1. Describe 7 properties of living things and explain why are they important ?

 Highly organized, so that multiple different processes can be done next to

each other independently and work together to the survive. Structurally
specialized.
 Homeostasis, having a constant internal environment so that it can specify
the reaction area and conditions. For example pH, if the pH isn’t right some
enzyme won’t be able to keep their shape and be able to function. Or another
example is osmolarity. Nutrients/chemicals/ions.
 Reproduction, so that its species can live on. DNA/RNA. If it’s at the end it
might not be able to reproduce. Both on animal and cell level.
 Grow and develop from a simple being, so that it can learn and become
independent for surviving.
 Take in energy and transform it, so that it can use the energy to keep its own
processes going that are needed to life. Using mitochondria, ATP is produced,
metabolism.
 Respond to stimuli, to ensure it can survive when in life threatening
situations. Movement, following light ( plants), sensing external cues,
hormones.
 Adaption to the environment, also to make sure it can survive, which can be
done by for example better camouflage. Evolution (long time, using natural
selection).

2. What are the main features of a eukaryotic cells and their function is ?
 Plasma membrane: separates in from out, makes for homeostasis.
Holds everything together, contains proteins that controls what goes in
and out. If damaged lysis(internal leaves the cell).
 Nucleus: stores, packs, protects, and manages DNA. facilitates cell
division. Organize, transcribe, compact and celldivision of DNA.
 Endoplasmic reticulum: takes RNA and creates proteins and lipids.
Contains ribosomes (ribosomes themselves aren’t a organelle)
 Golgi-apparatus: modify proteins, stores and ship them.
 Endosomes and lysosomes: endosomes transport extracellular
material into the cell and lysosomes degrade the materials.
 Peroxisomes: digests substances that need oxidation. Degrade things
like large chains fatty acids, contains H2O2.
 Mitochondria: make energy to power the cell. Causing homeostasis,
apoptosis( programmed cell death).

3. How does water cross plasma membranes ?

Diffusion through aqua porines, which are proteins in the membranes specifically to
transport water in and out the cells.

4. What is the evidence that mitochondria arose from free living bacteria, discuss ?
The mitochondria has its own special ribosomes/DNA, that means that it originated
from an own self-sufficiency organism, an bacteria. Its own DNA is circular like a
prokaryote, this is different to the DNA of humans that is linear. It has 37 genome,
so it has transferred most of it’s DNA to the nuclear DNA, it contains 37 genes for
 the most important things. Minimum for living is 500-900 genes so it could not live
on its own. It has a double membrane. Has a cardiolinid.

5. What is peculiar about red blood cells ? Are they alive ?

Red blood cells don’t have a nucleus, they also don’t contain a lot of other
organelles. Because they don’t do other characteristics associated with live such as:
metabolization and reproduction they aren’t considered alive. So that its shape is
better surface area and has hemoglobin to connect oxygen and carbon dioxide.
They’re part of a large thing that lives, however if they themselves are alive can be
debated.
Virus themselves aren’t alive, however if they have a cell as their host, they’re
alive.

2.1) Describe how phospholipids are build up. Describe also their chemical features that are
necessary to explain their role in biological membranes. What does amphipathic molecule
mean.

If no membranes, no energy storage, no homeostasis, no signalling, no in from out, etc.

Phospholipids are amphipathic molecules: they contain a clear hydrophilic/polar side and
a clear hydrophobic/nonpolar side. They’re build up from a glycerol with 2 fatty acids
attached through esterification on one side and a phosphate (which can have multiple
things attached to it) on the other. The fatty acids are hydrophobic, making two “tails”,
and the phosphate is hydrophilic and is the “head”. This makes it possible to make the
membranes by pointing the tails towards each other and have the heads stick out to the
outside, so that the hydrophilic heads are next to water, and the hydrophobic tails are
next to each other.

2.2) What kind of super structures do fatty acids build up in comparison to phospholipids?
Explain.

