RSF1010 (34). using the same procedure with tocotrienol standards purchased from Calbio-
chem (La Jolla, CA). Tocopherol content was normalized to the dry cell mass.
Protein analysis. The presence of HpdAt protein in recombinant strains was
determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and
cloned into XbaI- and NotI-digested pMON36546, resulting in the formation of Western blot analysis with peptide-directed antibodies obtained by immunization
plasmid pMON36547. of a rabbit with a synthetic peptide (CRTLREMRKRSSIGG). Peptide synthesis
Generation of Synechocystis sp. strain PCC 6803 ⌬slr0090. The open reading and antibody generation were performed by Sigma-Genosys, St. Louis, MO.
frame slr0090 had been identified to encode the Synechocystis sp. strain PCC 6803 Synechocystis sp. strain PCC 6803 cell extracts were prepared by six passages
hpd gene (6). To create a hpd mutant, a knockout construct, pMON29153, was through a French press (Sim-Aminco Spectronic Instruments) at 20,000 lb/in2
generated. This construct harbors the Synechocystis hpd interrupted by insertion with cells suspended in 50 mM Tris-HCl (pH 7.6) containing 5 mM dithiothreitol,
of the nptII marker. Plasmid pMON29153 was constructed by digesting 0.1% Triton X-100, 50 U of DNase I, and protease inhibitor cocktail tablets
pMON29138 (43) with BstXI, filling in the sticky ends using Klenow fragment, (Boehringer-Mannheim). The supernatant fraction from a 15-min centrifugation
and inserting the nptII expression cassette (blunted EcoRI fragment) from at 10,000 ⫻ g was used as a crude extract for protein analysis and enzyme assays.
pUC4K (40). The resulting plasmid contained the nptII cassette inserted 647 bp For protein gel analysis, 25 ␮g of total protein per lane was loaded on a 4 to 20%
downstream of the ATG start codon. This recombinant vector was transformed sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel (Invitrogen), and
into wild-type (WT) Synechocystis sp. strain PCC 6803 by using the transforma- polypeptides were separated according to the manufacturer’s protocol. Immu-
tion procedure described by Williams (44). Homologous recombination led to nodetection was performed with a 1:500 dilution of rabbit polyclonal peptide
the replacement of the WT slr0090 gene. Complete segregation of the mutant specific antibodies raised against a synthetic HpdAt peptide. An anti-rabbit im-
genome was obtained by restreaking single colonies several times on BG11 agar munoglobulin G–alkaline phosphatase conjugate was used as a secondary anti-
plates supplemented with kanamycin (25 ␮g/ml). PCR and Southern analysis of body (Sigma). The blots were developed by using nitroblue tetrazolium dye in
the Synechocystis sp. strain PCC 6803 ⌬slr0090 mutant were performed to con- conjunction with the alkaline phosphatase substrate BCIP (5-bromo-4-chloro-3-
firm complete segregation of the mutant genome (data not shown). indolylphosphate; Sigma). Proteins were quantified with Bradford reagent (Bio-
Strains, growth conditions, and cell sample preparation. Synechocystis sp. Rad) using bovine serum albumin as a standard.
