Plant Stress 10 (2023) 100279

Contents lists available at ScienceDirect

Plant Stress
journal homepage: www.sciencedirect.com/journal/plant-stress

A newly isolated Bacillus pumilus strain SH-9 modulates response to drought

stress in soybean via endogenous phytohormones and gene expression
(Daegu, South Korea)☆
Shifa Shaffique a, Muhammad Imran a, b, Arjun adhikari a, Muhammad Aaqil khan a, c,
Waqas Rahim d, Sarah Owdah Alomrani e, Byung- Wook Yun d, Sang-Mo kang a, *, In-Jung Lee a, *
a
Department of applied biosciences, Kyungpook national university, South Korea
b
Biosafety Division, National Institute of Agriculture Science, Rural Development Administration, Jeonju 54874, Republic of Korea
c
Department of chemical and life sciences, Qurtuba University of Science and Information Technology, Peshawar, Pakistan
d
Department of Plant Biosciences, School of Applied Biosciences, College of Agriculture & Life Science, Kyungpook National University, Daegu 41566, Republic of Korea
e
Department of Biology, College of Science and Arts, Najran University, Najran 66252, Saudi Arabia

A R T I C L E I N F O A B S T R A C T

Keywords: Drought stress hampers plant growth and productivity. Some microorganisms mitigate stress in plants; however,
Bacteria the molecular mechanism by which they interact with plants in mitigating stress remains unknown. This study
Drought stress aimed to determine the mechanism by which plant growth–promoting rhizobacteria modulate drought stress in
Gene expression profile
soybean. Results indicated that B. pumilus SH-9 (SH-9) produced indole acetic acid and siderophore, and had
Plant productivity
Bacillus spp.
capacity for phosphate solubilization. The test for polyethylene glycol 6000 (PEG) tolerance, showed that SH-9
Soybean could withstand high PEG concentration (up to 30 %). The isolate was identified a B. pumilus strain using a 16 s
ribosomal DNA gene sequence. Inoculation of soybeans with SH-9 enhanced soybean plant growth and biomass
by 20 %, even under high drought stress. This was due to a reduction of the endogenous phytohormone (abscisic
acid) and upregulation of the antioxidant defense system (SOD, POD, APX, and GSH) by SH-9. Furthermore, the
transcription factors GmDREB2, GmbZIP1, and GmNCED3 were involved. Inoculation with SH-9 also improved
physio-morphological characteristics such as biomass, chlorophyll, seedling length, and relative water contents
in the stressed plant. Overall, the findings of this study indicated that SH-9 enhances plant growth by promoting
phosphate solubilization, siderophore, and exopolysaccharides. We, therefore, conclude that SH-9 is a drought-
tolerant variant that can improve plant growth even under drought stress via modulation of expression of the
phytohormone gene, and antioxidant profile.

1. Introduction of the total crop yield loss, and it is one of the most debated topics in the
21st century (Basu et al., 2016; Bittencourt et al., 2023; Cotrina Cabello
Soybean (Glycine max) is a vital crop containing essential vitamins, et al., 2023). About 35 % of the earth’s land is semi-arid due to reduced
proteins, oils, minerals, and fibers. It is susceptible to abiotic stress, such rainfall, water scarcity, and global warming (Ma et al., 2016). As water
as drought stress. Numerous experimental studies have been conducted is essential for plant survival and serves as a nutrient transportation
to optimize soybean production under drought (Ashwin et al., 2023; medium, reduction in its level causes drought stress, which negatively
Wang et al., 2023). Despite a remarkable rise in soybean production, affects plant productivity and triggers oxidative stress (Chandra et al.,
drought stress affects crop yield (de Freitas et al., 2022; Waqar et al., 2021; Yang et al., 2021). Drought is one of the most serious threats to
2022). Therefore, improving the growth of soybean under drought stress world food production. Therefore, it is critical to understand how soil
has become an important goal for sustainable development. Among all water deficiencies of varying severity affect crop development and
abiotic stresses, drought is the leading stress, accounting for 30 %–50 % physiology. Drought interrupts cellular organization, metabolism, and

This article is part of a special issue entitled: “Role of Microorganisms in Plant Growth, Stress Amelioration and Phytoremediation” published at the journal Plant
☆

Stress.
* Corresponding authors.
E-mail addresses: kmoya@hanmail.net (S.-M. kang), ijlee@knu.ac.kr (I.-J. Lee).

https://doi.org/10.1016/j.stress.2023.100279
Received 13 September 2023; Received in revised form 16 October 2023; Accepted 29 October 2023
Available online 2 November 2023
2667-064X/© 2023 The Author(s). Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-
nc-nd/4.0/).
S. Shaffique et al. Plant Stress 10 (2023) 100279

