Review

For reprint orders, please contact: reprints@futuremedicine.com

Emerging tools for identification of

arthropod vectors

Amina Yssouf1, Lionel Almeras1, Didier Raoult1 & Philippe Parola*,1

The rapid and reliable identification of arthropod vector species is an essential component
of the fight against vector-borne diseases. However, owing to the lack of entomological
expertise required for the morphological identification method, development of alternative
and complementary tools is needed. This review describes the main methods used for
arthropod identification, focusing on the emergence of protein profiling using MALDI-TOF
MS technology. Sample preparation, analysis of reproducibility, database creation and blind
tests for controlling accuracy of this tool for arthropod identification are described. The
advantages and limitations of the MALDI-TOF MS method are illustrated by emphasizing
different hematophagous arthropods, including mosquitoes and ticks, the top two main
vectors of infectious diseases.

First draft submitted: 22 July 2015; Accepted for publication: 14 January 2016;
Published online: 12 April 2016

Arthropods are metazoan invertebrate animals encompassing more than 1 million species, and they Keywords 
represent more than 80% of all living animal species [1] . Some arthropods possess the capacity to • arthropod identification
transmit pathogens, although the proportion of arthropod species known to pose public health • database creation
hazards is relatively small [2] . Currently, the number of arthropods parasitizing humans, domestic • MALDI-TOF mass
animals and wildlife is estimated at approximately 39,000 species. The majority of these arthropod spectrometry profiling
species belong to the class of insects and arachnids including mosquitoes and ticks, respectively [3] . • molecular tools
Mosquitoes are the primary vectors of human infectious diseases, including malaria, dengue • morphological tools
and filariasis [4] . Every year more than 1 million individuals in the world die from mosquito-borne • vector-borne diseases
diseases [5] . With the identification and emergence of borrelioses and rickettsial diseases, ticks have
also been recognized to have major effects on public health [6] . In the last decade, the recent epidemic
of West Nile virus in USA [7] and the Chikungunya outbreaks in the Indian Ocean, Europe [8] and,
more recently, in America [9] are some examples of the expansion of vector-borne diseases (VBD) in
New World areas [10] . The rapid risk changes in VBD indicate that dissemination is now a global
problem. Arthropod monitoring and control of vector populations remain essential to surveying
and preventing VBD. Thus, the reliable and rapid identification of arthropod at the species level
to distinguish vectors from nonvectors is essential [11] .
This review first presents the main and frequently used methods and tools for arthropod identifi-
cation, emphasizing their advantages and limitations, including recent development in morphologi-
cal and molecular tools. In the second part of the review, innovative methods, focusing mainly on the

1
Aix Marseille Université, Unité de Recherche en Maladies Infectieuses et Tropicales Emergentes (URMITE), UM63, CNRS 7278, IRD 198
(Dakar, Sénégal), Inserm 1095, Faculté de Médecine, 27 bd Jean Moulin, 13385 Marseille cedex 5, France
*Author for correspondence: Tel.: +33 491 385 517; Fax: +33 491 387 772; philippe.parola@univ-amu.fr part of

10.2217/fmb.16.5 © 2016 Future Medicine Ltd Future Microbiol. (Epub ahead of print) ISSN 1746-0913
Review Yssouf, Almeras, Raoult & Parola

state of MALDI-TOF MS science for arthropod arthropod identification, free of entomological

identification at the species and subspecies levels, knowledge, have been developed.
are presented.
Morphometry method
Current methods for arthropod In medical entomology, the morphometry
identification method consists of studying and analyzing the
●●Morphological methods size and shape of biological structures and the
Morphological criteria relationships between these two geometrical fea-
Morphological identification is based on the use tures [25] . This method is mainly applied to the
of morphological characters, serving as guide- study of phenotypical evolution and systematics
lines for arthropod identification at the family, of insect vector populations [26] . By analyzing a
genus and species levels. These morphological part of the body, the wing [27,28] or the head [29]
identifications require the use of dichotomous for example, very small morphological varia-
identification keys existing in different for- tions in cryptic species that have not necessar-
mats such as books [12–14] or software [15] . ily been detected by traditional morphological
Morphological identification has the advantage approaches can be revealed. The morphometry
of being inexpensive in terms of reagent and method has been used in medical and veterinary
can be conducted in the field, thus enabling a entomology to distinguish Culicidae [30] as well
preliminary sorting of specimens [16] . Thus, the as Anopheles [31] , Aedes [32] and morphologically
morphological approach is still a popular tool for similar Culex species [33] . The main limitations of
arthropod identification. this method are labor-intensive biological mate-
However, this method presents several limi- rial preparation and geometric morphometric
tations, such as access to or the availability of analysis, which are chronophagous [31] .
corresponding arthropod identification keys; the
integrity of the specimens is necessary to avoid Wing interference patterns
the loss of species-specific identification crite- This method emerged in the 1990s and
ria [17,18] . For some arthropod families, dissection was investigated in many groups of
of specific organs and mounting under a micro- Hymenoptera [34] and Diptera [35,36] . The WIPs
scope are required for reliable identification [19] . method was used for the identification and the
These chronophagous and precise steps are not discovery of cryptic species in Hymenoptera
applicable when large numbers of specimens species [37] . The wings interference patterns
must be identified. For immature or engorged (WIPs) is an emerging method based on analy-
tick specimens, the lack of developed morpho- sis of morphological diversification of transpar-
logical characters or the presence of blood meal ent insect wing scales observed under electron
make the identification difficult [20] . Similarly, microscope on a dark background [37] by com-
the absence of morphological features for cryp- paring the arrangement of the scale through
tic or sibling species (e.g., similar or overlapping different interference colors in the ventral and
morphology criteria) are problematic, especially dorsal sides based on the thickness of the wing
as such species are now known to occur in many membrane [37,38] . It is based on analysis of the
vector taxons [16] . Moreover, these morphologi- wing color pattern produced by spatial varia-
cally similar arthropods can differ greatly in tion in the thickness of the air-cuticle multi-
their vector competence, preferred host and layer structure inside iridescent scales [38] . The
larval habitat [21] , necessiting accurate iden- advantages of this method are that it does not
tification. Examples include mosquitoes from require a special light source; it is rapid and
the An. gambiae complex [22] or ticks from the specific for the identification of adult Diptera
Rhipicephalus sanguineus group [23] . Additionally, species by querying wing color pattern photo-
for accurate identification, entomological exper- graphs against the WIPs database. Until now,
tise is generally required. In the 30 past years, the the WIPs method has not been evaluated for
numbers of experts in systematics have decreased identification of Diptera species known to be of
and the resulting absence of expertise transmis- medical interest such as mosquitoes, Culicoides
sion means that some arthropod families have and sand flies. While the WIPs method is a
become orphans [24] . Moreover, as entomologists promising tool for species recognition, it has
cannot be experts on a wide range of arthropod several limitations. It cannot be applied to spec-
families, complementary alternative methods for imens with damaged wings, requiring delicate

10.2217/fmb.16.5 Future Microbiol. (Epub ahead of print) future science group

 Emerging tools for identification of arthropod vectors Review

collection and transport. It cannot be applied amplifying DNA under isothermal conditions,
to identification of arthropod vectors without and thus requiring minimal laboratory equip-
wings such as ticks, lice or fleas. Nor can this ment, is perfectly adapted for field analyses.
tool be applied to Diptera species recognition However, the design of primers is complicated
at immature aquatic stages. Thus, the develop- and requires genomic sequence information; one
ment of a new method that was not limited primer system and amplification are needed per
by these factors and that would allow accurate arthropod species investigated. Although the
insect species identification in a short time and LAMP method was successfully applied for
in an economic way was required. distinction between An. gambiae and An. arabi-
ensis mosquitoes [68] , this method was developed
●●Molecular methods more for determination of the infection status of
The sequencing of specific coding and noncod- arthropod vectors [69–71] .
ing regions genetic sequences from some vector
species were designed for species identification, Genetic markers used for mosquito & tick
and played an important role in the development identification
of this approach [39] . The noncoding regions, Ribosomal DNA markers
including the spacer regions, are supposed to be Among the ribosomal DNA markers, the
less affected by adaptive selection and are often Internal Transcribed Spacer (ITS) and ribosomal
targeted in arthropod molecular taxonomy [40] . subunits are the main ribosomal markers used
Molecular methods present numerous advan- for mosquito and tick identification [40–41,72] .
tages. Insect developmental stages have no effect The ITS2 sequence possesses the greatest inter-
on target genetic sequences, and several sample species divergence and the lowest intraspecies
storage conditions are compatible with DNA variation and was proposed as the most suit-
preservation such as samples stored frozen in able DNA marker for species identification of
alcohol and in some cases even dried [41] . DNA arthropods such as mosquitoes and ticks [51,61] .
extracted from a specimen as small as an egg or To distinguish the species of Anopheles mosquito
the segment of one leg may be directly submit- complex from chromosome forms of An. gam-
ted to molecular analysis regardless of the stage biae ss, the ITS2 sequence is one of the most
of life [42] . In addition, molecular tools require a frequently used [73–76] . The ITS2 marker is also
small amount of biological material and several able to distinguish different Aedes species [48]
steps can be automated, allowing identification as well as Culex species [17,77] down to the sub-
of a large number of specimens. species level [77] . The ribosomal ITS1 gene is
Different genetic markers and molecular sometimes used to distinguish mosquito spe-
strategies have been developed using species- cies [45,48] . ITS2 sequencing has been also used to
specific nucleotide sequences designed mainly discriminate between several species belonging
from nuclear ribosomal DNA (rDNA) or mito- to hard and soft ticks and even the Argas spe-
chondrial rDNA (Table 1) . However, despite cies [62] . However, the ITS2 sequence was some-
the specificity, reproducibility and sensitivity times unable to accurately distinguish closely
of molecular methods, no consensus sequence related arthropod species, and its combination
exists for the identification of all arthropod spe- with other genes such as ITS1 or the COI was
cies. Incomplete or absent DNA sequence infor- frequently reported [58,78–79] . However, several
mation for a larger number of arthropod families other gene sequences have been employed for
are factors limiting the use of molecular biol- their identification or discrimination, such as
ogy methods for arthropod identification [43,44] . domain 3 (D3) of the 28S subunit for mosqui-
Additionally, these molecular methods are gen- toes [45,80] or the 18S rDNA sequence for tick
erally costly and relatively time consuming, thus identification [81] . The Intergenic spacer was for-
hampering their use. merly used to identify the An. gambiae complex
More recently, a novel nucleic acid amplifi- by using different PCR methods [42,50] .
cation method, termed loop-mediated isother- Consequently, among all ribosomal markers,
mal amplification (LAMP), was developed by the ITS2 gene seems the most used to distinguish
Notomi et al. [67] . The LAMP principle relied on species of the Culicidae and Ixodidae family, but
autocycling strand displacement DNA synthesis currently, no single ribosomal DNA sequence
by nucleic acid amplification in one step. This has been shown suitable for identification of all
sensitive, rapid (<1 h) and accurate technique, arthropod species.