strain PCC 6803 (ATCC 27184) was obtained from the American Type Culture Hpd assay. Hpd assays were performed according to a modified procedure
Collection. WT and recombinant cells of Synechocystis sp. strain PCC 6803 were from Secor (36). Radiolabeled [U-14C]p-hydroxyphenylpyruvate ([U-14C]HPPA)
cultivated photoautotrophically at 30°C under continuous illumination provided was prepared enzymatically from [U-14C]tyrosine (449 mCi/mmol; Amersham
by fluorescent lamps (70 ␮E m⫺2 s⫺1). Liquid cultures were shaken at 225 rpm Life Science) as described by Secor (36). The Hpd reaction mixture contained 50
on a rotary shaker. The basal medium (BG110) was a nitrogen-free medium mM potassium phosphate (pH.7.4), 0.1 mM unlabeled HPPA (freshly prepared
obtained by replacing NaNO3, Co(NO3)2, and ferric ammonium citrate in me- and equilibrated for 2 h at room temperature), 0.5 ␮Ci of [U-14C]HPPA, 5,000
dium BG11 (37) with equimolar fractions of NaCl, CoCl2, and ferric citrate, U of catalase (Sigma), 100 ␮l of a freshly prepared 1:1 (vol/vol) mixture of 150
respectively. Ammonium-containing medium (BG110NH4⫹) and nitrate-con- mM reduced glutathione (Sigma), 3 mM dichlorophenolindophenol (Sigma),
taining medium (BG110NO3⫺) were prepared by addition of 17.6 mM NH4Cl or and 250 ␮g of protein extract in a total volume of 500 ␮l. The reaction was
17.6 mM NaNO3, respectively, to the basal medium. Both media were buffered incubated for 30 min at 30°C and terminated by the addition of 150 ␮l of 20%
with 10 mM N-Tris-(hydroxymethyl)methyl-2-aminoethanesulfonic acid (TES)– (wt/vol) perchloric acid. Precipitated protein was removed by 5 min of centrif-
VOL. 71, 2005 nirAp AS INDUCIBLE PROMOTER IN SYNECHOCYSTIS SP. 5681

FIG. 3. Complementation of Synechocystis sp. strain PCC 6803

⌬slr0090 with Arabidopsis hpd driven by the nirA promoter. Total
tocopherol content was normalized to dry cell mass. Cells used for
tocopherol analysis were harvested after an incubation period of 10
days. Tocopherol levels shown for strains Synechocystis ⌬slr0090 and FIG. 4. RT-PCR expression analysis of hpdAt in Synechocystis sp.
Synechocystis ⌬slr0090(pMON36546) were below the limit of detection strain PCC 6803 ⌬slr0090(pMON36547). Three micrograms of total
(⬍5 ng mg–1). Abbreviations: ⌬slr0090, Synechocystis hpd insertional RNA prepared from BG110NO3⫺- or BG110NH4⫹-grown Synechocys-
inactivation mutant; pMON36546, empty vector control; pMON36547, tis was subjected to RT-PCR (see Materials and Methods). The aga-
nirAp::hpdAt. rose gel shows a 1-kb DNA ladder (lane MW; Invitrogen Life Tech-
nologies), PCR of pMON36547 (nirAp::hpdAt) plasmid control, RT-
PCR from Synechocystis sp. strain PCC 6803 ⌬slr0090 or wild-type
Synechocystis sp. strain PCC 6803 incubated for 16 h in BG110NO3⫺
ugation at 14,000 rpm in an Eppendorf centrifuge. The analysis was performed medium, and that of pMON36S47-harboring Synechocystis sp. strain
on an HP1100 series HPLC system consisting of an HP G1329A automatic PCC 6803 ⌬slr0090 incubated for 2, 8, and 16 h in BG110NH4⫹ or
sampler, an HP G1311A quaternary pump, an HP G1315A diode array detector, BG110NO3⫺ medium.