results in accumulation of reactive oxygen species (ROS) (Neelin et al., ROS signaling and mitogen-activated protein kinase pathways are
2003). Accumulation of ROS can cause oxidative damage to cellular crucial signaling networks in combating drought stress (Iqbal et al.,
structure (Verma et al., 2019). These ROS, including superoxide anions 2021). They improve plant productivity and growth through cellular
(O–2), singlet oxygen(O2), peroxide(H2O2), hydroxyl radicals(OH), and processes, including phytohormones, exopolysaccharides, phosphate
Alpha-oxygen (α-O), ultimately reduce plant productivity (Cruz de solubilization, and altering gene expression (Huang et al., 2012; Jeong
Carvalho, 2008; Verma et al., 2019). et al., 2020; Li et al., 2021).
Sustainable agronomy is a promising new approach based on bio­ A few microbial strains, such as those involved in endophytes,
logical resources to preserve agronomic production. Microbial consor­ PGPRs, and mycorrhiza, can mitigate drought stress (Imran et al., 2022).
tiums in agricultural production are the best example of sustainable Previous research indicates that Plant growth promoting bacteria (PGB)
agronomic practices (Bhandari et al., 2023; Jamil et al., 2022; Rou­ can improve drought resistance in wheat (Dahiya et al., 2020), maize
phael, 2022). In these consortiums, plants have a symbiotic relationship (Gholami et al., 2009), and rice (Ashrafuzzaman et al., 2009). Further­
with microorganisms, which initiates plant-microbial interaction more, inoculating crops with endophytes can increase the concentration
(Natesan et al., 2023; Roy and Müller, 2022). Plant growth–promoting of secondary metabolites (Khan et al., 2023; Peng et al., 2023; Xu et al.,
rhizobacteria (PGPR) are primarily bacteria that promote plant devel­ 2023).
opment and health. Recently, PGPR application in agriculture has In a previous study, we identified five microbes with adhesive po­
steadily expanded, and is projected to partially replace chemical fertil­ tential, biofilm-forming characteristics, and roles in plant–microbe
izers, insecticides, and other growth regulators in the future, providing interaction (Shaffique et al., 2022a). The results indicated that
an environmentally acceptable option for sustainable farming practices. B. pumilus strain SH-9, exhibits moderate motility and a moderate
It enhances plant productivity and growth via production of phytohor­ biofilm-forming potential. The aim of this study was to further charac­
mones and exopolysaccharides, and phosphate solubilization and gene terize and identify B. pumilus SH-9′s potential role and the molecular
expression. Beneficial microorganisms use direct and indirect ways to mechanism through which it mitigates drought stress via hormonal,
support crop growth and development under abiotic stressors. They antioxidant, and altering gene expression in a model plant soybean.
distribute secondary metabolites and phytohormones in stressful con­
ditions, highlighting the importance of plant–microbe interaction in 2. Materials and methods
sustainable agriculture and global food security. PGPR can either
directly or indirectly promote plant development in vitro, in a green­ 2.1. Isolation and screening of microbes
house, or in the field. PGPR includes various bacterial communities, one
of which is the gram-positive spore-forming Bacillus, which is gaining All microbial isolates were obtained from the root-adherent soil of an
popularity due to its inherent stability and long shelf life. Gram-positive Artemisia plant from Pohang Beach, South Korea. Soil samples were
bacteria, especially those from the genus Bacillus, are among the most preserved in a sea foam box for transportation to the School of Agri­
well studied experimental systems in bacteriology (Bonifer et al., 2019; culture and Life Sciences, Crop Physiology Laboratory, Kyungpook Na­
Rishad et al., 2017; Tepe and Dursun, 2014). tional University (Daegu, South Korea). A soil sample weighing 10 g was
In agricultural environments, various Bacillus species support crop diluted with 50 mL of distilled water before it was incubated for 24 h on
health in various ways. They enhance plant development by promoting a shaking incubator. The sample was serially diluted and used to prepare
the synthesis of plant hormones, such as abscisic acid (ABA), auxin inoculum, which was spread on Luria–Bertani (L.B.) media plates before
(IAA), thereby reducing drought stress. A number of PGPR species, the plates were incubated at 28 ◦ C. Streaking and restreaking were
including Bacillus pumilus can sustain plant growth in drying soil by performed to obtain pure bacterial culture colonies, which were pre­
inducing ABA and IAA synthesis, regulating stomatal movement, and served in a 75 % glycerol solution as a stock solution. This procedure was
reducing water loss (Ma et al., 2022; Xie et al., 2019). Therefore, it is performed as described previously (Shaffique et al., 2023) .
critical to understand the interactive effect of deficit irrigation and PGPR
inoculation on plant development and physiology. 2.2. Plant growth–promoting bioassay
Some of PGPR species can directly boost plant development by
improving nutrient uptake or by enhancing the host plant’s natural Bacterial isolates were screened for their plant growth–promoting
defenses against infection. Other species can suppress or restrict the potential (PGP), following a previously described method (Shaffique
growth of pests and/or pathogenic microbes (Ekwealor and Ebele, et al., 2022b). Phosphate solubilization activity was checked by inocu­
2003). The numerous enzymes, antibiotics, and metabolites that Bacillus lating the bacterial isolates on trypticase soy agar medium supple­
species produce make them useful in a wide range of industries, mented with tricalcium phosphate. A translucent halo around the
including agriculture and medicine. Additionally, their ability to inoculum spotted after 24 to 48 h would indicate a positive result.
generate spores, which allows them to thrive in unfavorable environ­ Ability to produce IAA was determined by mixing equal amounts of the
mental conditions, makes them distinctive and attractive (Azeem et al., bacterial isolate and Salkowski’s reagent before placing the mixture in
2023; Rabbee et al., 2023). These Bacillus spores must germinate in the dark for 30 to 40 min. A reddish-pink color indicated the ability to
order to develop into metabolically active cells after being introduced to produce IAA by the bacteria. Ability to produce siderophore was
the plant as dormant cells. After germination, these bacteria are drawn determined by inoculating bacterial isolates on chromeazurol S agar
by chemotaxis, triggering the complicated molecular process of root plates. The presence of an opaque halo zone was indicative of side­
colonization and exerting growth–promoting potentials. When Bacillus rophore production. A congo red assay was performed to screen isolates
spp. colonize a plant, they trigger both direct (e.g., the production of for EPS activity. Isolates were allowed to grow on the EPS media plate
siderophore, nitrogen fixation, phytohormones, and nutrient solubili­ for 24 to 48 h. A reddish halo against a black background would indicate
zation) and indirect (e.g., the production of exopolysaccharides (EPS), EPS activity (Shaffique et al., 2022d).
biofilm formation, hydrogen cyanide (HCN), and lytic enzymes) mech­
anisms to promote plant growth (Poveda and González-Andrés, 2021; 2.3. Molecular characterization
Shafi et al., 2017). The improvement in selection of microbes for bio­
logical control, such as inoculation of plants, characterization, and Genomic DNA (gDNA) was extracted from the SH-9 isolate using a
management, has been enabled by the development of molecular and DNeasy plant mini kit (Qiagen, Valencia, CA, USA). Bacterial isolate was
genomic technologies, including modifying wild-type strains to enhance identified through using universal primers (27F primer [5′-AGAGTTT­
their capacity to control soil-borne illnesses (Geetha and Gunasekaran, GATC (A.C.) TGGCTCAG-3′] and 1492R (5′-CGG (T/C) TACCTTGT­
2010; Masood et al., 2020). TACGACTT-3′) to amplify 16S rDNA. The similarity of acquired