future science group www.futuremedicine.com 10.2217/fmb.16.5

 Table 1. Principal genetic markers used for mosquitoes and ticks identification.
Genetic PCR method Primers Usefulness Comments Ref.
markers

10.2217/fmb.16.5
Mosquitoes
ITS2 Standard PCR and ITS2a: 5´-TGTGAACTGCAGGACACAT–3´ Distinction of anopheline sibling species Useful for low-level phylogenetic [45,46]
sequencing ITS2b: 5´-TATGCTTAAATTCAGGGGGT–3´ involved in malaria transmission (An. analyses and to distinguish closely
funestus and nili groups) related species
Standard PCR and 5.8F /5´-TGTGAACTGCAGGACACATG- 3´ Application to identification of Large availability of Genbank [47]
sequencing 28R/5´-ATGCTTAAATTTAGGGGGTA–3´ specimens from Anopheles and Culex sequences
genera
PCR-RFLP 18SFHIN/5´-GTAAGCTTCCTTTGTACACACCGCCCG Identification of subgenus adenine [48]
T–3´ mosquito species (subgenus Stegomyia)
CP 16/5´-GCCGGTACCATGCTTAAATTTAGGGGGTA–3´
aeg.r1. TAACGGACACGTTCTAGGCCCT
alb.r1 GTACTAGGCTCACTGCCACTGA
Review Yssouf, Almeras, Raoult & Parola

fla.r3 ACCRCAAGCAAGCCTCRTCGTA
riv.r1 GTGTCGTCCG GGGTKAMCGT
dai.ri ACGGGTTGGT TGGCAAAAGCCGT
Multiplex PCR ANU: 5´-GATGCACACATTCTTGAGTGCC3´ Distinction of anopheline sibling species [49]
ANO: 5´AGCACGGTCACCACGGTTCTCC3´ involved in malaria transmission (An. nili
ANC: 5´CTGGTGGGGTTCTTCTCTTCTCG 3´ group)

Future Microbiol. (Epub ahead of print)

ANT: 5´TGGCTGCTTCTCGTGGCGCG3´
ANS: 5´ATGCACCACGGGGGGTTTGGGCC3´
ITS1 Standard PCR and ITS1aF/5´-CGAGCCGAGTGATCCACCG–3´ Distinction of anopheline sibling species Suitable marker in complement to the [45]
sequencing ITS1aR/5´- TTGATTACGTCCCTGCCCTTT–3´ involved in malaria transmission (An. ITS 2 for systematic and taxonomic
moucheti group) purposes
IGS Multiplex PCR UN: GTCTGCCCCTTCCTCGATGT Identification of An. gambiae complex Mainly used for An. gambiae complex [42]
GA: CTGGTTTGGTCGGCACGTTT distinction
ME: TGACCAACCCACTCCCTTGA
Ar: AAGTGTCCTTCTCCATCCTA
QD: CAGACCAAGATGGTTAGTAT
TaqMan real-time PCR comF (5´-GCTTGGTGGTTTGTCCG–3´ Discrimination of An. gambiae group [50]
comR (5´-CTGTGTCGACGTGGTCCC–3´ species
probe AG/AA (5´-GACCAAGACGAGC–3´
probe AQ/AM (5´-GACCAAGACGCGC–3´
PCR-RFLP UN: 5´-GTGTGCCCCTTCCTCGATGT3´ Dedicated to An. gambiae group species [51]
GA: 5´-CTGGTTTGGTCGGCACGTTT–3´ identification
QD: 5´-CAGACCAAGATGGTTAGTAT–3´
ME: 5´-TGACCAACCCACTCCCTTGA–3´
D3 Standard PCR/ D3a 5´-GACCCGTCTTGAAACACGGA3´ Distinction of anopheline sibling species Powerful tool for taxonomic studies in [52]
sequencing D3b 5´-TCGGAAGGAACCAGCTACTA3´ involved in malaria transmission (An. nili anophelines, but insufficient to distinct
group) typical from atypical An. nili forms

future science group

 Table 1. Principal genetic markers used for mosquitoes and ticks identification (cont.).
Genetic PCR method Primers Usefulness Comments Ref.
markers
Mosquitoes (cont.)
COI PCR-RFLP UEA3/5´-TATRGCWTTYCCWCGAATAAATAA–3 Ideal candidate for the molecular Efficient for taxonomical classification [53]

future science group

Fly10 /5´-ASTGCACTAATCTGCCATATTAG–3´ identification of Aedes disease vectors to of the majority of mosquito species
species level including members of cryptic species,
Standard PCR/ COI F/ 5´-GGATTTGGAAATTGATTAGTTCCTT–3´ Effectiveness of COI barcodes for whereas divergences remain equivocal [54,55]
sequencing COI R/5´-AAAAATTTTAATTCCAGTTGGAACAGC–3´ mosquito species identification by using only this sequence
Standard PCR/ LCO1490 5´-GGTCAACAAATCATAAAGATATTGG–3´ Unable to classify correctly some closely [56]
sequencing HCO2198 5´-TAAACTTCAGGGTGACCAAAAAATCA–3´ related species of Culex genus
16S Standard PCR/ 16S F/ 5´-GAATGAGATATATACTGTC–3´ Identification of Culicidae species from Despite a hypervariable region [57]
sequencing 16S R/ 5´-CTTTTTTGTCGATAAGAAC Aedes, Culex and Anopheles genera allowing to distinct mosquito species,
16S is not frequently used
Ticks
ITS2 PCR-RFLP TITS2F1/ 5′-CGAGACTTGGTGTGAATTGCA–3´ Useful to identify hard and soft ticks High sequence variations suitable to [58,59]
TITS2R1/ 5′- TCCCATACACCACATTTCCCG–3´ distinct species complex
PCR-RFLP ITS2 F/ 5´-CTGCGAGACTTGGTGTGAAT–3´ Identification of species until closely of ticks belonging to Ixodes and [60]
ITS2 R/ 5´-TATGCTTAAGTTCAGCGGGT–3´ related ticks Rhipicephalus genera, however, the
Standard PCR/ ITS2–F/ 5´-ACATTGCGGCCTTGGGTCTT–3´ Identification of the most vectors of combination with other mitochondrial [61]
sequencing ITS2–R/ 5´-TCGCCTGATCTGAGGTCGAC–3´ human diseases genes (e.g., ITS1 or COI) could be
Standard PCR/ RIB–3 (CGG GAT CCT TC(A,G) CTC GCC G(C,T)T ACT) Tick identification at immature stages required [62]
sequencing RIB–4 (CCA TCG ATG TGA A(C,T)T GCA GGA CA) and blood-engorged status
ITS1 PCR-RFLP TITS1F/ 5´-TCATAAGCTCGCGTTGATT–3´ Useful to identify hard and soft ticks Suitable marker in complement to [58]
TITS1R/ 5´-AGCTGGCTGCGTTCTTCAT–3´ ITS 2 for systematic and taxonomic
purposes
18S Standard PCR/ For/ 5´-GGCCCCGTAATTGGAATGAGTA–3´ Relevant for tick identification but Restricted to comparisons of distant [63]
sequencing Rev/ 5´- CACCACCCACCGAATCAAGAAA–3´ insufficient for phylogenetic study taxa
12S Standard PCR/ T1B/ 5´-AAACTAGGATTAGATACCCT–3´ Identification of species from same Relevant marker for tick identification [59,64,65]
sequencing T2A/ 5´-AATGAGAGCGACGGGCGATGT–3´ genera and closely related tick species
COI Standard PCR/ C1–J–1718 (5´-GGAGGATTTGGAAATTGATTAGTTCC–3´ Identification of species from same Useful for tick species identification [59]

www.futuremedicine.com
sequencing C1–N–2329 (5´-ACTGTAAATATATGATGAGCTCA–3´ genera and closely related ticks COI gene, a better genetic markers for
Standard PCR/Cloning cox1F/ 5´-GGAACAATATATTTAATTTTTGG–3´ Useful genetic markers for the tick species identification compared [64,66]
and sequencing cox1R /5´-ATCTATCCCTACTGTAAATATATG–3´ specific identification and genetic with the 12S and ITS2
characterization of ticks
16S Standard PCR/ 16S-F/ 5´-TTAAATTGCTGTRGTATT3 Efficient for tick species identification Relevant marker for tick species [64]
sequencing 16S-R1/ 5´-CCGGTCTGAACTCASAWC–3´ identification although for closely
related species but it could be used
Emerging tools for identification of arthropod vectors