Fatty acids build up micelles, a one-layer ball of fatty acids with their points pointing
towards the center and the heads outwards. For phospholipids they create liposomes,
which are 2 layers with the heads to the outside and inside and the tails pointed towards
each other.

2.3) Draw the chemical structure of a phospholipid consisting of a fatty acid, glycerol and
serine.
If under physological conditions means that you have to show the charges.

2.5) Explain the differences of active and passive transport.

Passive transport goes with the electrochemical gradient and is spontaneous +

energetically downhill. Active transport cost energy, in form of ATP or light for example,
and goes against the electrochemical gradient(or membrane potential, if it’s cost more
energy than the electrochemical gradient produces).

2.6) In the scheme the transportation velocity (speed) of glucose is plotted against its
concentration. So for simple diffusion (blue) that is a linear behavior.
-> What does this mean?

This means that if the external concentration of glucose doubles, so does the initial rate of
glucose uptake. Simple diffusion, no limiting factor, if one goes up, the other also goes up.
Make sure to explain the axises, which one is the variable. Higher glucose concentration
means higher uptake

For two passive glucose transporters GLUT1 and GLUT2 the curve looks different.
-> Please explain one of the curves, including the indicated characteristic values (vmax and Km),
what can we learn from them?
With GLUT1 we can see that the higher the concentration of glucose gets, the less the
initial rate of concentration increases, this makes sense, due to the more glucose being
present, the less optional glucose transporters free at any given time. The V max tells us the
maximum amount of rate of glucose intake the transporters can theoretically sustain. K m is
the external concentration of glucose at which 1/2V max (half of the max rate of glucose
uptake) is reached, this tells us the affinity of the GLUT1 for the glucose, the lower the K m
the higher the affinity of the protein.

Always explain what you see in the graph, this can give you an extra point. Say that there is
an limiting factor.

2.7) Explain how the glucose-Na+-carrier (see scheme below) works.

To which class of carrier does it belong?
Hint: we want the glucose on the cytosolic side. What is the challenge and how is it
overcome by this system. What downside does it have

Always start writing first way you’re seeing, you see glucose and Na +, Na+ with the
gradient, glucose against. In what state they’re open to. By the sodium the glucose has a
high affinity. By diffusing out the sodium, the glucose pocket is changed, less affinity and it
goes out. Sodium makes for cooperative binding of glucose. The downside is that you lose
the electrochemical Na+ gradient. It’s an symport, it takes the energy from the downhill
movement of the Na+ , which is supported electromechanically and with the membrane
potential, into the opposite direction to fund the energy of the uphill direction of the
glucose.

2.8) Explain how a K+-channel discriminates between K+- and the way smaller Na +-Ions. Why
are K+-ions transported and smaller Na+-ions not?

The potassium can interact energetically favorable with the selectivity filter of the K +-
channel, and thus let them be transported. Na +-ions are too small for this, not gaining the
energy favourability, and having not enough energy to move through the channel. They
have to first strip of the hydration shell, the energy for this is come from carbonyl of the
selectivity loop rehydrate in the selectivity filter. Only potassium is the right side. The
resolvation energy is higher than the desolvation energy. They don’t go back bc they’re
going along the gradient. On the other side it gets rehydrated. Bc sodium is smaller, it
can’t form the carbonyl bonds, this means that the resolvation energy is less, this is then
less than the desolvation energy and thus is not energetically favorable.

3.1) Why is it that in DNA, adenines only bind thymine (A-T) and guanines only bind
cytosines (G-C)? Why is this important.
This is because of the specific hydrogen bonding patterns, for which both adenine and
thymine make 2 hydrogen bonds and guanine and cytosine make 3. This is important,
because this means that if you know the code of one of the sides of the DNA, you can
figure out the other.

3.2) What is the differences between message DNA and RNA and why are these traits
useful to their unique functions?
DNA RNA
Double stranded Single stranded
thymine Uracil
deoxyribose ribose
Stable Labile (Unstable)
All characteristics come down to that they make the RNA less stable than the DNA, which
makes sense for their functions. DNA is meant to be preserved for a long time, so that it’s
information can be preserved. For RNA it’s function is to transcribe the code from DNA
and make a protein from it, this is short and afterwards it’s not needed and thus should be
destroyed, not long lasting.