2
S. Shaffique et al. Plant Stress 10 (2023) 100279

nucleotide sequences to those in the National Center for Biotechnology was used for SOD activity assay as described by Imran et al. (2021a).
Information (NCBI) database was determined. After obtaining the sim­
ilarity index, a phylogenetic tree was constructed using MEGA 10, as 2.8 Endogenous ABA analysis
described by Shaffique et al. (2022d).
ABA content in the plant samples was determined using the method
2.4. In vitro polyethylene glycol tolerance assay described by [54]. A mass of 0.2 g of a freeze-dried plant sample was
dissolved in 10 mL of phosphate buffer and vacuum filtered before 0.5
For the stress tolerance capacity of the isolates, an in vitro poly­ mL of the ABA standard was added, followed by rotary evaporation and
ethylene glycol (PEG) tolerance assay was performed using an sonication with NaOH. Dichloromethane was added to the sample
ultraviolet-visible (UV–VIS) spectrophotometer (Shimadzu, Kyoto, before the mixture was shaken at a pH of 13. After separating the phases,
Japan). The selected bacterial isolates were allowed to grow in PEG the lower layer was removed, and the pH was adjusted to 3.5. Ethyl
6000 at seven concentrations (0 %, 5 %, 10 %, 15 %, 20 %, 25 %, and 30 acetate facilitated solvent separation before the sample was dried by
%). The growth and survival were assessed by measuring absorbance at rotary evaporation. Vacuum drying with 1 g of PVP was performed
600 nm (Abdel-Raheem et al., 2007). before washing and solvent extraction. Subsequently, the samples were
sonicated with ethyl acetate and placed for N-drying. Finally, 60 µL of
2.5. Plant’s growth condition and treatment diazomethane and 20 µL of dichloromethane were added and the sample
was further processed for GC–MS analysis using Lab-Base (Thermo­
Soybean seeds cultivar (Pungsannamul) were purchased from Ge­ Quest, Manchester, U.K.) data system software.
netic Resources, Kyungpook National University. The seeds were first
sterilized with a 2.5 % sodium hypochlorite solution, washed thor­ 2.9. Endogenous auxin analysis
oughly with autoclave distill water, and allowed to germinate in horti­
cultural soil. After the emergence of seedlings, equal-sized seedlings Endogenous auxin level was measured using Salkowski’s reagent as
were transferred into pots containing the same type of horticultural soil. described by Ali et al. (2010), Gilbert et al. (2022). The plant sample was
The experiments were conducted in a growth chamber under the ground in liquid nitrogen and mixed with 80 % methanol before it was
following conditions: 14 h day at 28 ◦ C and 10 h night at 25 ◦ C, 60 %–70 vortexed and centrifuged at 10,000 × g for 10 min. The supernatant was
% relative humidity, and 250 μmol/m–2 s–1 light intensity, as described mixed with an equal amount of Salkowski’s reagent. The presence of a
by Imran et al. (2023). The experimental setup was divided into two red color indicated auxin production in the sample. The intensity of the
groups: [Group A] Control group including (Control) control soybean color was measured using a spectrophotometer at 536 nm against the
(only distilled water), (D10 %) drought 10 %, and (D20 %) drought 20 uninoculated medium as blank. The optical density of the test sample
%, [Group B] SH-9 inoculated group (SH-9) control only SH-9 inocu­ was read off the standard IAA curve (10–100 μg⋅ml− 1) to calculate the
lated, (SH-9/D10 %) SH-9/drought 10 %, and (SH-9/D20 %) concentration.
SH-9/drought 20 %. For isolate inoculation, the bacteria were allowed
to grow in 250 mL of autoclaved L.B. medium for 3 days before they 2.10. Estimation of gene expression through RT-qPCR
were centrifuged at 5000 × g for 12 min to obtain bacterial pellets.
Inoculum was prepared by taking ~108 colony-forming units which All procedures were executed as described by Stolf-Moreira et al.
were then diluted with sterilized distilled water and put into each pot. (2010), Xu et al. (2011). TRIzol reagent was used to extract the total
The treatment was given after every two days for a total of three times. RNA of the plant from leaves. cDNA was synthesized using the a Dia­
After pre-treatment with isolate SH-9, plants were exposed to drought Star™ R.T kit (SolGent, Korea) from plant RNA. qRT-qPCR was per­
stress by application of PEG 6000. PEG is higher molecular weight formed in the Eco™ real-time PCR machine using 2× Real-time PCR
compound that is used to induce artificial osmotic stress. Plants were Master Mix (including SYBR® Green I BioFACT™ Korea) using the
harvested 14 days after inducing drought stress treatment. Their synthesized cDNA and gene-specific primers (forward and reverse)
morphological parameters, namely, seedling length, biomass, and (Table 1). After initial denaturing at 94 ◦ C for 5 min, the sample was
chlorophyll content (SPAD-502; Konica Minolta, Japan), were measured subjected to 40 cycles of denaturing at 94 ◦ C for 30 s, annealing at 58 ◦ C
as described by Imran et al. (2021a), Khan et al. (2020a). for 30 s, extension at 72 ◦ C for 1 min, and final extension at 72 ◦ C for 5
min. Actin was utilized for each response to standardize the level of
2.6. Relative water content relative expression of each gene, and the expression level in control
plants was computed relative to other treated plants. The genes and their
The relative water content (RWC) of plant samples was measured corresponding primers (forward and reverse) are shown in Table 1.
using the fresh weight (FW) of every seventh leaf, which was submerged
in water for 8 h. After 8 h, the turgid weight (TW) was noted before the 2.11. Statistical analysis
leaf was left in an oven to dry at 75 ◦ C–80 ◦ C for 8 h to determine the dry
weight (DW). The RWC was calculated using the following equation Each experiment was conducted in three biological replicates and
described by Imran et al. (2022): subjected to Duncan’s multiple range test (DMRT) in SAS version 9.2.
The DMRT was used to examine pairwise differences between sample
RWC = FW − DW/TW − DW × 100 mean values. For graphical representation, GraphPad Prism version 6.01
(San Diego, CA, USA) was used.
2.7. Quantification of antioxidant enzyme
3. Results
The spectrophotometric method was used to determine antioxidant
activities of superoxide dismutase (SOD), peroxidase (POD), ascorbate 3.1. Plant growth–promoting assays
peroxidase (APX), and glutathione (GSH)using a spectrophotometer
(Thermo Fisher Scientific, Waltham, MA, USA) to measure absorbance All rhizosphere isolates were screened for plant growth promoting
as described by Imran et al. (2021b). Briefly, POD in soybean was (PGP), such as IAA, exopolysaccharide (EPS), siderophore production,
determined spectrophotometrically using the method developed by Kim and phosphate solubilization. The results indicated that isolate SH-9 had
et al. (2017). Similarly, the activity of APX in soybean was determined the highest phosphate-solubilizing index of 4.69 ± 0.30 cm and ability
using the method described by Khan (2020b). The Marklund method to produce siderophore with a transparent halo zone with an index of

3
S. Shaffique et al. Plant Stress 10 (2023) 100279

Table 1
Genes name and their corresponding forwards and reverse primers.
Gene Name Forward primer Reverse primer

GmDREB2 5′CGACCAGGAGGGCAGTGAT3′ 5′GCTTTTCGGCGAATGGAAT3′

GmNCED3 5′GACAGGCAAGTCCACGAGAA3′ 5′ACTTCGTCTTTCTCCCGAGC3′
GmbZIP1 5′CGCCGTAACCGATACCTTCA3′ 5′GGTGGAATGCTTGGGAGTGA3′
Actin 5′ATGGTGGGTATGGGTCAAAA3′ 5′GAGGACAGGATGCTGCTCCTCAG3′

2.59 ± 0.12 cm colony diameter. Similarly, SH-9 was positive for EPS
production with an index of 4.67 ± 0.13. The SH-9 showed a significant
IAA production by forming a reddish color in Salkowski’s reagent
(Fig. 1).

3.2. Stress tolerance and identification of SH-9

After assessing the different PGPR traits, SH-9 was further screened
for its capacity to withstand drought stress under various PEG concen­
trations. The results indicated that SH-9 exhibited the highest tolerance
toward drought stress. At 5 % PEG, it showed a non-significant differ­
ence to control 1, but as the PEG concentration increased, the SH-9
tolerance decreased. SH-9 showed higher tolerance at PEG 20 % than
at PEG 35 and 30 % (Fig. 2). The 16S rRNA sequence of the SH-9 isolate
had a substantial similarity with Bacillus pumilus spp., and it grouped
with B. pumilus in the phylogenetic tree.” The sequence was submitted to
the NCBI database under a unique gene accession number ON753949
(Fig. 3). Fig. 2. SH-9 growth under seven PEG 6000 concentrations (0 %–30 %).
Different lower case letters on top of bars indicate significant difference be­
tween treatments at p-value of <0.05. The error bar represents the standard
3.3. Effects of SH-9 application on soybean growth under drought stress
error of the mean (SEM) among the replicates.

The results indicated that high drought stress adversely affected

3.4. Modulation of relative water content by SH-9 application
growth and development of soybeans (Fig. 4). An increase in shoot
length by 12 %–14 % was recorded in plants under 10 % and 20 %
RWC is an essential indicator of dehydration in plants. This study
drought stress relative to the control plants. This may enable the plants
assessed the effects of drought stress and SH-9 application on RWC
to survive and grow under stress conditions growth (Farooq et al., 2009;
content. Drought stress reduced the RWC in all groups. However, this
Salehi-Lisar and Bakhshayeshan-Agdam, 2016), but long-term exposure
reduction in RWC was significantly lessened by inoculation of plants
to stress reduced their productivity through a significant reduction in
with SH-9 by 36.5 % and 29.9 % under 10 % and 20 % drought,
root length (12 %–26 %), fresh weight (19.3 %–29.03 %), dry weight
respectively, when compared to the control plant (only drought) (Fig. 5).
(22.2 %–33.3 %), and chlorophyll content (17.5 %–27.85 %) under sole
10 % and 20 % drought stress relative to the control group. However, the
plant–microbe interaction relaxed the effect of drought stress and 3.5. Effects of SH-9 application on the regulation of phytohormones aba
improved the morphological characteristics under drought stress, as and auxin
shown in Table 2.
The abbreviation represents control (only water), D10 % (10 % ABA is considered one of the most vital stress response hormones.
drought), D20 % (20 % drought), SH-9 (Isolate SH-9 treated), S.L. (shoot However, its higher level can cause a substantial increase in ROS pro­
length), R.L. (Root length), F.W. (fresh weight), D.W. (dry weight), Chl duction, which may affect cell function (Brossa et al., 2011). Therefore,
(chlorophyll content), SPAD (Soil Plant Analysis Development). Each these results revealed that under normal conditions, there was a mod­
data value is the mean of three replicates with ±S.D. The different lower erate difference between the control plants (only water) and the SH-9
case letters represent significant differences between treatment groups treated plants, but drought stress dramatically increased the endo-ABA
at p- value of <0.05, evaluated by one-way ANOVA through the DMRT content by 51 % and 97.5 % at 10 % and 20 % drought, respectively,
test. Values sharing the same letter are statistically equal at p-value < relative to control plants. In contrast, the isolate SH-9 application
0.05, whereas those sharing different letters are significantly different. significantly reduced ABA content by 20.6 % to 26.8 % in plants under