with COI
Review

10.2217/fmb.16.5
Review Yssouf, Almeras, Raoult & Parola

Mitochondrial markers methods. These different properties promoted its

The COI gene, described as the standard marker establishment as a reference method in diagnos-
for mitochondrial DNA barcoding, can be tic laboratories for the identification of micro-
useful for identifying arthropods at the spe- organisms, and it has revolutionized microbial
cies level [61,82] . Moreover, others studies have identification. Subsequently, MALDI-TOF MS
emphasized that COI sequencing can efficiently was evaluated for the identification of multicel-
discriminate arthropod complex species [54,83] . lular organisms, including arthropods (Table 2) .
However, intraspecies variations of COI sequence A pioneering study of insects demonstrated the
from specimens collected in distinct geographi- applicability of MALDI-TOF MS profiling
cal areas failed to distinguish mosquitoes [55,84] for identification of the South African insect
or ticks’ sibling [64] species, requiring the use of Mantophasmatodea based on the analysis of
other genetic markers [56,84] . Some studies com- peptides extracted from neurohemal organs [89] .
pared the rates of correct arthropod specimen One year later, the MALDI-TOF MS profiling
identification using the main molecular markers approach was used to distinguish sibling spe-
(e.g., COI, 16S rDNA, ITS2, 12S rDNA) [61] . In cies from the Drosophila melanogaster subgroup
those cases, although COI seems to be the first using protein extracts from whole specimens [90] .
choice for arthropod identification, other mark- Another study of Drosophila species reported
ers are required when COI does not produce that similar spectra were observed regardless of
reliable results [61] . Moreover, numerous other the gender; however, some changes were noted
gene sequences have been assessed according to according to the geographical origin of speci-
arthropod groups, which are additional factors mens from the same species [90] . The same year,
muddying the definition of a specific target gene, the uniqueness of MALDI-TOF MS profiles
and emphasizing the great difficulty in achieving obtained from protein extracts of whole aphids
this goal. demonstrated that they can be used as species-
Although the COI gene remains the best specific diagnostic markers to identify these
mitochondrial marker for identifying arthropod species [91] . Moreover, the authors reported that
species, this genetic marker is sometimes inad- species-specific protein profiles were maintained
equate in distinguishing all species from both independently of nutritional status [91] . These
arthropod groups at the subspecies level. Thus, studies showed that MALDI-TOF MS could be
the development of a new approach requiring used for the identification of small multicellular
a minimum of time and expense and able to organisms in a manner similar to the identifica-
identify arthropod species without the need for tion of bacteria [30] . Subsequently, the MALDI-
genetic sequence information is indispensable. TOF MS technique was applied to different
arthropod families, including the Culicoides bit-
An emerging method for arthropod ing midges [92,93] , ticks [11,94] , mosquitoes [95,96] ,
identification: MALDI-TOF MS profiling tsetse flies [97,98] , sand flies [99] and fleas [100] .
●●MALDI-TOF MS applications in arthropod These studies reported that the MALDI-TOF
identification MS approach is suitable for arthropod iden-
At the beginning of the 2000s, matrix-assisted tification at the species level and down to the
laser desorption ionization-time of flight mass subgroup or complex level [95,96] . A flowchart
spectrometry (MALDI-TOF MS) was applied to illustrating the main steps of the experimental
the identification and phylogenetic classification workflow for reference database creation, evalu-
of micro-organisms, including bacteria, fungi ation and use for arthropod identification by
and yeasts [85,86] . Since then, MALDI-TOF MS MALDI-TOF MS are summarized in Figure 1.
has been introduced into routine analyses for
systematic identification of micro-organisms ●●The principle of MALDI-TOF MS
in clinical microbiology laboratories [86–88] . This method is based on acidic extraction of pro-
The popularity of MALDI-TOF MS-based teins from an organism of interest. The resulting
approaches is attributed mainly to the relatively peptide/protein mixture is then placed on a steel
simple sample preparation, the speed with which target plate and covered with MALDI matrix
the data can be collected and analyzed and reli- and dried until it cocrystallizes. The crystal is
able identification. Moreover, this cost-effective then irradiated with laser pulses, effecting the
method is financially competitive compared desorption and ‘soft’ ionization of large, intact
with conventional phenotypic and molecular biomolecules [86] and protecting them from

10.2217/fmb.16.5 Future Microbiol. (Epub ahead of print) future science group

 Emerging tools for identification of arthropod vectors Review

destruction by the direct laser pulses [101] . The storage in ethanol maintained spectra profiles
desorbed and ionized molecules are then acceler- and permitted unambiguous identification of
ated in an electric field and separated through Culicoides species [93] . Nevertheless, other works
a flight tube in the linear or reflectron mode reported that freshly prepared specimens pro-
according to their mass-to-charge ratio until vided higher average data counts in terms of the
they reach a detector [102–104] . Thus, the time- number and intensity of peaks than specimens
of-flight (TOF) of each molecule is measured by stored in 70% ethanol [93,100] .
MS. Then, the molecular mixture from a sample Similarly, a recent study using MALDI-TOF
is detected on the basis of its TOF and charac- MS for flea identification revealed that the stor-
terized by a mass spectrum composed of peaks age of specimens in ethanol disrupts and influ-
with varying masses and intensities of ions [86] . ences the spectra compared with fresh or frozen
According to the apparatus and machine setting, samples, and dramatically alters the reliability
the window range of mass-to-charge ratio can of identification [110] . Thus, the use of fresh or
vary, but generally solely peptides and proteins of frozen samples of ticks [11] , tsetse flies [97] and
low molecular weight (<25 kDa) were detected. Drosophila species [90] remains the best method
The mass spectra generated are unique protein in terms of peak number, signal intensity and
‘fingerprint signatures’ for reliable species iden- peak resolution [100,101] . Moreover, long periods
tification and taxonomic classification [87,102] and of protein sample storage in ethanol induce pro-
protein identity is usually unimportant [90] . The tein precipitation and decrease protein solubil-
reproducibility of the spectra is a critical parame- ity, which could lead to the loss of qualitative
ter for the creation of a spectra reference database and quantitative spectra profiles [44] . A drying
and accurate species identification. method of preservation was also tested for mos-
quito specimens [107] . The arthropod placed in
●●Preparation of arthropod samples for silica gel with a piece of cotton at room tempera-
MALDI-TOF MS ture for several months did not alter dramatically
Storage conditions & body parts used MS analysis [107] . Thus, storage conditions are an
The mode of sample conservation and the choice important factor in MALDI-TOF MS analysis
of the whole specimen or body parts are crucial of arthropod specimens.
parameters for MALDI-TOF MS analyses. For The second crucial parameter is the choice of
epidemiological studies, arthropods are generally the body parts use for the MS reference database
collected in the field through different methods creation. In contrast to molecular biology analy-
depending on the arthropod family [96] . The sis, where the genome is the same for all cells
methods may include using traps, spraying and of a specimen except the sex cells, the protein
aspiration for insect groups or ectoparasite col- repertoire from arthropods varies according to
lection, including ticks, lice or fleas removed compartment [97] . Thus, it is indispensable to
from vertebrate hosts [11] . In these field condi- initially test the whole specimen and different
tions, samples are generally stored either in 70% body parts to determine which one produces a
ethanol, frozen, dried in silica gel or left at room unique and reproducible protein pattern for each
temperature until further analysis in the labora- species.
tory. Storage conditions can have a deleterious Although pioneering studies used whole spec-
impact on the MS protein pattern; thus, it is imens, it is now well recognized that arthropod
essential to test and determine the consequences abdomens should be excluded from analysis,
of sample storage conditions on spectra prior to especially for mature, hematophagous arthro-
creating a reference library. Fresh [11] or frozen pods (Table 2) . Several studies reported that dis-
specimens [100] are preferred for the evaluation of section and exclusion of the abdomen increased
arthropod identification by MALDI-TOF MS. the reproducibility and quality of the MS spec-
The storage of field samples in ethanol tra [95,99] . The deleterious effects were attributed
remains a common preservation mode. Several to the gut contents, which can differ within a spe-
studies, using exclusively arthropod species cies due to distinct diets [95] . This phenomenon
stored in ethanol, including Culicoides biting is enhanced in hematophagous arthropods [92] .
midges [105] , mosquitoes [95] and Drosophila [44] Consequently, omitting the abdomen appears
species, showed successful identification of spe- to be the better strategy for protein extraction
cies by MALDI-TOF MS (Table 2) [92] . Another for further MALDI-TOF analyses. The abdo-
study confirmed that short periods of sample men can be used for other purposes, including

future science group www.futuremedicine.com 10.2217/fmb.16.5

 Table 2. Application of matrix-assisted laser desorption ionization time-of-flight mass spectrometry for arthropod identification.
Arthropod groups Storage condition Body section Matrix used Instrument types Comments Ref.
used

10.2217/fmb.16.5
Mantophasmatodea Fresh specimens Neurohemal α-cyano-4- Voyager DE biospectrometry Neuropeptide MS patterns stable [89]
organs hydroxycinnamic acid workstation (Perseptive between males, females and larvae
Biosystems, MA, USA) per species. Relationship between
geographical location of samples and
peptide sequences
Drosophila Fresh specimens Whole body α-cyano-4- Voyager Elite MALDI-TOF MS Reproducibility of MS spectra from [90]
hydroxycinnamic acid; (Perseptive Biosystems) specimens of the same species coming
sinapinic acid from distinct localities
70% ethanol at RT or Whole body Sinapic acid Ultraflex III MALDI-TOF Storing mode influences quantitatively [44]
-20°C for long storage spectrometer (Bruker Daltonics, (intensity) and qualitatively (peak
period Bremen, Germany) diversity) MS spectra
Aphids Fresh specimens Whole body α-cyno-4- Voyager DE Pro MALDI-TOF MS Presence of peaks specific in each stages [91]
Review Yssouf, Almeras, Raoult & Parola