3.3) How does tRNA work?

tRNA contains and anti-codon to a specific codon (a sequence of 3 base pairs) on one of its
stem loops and has the amino acid matching the codon-anticodon pair attached to its 3’
end. So that during translation it can bind in the rRNA to the codon and deliver the right
amino acid and leave after attaching it to the next.
4.1) When expressing a mouse gene in a bacterial expression system should you use a genomic
library or a cDNA library and why?

cDNA, because it has been constructed from mRNA, which means that all the introns(extra non-
coding information) has already been taken out, which is not the case for genomic DNA.

4.2) If you perform a restriction enzyme digest with HaeIII (GGCC) on the following PCR products
(linear) from two different donors how many bands will you see on a DNA gel and what size will they
be?

For patient 1 you will see 3 bands, all 1 smaller and 2 mediums. For the patient you will see 2
bands, 1 large and 1 medium.

With digests you can check mutations, but you have to know which mutation you are expecting.

Patient 1 (wild type)

CCTGAAAAGCTAAAGCTCTACTCAGAGTTTCTGGGGAAGCGG/
CCATGGTTTGCAGGAAACAAGGTAAAGGAGGAGTGATATGGGGAATGAGATCTGTTTTGCTTCACGTGTTAT
GGAGGTTCCAGCCCACATATTCTTGG/
CCTTCTGCAGATCACTTTTGTAGATTTTCTCGTCTATGATGTCCTTGACCTCCACCGTATATTTGAGC

Patient 2 (mutation)

CCTGAAAAGCTAAAGCTCTACTCAGAGTTTCTGGGGAAGCGGCTATGGTTTGCAGGAAACAAGGTAAAGGAG
GAGTGATATGGGGAATGAGATCTGTTTTGCTTCACGTGTTATGGAGGTTCCAGCCCACATATTCTTGG/
CCTTCTGCAGATCACTTTTGTAGATTTTCTCGTCTATGATGTCCTTGACCTCCACCGTATATTTGAGC

4.3) Explain how sequencing works. Illustrate your explanation with diagrams.

DNA is first hybridized with an primer. Then DNA polymerase is added with an excess of DNTP’s
and a small amount of ddNTPS. The ddNTPS don’t have the OH-group that the dNTPs have and
thus terminate further polymerization. They all have an marker on them so that you can know
which ddNTP has terminated the chain. All chains will be of different lengths, because they have
all been terminated and different points by different ddNTPS. You then put them in gel and use
electrophoresis to separate the fragments by length. Then you can read from the bottom to the
top the sequence of nucleotides.

PCR: primers (forward and backwards), DNA polymerase (heat resistent= taq), dNTP’s( has ATP
attached to give energy for the attachement), sample, buffer. The heat used denatures the Dubble
helix.

Sequencing: ddNTP’s, primer (no forward or back), DANN polymerase (often also taq), sample,
buffer.

4.4) In the course of studying a gene and its possible mutation in humans, you obtain genomic DNA
samples from a collection of persons and PCR amplify a region of interest within this gene. For one
of the samples, you obtain the sequencing chromatogram shown here. Provide an explanation for
the appearance of these data at position 49 (indicated by the arrow):
We have two copies of DNA- 1 from paternal and one maternal. This person has two
variants of one gen. Heterozygous. If this is a common mutation it is called Single
nucleotide polymorphism (SNP) they are normal variations in the DNA sequence and
are the most common type of genetic variation among people. Might also be an
uncommon mutation

5.1) Is glycolysis the reverse of gluconeogenesis?

Gluconeogenesis has 2 reactions that are different, different enzymes for them. Most reactions are
reversible, but not all. There are 3 differences. Because not everything is reversible.

5.2) In which way glycolysis is linked to the TCA cycle?