Fig. 1. Characteristics of SH-9 with respect to plant growth–promoting assays. (a) Siderophore production, (b) Phosphate solubilization, (c) Exopolysaccharides, and
(d) Indole acetic acid production by the SH-9 bacterial isolate.

4
S. Shaffique et al. Plant Stress 10 (2023) 100279

Fig. 3. SH-9 strain in a phylogenetic tree with other Bacillus pumilus strains based on 16S rRNA sequences. The phylogenetic tree was created using the neighbor
joining (NJ) method with 1000 boot strap replications and a 70 % cut off value. Bootstrap values were shown at each node. The phylogenetic tree represents
taxonomic status and ecological evolution of two different species (Bacillus pumilus and Priestia megatrium).

Fig. 4. Effects of SH-9 under drought and non-drought conditions on the phenotypic appearance of soybean plants. A) control plants without any stress, B) 10 %
drought, C 20 % drought, D) SH-9 treated, E) SH-9 plus 10 % drought, and F) SH-9 plus /20 % drought.

3.6. SH-9 application modulated antioxidant enzyme activities under

Table 2
drought stress
Effects of SH-9 application on soybean growth and development under drought
stress.
The antioxidant enzyme activities in the control and SH-9-treated
Treatment S.L (cm) R.L. (cm) F.W. (g) D.W. (g) Chl plants were not significantly different. In contrast, drought stress
(SPAD)
caused a significant reduction in SOD activity (28.6 % and 34.7 %) and
Control 12.1 ± 15.1 ± 2.5 ± 2.04 ± 38.1 ± APX (19.3 % and 24.1 %). SH-9 application significantly enhanced this
0.11b 0.16b 0.04b 0.06b 1.4b
reduction in SOD (19.4 % and 13.3 %) and APX (18.5 % and 13.9 %)
D10 % 12.6 ± 10.1 ± 1.9 ± 1.51 ± 28.1 ±
0.11b 0.11d 0.04cd 0.04e 1.2e activity under 10 % and 20 % drought stress, respectively (Fig. 7a and
D20 % 15.8 ± 10.7 ± 1.7 ± 1.30 ± 24.2 ± b). Similarly, due to drought stress POD (9.8 % and 8.5 %) and GSH
0.13a 0.12d 0.02c 0.06f 1.0f (10.3 % and 7.2 %) activities were slightly higher in plants under
SH-9 15.2 ± 16.7 ± 2.9 ± 2.32 ± 42.1 ± drought stress than in those in the control, and SH-9 treatment caused a
0.15a 0.17a 0.06a 0.05a 1.6a
SH-9/D10 13.1 ± 13.1 ± 2.0 ± 1.81 ± 34.1 ±
considerable increase in POD activity (9.8 % and 8.5 %).
% 0.09d 0.11c 0.05c 0.06c 1.1c
SH-9/D20 10.3 ± 13.3 ± 2.1 ± 1.67 ± 31.02 ±
% 0.11c 0.12c 0.06c 0.05d 1.3d 3.7. Effects of SH-9 application on transcription regulation under drought
stress

drought stress (Fig. 6a). These findings were supported by the significant The effects of isolate SH-9 on the transcription factor under drought
upregulation of the ABA biosynthesis gene NCED3 expression under stress were assessed. The results indicated a significantly higher
drought stress (Fig. 6b). Furthermore, application of SH-9, increased the expression of dehydration response DREB2 in plants under drought than
upregulation of IAA by 6.5 % relative to that of the control group in the control plants. SH-9 application caused a considerable reduction
(Fig. 6c). in the DREB expression under drought stress relative to the negative

5
S. Shaffique et al. Plant Stress 10 (2023) 100279

control (Fig. 8a). Similarly, expression of the stress response transcrip­

tion factor bZIP was higher in plants under drought stress than in the
control plants. SH-9 application caused a further increase the expression
of GmbZIP in plants under drought stress than in those in the negative
control (Fig. 8b).

4. Discussion

Soybean is an essential crop that is susceptible to drought stress. Its

quality, yield, growth, and production, are affected by drought stress.
The development of the soybean crop is hindered by the direct effects of
drought stress on photosynthesis, stomatal conductance, and meta­
bolism (de Freitas et al., 2022; Desclaux et al., 2000).
Current strategies to mitigating the effects of drought include
applying biostimulants such as microbes (Phour and Sindhu, 2022;
Zhang et al., 2022). Several previous studies have examined the appli­
cation of the plant growth–promoting bacteria as a promising approach
toward sustainable agronomy (Kour and Yadav, 2022; Lalay et al.,
Fig. 5. Relative water content percentage in various treatment groups. Values
2022). Recently, the use of microbes in mitigating drought stress has
were represent mean values of three replicates, and the error bars represent
SEM. Bars with different lower case letters indicate significant differences be­
attracted significant attention (Shaffique et al., 2022c).
tween treatments at p-value of <0.05, as evaluated by DMRT. Values sharing In this study, we examined the different PGPR potentials of SH-9,
the same letter are statistically equal at p-value < 0.05, whereas those sharing such as EPS, Siderophore, phosphate solubilizing, and IAA activity.
different letters are significantly different. We found that SH-9 had a remarkably high ability to produce EPS,
Siderophore, and phosphate solubilizing, and exhibited IAA activity.
The SH-9 was further investigated for its effects on soybean plants
under drought stress. The results indicated that SH-9 inoculation
significantly reduced drought stress in soybean by increasing plant

Fig. 6. (a). Abscisic acid content in various treatment groups. (b). Relative expression of candidate gene (NCED3) in soybean plants. The values were calculated
relative to those of actin gene expression. (c). Content of IAA in all treatment groups. Values represented mean values of three replicates, and the error bars rep­
resented SEM. Bars with different lower case letters indicate significant differences between treatments at p-value of <0.05, as evaluated by DMRT. Values sharing
the same letter are statistically equal at p-value < 0.05, whereas those sharing different letters are significantly different.