(adult + nymphs) hydroxycinnamic acid, 100 (Applied Biosystems, CA,

sinapinic acid USA)
Culicoides Specimens fresh and Whole insects or Water or sinapic AximaTM Confidence MALDI-TOF SA better MS spectra with SA than DHB; [93]
stored in ethanol thoraxes acid (SA) or mass spectrometer (Shimadzu- engorgement altering MS spectra, the
2.5-dihydroxybenzoic Biotech Corp., Kyoto, Japan) removing of abdomens is recommended;
acid (DHB) 70% ethanol storage alters MS spectra

Future Microbiol. (Epub ahead of print)

Specimens stored in Thoraxes with Sinapic acid AximaTM Confidence MALDI-TOF Despite correct MS identification from [92]
ethanol head, wings and mass spectrometer (Shimadzu- specimens preserved in 70% ethanol,
legs Biotech Corp.) more data counts (peaks) were observed
for freshly caught specimens
Larva stored in Whole body Sinapic acid AximaTM Confidence MALDI-TOF Gut content of larva modifies the MS [106]
ethanol at 4°C without gut mass spectrometer (Shimadzu- patterns. MS spectra change according
Biotech Corp.) to Ceratopogonid larva developmental
stage
Specimens stored in Whole body Sinapic acid AximaTM Confidence MALDI-TOF First application of MALDI-TOF MS for [105]
ethanol without mass spectrometer (Shimadzu- large identification of culicoides collected
abdomen Biotech Corp.) in the field
Ticks Fresh specimens Evaluation of α-cyano-4- Ultraflex III MALDI-TOF Whole or body parts generated [94]
different body hydroxycinnamic acid spectrometer (Bruker Daltonics) reproducible MS spectra for tick
parts identification except legs
Fresh specimens Legs α-cyano-4- Microflex LT (Bruker Daltonics) Legs are sufficient for tick identification [11]
hydroxycinnamic acid by MALDI-TOF MS

future science group

 Table 2. Application of matrix-assisted laser desorption ionization time-of-flight-mass spectrometry for arthropod identification (cont.).
Arthropod groups Storage condition Body section Matrix used Instrument types Comments Ref.
used
Mosquitoes Fresh and dried Legs α-cyano-4- Microflex LT (Bruker Daltonics) Legs are sufficient for mosquito [96]
specimens hydroxycinnamic acid identification by MALDI-TOF MS

future science group

Dried specimens Legs α-cyano-4- Microflex LT (Bruker Daltonics) High MS spectra quality need for relevant [107]
hydroxycinnamic acid identification
Fresh Eggs Sinapic acid AximaTM Confidence MALDI-TOF Eggs are sufficient for mosquito [108]
mass spectrometer (Shimadzu- identification by MALDI-TOF MS
Biotech Corp.)
Fresh and specimens Larva α-cyano-4- Microflex LT (Bruker Daltonics). MS spectra change according to aquatic [109]
stored in ethanol hydroxycinnamic acid developmental stages; but efficient
for larva mosquito identification; live
monitoring of mosquito breeding sites
conceivable
Several months in Heads and Saturated sinapic acid AximaTM Confidence MALDI-TOF Highly specific MS patterns allowing to [95]
ethanol thoraces mass spectrometer (Shimadzu- distinct also cryptic Anopheles species
Biotech Corp.)
Fleas Fresh and specimens Whole body α-cyano-4- Microflex LT (Bruker Daltonics) Important alteration of MS profiles for [100]
stored in ethanol without hydroxycinnamic acid specimens stored in alcohol compared
abdomen with fresh fleas
Tsetse flies Fresh specimens Evaluation of α-cyano-4- Microflex LT (Bruker Daltonics) All body parts suitable for specimen [97]
different body hydroxycinnamic acid identification but irrespective of the
parts gender
Specimens stored in Wings α-cyano-4- Microflex LT (Bruker Daltonics) Specific MS spectra according to species, [98]
ethanol hydroxycinnamic acid location and gender
Sand flies Specimens stored in Body without Sinapinic acid Ultraflex III MALDI-TOF Frozen specimens provide the best MS [99]
ethanol or at -20°C head and spectrometer (Bruker Daltonics) spectra, applicable for phlebotomine
abdomen sand fly identification

www.futuremedicine.com
Emerging tools for identification of arthropod vectors
Review

10.2217/fmb.16.5
Review Yssouf, Almeras, Raoult & Parola

MALDI-TOF MS analyses

Arthropod collection

Determination of Whole Cephalothorax

l h Legs

Optimization and evaluation

body part compartment

of sample preparation
Field Breeding

Species n°1
Reproducibility
intraspecies
Identification
Specificity
Morphological keys
Molecular marker(s) Species n°2 interspecies
Legs
Reproducibility
intraspecies

Creation and
validation
Blind tests
Reference MS spectra database creation
Threshold identification
value

Species n°3

Interrogation

identification
Field collection Host collection

Specimen
Not included
in the database

Figure 1. Overall strategy for the use of MALDI-TOF MS for arthropod identification. The successive steps of arthropod collection (A)
for optimization and evaluation of sample preparation (B), creation and validation of the spectra reference database (C) until its use for
arthropod identification (D) are summarized.

validation of species identification by molecular with beads [93] . Arthropod proteins are generally
methods [93] . However, other body parts can be extracted with a buffer containing a mixture of
used. For example, the high diversity of venom formic acid and acetonitrile [100] or formic acid
peptides resulted in application of MALDI-TOF alone [95] . The role of formic acid is to destroy
MS for the classification of scorpions and ants the cell wall, while acetonitrile ensures protein
using their venom drops and venom glands, extraction [34,110] . Water was also successfully
respectively [111,112] . Similarly, the dissection of tested for protein extraction [93] . The crushing
small neuroendocrine tissues, the neurohemal method in water has the advantage of preserving
organs, from Mantophasmatodea specimens was the DNA, allowing cross validation of arthropod
also sufficient for successful identification by identity by molecular methods [90] .
proteomic tools [113] .
Protein is extracted by crushing the specimen The choice of matrix & MALDI-TOF parameters
in organic solvents. The crushing is performed The choice of matrix is a critical factor in
either manually with a pellet pestle [11,90] or MALDI-TOF analysis because the matrix
automatically with an automatic homogenizer influences the homogeneity of cocrystallization

10.2217/fmb.16.5 Future Microbiol. (Epub ahead of print) future science group

 Emerging tools for identification of arthropod vectors Review

with the analytes [101] . The quality of co-crys- Tick species identification
tallization determines the efficiency of molec- Two studies evaluated the MALDI-TOF MS
ular ionization and detection [103] . The main approach to distinguishing tick species using
matrices used for arthropod identification are only fresh specimens [11] . Although both stud-
trans-3,5-dimethyloxy-4-hydroxycinnamic acid ies analyzed MS profiles from adult specimens,
(Sinapinic acid or SA) [95,105] and α-cyano-4- Karger et al. were also interested in the conse-
hydroxycinnamic acid [11,97] (Table 2) . The matrix quences of developmental stages on MS protein
is usually dissolved in a mixture of water and profiles [94] . Despite the MS profile changes dur-
organic solvents, including acetonitrile and a ing tick metamorphosis, the ticks were correctly
strong acid, for example, trifluoroacetic acid [86] . classified, first at the species level and second
Different deposition methods exist for loading according to developmental stage. It was sug-
the sample and matrix onto a target plate [114] . gested that some prominent peaks appeared
However, the most frequently used method con- in all the different stages for each tick species,
sists of an air-dried sample overlaid with matrix resulting in correct classification. Interestingly,
solution [96,97] . A high or low protein concen- proteins extracted from tick legs yielded species-
tration in the sample affects the quality of the specific and reproducible spectra resulting in the
spectrum [102,106] . Thus, determination of the creation of a spectra reference database for iden-
optimal protein concentration to deposit on the tification purposes [11] like the one developed for
target plate is required. mosquito specimens [96] . For sample preparation,
Yssouf et al. used classical protocols (i.e., a mix-
Mosquito species identification ture of formic acid and acetonitrile), whereas the
Since the emergence of MALDI-TOF MS eval- Karger group homogenized the tick body with
uation for arthropod identification, five stud- guanidinium chloride solution. Although this
ies used this innovative approach for mosquito last buffer is compatible with DNA extraction,
identification [95–96,102,106–108] . Three studies salts present in the buffer perturb MS analysis,
focused on evaluation of MALDI-TOF MS for and should be removed.
identification of adult mosquitoes [95–96,107] . Interestingly, the simplicity of the standard-
Adult mosquitoes were stored either in 70% ized protocol and the quality of MS spectra gen-
ethanol for several months [95] , or were fresh, erated by tick legs resulted in the transfer of the
frozen or dried with silica gel [107] . All these pres- tick leg reference MS database to the Marseille
ervation modes led to MS spectra of sufficient hospital diagnosis microbiology laboratory
quality to distinguish the mosquito species and for the identification of ticks removed from
complexes. Interestingly, different body parts patients [11] . This procedure identifies in less
were selected. Whole adult mosquitoes without than 1 h without any entomological expertise,
the abdomen were chosen by Muller et al. [95] , which is helpful for physician diagnosis.
while Yssouf et al. demonstrated that legs were
sufficient to obtain specific and reproducible ●●Database creation & blind tests
MS spectra [96,107] . The use of the legs has Prior to the determination of a specimen’s
multiple advantages, including minimal influ- identity based on MS spectra, the creation
ence of mosquito gender, age or diet on MS of a spectra reference database similar to the
profiles, and preservation of other body parts Genbank database is indispensable (Figure 1) .
for complementary experiments, including the An arthropod MALDI-TOF MS database is cre-
detection of micro-organisms [109] . Recently, ated using dedicated software, for instance, the
the MALDI-TOF MS strategy was applied for MALDI-Biotyper (Bruker Daltonic) or Saramis
Aedes species identification using mosquito (AnagnosTec GmbH). The database is created
eggs [108] . More recently, Dieme et al. reported with several representative spectra per species
that MALDI-TOF MS also identified mosquito selected for their consistency and reproducibil-
species at aquatic stages [109] . Insect metamor- ity. At least two distinct specimens per species
phosis has already been described to induce should be included in the reference database;
MS spectra changes [94] . However, appropri- however, to increase the accuracy of identifica-
ate sample preparations and spectra reference tion, it is better to add several specimens per
database creation result in reliable identifica- species. To obtain a representative database, the
tion of immature specimens by MALDI-TOF inclusion of MS spectra from specimens of both
MS [94,99,106] . genders and from different geographical regions