and an HP G1321A fluorescence detector (Agilent Technologies, Englewood,
CO) and a Packard Radiomatic 500TR flow scintillation analyzer (Hewlett-
Packard, Meridien, CT). Hpd reaction products were separated by reversed-
phase HPLC using a Vydac model 201HS54 C18 HPLC column (4.6 by 250 mm,
same medium. As expected, Synechocystis sp. strain PCC 6803
5 ␮m) coupled with an All-tech C18 guard column (P. J. Cobert Associates, Inc.,
St. Louis, MO) and a solvent system consisting of buffers A (0.1% H3PO4 in ⌬slr0090(pMON36547) failed to accumulate tocopherol when
water) and B (0.1% H3PO4 in methanol). The solvent gradient raised buffer B grown in BG110NH4⫹ medium (Fig. 3). To confirm hpdAt
from 0 to 15 min from 25 to 50% and held buffer B from 15 to 20 min constant expression in BG110NO3⫺-grown cells, RT-PCR amplifica-
at 50%. Compounds of interest were detected by diode array detector set at 210 tions were performed. The hpdAt transcript was detected in
and 254 nm and by the flow scintillation analyzer set at 156 KeV of ULD to
detect 14C compounds. The sample injection volume was 20 ␮l, and the flow rate
Synechocystis sp. strain PCC 6803 ⌬slr0090(pMON36547) at
was set at 1.0 ml/min. 2 h after nitrate induction and continued to accumulate at 8
and 16 h postinduction (Fig. 4). In contrast, the transcript was
not detected in Synechocystis sp. strain PCC 6803 ⌬slr0090-
RESULTS AND DISCUSSION
(pMON36547) cultivated in BG110NH4⫹ medium. These re-
Functional complementation of Synechocystis sp. strain PCC sults support the induction of nirAp by nitrate in Synechocystis
6803 ⌬slr0090 with hpdAt driven by the nirA promoter. A tar- sp. strain PPC 6803 and the functionality of hpdAt complement-
geted mutation in Synechocystis sp. strain PPC 6803 was cre- ing the ⌬slr0090 mutation.
ated by homologous recombination (see Materials and Meth- Nitrate-responsive expression of hpdAt under nirA promoter
ods), and the resulting mutant, Synechocystis sp. strain PPC control in Synechocystis sp. strain PCC 6803. To further dem-
6803 ⌬slr0090, was analyzed for changes in tocopherol content onstrate nitrate-dependent activation of the Synechococcus
compared to WT cultures. Tocopherol levels in the mutant nirA promoter and assess its efficacy in induction of heterolo-
were below the limit of detection (⬍5 ng/mg dry cell mass) gous gene expression in Synechocystis, the expression vector
(Fig. 3) (6), indicating an essential role of Hpd in tocopherol pMON36547 and the empty vector control pMON36546 were
biosynthesis. This result is consistent with the loss of Hpd conjugated into WT Synechocystis sp. strain PCC 6803. In or-
activity in this mutant (data not shown). The mutant cell der to analyze gene expression and tocopherol levels, trans-
growth rates were comparable to that of WT cells, indicating genic and WT cells were grown in parallel and sampled at 2, 4,
that photosynthesis was not affected (6). Subsequently, the 10, and 12 days after inoculation. As shown in Fig. 5, utilization
mutant was used to test the functionality of nirAp::hpdAt in of different nitrogen sources in the culture media resulted in
complementation experiments. substantial differences in HpdAt polypeptide level and enzyme
For complementation, Synechocystis sp. strain PCC 6803 activity. Using anti-HpdAt peptide antibody, a single immuno-
⌬slr0090 was transformed with pMON36547. This plasmid har- reactive band was detected in an extract of Synechocystis sp.
bored a nirAp::hpdAt expression cassette. As shown in Fig. 3, strain PCC 6803(pMON36547) expressing hpdAt when grown
complemented strains grown on BG110NO3⫺ medium con- in BG110NO3⫺ medium. Extracts of this recombinant strain
tained ⬃3.5-fold more tocopherol than WT cells grown on the grown in BG110NH4⫹ did not contain detectable immunore-
5682 QI ET AL. APPL. ENVIRON. MICROBIOL.

FIG. 5. Induction of nirAp in BG110NO3⫺ media. (A) Immunoblot analysis of HpdAt peptide in Synechocystis sp. strain PCC 6803 harboring
pMON36547 (nirAp::hpdAt) or pMON36546 (empty vector control) incubated for 4 days in BG110NO3⫺ medium (lane 1, 4dNO3⫺) or for 2 days
in BG110NO3⫺ or BG110NH4⫹ medium (remaining lanes). (B) Hpd enzyme activity detected in the corresponding crude cell extracts. Hpd enzyme
activity in Synechocystis sp. strain PCC 6803(pMON36547) incubated in BG110NH4⫹ medium and in Synechocystis sp. strain PCC
6803(pMON36546) as well as in the WT control originates from endogenously expressed Synechocystis Hpd. Hpd activity in E. coli expressing hpdAt
was typically 30 to 50 nmol min⫺1 mg of protein⫺1.