6
S. Shaffique et al. Plant Stress 10 (2023) 100279

Fig. 7. The application of SH-9 modulated the antioxidant defense system in all treatment groups. (a) Modulation of the SOD in all treatment groups, (b) Modulation
of APX activity, (c) Modulation of the peroxidase level. (d) Effects of SH-9 inoculation on GSH activation under drought and non-drought conditions in soybean
plants. Each data point represents the mean value of three replicates, and the error bars represent the SEM. Bars with different lower case letters indicate significant
differences between treatments at p-value of <0.05, as evaluated by DMRT. Values sharing the same letter are statistically equal at p-value < 0.05, whereas those
sharing different letters are significantly different.

growth, biomass, and photosynthetic pigments. The beneficial effects of mediated by ABA and ABA-related genes, such as GmNCED3 (Wahid
SH-9 on soybeans can be attributed to its PGP trait. SH-9 demonstrated et al., 2020). Our results suggest that SH-9 inoculation enhanced plant
plant growth promoting (PGP) traits, such as EPS, siderophore, IAA, and growth under drought stress by reducing ABA accumulation. Similarly,
phytohormone (ABA and IAA) production and phosphate solubilization. IAA is another phytohormone that plays a dynamic role in mitigating
Photosynthetic processes are susceptible to drought stress (Reddy et al., plant growth during drought stress (Spaepen and Vanderleyden, 2011).
2004; Zargar et al., 2017). Plants have evolved sophisticated mecha­ Phytohormones act as signal molecules and reduce oxidative stress by
nisms to combat drought stress, such as metabolic reprogramming, altering gene expression and activation of the antioxidant defense sys­
endogenous phytohormones, and stomatal closure to inhibit photosyn­ tem. Some previous studies suggest that endogenous phytohormones are
thesis, modulating gene expression, and activation of the endogenous associated with drought stress tolerance (Dhar et al., 2022). In this
antioxidant defense mechanism. Results showed a decrease in chloro­ study, we observed higher ABA levels under drought stress, but ABA
phyll content in uninoculated plants during drought stress, whereas levels decreased when plants were inoculated with SH-9.
SH-9 inoculation resulted in less pronounced reduction in chlorophyll Moreover, drought stress enhances the accumulation of free radicals,
content under drought stress. Higher chlorophyll content was associated including singlet oxygen, superoxide anion, and H2O2, which causes
with higher biomass of plants than in plants in the negative control. cellular degradation and toxicity. However, plants can scavenge free
Previous studies have also reported that the application of radicals by activating the intrinsic antioxidant pathways, such as acti­
drought-tolerant microbes increases the chlorophyll content in various vating SOD, POD, APX, and GSH reductase, which enhance protection
crops, such as broccoli (Kim et al., 2020), maize (Shaffique et al., against cellular damage and reduce oxidative stress (Nahar et al., 2015;
2022d), wheat (Kasim et al., 2013), tomato (Shintu and Jayaram, 2015), Xing et al., 2016). Similarly, soybean plants inoculated with SH-9
and rice (Gusain et al., 2015). significantly increased free radical scavenging by increasing the activ­
The observed increase in drought stress tolerance can be attributed to ities of SOD, POD, APX, and GSH. GSH is mainly present in the cytosol of
endo-ABA accumulation, as endogenous phytohormones, such as ABA, cells that build up the redox balance (Zhou et al., 2022).
are crucial in regulating plant growth under ecological stresses (Joga­ Inoculation of plants with rhizospheric bacteria enhances antioxi­
wat et al., 2021). Among other phytohormones, ABA is more likely to dant enzymes production (Angon et al., 2022; Kour and Yadav, 2022). In
respond to drought stress by prompting stomatal closure and water this study, activities of SOD, APX, and POD were higher in plants
maintenance (Altaf et al., 2023; Mukherjee et al., 2023). Plant–microbe inoculated with SH-9 than in non-inoculated plants under drought
interaction has attracted attention in the field of sustainable agronomy stress. Our findings corroborate those of (Moretti et al., 2021; Porcel
(Gonzalez and Gonzalez-Lopez, 2013). Plant–microbe interaction is et al., 2003; Shaffique et al., 2022d), who detected a remarkably high

7
S. Shaffique et al. Plant Stress 10 (2023) 100279

DREB2 are vital in alleviating drought stress and are also involved in
ABA signal transduction (Mohsenzadeh Golfazani et al., 2022). Drought
stress significantly upregulated the expression level of NCED3, which is
responsible for the production of the ABA (stress hormone). Inoculation
of plants with SH-9 down-regulated the expression of NCED3 relative to
the control group. Therefore, our results confirm that the application of
SH-9 has the potential to improve drought stress tolerance via modu­
lation of the expression of stress-responsive genes, which enhances stress
tolerance.

5. Conclusions and future prospective

The results of this study showed that the isolate SH-9 is a new
drought-tolerant variant of Bacillus spp. The isolate exhibited plant
growth–promoting characteristics, including EPS, siderophore produc­
tion, and phosphate solubilization. It also enhanced growth attributes,
such as biomass, RWC, and chlorophyll in soybeans. Plant growth–­
promoting characteristics were observed after SH-9 inoculation, which
mediated endogenous phytohormones (ABA and IAA) and antioxidant
enzymes (GSH, SOD, APX, and POD), preventing cellular damage. The
rhizospheric drought-tolerant strain (SH-9) could also modulate
drought-related transcription factors, such as GmbZIP1, GmDREB2, and
GmNCED3. These findings suggest that SH-9 can be an eco-friendly,
sustainable biostimulant.

Institutional review board statement

Not applicable.

Informed consent statement

Not applicable.

Declaration of Competing Interest

The authors declare no conflict of interest.

Fig. 8. Effects of SH-9 inoculation under drought conditions on the relative Data availability
expression of the stress response genes) (a) GmDREB2, and (b) GmbZIP1, in
soybean plants. The values were calculated relative to those of actin gene Not applicable.
expression. Mean values of three replicates were obtained, and error bars rep­
resented the SEM. Bars with different lower case letters indicate significant
differences between the treatments at p-value of <0.05, as evaluated by DMRT.
Values sharing the same letter are statistically equal at p-value < 0.05, whereas
Acknowledgment
those sharing different letters are significantly different.
This work was supported by the National Research Foundation of
Korea (NRF) grant funded by the Korea government (MSIT) (no.
activity of SOD, APX, and POD in microbial-inoculated plants under
2022R1A2C1008993).
abiotic stress. These results demonstrated that microbial inoculation of
plants triggered the antioxidant activity in soybean plants to cope with
the free radicals. Higher levels of antioxidant molecules under drought Funding
stress are associated with a high level of ROS and de novo synthesis of
enzymatic proteins. Republic of Korea and Korea Basic Science Institute (National
These factors also correlated with the molecular response of plants Research Facilities and Equipment Center) grant funded by the Ministry
under stress conditions. During drought stress, the transcription factor, of Education (NRF-2021R1A6C101A416).
dehydration-responsive element binding (DREB2), is activated to regu­
late the stress signaling pathway to transduce gene expression (Bai et al., References
2022). DREB2 is a transcription factor that regulates dehydration
Abdel-Raheem, A., Ragab, A., Kasem, Z., Omar, F., Samera, A., 2007. In vitro selection
stress-responsive genes and plays a significant role in stress mitigation in for tomato plants for drought tolerance via callus culture under polyethylene glycol
numerous plant species (Kudo et al., 2019; Manna et al., 2021). Several (PEG) and mannitol treatments. In: Paper presented at the African Crop Science
previous studies reported that upregulation of the DREB2 gene resulted Conference Proceedings.
Ali, B., Sabri, A.N., Hasnain, S., 2010. Rhizobacterial potential to alter auxin content and
in stress tolerance (Dong et al., 2017; Hussain et al., 2011). Our findings
growth of Vigna radiata (L.). World J. Microbiol. Biotechnol. 26 (8), 1379–1384.
suggest that SH-9 inoculation during drought stress upregulated the Altaf, M.A., Shahid, R., Kumar, R., Altaf, M.M., Kumar, A., Khan, L.U., Bahadur, S., 2023.
expression levels of GmDREB2 and bZIP1, which may be associated with Phytohormones mediated modulation of abiotic stress tolerance and potential
the production of phytohormones and osmoprotactans, ultimately crosstalk in horticultural crops. J. Plant Growth Regul. 42 (8), 4724–4750.
Angon, P.B., Tahjib-Ul-Arif, M., Samin, S.I., Habiba, U., Hossain, M.A., Brestic, M., 2022.
mitigating drought stress. Moreover, transcription factors bZIP1 and How do plants respond to combined drought and salinity stress?—A systematic
review. Plants, 11 (21), 2884.