future science group www.futuremedicine.com 10.2217/fmb.16.5

Review Yssouf, Almeras, Raoult & Parola

for each species is recommended to estimate failure to achieve a significant identification

intraspecies variation. threshold was attributed to the lower quality of
After the creation of the MS reference data- the spectra. Thus, the authors suggested includ-
base, blind tests are then performed to evalu- ing spectra quality control parameters prior to
ate the accuracy of the database for arthropod submitting them to blind tests. Presently, it is
identification. In this process, spectra from new difficult to set a definitive cut off, but, as in bac-
specimens of arthropod species are blindly que- terial identification, it will be necessary to carry
ried, regardless of their inclusion in the refer- out many more investigations before conclusions
ence database (Figure 1) . Analogous to BLAST, a can be reached.
list of species matches is generated with a score
corresponding to the level of mass spectra simi- Tick species identification
larities [86] . The score values obtained with the In the two studies carried out on ticks, blind
MALDI Biotyper 3.0 software range from 0 to tests were performed. Karger et al. emphasized
3, corresponding to arbitrary logarithmic units. that a threshold score of 2.0 resulted in a cor-
Although for bacteria, a threshold score of 1.8 rect species assignment [88] . By contrast, in the
is recommended for reliable genus identification Yssouf et al. study, identification scores varied
and 2.0 for probable species assignment [115] , in from 1.3 to 2.5 [11] . In this last study, ticks for
the case of arthropod identification, the estab- blind tests came from laboratory rearing, field
lishment of a threshold score requires querying collection and specimens removed from patients.
MS reference database with MS spectra of speci- As mentioned above, the heterogeneity in the
mens from arthropod species, regardless of their geographical origin of specimens and inclusion
inclusion in the database [94,96] . Moreover, as in the database of only adult specimens could
intraspecies MS variations could occur accord- explain the heterogeneity of identification scores.
ing to the geographical origin of the specimens, This study emphasizes the limitations of the
the determination of this threshold score is MALDI-TOF MS approach and the importance
particularly difficult and also dependent on of including a large number of specimens that
the richness of species diversity in the spectra are representative of the specimens of interest
reference database. in the reference database, taking into account
For research groups that have no expertise location and developmental stages.
and/or access to the MALDI-TOF MS platform,
private companies have proposed creating a dedi- ●●Advantages & limitations of the
cated database for the identification of specific MALDI-TOF MS approach for arthropod
organisms. For instance, Mabritec AG, which identification
is located in Switzerland, has created an MS The success of MALDI-TOF MS relies on the
reference database for arthropod identification, simplicity of sample preparation method, the brief
including more than 70 species of mosquitoes handling times and rapid data analysis, allowing
and biting midges. identification results to be obtained in a short time
(Figure 2) . Moreover, this method requires inexpen-
Mosquito species identification sive consumables and is economically competitive
Among the studies assessing MALDI-TOF MS with the other approaches described above [44,90] .
for mosquito identification after the database No entomological expertise in genetic informa-
creation, some validated the database by blind tion about the specimen or special training is
tests [94,96,108] . Yssouf et al. blindly tested both required for MALDI-TOF MS analysis [11] . The
laboratory-reared and field mosquito speci- main limitation is the acquisition of the MALDI-
mens [96] . In this study, log score values of cor- TOF MS instrument, which is expensive and rep-
rect identifications and misidentifications were, resents a major investment [96] . Nevertheless, its
respectively, greater than and less than 1.8, routine use in diagnosis has revolutionized micro-
resulting in a cut-off of 1.8 for relevant iden- biology, which has largely contributed to MALDI-
tifications [96] . More recently, the same team TOF MS democratization and accessibility [88] .
utilized a similar strategy for the identification Currently, MALDI-TOF MS equipment is avail-
of European mosquito species [107] . Although no able in numerous hospitals and research centers
misidentification was noted, three of 26 blindly even in developing countries, e.g. Senegal [96] .
tested specimens did not reach the significant For MALDI-TOF MS analysis, the integrity of
identification threshold value set (i.e., 1.8). The the protein sample is essential. Thus, it is crucial

10.2217/fmb.16.5 Future Microbiol. (Epub ahead of print) future science group

 Emerging tools for identification of arthropod vectors Review

Potential factors modifying

Preservation mode

MS spectra
Geographical and storage duration Pathogenic
origin agents

Insect Blood meal

metamorphosis origin

MALDI-TOF

Identification at Trophic

Advantages
immature and DB creation
preferences
adult stages

Reliable Infectious
(correct identification)
Economic status
Rapid
(<1€/sample) (from 15’ to 45’)

Applications

Laboratory Epidemiological studies

entomological diagnostic Reservoirs

Monitoring of vectors Pathogens survey

Figure 2. Limitations, advantages and applications of matrix-assisted laser desorption ionization

time-of-flight-mass spectrometry for arthropod identification. (A) The main factors which could
potentially modify MS spectra are listed (top part of panel). (B) The principal advantages of this
proteomic tool are indicated (middle part of panel). (C) The application of this emerging tool in the case
of arthropod survey is presented in the bottom of the panel (lower part of panel).
DB: Database; MALDI-TOF: Matrix-assisted laser desorption ionization time-of-flight-mass spectrometry.

to establish the appropriate sample preservation could appear more laborious. However, once the
conditions. MS database is created, the MALDI-TOF MS
Additionally, during the arthropod life cycle, approach remains the more rapid and economi-
metamorphosis occurs. Karger et al. demon- cal strategy for accurate arthropod identification.
strated that in hemimetabolous arthropods Interestingly, the majority of studies using
(e.g., ticks) morphologic changes induce quali- MALDI-TOF MS for arthropod identification
tative and quantitative modifications of protein were based on the analysis and comparison of
expression at each stage, which results in varia- intact protein patterns. However, this strategy
tions in the protein spectra [94] . Similar observa- could be sometime insufficient to distinguish
tions were reported by Dieme et al., developing very closely related arthropod species due to its
optimal strategies for identification of mos- relative low resolution and limited sensitivity for
quitoes at aquatic stages using MALDI-TOF larger masses.
MS [109] . Thus, the collection of specimens at In such condition, an alternative strategy is
each developmental stage for each species should conceivable by comparing peptide MS spectra.
be included to improve the accuracy of data- This method, known as peptide mass finger-
bases for arthropod identification. Compared printing or shotgun mass mapping, requires
with molecular biology methods, which are not proteolytic hydrolysis (e.g., trypsin) of the sam-
affected by the arthropod specimen develop- ple prior to MALDI-TOF MS reference data-
mental stage, the MALDI-TOF MS approach base creation or interrogation. The advantages

future science group www.futuremedicine.com 10.2217/fmb.16.5

Review Yssouf, Almeras, Raoult & Parola

of shotgun mass mapping are the increase in in the near future a reference method for ento-
resolution in the lower mass range (i.e., from mological laboratories possessing an MALDI-
500 to 4000 Da) and the method of obtain- TOF MS instrument. Although the creation of
ing peptide sequence information by analyzing a reference database might be limited, it could
the more stringent peptides with tandem mass subsequently be shared by granting open access
spectrometry. Until now, shotgun mass mapping for routine arthropod identification either for
has been applied one time for arthropod spe- entomological diagnosis or arthropod moni-
cies recognition using Culicoides biting midge toring. More recently, MALDI-TOF MS was
specimens [116] . assessed for the detection of pathogens associ-
ated with tick vectors [117,118] . Therefore, these
Conclusion & future perspective pioneering studies make dual identification
Morphological identification remains a classi- possible and offer new opportunities for medi-
cal taxonomic tool, and the molecular biology cal diagnosis and survey of pathogen circula-
approach is the most widely used alternative tion by focusing vector surveillance. Finally, it
method used to identify arthropods. However, seems likely that MALDI-TOF MS will revo-
MALDI-TOF MS represents an interesting lutionize medical entomology as it has revolu-
approach to arthropod identification and has tionized microbiology diagnostics.
numerous advantages, including simplicity of
specimen sample preparation, a minimum pro- Financial & competing interests disclosure
cessing time and very low consumable costs. This work has been carried out thanks to the support of the
These benefits of rapid arthropod identification A*MIDEX project (n° ANR-11-IDEX-0001-02) funded
without entomological skills will likely become by the Investissements d’Avenir French Government

Executive summary
Arthropod identification by morphological methods
●● Although morphological method remains a reference tool for arthropod identification, several factors such as
entomological skill/knowledge or the availability of identification keys limit its use.
●● Morphometric method based on the analysis of the size and shape of biological structures is mainly applied to study
phenotypical evolution and systematics of insect and could distinguish cryptic species which could not be revealed by
traditional morphological approaches.
●● Wing interference patterns are an emerging method based on analysis of the wing color pattern produced and
subsequent restriction to flying arthropods at the postpupal stage.
Arthropod identification by molecular methods
●● Molecular methods for arthropod identification are widely used, notably through progress in arthropod genome
sequencing. It is compatible with several sample preservation modes; conservation time and all arthropod
compartments can be selected.
●● No consensus sequence exists for the identification of all arthropod species and multiple gene sequences are required
for unambiguous arthropod identification.
Arthropod identification by MALDI-TOF MS
●● The MALDI-TOF MS tool is simple, cost effective, rapid for data collection and reliable for arthropod identification.
Unique protein ‘fingerprint signatures’ are generated for accurate species identification against a spectra reference
database.
●● However, sample storage modes influence MS spectra quality, favoring frozen preservation methods for submission to
MALDI-TOF MS. As the MS protein pattern changes according to body parts, one arthropod compartment should be
selected for database creation and further MS queries.
Conclusion
●● MALDI-TOF MS is a competitive method for rapid, reliable and inexpensive arthropod identification and does not
require entomological knowledge.
●● It is likely that MALDI-TOF MS will become soon a reference method for arthropod identification.