active proteins against anti-HpdAt peptide antibody (Fig. 5A). PCC 6803 harboring pMON36547 that were incubated for 12
These results confirmed the induction of hpdAt in BG110NO3⫺ days in BG110NO3⫺ had fivefold-increased tocopherol levels
and its repression by ammonium. The immunoreactive band compared to the WT control, whereas cells from the same
was also not observed in extracts of WT cells growing in either strain incubated in BG110NH4⫹ and cultures from the vector
BG110NH4⫹ or BG110NO3⫺ medium. This result was consis- control had tocopherol levels comparable to the WT control
tent with the lack of cross-reactivity with the E. coli-expressed (Fig. 7). Thus, tocopherol accumulation showed a positive cor-
Synechocystis Hpd (data not shown). relation with the HpdAt polypeptide level and enzyme activity.
To evaluate whether the increase in polypeptide levels cor- These results confirm functionality of the nirA promoter for
responds with increased enzyme activity, Hpd enzyme assays regulation of transgene expression via nitrate availability, dem-
were carried out with crude extracts of the Synechocystis onstrate its utilization for engineering of the tocopherol met-
strains. As shown in Fig. 5B, the extract derived from nitrate- abolic pathway in Synechocystis, and support the hypothesis
induced Synechocystis sp. strain PCC 6803(pMON36547) had that Hpd catalyzes a rate-limited reaction in tocopherol bio-
⬃5-fold increased Hpd activity compared to extracts derived synthesis (10, 15, 31, 42, 43).
from the vector control [Synechocystis sp. strain PCC More interestingly, Synechocystis cells expressing hpdAt ac-
6803(pMON36546)] or WT cell extracts. Such an increase in cumulated up to 20% of their total tocopherols as tocotrienols
Hpd activity was not observed with cell extracts derived from
Synechocystis sp. strain PCC 6803(pMON36547) incubated in
ammonium-containing medium. In addition, the culture super-
natant of hpdAt-expressing Synechocystis sp. strain PCC
6803(pMON3654) incubated in BG110NO3⫺ medium turned a
dark brown color after 10 days of incubation (Fig. 6). A similar
phenomenon was observed in recombinant E. coli cultures
expressing Arabidopsis or Synechocystis hpd (data not shown)
and has been reported in other systems as well (7, 8). The
brown color is thought to be the result of HGA accumulation
and excretion into the culture medium (7). In aqueous medium
HGA can be oxidized and polymerized to form a brown mel-
anin-like pigment. Western blotting experiments, enzyme assay
data, and color changes of the culture supernatant are consis-
tent with transgenic hpdAt expression in Synechocystis sp. strain
PCC 6803(pMON36547) incubated in BG110NO3⫺. Similarly,
Western blot and enzyme assay data obtained with crude ex-
tracts of the same strain after incubation in BG110NH4⫹ did
not provide any evidence for hpdAt expression, suggesting that
the nirA promoter is inactive under such growth conditions.
Transgenic expression of hpdAt led to increased tocopherol FIG. 6. Synechocystis culture supernatants. Culture supernatants
levels. To determine whether the tocopherol content and com- shown above were collected by 25 min of centrifugation at 4,000 ⫻ g
after 10 days of incubation at 30°C. The culture supernatant of Syn-
position had been affected by transgenic expression of hpdAt, echocystis sp. strain PCC 6803(pMON36547) incubated in BG110NO3⫺
aliquots of the cell culture were taken at various time points medium exhibits a characteristic brown color that is typical for bacteria
for tocopherol analysis. Cultures of Synechocystis sp. strain excreting HGA (7).