Glycolysis is the predecessor of the TCA cycle, it takes glucose and creates pyruvate, which then
can be made into acetyl-CoA and put into the TCA cycle. Glycolysis in the cytsol, TCA in the
mitochondria. When pyruvateà acetyl-coa CO2 gets produced. The pyruvate is oxidized in the TCA
cycle

5.3) What is the first metabolic intermediate formed in the TCA cycle?

Citrate/ citric acid

5.4) What is anaplerosis?

The replenishing of intermediates of the TCA cycle that were lost due to the use of biosynthesis.

Cataplerosis is the depletion of the intermediates in the TCA cycle.

5.5) How is oxidative phosphorylation linked to the TCA cycle?

TCA reduces NADH and FADH2 through oxidation of acetyl-CoA which donate electrons to the
mitochondrial membrane which eventually leads to the synthesis of ATP through oxidative
phosphorylation. Phosphorylation is a process in the mitochondria where there is electron
transfer. Succinate-q reductase

5.6) What is the main process of ATP production?

Oxidative phosphorylation

5.7) How do mitochondrial metabolites leave the mitochondria?

Through shuttles, enzymes are used to convert molecules into metabolites that are capable of
crossing membranes via transporters.

The shuttles give reactions that transport the metabolites, the transporters are the carrier type, no
reaction.

By mitochondrial shuttles and carriers. Shuttles are involved with different reactions but the
shuttles are big proteins in the membrane that just carry things back and forth. Mostly not passive
diffusion
6.1) Explain why amino acids are chiral molecules. Which isomers are common in nature? What is
causing the stereoselectivity in nature?

They have a chiral center, the L isomers are more prevalent in nature. This is due to the steric
hinderance during the protonation quinonoid intermediate, where the proton can only attach
from the back.

6.2) Draw the hexapeptide ‘TAFEL’ including its stereochemistry and as it would appear under
physiological conditions.

6.3) Draw the L-amino acids Ser and Cys. Determine their absolute configuration and explain your
steps.

Draw after the backbone, then draw a methyl group for all side chains (except glycine) with the
right stereochemistry.

Write “under pshyicological conditions” so that the zwitter ion is drawn

6.4) Below you find a cytosolic protein sequence. You measure an absorbance at 280 nm of 0.698 AU
(Absorption is usually measured in 1 cm path lengths). What is the concentration of your protein in
g/l and also in M? Use ProtParam (google!) for finding out missing information about your protein.

protein sequence:

8.701E10^-6

1.18 g/L

The absorbance is different for every wavelengths.

6.5) What kind of bond is the peptide bond? What is the chemical reaction called that forms a
dipeptide from two amino acids? In which machinery is responsible for this bond formation within
our cells?

Amide bond, condensation reaction, ribosomes.

6.6) Protein Structures are described in four levels. Explain the four levels of protein structure in
bullet points. Include by which chemical forces they are held together.

· Primary structure, sequence of amino acids, held together by covalent bonds

· Secondary structure, regions stabilized by hydrogen bonds, alpha-helix or beta-sheets, loops held
together by hydrogen bonds

· Tertiary structure, assembly of secondary structures in 3D space, ionic, polar, hydrophobic, or

covalent, hydrogen bonds, van der waals.

· Quartenary structure, interaction of multiple polypeptide chains, ionic, polar, hydrophobic, or

covalent, hydrogen bonds, van der waals.

6.7) Label all relevant aspects of this Ramachandran plot. Describe what the indicated areas are.
LU: beta strands, LD: Right handed helix, RU: Left handed helix

6.8) The following protein is a transmembrane protein. Only the loop areas are facing outside the
membrane. On the inside of this barrel water soluble molecules are transported.

What can you tell about the amino acid composition of the β-sheet?

The arrows point from the N-terminus to the C-terminus, and bc they point in the opposite
direction the strands are anti-parallel hydrophobic

Which amino acids would you expect inside the β-barrel? Give examples.

Polar or charged amino acids, such as, serine, threonine, arginine and histidine.

Which amino acids would you expect outside the β-barrel? Give examples.

The amino acids on the inside of the beta-barrel should be hydrophobic, such as alanine, valine,
isoleucine, leucine and methionine.

