High sensitivity detection of coronavirus SARS-CoV-2 using multiplex PCR and a multiplex-PCR-based

metagenomic method

Chenyu Li1#, David N. Debruyne1#, Julia Spencer1, Vidushi Kapoor1, Lily Y. Liu1, Bo Zhou2, Lucie Lee1,
Rounak Feigelman1, Grayson Burdon1, Jeffrey Liu1, Alejandra Oliva1, Adam Borcherding3, Hongdong
Tan3,4, Alexander E. Urban2, Guoying Liu1, Zhitong Liu1*

1 Paragon Genomics Inc., Hayward, CA 94545 USA

2 Department of Psychiatry and Behavioral Sciences, Department of Genetics, Stanford University, CA
94305 USA
3 MGI, BGI-Shenzhen, Shenzhen 518083 China
4
BGI-Shenzhen, Shenzhen 518083 China

# These authors contributed equally to the work.

* Corresponding author’s email: zhitong@paragongenomics.com
Abstract
Many detection methods have been used or reported for the diagnosis and/or surveillance of SARS-CoV-
2. Among them, reverse transcription polymerase chain reaction (RT-PCR) is the most sensitive, claiming
detection of about 5 copies of viruses. However, it has been reported that only 47-59% of the positive
cases were identified by RT-PCR, probably due to loss or degradation of virus RNA in the sampling process,
or even mutation of the virus genome. Therefore, developing highly sensitive methods is imperative to
ensure robust detection capabilities. With the goal of improving sensitivity and accommodate various
application settings, we developed a multiplex-PCR-based method comprised of 172 pairs of specific
primers, and demonstrated its efficiency to detect SARS-CoV-2 at low copy numbers. The assay produced
clean characteristic target peaks of defined sizes, which allowed for direct identification of positives by
electrophoresis. In addition, optional sequencing can provide further confirmation as well as phylogenetic
information of the identified virus(es) for specific strain discrimination, which will be of paramount
importance for surveillance purposes that represent a global health imperative. Finally, we also developed
in parallel a multiplex-PCR-based metagenomic method that is amenable to detect SARS-CoV-2, with the
additional benefit of its potential for uncovering mutational diversity and novel pathogens at low
sequencing depth.
Introduction
A severe epidemic coronavirus (SARS-CoV-2) infection, now just characterized as a pandemic by the World
Health Organization (WHO), started in December of 2019 in Wuhan China and quickly spread to many
countries in the world1-3. It has caused over 7,000 deaths as of mid-March and made daily impacts on
various aspects of societal life around the globe4. SARS-CoV-2 is a coronavirus with positive-sense, single-
stranded RNA about 30kb in length. The genome of SARS-CoV-2 is currently under careful investigation5-9
and being extensively modeled according to the Chinese National Center for Biological information (2019
New Coronavirus Information Database, https://bigd.big.ac.cn/ncov). Of note, SARS-CoV-2 exhibits over
99% sequence similarity among many sequenced isolates, and is also highly similar to other
coronaviruses5,9.
Present methods for detecting SARS-CoV-2 have been reported and discussed10,11, including RT-
PCR, serological testing12 and reverse transcription-loop-mediated isothermal amplification13,14. Currently,
RT-PCR is considered the gold standard of diagnosis for SARS-CoV-2 due to its ease of use and high
sensitivity. RT-PCR has been reported to detect SARS-CoV-2 in saliva15, pharyngeal swab, blood, anal
swab16, urine, stool17, and sputum specimens18. In laboratory conditions, the RT-PCR methodology has
been shown to detect 4-8 copies of virus, through amplification of targets in the Orf1ab, E and N viral
genes, at 95% confidence intervals19-21. However, only about 47-59% of the positive cases were identified
by RT-PCR, and 75% of RT-PCR negative results were actually found to be positive, with repeated tests
required17,22-24. In addition, there is evidence suggesting that heat inactivation of clinical samples causes
loss of virus particles, thereby hindering the efficiency of downstream diagnosis25.
Therefore, it is necessary to develop robust, sensitive, specific and highly quantitative methods
for the delivery of reliable diagnostic assays26,27. The urgency to develop an effective surveillance method
that can be easily used in a variety of laboratory settings is underlined by the wide and rapid spreading of
SARS-CoV-228-30. In addition, such method should also distinguish SARS-CoV-2 from other respiratory
pathogens such as influenza virus, parainfluenza virus, adenovirus, respiratory syncytial virus, rhinovirus,
human metapneumovirus, SARS coronavirus, etc., as well as mycoplasma pneumoniae, chlamydia
pneumonia and bacterial pneumonia 31-34. Furthermore, providing nucleotide sequence information
through next generation sequencing (NGS) will prove to be essential for the surveillance of SARS-CoV-2’s
evolution35-38. Indeed, SARS-CoV-2 phylogenetic studies through genome sequence analysis have provided
better understanding of the transmission origin, time and routes, which has guided policy-making and
management procedures8,36,37,39-41.
Here, we describe the development of a highly sensitive and robust detection assay incorporating
the use of multiplex PCR technology to identify SARS-CoV-2. Theoretically, the multiplex PCR strategy, by
amplifying hundreds of targets, has significantly higher sensitivity than RT-PCR and may even detect DNA
molecules resulting from degraded virus genome fragments. Multiplex PCR has been shown to be an
efficient and low-cost method to detect Plasmodium falciparum infections, with high coverage (median
99%), specificity (99.8%) and sensitivity. Moreover, this solution can be tailored to simultaneously address
multiple questions of interest within various epidemiological settings42. Similar to a recently described
metagenomic approach for SARS-CoV-2 identification43, we also establish a user-friendly multiplex-PCR-
based metagenomic method that is not only able to detect SARS-CoV-2, but could also be applied for the
identification of significant sequence mutations within known viruses and to uncover novel pathogens
with a limited sequencing depth of approximately 1 million reads.
Results