VOL. 71, 2005 nirAp AS INDUCIBLE PROMOTER IN SYNECHOCYSTIS SP. 5683

suitable tool for metabolic engineering in Synechocystis. Its

ability to be inactivated in ammonium-containing medium
makes it particularly suitable for the expression of potentially
toxic genes or for engineering metabolic pathways that may
produce toxic products or intermediates. In the present study,
we obtained evidence that the upregulated hpdAt expression
results in an increased synthesis of HGA, tocopherols, and
tocotrienols in Synechocystis in vivo, indicating that Hpd plays
an important role in tocopherol production and that additional
enzymes such as geranylgeranyl diphosphate reductase may be
required to overcome additional constraints for further en-
hancement of the tocopherol accumulation in this strain. The
results obtained from this photosynthetic model system pro-
vide useful information for tocopherol metabolic engineering
in other organisms.

ACKNOWLEDGMENTS
FIG. 7. Tocopherol content and composition in Synechocystis sp.
strain PCC 6803 cultures grown in BG110NH4⫹ and BG110NO3⫺ We are grateful to Mylavarapu Venkatramesh, Dusty Post-Beitten-
media. Tocopherol and tocotrienol contents of Synechocystis cultures miller, and Kenneth J. Gruys (Monsanto Company) for helpful discus-
are normalized to dry cell mass. Cells used for this experiment were sions during the experimental course of this study and the preparation
harvested after an incubation period of 12 days. of the manuscript. We thank Jeffrey M. Staub and Lisa M. Weaver
(Monsanto Company) for critical reading of the manuscript. We also
thank Yanping Zhu for skillful technical assistance with Synechocystis
cell culture and Tatsuo Omata (Nagoya University) for Synechococcus
(Fig. 7). None of the WT or vector control Synechocystis sam- sp. strain PCC 7942.
ples contained detectable tocotrienol levels. As described
REFERENCES
above, the tocotrienol precursor, 2-methyl-6-geranylgeranyl-
1. Aichi, M. N., Takatani, and T. Omata. 2001. Role of NtcB in activation of
benzoquinol, is formed via the condensation of HGA and nitrate assimilation genes in the cyanobacterium Synechocystis sp. strain PCC
geranylgeranyl diphosphate catalyzed by the homogentisate 6803. J. Bacteriol. 183:5840–5847.
phytyltransferase (Vte2), whereas tocopherol synthesis utilizes 2. Allakhverdiev, S. I., Y. Nishiyama, I. Suzuki, Y. Tasaka, and N. Murata.
1999. Genetic engineering of the unsaturation of fatty acids in membrane
HGA and PDP. The formation of tocotrienols by Synechocystis lipids alters the tolerance of Synechocystis to salt stress. Proc. Natl. Acad. Sci.
Vte2 is consistent with data provided by Collakova and Della- USA 96:5862–5867.
3. Bramley, P. M., I. Elmadfa, A. Kafatos, F. J. Kelly, Y. Manios, H. E.
Penna (5) and suggests that 2-methyl-6-phytylbenzoquinol Roxborough, W. Schuch, P. J. A. Sheehy, and K. H. Wagner. 2000. Vitamin
methyltransferase (Vte3), tocopherol cyclase (Vte1), and E. J. Sci. Food Agric. 80:913–938.
␥-methyltransferase (Vte4) in Synechocystis sp. strain PCC 4. Burton, G. W., and M. G. Trader. 1990. Vitamin E: antioxidant activity,
biokinetics, and bioavailability. Annu. Rev. Nutr. 10:357–382.
6803 can utilize tocotrienol precursors as substrates as well. In 5. Collakova, E., and D. DellaPenna. 2001. Isolation and functional analysis of
addition, the formation of tocotrienols and accumulation of homogentisate phytyltransferase from Synechocystis sp. PCC 6803 and Arab-
HGA provide evidence for a limitation of endogenous PDP, idopsis. Plant Physiol. 127:1113–1124.