10.2217/fmb.16.5 Future Microbiol. (Epub ahead of print) future science group

 Emerging tools for identification of arthropod vectors Review

program, managed by the French National Research Agency matter or materials discussed in the manuscript apart from
(ANR). The authors have no other relevant affiliations or those disclosed.
financial involvement with any organization or entity with No writing assistance was utilized in the production of
a financial interest in or financial conflict with the subject this manuscript.

References 14 Salman MD, Tarrés-Call J, Estrada-Peña molecular approach. J. Parasitol. 83(2),

A. Ticks and Tick-borne Diseases: Geographical 302–306 (1997).
1 Giribet G, Ribera C. A review of arthropod
Distribution and Control Strategies in the 24 Cuisance D, Antoine RJ. Current status of
phylogeny: new data based on ribosomal
Euro-Asia Region. CAB medical and veterinary entomology in France:
DNA sequences and direct character
International, Wallingford, UK (2013). endangered discipline or promising science?
optimization. Cladistics 16, 204–231
(2000). 15 Hervy J, Le Goff G, Geoffroy B, Hervé J, Comp. Immunol. Microbiol. Infect. Dis. 27(5),
Manga L. Les Anophèles de la Région 377–392 (2004).
2 Mathison BA, Pritt BS. Laboratory
Afro-tropicale, Lociciel d’identification et 25 Dujardin JP, Slice DE. Contributions of
identification of arthropod ectoparasites.
d’enseignement, Collection Didactique. morphometrics to medical
Clin. Microbiol. Rev. 27(1), 48–67 (2014).
Orstom, Paris, France (1998). entomology. In: Encyclopaedia of Infectious
3 Hopla CE, Durden LA, Keirans JE.
16 Beebe NW, Cooper RD. Systematics of Diseases. Tibayrenc M (Ed.). John Wiley &
Ectoparasites and classification. Rev. Sci. Tech.
malaria vectors with particular reference to the Sons, Inc., NJ, USA, 433–445 (2007).
13(4), 985–1017 (1994).
Anopheles punctulatus group. Int. J. Parasitol. 26 Dujardin JP, Le PF, Baylac M. Geographical
4 Zeller H, Marrama L, Sudre B, Van BW, 30(1), 1–17 (2000). versus interspecific differentiation of sand flies
Warns-Petit E. Mosquito-borne disease 17 Kent RJ, Deus S, Williams M, Savage HM. (Diptera: Psychodidae): a landmark data
surveillance by the European Centre for Development of a multiplexed polymerase analysis. Bull. Entomol. Res. 93(1), 87–90
Disease Prevention and Control. Clin. chain reaction-restriction fragment length (2003).
Microbiol. Infect. 19(8), 693–698 (2013). polymorphism (PCR-RFLP) assay to identify 27 Gaspe MS, Schachter-Broide J, Gurevitz J,
5 McGraw EA, O’Neill SL. Beyond common members of the Subgenera Culex Kitron U, Gurtler RE, Dujardin JP.
insecticides: new thinking on an ancient (Culex) and Culex (Phenacomyia) in Microgeographic spatial structuring of
problem. Nat. Rev. Microbiol. 11(3), 181–193 Guatemala. Am. J. Trop. Med. Hyg. 83(2), Triatoma infestans (Hemiptera: Reduviidae)
(2013). 285–291 (2010). populations using wing geometric
6 Parola P, Raoult D. Ticks and tickborne 18 Zapata MA, Cienfuegos AV, Quiros OI, morphometry in the Argentine Chaco.
bacterial diseases in humans: an emerging Quinones ML, Luckhart S, Correa MM. J. Med. Entomol. 49(3), 504–514 (2012).
infectious threat. Clin. Infect. Dis. 32(6), Discrimination of seven Anopheles species from 28 De la Riva J, Le PF, Ali V, Matias A,
897–928 (2001). San Pedro de Uraba, Antioquia, Colombia, by Mollinedo S, Dujardin JP. Wing geometry as
polymerase chain reaction-restriction fragment a tool for studying the Lutzomyia longipalpis
7 Roehrig JT. West nile virus in the United
length polymorphism analysis of its sequences. (Diptera: Psychodidae) complex. Mem. Inst.
States – a historical perspective. Viruses 5(12),
Am. J. Trop. Med. Hyg. 77(1), 67–72 (2007). Oswaldo Cruz 96(8), 1089–1094 (2001).
3088–3108 (2013).
19 Mukhopadhyay J, Ghosh K, Braig HR. 29 Dujardin JP, Bermudez H, Schofield CJ. The
8 Simon F, Savini H, Parola P. Chikungunya: a
Identification of cutaneous Leishmaniasis use of morphometrics in entomological
paradigm of emergence and globalization of
vectors, Phlebotomus papatasi and P. duboscqi surveillance of sylvatic foci of Triatoma
vector-borne diseases. Med. Clin. North Am.
using random amplified polymorphic DNA. infestans in Bolivia. Acta Trop. 66(3), 145–153
92(6), 1323–1343, ix (2008).
Acta Trop. 76(3), 277–283 (2000). (1997).
9 Leparc-Goffart I, Nougairede A, Cassadou S, 20 Anderson JM, Ammerman NC, Norris DE.
Prat C, de Lamballerie X. Chikungunya in 30 Kanojia PC, Paingankar MS, Patil AA,
Molecular differentiation of metastriate tick Gokhale MD, Deobagkar DN.
the Americas. Lancet 383(9916), 514– (2014). immatures. Vector. Borne Zoonotic Dis. 4(4), Morphometric and allozyme variation in
10 Leder K, Torresi J, Libman MD et al. 334–342 (2004). Culex tritaeniorhynchus mosquito populations
GeoSentinel surveillance of illness in returned 21 Futami K, Dida GO, Sonye GO et al. Impacts from India. J. Insect Sci. 10, 138 (2010).
travelers, 2007–2011. Ann. Intern. Med of insecticide treated bed nets on Anopheles 31 Lorenz C, Marques TC, Sallum MA, Suesdek
158(6), 456–468 (2013). gambiae s.l. populations in Mbita district and L. Morphometrical diagnosis of the malaria
11 Yssouf A, Flaudrops C, Drali R et al. Suba district, Western Kenya. Parasit. Vectors vectors Anopheles cruzii, An. homunculus and
Matrix-assisted laser desorption ionization- 7, 63 (2014). An. bellator. Parasit. Vectors 5, 257– (2012).
time of flight mass spectrometry for rapid 22 Marrelli MT, Souza LF, Marques RC et al. 32 Jirakanjanakit N, Dujardin JP.
identification of tick vectors. J. Clin. Taxonomic and phylogenetic relationships Discrimination of Aedes aegypti (Diptera:
Microbiol. 51(2), 522–528 (2013). between neotropical species of ticks from Culicidae) laboratory lines based on wing
12 Walker AR, Bouattour A. Ticks Of Domestic genus Amblyomma (Acari: Ixodidae) inferred geometry. Southeast Asian J. Trop. Med. Public
Animals In Africa: A Guide To Identification from second internal transcribed spacer Health 36(4), 858–861 (2005).
Of Species. Bioscience Reports, Edinburgh, sequences of rDNA. J. Med. Entomol. 44(2),
33 Vidal P, Rocha L, Peruzin M. Wing
UK (2003). 222–228 (2007).
diagnostic characters for mosquitoes Culex
13 Becker N, Petric D, Zgomba M et al. 23 Zahler M, Filippova NA, Morel PC, Gothe R, quinquefasciatus and Culex nigripalpus
Mosquitoes and Their Control. Springer, Rinder H. Relationships between species of (Diptera; Culicidae). Rev. Bras. Entomol. 55,
Berlin, Heidelberg, Germany (2014). the Rhipicephalus sanguineus group: a 134–137 (2011).