8
S. Shaffique et al. Plant Stress 10 (2023) 100279

Ashrafuzzaman, M., Hossen, F.A., Ismail, M.R., Hoque, A., Islam, M.Z., Shahidullah, S., Imran, M., Shazad, R., Bilal, S., Imran, Q.M., Khan, M., Kang, S.-M., Lee, I.-J., 2021b.
Meon, S., 2009. Efficiency of plant growth-promoting rhizobacteria (PGPR) for the Exogenous melatonin mediates the regulation of endogenous nitric oxide in Glycine
enhancement of rice growth. Afr. J. Biotechnol. 8 (7). max L. to reduce effects of drought stress. Environ. Exp. Bot. 188, 104511.
Ashwin, R., Bagyaraj, D.J., Mohan Raju, B., 2023. Ameliorating the drought stress Iqbal, B., Jan, M.T., Inamullah, I., Khan, A.A., Muhammad, Z., Anwar, S., Usman, A.,
tolerance of a susceptible soybean cultivar, MAUS 2 through dual inoculation with 2021. 01. Integrated management of compost type and fertilizer-N in Maize. Pure
selected rhizobia and AM fungus. Fungal Biol. Biotechnol. 10 (1), 1–19. Appl. Biol. (PAB) 4 (4), 453–457.
Azeem, M., Javed, S., Zahoor, A., 2023. Bacillus species as potential plant growth Jamil, F., Mukhtar, H., Fouillaud, M., Dufossé, L., 2022. Rhizosphere signaling: insights
promoting rhizobacteria for drought stress resilience. Russ. J. Plant Physiol. 70 (4), into plant–rhizomicrobiome interactions for sustainable agronomy. Microorganisms
59. 10 (5), 899.
Bai, X., Zhou, Y., Islam, M.A., Zhang, W., Ning, L., Ling, B., Chen, M., 2022. A soybean Jeong, S., Lim, C.W., Lee, S.C., 2020. The pepper MAP kinase CaAIMK1 positively
GmDREB3 gene contributes to drought tolerance in wheat. Food Energy Secur. 11 regulates ABA and drought stress responses. Front. Plant Sci. 11, 720.
(4), e426. Jogawat, A., Yadav, B., Lakra, N., Singh, A.K., Narayan, O.P., 2021. Crosstalk between
Basu, S., Ramegowda, V., Kumar, A., Pereira, A., 2016. Plant adaptation to drought phytohormones and secondary metabolites in the drought stress tolerance of crop
stress. F1000Res 5. plants: a review. Physiol. Plant. 172 (2), 1106–1132.
Bhandari, S., Kukreja, S., Singh, B., Kumar, V., Gautam, S., Sharma, V., Goutam, U., Kasim, W.A., Osman, M.E., Omar, M.N., El-Daim, A., Islam, A., Bejai, S., Meijer, J., 2013.
2023. Role of Beneficial Microbes in Biotic and Abiotic Stress Relationship Between Control of drought stress in wheat using plant-growth-promoting bacteria. J. Plant
Microbes and the Environment for Sustainable Ecosystem Services, Volume 3. Grow. Regul. 32 (1), 122–130.
Elsevier, pp. 243–259. Khan, A., Numan, M., Khan, A.L., Lee, I.-J., Imran, M., Asaf, S., Al-Harrasi, A, 2020a.
Bittencourt, P.P., Alves, A.F., Ferreira, M.B., da Silva Irineu, L.E.S., Pinto, V.B., Melatonin: awakening the defense mechanisms during plant oxidative stress. Plants
Olivares, F.L., 2023. Mechanisms and Applications of Bacterial Inoculants in Plant 9 (4), 407.
Drought Stress Tolerance. Microorganisms 11 (2), 502. Khan, M.A., Asaf, S., Khan, A.L., Jan, R., Kang, S.-M., Kim, K.-M., Lee, I.-J., 2020b.
Bonifer, K.S., Wen, X., Hasim, S., Phillips, E.K., Dunlap, R.N., Gann, E.R., Reynolds, T.B., Extending thermotolerance to tomato seedlings by inoculation with SA1 isolate of
2019. Bacillus pumilus B12 degrades polylactic acid and degradation is affected by Bacillus cereus and comparison with exogenous humic acid application. PLoS One 15
changing nutrient conditions. Front. Microbiol. 10, 2548. (4), e0232228.
Brossa, R., López-Carbonell, M., Jubany-Marí, T., Alegre, L., 2011. Interplay between Khan, W., Shah, S., Ullah, A., Ullah, S., Amin, F., Iqbal, B., Al-Qahtani, W.H., 2023.
abscisic acid and jasmonic acid and its role in water-oxidative stress in wild-type, Utilizing hydrothermal time models to assess the effects of temperature and osmotic
ABA-deficient, JA-deficient, and ascorbate-deficient Arabidopsis plants. J. Plant stress on maize (Zea mays L.) germination and physiological responses. BMC Plant
Grow. Regul. 30, 322–333. Biol. 23 (1), 1–14.
Chandra, P., Wunnava, A., Verma, P., Chandra, A., Sharma, R.K., 2021. Strategies to Kim, Y.-H., Khan, A.L., Waqas, M., Lee, I.-J., 2017. Silicon regulates antioxidant activities
mitigate the adverse effect of drought stress on crop plants—influences of soil of crop plants under abiotic-induced oxidative stress: a review. Front. Plant Sci. 8,
bacteria: a review. Pedosphere 31 (3), 496–509. 510.
Cotrina Cabello, G.G., Ruiz Rodriguez, A., Husnain Gondal, A., Areche, F.O., Flores, D.D. Kim, Y.-N., Khan, M.A., Kang, S.-M., Hamayun, M., Lee, I.-J., 2020. Enhancement of
C., Astete, J.A.Q., Yovera Saldarriaga, J., 2023. Plant adaptability to climate change Drought-Stress Tolerance of Brassica Oleracea var. italica L. by Newly Isolated
and drought stress for crop growth and production. CABI Rev.(2023). Variovorax sp. YNA59.
Cruz de Carvalho, M.H., 2008. Drought stress and reactive oxygen species: production, Kour, D., Yadav, A.N., 2022. Bacterial mitigation of drought stress in plants: current
scavenging and signaling. Plant. Signal. Behav. 3 (3), 156–165. perspectives and future challenges. Curr. Microbiol. 79 (9), 1–19.
Dahiya, P., Kaushik, R., Sindhu, A., 2020. An introduction to plant growth promoting Kudo, M., Kidokoro, S., Yoshida, T., Mizoi, J., Kojima, M., Takebayashi, Y., Yamaguchi-
rhizobacteria, antifungal metabolites biosynthesis using PRPR with reference to Shinozaki, K., 2019. A gene-stacking approach to overcome the trade-off between
Pseudomonas species and it’s other characteristics like antagonistic and drought stress tolerance and growth in Arabidopsis. Plant J. 97 (2), 240–256.
biocontrolling properties. Int. Res. J. Adv. Sci. Hub 2 (Special Issue ICAMET 10S), Lalay, G., Ullah, S., Ahmed, I., 2022. Physiological and biochemical responses of Brassica
95–100. napus L. to drought-induced stress by the application of biochar and Plant Growth
de Freitas, V.F., Cerezini, P., Hungria, M., Nogueira, M.A., 2022. Strategies to deal with Promoting Rhizobacteria. Microsc. Res. Tech. 85 (4), 1267–1281.
drought-stress in biological nitrogen fixation in soybean. Appl. Soil Ecol. 172, Li, G., Wang, J., Zhang, J., Li, Y., Liu, E., Yu, Y., Li, J., 2021. Effects of experimental