6. Dähnhardt, D., J. Falk, J. Appel, T. A. W. van der Kooij, R., Schulz-
suggesting that experiments to engineer further tocopherol Friedrich, and K. Krupinska. 2002. The hydroxyphenypyruvate dioxygenase
increases in Synechocystis should focus on this part of the from Synechocystis sp. PCC 6803 is not required for plastoquinone biosyn-
thesis. FEBS Lett. 523:177–181.
pathway. 7. David, C., A. Daro, E. Szalai, T. Atarhouch, and M. Mergeay. 1996. Forma-
Conclusions. A 166-bp DNA fragment from the 5⬘ untrans- tion of polymeric pigments in the presence of bacteria and comparison with
lated region of the nirA operon was isolated from the genome chemical oxidative coupling. II. Catabolism of tyrosine and hydroxyphenyl-
acetic acid by Alcaligenes eutrophus CH34 and mutants. Eur. Polym. J. 32:
of Synechococcus sp. strain PCC 7942. Sequence analysis re- 669–679.
vealed the presence of the consensus sequence (GTAN8TAC) 8. Denoya, C. D., D. D. Skinner, and M. R. Morgenstern. 1994. A Streptomyces
for cyanobacterial NtcA-binding sites, an L1-like inverted re- avermitilis gene encoding a 4-hydroxyphenylpyruvic acid dioxygenase-like
protein that directs the production of homogentisic acid and an ochronotic
peat containing a LysR motif (TN11A), and the putative ⫺10 pigment in Escherichia coli. J. Bacteriol. 176:5312–5319.
element, showing a typical structure for a nitrogen-regulated 9. Elhai, J., and C. P. Wolk. 1988. Conjugative transfer of DNA to cyanobac-
teria. Methods Enzymol. 167:747–754.
promoter in cyanobacteria (12, 24, 38). By monitoring the 10. Falk, J., G. Andersen, B. Kernebeck, and K. Krupinska. 2003. Constitutive
expression level of hpdAt and its impact on tocopherol levels in overexpression of barley 4-hydroxyphenylpyruvate dioxygenase in tobacco
Synechocystis sp. strain PCC 6803 or Synechocystis sp. strain results in elevation of the vitamin E content in seeds but not in leaves. FEBS
Lett. 540:35–40.
PCC 6803 ⌬slr0090 harboring pMON36547, a nirAp::hpdAt ex- 11. Flores, E., and A. Herrero. 1994 Assimilatory nitrogen metabolism and its
pression construct, we were able to show that the nirA pro- regulation, p. 487–517. In D. A. Bryant (ed.), The molecular biology of
moter is active in BG110NO3⫺ medium and inactive in cyanobacteria. Kluwer Academic Publishers, Dordrecht, The Netherlands.
12. Frias, J. E., E. Flores, and A. Herrero. 1997. Nitrate assimilation gene cluster
BG110NH4⫹ medium. More importantly, the results presented from the heterocyst-forming cyanobacterium Anabaena sp. strain PCC 7120.
here are the first, to our knowledge, to demonstrate that the J. Bacteriol. 179:477–486.
13. Frias, J. E., E. Flores, and A. Herrero. 2000. Activation of the Anabaena nir
nitrate-inducible nirA promoter can be used to drive and reg- operon promoter requires both NtcA (CAP family) and BtcB (LysR family)
ulate the transcription of transgenes in Synechocystis sp. strain transcription factors. Mol. Microbiol. 38:613–625.