future science group www.futuremedicine.com 10.2217/fmb.16.5

Review Yssouf, Almeras, Raoult & Parola

34 Simon E. Preliminary study of wing 46 Cohuet A, Simard F, Toto JC, Kengne P, Mem. Inst. Oswaldo Cruz 108(Suppl. 1),
interference patterns (WIPs) in some species Coetzee M, Fontenille D. Species 110–122 (2013).
of soft scale (Hemiptera, Sternorrhyncha, identification within the Anopheles funestus 57 Shouche YS, Patole MS. Sequence analysis of
Coccoidea, Coccidae). Zookeys 319, 269–281 group of malaria vectors in Cameroon and mitochondrial 16S ribosomal RNA gene
(2013). evidence for a new species. Am. J. Trop. Med. fragment from seven mosquito species.
35 Parchem RJ, Perry MW, Patel NH. Patterns Hyg. 69(2), 200–205 (2003). J. Biosci. 25(4), 361–366 (2000).
on the insect wing. Curr. Opin. Genet. Dev. 47 Walton C, Somboon P, O’Loughlin SM et al. 58 Chitimia L, Lin RQ, Cosoroaba I, Braila P,
17(4), 300–308 (2007). Genetic diversity and molecular identification Song HQ, Zhu XQ. Molecular
36 Shevtsova E, Hansson C, Janzen DH, of mosquito species in the Anopheles maculatus characterization of hard and soft ticks from
Kjaerandsen J. Stable structural color patterns group using the ITS2 region of rDNA. Infect. Romania by sequences of the internal
displayed on transparent insect wings. Proc. Genet. Evol. 7(1), 93–102 (2007). transcribed spacers of ribosomal DNA.
Natl Acad. Sci. USA 108(2), 668–673 (2011). 48 Higa Y, Toma T, Tsuda Y, Miyagi I. A Parasitol. Res. 105(4), 907–911 (2009).
multiplex PCR-based molecular identification 59 Lu X, Lin XD, Wang JB et al. Molecular
37 Shevtsova E, Hansson C. Species recognition
of five morphologically related, medically survey of hard ticks in endemic areas of
through wing interference patterns (WIPs) in
important subgenus Stegomyia mosquitoes tick-borne diseases in China. Ticks. Tick
Achrysocharoides Girault (Hymenoptera,
from the genus Aedes (Diptera: Culicidae) Borne Dis. 4(4), 288–296 (2013).
Eulophidae) including two new species.
found in the Ryukyu Archipelago, Japan. Jpn.
Zookeys 154, 9–30 (2011). 60 El Kammah KM, El-Fiky ZA. Molecular
J. Infect. Dis. 63(5), 312–316 (2010).
38 Yoshioka S, Kinoshita S. Polarization-sensitive markers of some tick genera in Egypt based
49 Kengne P, Awono-Ambene HP, Antonio- on the internal transcribed spacer (ITS–2):
color mixing in the wing of the Madagascan
Nkondjio C, Fontenille D. [Development of a 1- Ixodidae (Boophilus and Hyalomma).
sunset moth. Opt. Express 15(5), 2691–2701
PCR (polymerase chain reaction) specific for Arab. J. Biotech 8(1), 61–66 (2005).
(2007).
complex Anopheles nili (Theobald) 1904
39 Van Rensburg AJ, Hunt RH, Koekemoer LL, 61 Jizhou LV, Wu S, Zhang Y et al. Assessment
species in Cameroon]. Bull. Soc. Pathol. Exot.
Coetzee M, Shiff CJ, Minjas J. The of four DNA fragments (COI, 16S rDNA,
96(3), 165–167 (2003).
polymerase chain reaction method as a tool ITS2, 12S rDNA) for species identification of
50 Bass C, Williamson MS, Wilding CS, the Ixodida (Acari: Ixodida). Parasit. Vectors
for identifying members of the Anopheles
Donnelly MJ, Field LM. Identification of the 7, 93 (2014).
gambiae complex (Diptera: Culicidae) in
main malaria vectors in the Anopheles gambiae
northeastern Tanzania. J. Am. Mosq. Control 62 Zahler M, Gothe R, Rinder H. Diagnostic
species complex using a TaqMan real-time
Assoc. 12(2 Pt 1), 271–274 (1996). DNA amplification from individual tick eggs,
PCR assay. Malar. J. 6, 155 (2007).
40 Norris DE. Genetic markers for study of the larvae and nymphs. Exp. Appl. Acarol. 19(12),
51 Fanello C, Santolamazza F, della TA. 731–736 (1995).
anopheline vectors of human malaria. Int. J.
Simultaneous identification of species and
Parasitol. 32(13), 1607–1615 (2002). 63 Mangold AJ, Bargues MD, Mas-Coma S. 18S
molecular forms of the Anopheles gambiae
41 Collins FH, Paskewitz SM. A review of the rRNA gene sequences and phylogenetic
complex by PCR-RFLP. Med. Vet. Entomol.
use of ribosomal DNA (rDNA) to relationships of European hard-tick species
16(4), 461–464 (2002).
differentiate among cryptic Anopheles species. (Acari: Ixodidae). Parasitol. Res. 84(1), 31–37
52 Kengne P, Awono-Ambene P, Antonio- (1998).
Insect Mol. Biol. 5(1), 1–9 (1996).
Nkondjio C, Simard F, Fontenille D.
42 Scott JA, Brogdon WG, Collins FH. 64 Lv J, Wu S, Zhang Y et al. Assessment of four
Molecular identification of the Anopheles nili
Identification of single specimens of the DNA fragments (COI, 16S rDNA, ITS2, 12S
group of African malaria vectors. Med. Vet.
Anopheles gambiae complex by the polymerase rDNA) for species identification of the Ixodida
Entomol. 17(1), 67–74 (2003).
chain reaction. Am. J. Trop. Med. Hyg. 49(4), (Acari: Ixodida). Parasit. Vectors 7, 93 (2014).
53 Cook S, Diallo M, Sall AA, Cooper A,
520–529 (1993). 65 Beati L, Keirans JE. Analysis of the systematic
Holmes EC. Mitochondrial markers for
relationships among ticks of the genera
43 Fang Q, Keirans JE, Mixson T. The use of the molecular identification of Aedes mosquitoes
Rhipicephalus and Boophilus (Acari: Ixodidae)
nuclear protein-encoding gene, RNA (Diptera: Culicidae) involved in transmission
based on mitochondrial 12S ribosomal DNA
polymerase II, for tick molecular systematics. of arboviral disease in West Africa. J. Med.
gene sequences and morphological characters.
Exp. Appl. Acarol. 28(1–4), 69–75 (2002). Entomol. 42(1), 19–28 (2005).
J. Parasitol. 87(1), 32–48 (2001).
44 Feltens R, Gorner R, Kalkhof S, Groger- 54 Kumar NP, Rajavel AR, Natarajan R,
66 Chitimia L, Lin RQ, Cosoroaba I et al.
Arndt H, von BM. Discrimination of Jambulingam P. DNA barcodes can
Genetic characterization of ticks from
different species from the genus Drosophila by distinguish species of Indian mosquitoes
southwestern Romania by sequences of
intact protein profiling using matrix-assisted (Diptera: Culicidae). J. Med. Entomol. 44(1),
mitochondrial cox1 and nad5 genes. Exp.
laser desorption ionization mass spectrometry. 1–7 (2007).
Appl. Acarol. 52(3), 305–311 (2010).
BMC. Evol. Biol. 10, 95 (2010). 55 Wang G, Li C, Guo X et al. Identifying the
67 Notomi T, Okayama H, Masubuchi H et al.
45 Kengne P, Antonio-Nkondjio C, Awono- main mosquito species in China based on
Loop-mediated isothermal amplification of
Ambene HP, Simard F, Awolola TS, DNA barcoding. PLoS ONE 7(10), e47051
DNA. Nucleic Acids Res. 28(12), E63 (2000).
Fontenille D. Molecular differentiation of (2012).
three closely related members of the mosquito 68 Bonizzoni M, Afrane Y, Yan G. Loop-
56 Laurito M, Oliveira TM, Almiron WR,
species complex, Anopheles moucheti, by mediated isothermal amplification (LAMP)
Sallum MA. COI barcode versus
mitochondrial and ribosomal DNA for rapid identification of Anopheles gambiae
morphological identification of Culex (Culex)
polymorphism. Med. Vet. Entomol. 21(2), and Anopheles arabiensis mosquitoes. Am. J.
(Diptera: Culicidae) species: a case study
177–182 (2007). Trop. Med. Hyg. 81(6), 1030–1034 (2009).
using samples from Argentina and Brazil.