7.1a) Immobilized Metal Affinity Chromatography (IMAC):

(3:29) https://www.youtube.com/watch?v=-5zARVn6WHg
(2:34) https://www.youtube.com/watch?v=h0ZGlrGK6-E
(1:11) https://www.youtube.com/watch?v=B__n4buDycs
Q1) How are specific target proteins separated in an affinity chromatography step
You have a ligand (Ni2+) and specific proteins bind to the ligand and others go through.
Q2) What are the general steps in affinity chromatography
First step introduce ample to column, substance retained by ligand, get rid of compounds by
washing them off and adjusting pH
Q3) How do you elute your target protein from a Ni-NTA column?
Add compounds which competes to bind with the ions and the protein which you want will get
eluded. Imidazole
Q4) Find out how His6-tags and GST-tags are used to purify proteins. How are these proteins
eluted from the columns after the washing steps?
Competitive elution or affinity binding

7.1b) Ion Exchange Chromatography (IEX)

(6:44) https://www.youtube.com/watch?v=i4U4ndf2ayg
Q1) What is the physicochemical property that IEX takes advantage of?
The Ph of the proteins because if the Ph changes the ions will form. The N terminus and c terminus
are deprotonated at pH 7 and are charged. The side chains are also charged; arganine, histidine,
lysine, aspartic acid and glutamic acid
Q2) How does the pH of your buffer you are using for purification affect the purification
success?
The pH can decide if a specific amino acid is deprotonated or protonated. If you shik pH you shik
overal average charge of the proteins
Q3) How do you elute your target protein in an IEX chromatography?
By adding more ions to the solution the charges will compete to bind and release the target
protein.
Q4) Why can IEX be used to clean your target protein from nucleic acid contaminations?
Difference in charge and pHi

7.1c) Size Exclusion Chromatography (SEC)

(4:29) https://www.youtube.com/watch?v=4E1NRCoycNk
(1:00) https://www.youtube.com/watch?v=aWtThd13I4I
Q1) What is the physicochemical property that SEC takes advantage of?
The physicochemical property that SEC takes advantage of is molecular weight because higher
molecular weight elutes first (size distributon).
Q2) How do you elute your target protein in an SEC chromatography?
By knowing the approximate size of it and putting it through the gel. Then collecAng all the
fragments and testing it for the targeted protein.
Q3) Do very small peptides (few amino acids ~2 kDa) contaminants elute early or late??
Late, smaller molecules will interact with the pores of the beads and stay behind longer, meaning
that they will elute later
Q4) Does a large target protein-tetramer (each sub-unit has 50 kDa) elutes before or after a
80 kDa contamination?
Since it’s a tetramer it has four subunits and each subunit is 50 kDa, meanwhile the contamination
is 80 kDa. The tetramer is larger and will elute before the contamination.

7.1d) SDS-Polyacrylamide Gelelectrophoresis (SDS-PAGE)

(8:37) https://www.youtube.com/watch?v=i_6y6Z5UvwE
Q1) What is the purpose of running an SDS-PAGE? What does it stand for?
It stands for sodium dodecyl … Separates proteins based off of their molecular weight.
Q2) Why does your sample buffer contain beta-mercaptoethanol, and what is the role of
SDS?
Proteins have complex structures and they have to be broken down and linear. SDS breaks the
hydrogen bridges and the other reduces the disulphide bridges to cysteine. SDS gives it the charge
and makes it much higher for it to travel on the gel.
Q3) Why do proteins not precipitate (like an egg in a fry pan) when heated up to 95degC?
The proteins of an egg denatured when heated but when cooled off it can form new bonds but
when SDS is present it will remain a linear polynucleotide
Q4) How do you visualize you proteins after the SDS-PAGE?
You add a staining solution that will bind to the proteins and give it color

7.2) Why is GFP green? Draw its chromophore. Name the involved amino acids and label their
contributions to the chromophore structure for each of them. (3P)

Due to the aromicity, making for delocalized electrons that can be excited and then emission a
lower energy wavelength.