PCC 6803 and that this regulation can lead to changes in 14. Gambetta, G. A., and J. C. Lagarias. 2001. Genetic engineering of phyto-
chrome biosynthesis in bacteria. Proc. Natl. Acad. Sci. USA 98:10566–10571.
metabolite flux for production of target chemicals, such as 15. Garcia, I., M. Rodgers, R. Pepin, T. F. Hsieh, and M. Matringe. 1999.
tocopherols. Therefore, the nirA promoter system provides a Characterization and subcellular compartmentation of recombinant 4-hy-
5684 QI ET AL. APPL. ENVIRON. MICROBIOL.

droxyphenylpyruvate dioxygenase from Arabidopsis in transgenic tobacco. 29. Omata, T., X. Andriesse, and A. Hirano. 1993. Identification and character-
Plant Physiol. 119:1507–1516. ization of a gene cluster involved in nitrate transport in the cyanobacterium
16. Golden, S. 1994 Light-responsive gene expression and the biochemistry of Synechococcus sp. strain PCC 7942. Mol. Gen. Genet. 236:193–202.
the photosystem II reaction center, p. 693–714. In D. A. Bryant (ed.), The 30. Prentki, P., and H. M. Kirsch. 1984. In vitro insertional mutagenesis with a
molecular biology of cyanobacteria. Kluwer Academic Publishers, Dordrecht, selectable DNA fragment. Gene 29:303–313.
The Netherlands. 31. Rippert, P., C. Scimemi, M. Dubald, and M. Matringe. 2004. Engineering
17. Graßes, T., B. Grimm, O. Koroleva, and P. Jahns. 2001. Loss of ␣-tocoph- plant shikimate pathway for production of tocotrienol and improving herbi-
erol in tobacco plants with decreased geranylgeranyl reductase activity does cide resistance. Plant Physiol. 134:92–100.
not modify photosynthesis in optimal growth conditions but increases sen- 32. Rubio, L. M., A. Herrero, and E. Flores. 1996. A cyanobacterial narB gene
sitivity to high-light stress. Planta 213:620–628. encodes a ferrodoxin-dependent nitrate reductase. Plant Mol. Biol. 30:845–
18. Havaux, M., C. Lütz, and B. Grimm. 2003. Chloroplast membrane photo- 850.
stability in chlP transgenic tobacco plants deficient in tocopherols. Plant
33. Savidge, B., J. D. Weiss, Y.-H. H. Wong, M. W. Lassner, T. A. Mitsky, C. K.
Physiol. 132:300–310.
Shewmaker, D. Post-Beittenmiller, and H. E. Valentin. 2002. Isolation and
19. Kaneko, T. S., S. Sato, H. Kotani, A. Tanaka, E. Asamizu, Y. Nakamura, N.
Miyajima, M. Hirosawa, M. Sugiura, S. Sasamoto, T. Kimura, T. Hosouchi, characterization of homogentisate phytyltransferase genes from Synechocys-
A. Matsuno, A. Muraki, N. Nakazaki, K. Naruo, S. Okumura, S. Shimpo, C. tis PCC 6803 and Arabidopsis. Plant Physiol. 129:321–332.
Takeuchi, T. Wada, A. Watanabe, M. Yamada. M. Yasuda, and S. Tabata. 34. Scholz, P., V. Haring, B. Wittmann-Liebold, K. Ashman, and M. Bagdasar-
1996. Sequence analysis of the genome of the unicellular cyanobacterium ian. 1989. Complete nucleotide sequence and gene organization of the
Synechocystis sp. strain PCC 6803. II. Sequence determination of the entire broad-host-range plasmid RSF1010. Gene 75:271–288.
genome and assignment of potential protein-coding regions. DNA Res. 35. Schweizer, H. P. 1993. Small broad-host-range gentamycin resistance gene
3:109–136. cassettes for site-specific insertion and deletion mutagenesis. BioTechniques
20. Kikuchi, H., M. Aichi, I. Suzuki, and T. Omata. 1996. Positive regulation by 15:831–833.
nitrite of the nitrate assimilation operon in the cyanobacteria Synchococcus 36. Secor, J. 1994. Inhibition of barnyardgrass 4-hydroxyphenylpyruvate dioxy-
sp. strain PCC 7942 and Plectonema boryanum. J. Bacteriol. 178:5822–5825. genase by sulcotrione. Plant Physiol. 106:1429–1433.