104352. warming and Canada goldenrod invasion on the diversity and function of the soil
Desclaux, D., Huynh, T.T., Roumet, P., 2000. Identification of soybean plant nematode community. Sustainability 13 (23), 13145.
characteristics that indicate the timing of drought stress. Crop Sci. 40 (3), 716–722. Ma, X., Huete, A., Cleverly, J., Eamus, D., Chevallier, F., Joiner, J., Meyer, W., 2016.
Dhar, N., Gopalan, N., Nikhil, P., Mohapatra, S., 2022. Role of Phytohormones in Plant- Drought rapidly diminishes the large net CO2 uptake in 2011 over semi-arid
Microbial Interaction Auxins, Cytokinins and Gibberellins Signaling in Plants. Australia. Sci. Rep. 6 (1), 1–9.
Springer, pp. 313–336. Ma, X., Xu, Z., Lang, D., Zhou, L., Zhang, W., Zhang, X., 2022. Comprehensive
Dong, C., Ma, Y., Wisniewski, M., Cheng, Z.-M., 2017. Meta-analysis of the effect of physiological, transcriptomic, and metabolomic analyses reveal the synergistic
overexpression of CBF/DREB family genes on drought stress response. Environ. Exp. mechanism of Bacillus pumilus G5 combined with silicon alleviate oxidative stress in
Bot. 142, 1–14. drought-stressed Glycyrrhiza uralensis Fisch. Front. Plant Sci. 13, 1033915.
Ekwealor, I.A., Ebele, O.A., 2003. Preliminary study of L-lysine production by Bacillus Manna, M., Thakur, T., Chirom, O., Mandlik, R., Deshmukh, R., Salvi, P., 2021.
species using various agricultural by-products. Food/Nahrung 47 (4), 226–227. Transcription factors as key molecular target to strengthen the drought stress
Farooq, M., Wahid, A., Kobayashi, N., Fujita, D., Basra, S., 2009. Plant drought stress: tolerance in plants. Physiol. Plant. 172 (2), 847–868.
effects, mechanisms and management. Sustain. Agricult. 153–188. Masood, S., Zhao, X.Q., Shen, R.F., 2020. Bacillus pumilus promotes the growth and
Geetha, K., Gunasekaran, P., 2010. Optimization of nutrient medium containing nitrogen uptake of tomato plants under nitrogen fertilization. Sci. Hortic. 272,
agricultural waste for xylanase production by Bacillus pumilus B20. Biotechnol. 109581.
Bioprocess Eng. 15, 882–889. Mohsenzadeh Golfazani, M., Taghvaei, M.M., Samizadeh Lahiji, H., Ashery, S., Raza, A.,
Gholami, A., Shahsavani, S., Nezarat, S., 2009. The effect of plant growth promoting 2022. Investigation of proteins’ interaction network and the expression pattern of
rhizobacteria (PGPR) on germination, seedling growth and yield of maize. Int. J. genes involved in the ABA biogenesis and antioxidant system under methanol spray
Agricult. Biosyst. Eng. 3 (1), 9–14. in drought-stressed rapeseed. 3 Biotech. 12 (9), 1–18.
Gilbert, S., Poulev, A., Chrisler, W., Acosta, K., Orr, G., Lebeis, S., Lam, E., 2022. Auxin- Moretti, L.G., Crusciol, C.A.C., Bossolani, J.W., Calonego, J.C., Moreira, A., Garcia, A.,
producing bacteria from duckweeds have different colonization patterns and effects Hungria, M., 2021. Beneficial microbial species and metabolites alleviate soybean
on plant morphology. Plants 11 (6), 721. oxidative damage and increase grain yield during short dry spells. Eur. J. Agron.
Gonzalez, M.B.R., Gonzalez-Lopez, J., 2013. Beneficial Plant-Microbial interactions: 127, 126293.
Ecology and Applications. CRC press. Mukherjee, A., Dwivedi, S., Bhagavatula, L., Datta, S., 2023. Integration of light and ABA
Gusain, Y.S., Singh, U., Sharma, A., 2015. Bacterial mediated amelioration of drought signaling pathways to combat drought stress in plants. Plant Cell Rep. 42 (5),
stress in drought tolerant and susceptible cultivars of rice (Oryza sativa L.). Afr. J. 829–841.
Biotechnol. 14 (9), 764–773. Nahar, K., Hasanuzzaman, M., Alam, M., Fujita, M., 2015. Glutathione-induced Drought
Huang, G.-T., Ma, S.-L., Bai, L.-P., Zhang, L., Ma, H., Jia, P., Guo, Z.-F., 2012. Signal Stress Tolerance in Mung bean: Coordinated Roles of the Antioxidant Defence and
transduction during cold, salt, and drought stresses in plants. Mol. Biol. Rep. 39, Methylglyoxal Detoxification Systems. AoB Plants, p. 7.
969–987. Natesan, S., Rajaram, S., Manoharan, D., Ramachandran, T., 2023. The Beneficial Plant
Hussain, S.S., Kayani, M.A., Amjad, M., 2011. Transcription factors as tools to engineer Microbial Association For Sustainable Agriculture Plant Microbiome For Plant
enhanced drought stress tolerance in plants. Biotechnol. Prog. 27 (2), 297–306. Productivity and Sustainable Agriculture. Springer, pp. 137–210.
Imran, M., Khan, A.L., Mun, B.-G., Bilal, S., Shaffique, S., Kwon, E.-H., Lee, I.-J., 2022. Neelin, J., Chou, C., Su, H., 2003. Tropical drought regions in global warming and El
Melatonin and nitric oxide: dual players inhibiting hazardous metal toxicity in Niño teleconnections. Geophys. Res. Lett. 30 (24).
soybean plants via molecular and antioxidant signaling cascades. Chemosphere 308, Peng, R., Li, X., Lou, J., Song, Y., Iqbal, B., Tang, Y., Yang, Z., 2023. Regulation of the Soil
136575. Microbial Metabolism Through Alterations in the Vegetative Community in
Imran, M., Latif Khan, A., Shahzad, R., Aaqil Khan, M., Bilal, S., Khan, A., Lee, I.-J., Wetlands. Polish Journal of Environmental Studies.
2021a. Exogenous melatonin induces drought stress tolerance by promoting plant Phour, M., Sindhu, S.S., 2022. Mitigating abiotic stress: microbiome engineering for
growth and antioxidant defence system of soybean plants. AoB Plant. 13 (4) plab026. improving agricultural production and environmental sustainability. Planta 256 (5),
Imran, M., Mpovo, C.L., Aaqil Khan, M., Shaffique, S., Ninson, D., Bilal, S., Yun, B.-W., 85.
2023. Synergistic effect of melatonin and lysinibacillus fusiformis L.(PLT16) to Porcel, R., Barea, J.M., Ruiz-Lozano, J.M., 2003. Antioxidant activities in mycorrhizal
mitigate drought stress via regulation of hormonal, antioxidants system, and physio- soybean plants under drought stress and their possible relationship to the process of
molecular responses in soybean plants. Int. J. Mol. Sci. 24 (10), 8489. nodule senescence. New Phytol. 157 (1), 135–143.