8.1) Why is amino acid phosphorylation a useful protein modification, especially in cell signaling ?
Phosphorylation gives the amino acid more negative charge and changes it’s conformation and
thus it’s behaviour. Many enzymes and receptors are activated/deactivated. It can create an
cascade and affect protein-protein interactions. It can change the location of a protein within an
cell, and influence the stability of the protein.

It’s switchable, you can remove it. Often proteins have several phosphorylation sites together,
which can make for a lot of little things. It can change from no protein interaction to a lot of
protein interaction. Protein kinases are often just called kinases, they can do phosphorylation.
Dephosphorylations Is catalysed by phosphatases (it’s not the opposite reaction, it’s
hydrolyzation.)

8.2) Draw the main features in EGF signaling from EGF binding to RAS activation

EGF binds the EGFR, EGFR dimerizes, cross-phosphorylation, Grb2 which has an SH2 domain, SOS
binds Grb2s SH3 domain, SOS removes GDP from RAS and GTP binds, Ras-GTP is activated and
binds to RAF causing a kinase cascade

8.3) . What parts of this system can potentially go wrong leading to cancer development.

· Overexpression of the EGFr’s, which creates more signals without extra EGF, by creating more
dimers. EGF can dimerize without EGF connecting

· Mutation in RAS so that the GTP activated is very hard to hydrolyze back into the GDP inactive
version.

· Deletion that leads to more phosphorylation in the C terminal. Mutations that increase the
kinase activity, leading to more peliferation. Endless phosphorylation of the internal domain of
EGFR, this can be drugged to help peeps.

· Mutation leading to inactiviation of phosphates for EGFR

· Overexpression EGF

9.1) Name and explain the 7 common features of Signal Transduction.

1. Signal: An hormone, ligand etc is released

2. Reception: the signal attaches to an receptor

3. Amplification: from the 1 molecule on 1 receptor, an chain begins and more and more
molecules participate, amplifying the signal

4. Cross-talk: molecules in the chains start to interact with other signalling pathways, influencing
them.

5. Integration: other pathways influence the original pathway and the signals are integrated

6. Transduction: the signal is sent through the cel, through multiple different messengers

7. Response: the signal goes into the nuclei and changes something about the cellular behaviour,
such as affecting an transcription factor.
9.2) Describe the steps of β2-adrenergic receptor signaling. What are the physiological effects when
this signaling switches on?

A hormone binds to an inactive receptor and activates it changing its conformation. The activated
receptor then interacts with the G alpha and it undergoes a conformational change. The beta
gamma part stays bonded to the receptor and the alpha part binds to an effector activating it.
Then it undergoes conformational changes and repeats all over again.

9.3) Describe the steps of the vision process. Explain in detail the conformational change that
enables Transducin binding.

For the vision process:

1. Rhodopsin gets activated by light to opsin, which makes it go through a conformational change.

2. Due to this conformational change, transducine can bind, which it then switches out the
attached GDP for GTP, detaching the Galpha from the other part of the Gs.

3. 2 Galpha’s go to an inactive PDE and detach the gamma parts, making it active, which then
changes cGMP to GMP.

4. The low cGMP concentration then constitutes the closing of the Na+ and Ca2+ channel.

Light changes the 11-cis retinal in the rhodopsin to the 11-trans retinal in the opsin. The change
from rhodopsin to opsin makes the 6 helix move slightly out of the way, this makes it possible for
the Galpha to bond and continue the signal pathway, which was earlier not possible bc of the 6
helix being in the way.

Extra:

You need an auxillary enzyme callad GAP to hydrolyse the GTP to GDP In Ras. GeF kicks out the
GDP.

The membrane is a double lipid structure, the liquid mozaik model of a membrane, it tells you that
at room temperature you can laterally move around, lipids can flip-flop but whole proteins can’t.
The membrane is “liquid”. The more kinks and chloresterol there are, the less tight the membrane
is made and more the proteins and lipids can move around.

For phi and psi, the peptide bond is in the plane.