21. Lagarde, D., L. Beuf, and W. Vermaas. 2000. Increased production of zea- 37. Stanier, R. Y., R. Kunisawa, M. Mandel, and G. Cohen-Bazire. 1971. Puri-
xanthin and other pigments by application of genetic engineering techniques fication and properties of unicellular blue-green algae (order Chroococcales).
to Synechocystis sp. strain PCC 6803. Appl. Environ. Microbiol. 66:64–72. Bacteriol. Rev. 35:171–205.
22. Luque, I., E. Flores, and A. Herrero. 1993. Nitrite reductase gene from 38. Suzuki, I., T. Sugiyama, and T. Omata. 1993. Primary structure and tran-
Synechococcus sp. PCC 7942: homology between cyanobacterial and higher- scriptional regulation of the gene for nitrite reductase from the cyanobac-
plant nitrite reductase. Plant Mol. Biol. 21:1201–1205. terium Synechococcus PCC 7942. Plant Cell Physiol. 34:1311–1320.
23. Luque, I., E. Flores, and A. Herrero. 1994. Molecular mechanism for the 39. Suzuki, I., H. Kikuchi, S. Nakanishi, Y. Fujita, T. Sugiyama, and T. Omata.
operation of nitrogen control in cyanobacteria. EMBO J. 13:2862–2869. 1995. A novel nitrite reductase gene from the cyanobacterium Plectonema
24. Maeda, S.-I., Y. Kawaguchi, T. A. Ohe, and T. Omata. 1998. cis-Acting boryanum. J. Bacteriol. 177:6137–6143.
sequences required for NtcB-dependent, nitrite-responsive positive regula- 40. Taylor, L. A., and R. E. Rose. 1988. A correction in the nucleotide sequence
tion of the nitrate assimilation operon in the cyanobacterium Synechococcus
of the Tn903 kanamycin resistance determinant in pUC4K. Nucleic Acids
sp. strain PCC 7942. J. Bacteriol. 180:4080–4088.
Res. 16:358.
25. Marraccini, P., S. Bulteau, C. Cassier-Chauvat, P. Mermet-Bouvier, and F.
Chauvat. 1993. A conjugative plasmid vector for promoter analysis in several 41. Trebst, A., B. Depka, and H. Holländer-Czytko. 2002. A specific role for
cyanobacteria of the genera Synechococcus and Synechocystis. Plant Mol. tocopherol and of chemical singlet oxygen quenchers in the maintenance of
Biol. 23:905–909. photosystem II structure and function in Chlamydomonas reinhardtii. FEBS
26. Mohamed, A., and C. Jansson. 1989. Influence of light on accumulation of Lett. 516:156–160.
photosynthesis-specific transcripts in the cyanobacterium Synechocystis 6803. 42. Tsegaye, Y., D. K. Shintani, and D. DellaPenna. 2002. Overexpression of the
Plant Mol. Biol. 13:693–700. enzyme p-hydroxyphenylpyruvate dioxygenase in Arabidopsis and its relation
27. Munné-Bosch, S., and L. Alegre. 2002. The function of tocopherols and to tocopherol biosynthesis. Plant Physiol. Biochem. 40:913–920.
tocotrienols in plants. Crit. Rev. Plant Sci. 21:31–57. 43. Valentin, H. E., and T. A. Mitzky. November 2002. TYRA genes and uses
28. Ng, W.-O., R. Zentella, Y. Wang, J. S. A. Taylor, and H. B. Pakrasi. 2000. thereof. International patent application WO 2/089561.
phrA, the major photoreactivating factor in the cyanobacterium Synechocystis 44. Williams, J. G. K. 1988. Construction of specific mutations in Photosystem II
sp. strain PCC 6803 codes for cyclobutane-pyrimidine-dimer-specific DNA photosynthetic reaction center by genetic engineering methods in Synecho-
photolyase. Arch. Microbiol. 173:412–417. cystis 6803. Methods Enzymol. 167:766–778.

View publication stats