9
S. Shaffique et al. Plant Stress 10 (2023) 100279

Poveda, J., González-Andrés, F., 2021. Bacillus as a source of phytohormones for use in Stolf-Moreira, R., Medri, M., Neumaier, N., Lemos, N., Pimenta, J., Tobita, S., Farias, J.,
agriculture. Appl. Microbiol. Biotechnol. 1–17. 2010. Soybean physiology and gene expression during drought. Genet. Molecul. Res.
Rabbee, M.F., Hwang, B.-S., Baek, K.-H., 2023. Bacillus velezensis: a beneficial biocontrol 9 (4), 1946–1956.
agent or facultative phytopathogen for sustainable agriculture. Agronomy 13 (3), Tepe, O., Dursun, A.Y., 2014. Exo-pectinase production by Bacillus pumilus using
840. different agricultural wastes and optimizing of medium components using response
Reddy, A.R., Chaitanya, K.V., Vivekanandan, M., 2004. Drought-induced responses of surface methodology. Environm. Sci. Pollut. Res. 21, 9911–9920.
photosynthesis and antioxidant metabolism in higher plants. J. Plant Physiol. 161 Verma, G., Srivastava, D., Tiwari, P., Chakrabarty, D., 2019. ROS modulation in crop
(11), 1189–1202. plants under drought stress. Reactive Oxygen, Nitrogen and Sulfur Species in plants:
Rishad, K., Rebello, S., Shabanamol, P., Jisha, M., 2017. Biocontrol potential of Production, Metabolism, Signaling and Defense Mechanisms, pp. 311–336.
halotolerant bacterial chitinase from high yielding novel Bacillus pumilus MCB-7 Wahid, F., Sharif, M., Ali, A., Fahad, S., Adnan, M., Noor, M., Saeed, M., 2020. Plant-
autochthonous to mangrove ecosystem. Pestic. Biochem. Physiol. 137, 36–41. microbes Interactions and Functions in Changing Climate Environment, climate,
Rouphael, Y., 2022. Advances and Sustainable Practices For the Rapidly Changing Field Plant and Vegetation Growth. Springer, pp. 397–419.
of Agronomy, 12. MDPI, p. 2074. Wang, X., Zhou, X., Qu, Z., Yan, C., Ma, C., Liu, J., Dong, S., 2023. Regulation of soybean
Roy, S., Müller, L.M., 2022. A rulebook for peptide control of legume–microbe drought response by mepiquat chloride pretreatment. Front. Plant Sci. 14, 1149114.
endosymbioses. Trend. Plant. Sci. Waqar, A., Bano, A., Ajmal, M., 2022. Effects of PGPR bioinoculants, hydrogel and
Salehi-Lisar, S.Y., Bakhshayeshan-Agdam, H., 2016. Drought stress in plants: causes, biochar on growth and physiology of soybean under drought stress. Commun. Soil
consequences, and tolerance. Drought Stress Toleran. Plant. 1, 1–16. Physiology and Sci. Plant Anal. 53 (7), 826–847.
Biochemistry. Xie, Z., Chu, Y., Zhang, W., Lang, D., Zhang, X., 2019. Bacillus pumilus alleviates drought
Shaffique, S., Imran, M., Kang, S.-M., Khan, M.A., Asaf, S., Kim, W.-C., Lee, I.-J., 2023. stress and increases metabolite accumulation in Glycyrrhiza uralensis Fisch. Environ.
Seed Bio-priming of wheat with a novel bacterial strain to modulate drought stress in Exp. Bot. 158, 99–106.
Daegu, South Korea. Front. Plant Sci. 14, 1118941. XING, X.-h., FANG, C.-w., Long, L., JIANG, H.-q., Qin, Z., JIANG, H.-d., WANG, S.-h.,
Shaffique, S., Imran, M., Wani, S.H., Khan, M.A., Kang, S.-M., Adhikari, A., Lee, I.-J., 2016. Improved drought tolerance by α-naphthaleneacetic acid-induced ROS
2022a. Evaluating the adhesive potential of the newly isolated bacterial strains in accumulation in two soybean cultivars. J. Integr. Agric. 15 (8), 1770–1784.
research exploitation of plant microbial interaction. Front. Plant Sci. 13. Xu, L., Han, L., Huang, B., 2011. Antioxidant enzyme activities and gene expression
Shaffique, S., Imran, M., Wani, S.H., Khan, M.A., Kang, S.-M., Adhikari, A., Lee, I.-J., patterns in leaves of Kentucky bluegrass in response to drought and post-drought
2022b. Evaluating the adhesive potential of the newly isolated bacterial strains in recovery. J. Am. Soc. Horticult. Sci. 136 (4), 247–255.
research exploitation of plant microbial interaction. Front. Plant Sci. 13, 1004331. Xu, Z., Liu, Y., Zhang, N., Xun, W., Feng, H., Miao, Y., Zhang, R., 2023. Chemical
Shaffique, S., Khan, M.A., Imran, M., Kang, S.-M., Park, Y.-S., Wani, S.H., Lee, I.-J., communication in plant–microbe beneficial interactions: a toolbox for precise
2022c. Research progress in the field of microbial mitigation of drought stress in management of beneficial microbes. Curr. Opin. Microbiol. 72, 102269.
plants. Front. Plant Sci. 13. Yang, X., Lu, M., Wang, Y., Wang, Y., Liu, Z., Chen, S., 2021. Response mechanism of
Shaffique, S., Khan, M.A., Wani, S.H., Imran, M., Kang, S.-M., Pande, A., Lee, I.-J., 2022d. plants to drought stress. Horticulturae 7 (3), 50.
Biopriming of maize seeds with a novel bacterial strain SH-6 to enhance drought Zargar, S.M., Gupta, N., Nazir, M., Mahajan, R., Malik, F.A., Sofi, N.R., Salgotra, R., 2017.
tolerance in South Korea. Plants 11 (13), 1674. Impact of drought on photosynthesis: molecular perspective. Plant Gene 11,
Shafi, J., Tian, H., Ji, M., 2017. Bacillus species as versatile weapons for plant pathogens: 154–159.
a review. Biotechnol. Biotechnolog. Equipm. 31 (3), 446–459. Zhang, H., Zhu, J., Gong, Z., Zhu, J.-K., 2022. Abiotic stress responses in plants. Nat. Rev.
Shintu, P., Jayaram, K., 2015. Phosphate solubilising bacteria (Bacillus polymyxa)-An Genet. 23 (2), 104–119.
effective approach to mitigate drought in tomato (Lycopersicon esculentum Mill.). Zhou, Y., Li, H., Chen, H., Yang, X., Yu, T., Wang, Y., Chen, Z., 2022. Proteomic
Trop. Plant Res 2, 17–22. Investigation of Molecular Mechanisms in Response to PEG-Induced Drought Stress
Spaepen, S., Vanderleyden, J., 2011. Auxin and plant-microbe interactions. Cold Spring in Soybean Roots. Plants 11 (9), 1173.
Harb. Perspect. Biol. 3 (4), a001438.

10