10.2217/fmb.16.5 Future Microbiol. (Epub ahead of print) future science group

 Emerging tools for identification of arthropod vectors Review

69 Yang J, Guan G, Niu Q et al. Development mitochondrial genes. J. Vector. Ecol. 40(1), ionization time of flight mass spectrometry
and application of a loop-mediated isothermal 16–27 (2015). protein profiling. Syst. Entemol. 30, 186–190
amplification assay for rapid detection of 80 Alam MT, Das MK, Dev V, Ansari MA, (2005).
Borrelia burgdorferi s. l. in ticks. Transbound. Sharma YD. Identification of two cryptic 91 Perera M, Vargas RDF, Jones MGK.
Emerg. Dis. 60(3), 238–244 (2013). species in the Anopheles (Cellia) annularis Identification of aphid species using protein
70 Aonuma H, Suzuki M, Iseki H et al. Rapid complex using ribosomal DNA PCR-RFLP. profiling and matrix-assisted laser desorption/
identification of plasmodium-carrying Parasitol. Res. 100(5), 943–948 (2007). ionisation time-of-flight mass spectrometry.
mosquitoes using loop-mediated isothermal 81 Dobson SJ, Barker SC. Phylogeny of the hard Entomologia Experimentalis et Applicata 117,
amplification. Biochem. Biophys. Res. ticks (Ixodidae) inferred from 18S rRNA 243–247 (2005).
Commun. 376(4), 671–676 (2008). indicates that the genus Aponomma is 92 Kaufmann C, Schaffner F, Ziegler D, Pfluger
71 Nzelu CO, Gomez EA, Caceres AG et al. paraphyletic. Mol. Phylogenet. Evol. 11(2), V, Mathis A. Identification of field-caught
Development of a loop-mediated isothermal 288–295 (1999). Culicoides biting midges using matrix-
amplification method for rapid mass- 82 Chan A, Chiang LP, Hapuarachchi HC et al. assisted laser desorption/ionization time of
screening of sand flies for Leishmania DNA barcoding: complementing flight mass spectrometry. Parasitology 139(2),
infection. Acta Trop. 132, 1–6 (2014). morphological identification of mosquito 248–258 (2012).
72 Wesson DM, McLain DK, Oliver JH, species in Singapore. Parasit. Vectors 7, 569 93 Kaufmann C, Ziegler D, Schaffner F,
Piesman J, Collins FH. Investigation of the (2014). Carpenter S, Pfluger V, Mathis A. Evaluation
validity of species status of Ixodes dammini 83 Pradeep KN, Krishnamoorthy N, Sahu SS, of matrix-assisted laser desorption/ionization
(Acari: Ixodidae) using rDNA. Proc. Natl Rajavel AR, Sabesan S, Jambulingam P. DNA time of flight mass spectrometry for
Acad. Sci. USA 90(21), 10221–10225 (1993). Barcodes indicate members of the Anopheles characterization of Culicoides nubeculosus
73 Cienfuegos AV, Rosero DA, Naranjo N, fluviatilis (Diptera: Culicidae) species biting midges. Med. Vet. Entomol. 25(1),
Luckhart S, Conn JE, Correa MM. complex to be conspecific in India. Mol. Ecol. 32–38 (2011).
Evaluation of a PCR-RFLP-ITS2 assay for Resour. 13(3), 354–361 (2013). 94 Karger A, Kampen H, Bettin B et al. Species
discrimination of Anopheles species in 84 Tahir HM, Kanwal N, Mehwish, . The determination and characterization of
northern and western Colombia. Acta Trop. sequence divergence in cytochrome C oxidase developmental stages of ticks by whole-animal
118(2), 128–135 (2011). I gene of Culex quinquefasciatus mosquito and matrix-assisted laser desorption/ionization
74 Cornel AJ, Porter CH, Collins FH. its comparison with four other Culex species. mass spectrometry. Ticks. Tick. Borne. Dis.
Polymerase chain reaction species diagnostic Mitochondrial. DNA 10, 1–4 (2015). 3(2), 78–89 (2012).
assay for Anopheles quadrimaculatus cryptic 85 Croxatto A, Prod’hom G, Greub G. 95 Müller P, Pflüger V, Wittwer M et al.
species (Diptera: Culicidae) based on Applications of MALDI-TOF mass Identification of cryptic Anopheles mosquito
ribosomal DNA ITS2 sequences. J. Med. spectrometry in clinical diagnostic species by molecular protein profiling. PLoS
Entomol. 33(1), 109–116 (1996). microbiology. FEMS Microbiol. Rev. 36(2), ONE 8(2), e57486 (2013).
75 Proft J, Maier WA, Kampen H. Identification 380–407 (2012). 96 Yssouf A, Socolovschi C, Flaudrops C et al.
of six sibling species of the Anopheles 86 Welker M, Moore ER. Applications of Matrix-assisted laser desorption ionization-
maculipennis complex (Diptera: Culicidae) by whole-cell matrix-assisted laser-desorption/ time of flight mass spectrometry: an emerging
a polymerase chain reaction assay. Parasitol. ionization time-of-flight mass spectrometry in tool for the rapid identification of mosquito
Res. 85(10), 837–843 (1999). systematic microbiology. Syst. Appl. Microbiol. vectors. PLoS ONE 8(8), e72380 (2013).
76 Matson R, Rios CT, Chavez CB et al. 34(1), 2–11 (2011). 97 Hoppenheit A, Murugaiyan J, Bauer B,
Improved molecular technique for the 87 Bizzini A, Durussel C, Bille J, Greub G, Steuber S, Clausen PH, Roesler U.
differentiation of neotropical anopheline Prod’hom G. Performance of matrix-assisted Identification of Tsetse (Glossina spp.) using
species. Am. J. Trop. Med. Hyg. 78(3), laser desorption ionization-time of flight mass matrix-assisted laser desorption/ionisation
492–498 (2008). spectrometry for identification of bacterial time of flight mass spectrometry. PLoS. Negl.
77 Toma T, Miyagi I, Crabtree MB, Miller BR. strains routinely isolated in a clinical Trop. Dis. 7(7), e2305 (2013).
Identification of Culex vishnui subgroup microbiology laboratory. J. Clin. Microbiol. 98 Hoppenheit A, Murugaiyan J, Bauer B,
(Diptera: Culicidae) mosquitoes from the 48(5), 1549–1554 (2010). Clausen PH, Roesler U. Analysis of Glossina
Ryukyu Archipelago, Japan: development of a 88 Seng P, Rolain JM, Fournier PE, La Scola B, palpalis gambiensis and Glossina tachinoides
species-diagnostic polymerase chain reaction Drancourt M, Raoult D. MALDI-TOF-mass from two distant locations in Burkina Faso
assay based on sequence variation in spectrometry applications in clinical using MALDI TOF MS. Parasitol. Res.
ribosomal DNA spacers. J. Med. Entomol. microbiology. Future. Microbiol. 5(11), 113(2), 723–726 (2014).
37(4), 554–558 (2000). 1733–1754 (2010). 99 Dvorak V, Halada P, Hlavackova K,
78 Tian Z, Liu G, Xie J et al. Discrimination 89 Predel R, Roth S, Neupert S, Picker M. New Dokianakis E, Antoniou M, Volf P.
between Haemaphysalis longicornis and H. insect order Mantophasmatodea: species Identification of phlebotomine sand flies
qinghaiensis based on the partial 16S rDNA differentiation by mass fingerprints of peptide (Diptera: Psychodidae) by matrix-assisted
and the second internal transcribed spacer hormones? J. Zoo. Syst. Evol. Res. 43(2), laser desorption/ionization time of flight mass
(ITS–2). Exp. Appl. Acarol. 54(2), 165–172 149–156 (2005). spectrometry. Parasit. Vectors 7(1), 21 (2014).
(2011). 100 Yssouf A, Socolovschi C, Leulmi H et al.
90 Campbell PM. Species differentiation of
79 Norris LC, Norris DE. Phylogeny of insects and other multicellular organisms Identification of flea species using MALDI-
anopheline (Diptera: Culicidae) species in using matrix-assisted laser desorption/ TOF/MS. Comp. Immunol. Microbiol. Infect.
southern Africa, based on nuclear and Dis. 37(3), 153–157 (2014).

future science group www.futuremedicine.com 10.2217/fmb.16.5

Review Yssouf, Almeras, Raoult & Parola

101 Pan C, Xu S, Zhou H, Fu Y, Ye M, Zou H. of ceratopogonid and culicid larvae. chemotaxonomy. J. Proteomics. 105, 217–231
Recent developments in methods and Parasitology 140(3), 318–327 (2013). (2014).
technology for analysis of biological samples 107 Yssouf A, Parola P, Lindstrom A et al. 113 Predel R, Neupert S, Huetteroth W, Kahnt J,
by MALDI-TOF-MS. Anal. Bioanal. Chem. Identification of European mosquito species Waidelich D, Roth S. Peptidomics-based
387(1), 193–204 (2007). by MALDI-TOF MS. Parasitol. Res. 113(6), phylogeny and biogeography of
102 Carbonnelle E, Mesquita C, Bille E et al. 2375–2378 (2014). Mantophasmatodea (Hexapoda). Syst. Biol.
MALDI-TOF mass spectrometry tools for 108 Schaffner F, Kaufmann C, Pfluger V, Mathis 61(4), 609–629 (2012).
bacterial identification in clinical A. Rapid protein profiling facilitates 114 Sedo O, Sedlacek I, Zdrahal Z. Sample
microbiology laboratory. Clin. Biochem. surveillance of invasive mosquito species. preparation methods for MALDI-MS
44(1), 104–109 (2011). Parasit. Vectors 7, 142 (2014). profiling of bacteria. Mass Spectrom. Rev.
103 Marvin LF, Roberts MA, Fay LB. Matrix- 109 Dieme C, Yssouf A, Vega-Rua A et al. 30(3), 417–434 (2011).
assisted laser desorption/ionization Accurate identification of Culicidae at 115 Fournier PE, Couderc C, Buffet S, Flaudrops
time-of-flight mass spectrometry in clinical aquatic developmental stages by MALDI- C, Raoult D. Rapid and cost-effective
chemistry. Clin. Chim. Acta 337(1–2), 11–21 TOF MS profiling. Parasit. Vectors 7, 544 identification of Bartonella species using mass
(2003). (2014). spectrometry. J. Med. Microbiol. 58(Pt 9),
104 Martiny O, Vandenberg O. Exploitation de la 110 Sauer S, Freiwald A, Maier T et al. 1154–1159 (2009).
spectrométrie de masse en microbiologie: une Classification and identification of bacteria 116 Uhlmann KR, Gibb S, Kalkhof S et al.
révolution. Immuno-anlyse et Biologie by mass spectrometry and computational Species determination of Culicoides biting
Specialisée 27, 177–184 (2012). analysis. PLoS One 3(7), e2843 (2008). midges via peptide profiling using matrix-
105 Kaufmann C, Steinmann IC, Hegglin D, 111 Dyason K, Brandt W, Prendini L et al. assisted laser desorption ionization mass
Schaffner F, Mathis A. Spatio-temporal Determination of species-specific spectrometry. Parasit. Vectors 7, 392 (2014).
occurrence of Culicoides biting midges in the components in the venom of Parabuthus 117 Fotso Fotso A, Mediannikov O, Diatta G et
climatic regions of Switzerland, along with scorpions from southern Africa using al. MALDI-TOF mass spectrometry detection
large scale species identification by MALDI- matrix-assisted laser desorption time-of- of pathogens in vectors: the Borrelia
TOF mass spectrometry. Parasit. Vectors 5, flight mass spectrometry. Rapid Commun. crocidurae/Ornithodoros sonrai paradigm.
246 (2012). Mass Spectrom. 16(8), 768–773 (2002). PLoS Negl. Trop. Dis. 8(7), e2984 (2014).
106 Steinmann IC, Pfluger V, Schaffner F, Mathis 112 Touchard A, Dauvois M, Arguel MJ et al. 118 Yssouf A, Almeras L, Terras J, Socolovschi C,
A, Kaufmann C. Evaluation of matrix- Elucidation of the unexplored biodiversity of Raoult D, Parola P. Detection of Rickettsia
assisted laser desorption/ionization time of ant venom peptidomes via MALDI-TOF spp in ticks by MALDI-TOF MS. PLoS Negl.
flight mass spectrometry for the identification mass spectrometry and its application for Trop. Dis. 9(2), e0003473 (2015).

10.2217/fmb.16.5 Future Microbiol. (Epub ahead of print) future science group