Mathematical model of RT-PCR

Several RT-PCR methods for detecting SARS-CoV-2 have been reported to date15,19-21. Among them, two
groups reported the detection of 4-5 copies of the virus19,21. To investigate the opportunity for further
improvement on the sensitivity of RT-PCR, we built a mathematical model to estimate the limit of
detection (LOD) for SARS-CoV-2. The reported RT-PCR amplicon lengths are around 78-158bp, and the
SARS-CoV-2 genome is 29,903bp (NC_045512.2). Thus, in this mathematical modeling, we chose 100bp
amplicon length and 30kb SARS-CoV-2 genome size for the estimation. With the assumption of 99% RT-
PCR efficiency20, we found that RT-PCR assays could detect 4.8 copies of SARS-CoV-2 at 95% probability
(Fig. 1A), which is consistent with the experimental results obtained in a previous report 19. In this model,
the probability of RT-PCR assays to detect one copy of SARS-CoV-2 is only 26% (Supplemental Fig. 1). This
finding may explain, at least in part, the low reported 47-56% detection rates of SARS-CoV-2 in positive
samples by RT-PCR17,22. We further found that the LOD appears to be independent of the virus genome
size. For genomes of 4 to 100kb, the detection limit remains 4.8 copies at 95% probability.
One way to elevate the sensitivity is to amplify multiple targets on the same virus genome in a
multiplex PCR reaction, thereby increasing the frequency of occurrence in the mathematical model.
Amplifying multiple targets has the advantage of potentially detecting fragments of degraded virus
genome while withstanding sequencing variations, thus allowing for the detection of upcoming mutants.
The amplification efficiency of multiplex PCR is critical for LOD. We estimated that the efficiency of our
multiplex PCR technology is about 26% by using Unique Molecular Identifier (UMI)-labeled primers to
count the amplified products after NGS sequencing (Supplemental Fig. 2 and Supplemental Table 1).
However, the amplification efficiency could be lower, and not all amplicons amplified successfully if the
template used is one single strand of cDNA. Thus, more amplicons are potentially required for multiplex
PCR to detect limited copies of viruses.

Mathematical model of multiplex-PCR-based detection method

We thus designed a panel of 172 pairs of multiplex PCR primers for the sensitive detection of SARS-CoV-2
(Fig. 1B). The average amplicon length is 99bp. The amplicons run across the entire SARS-CoV-2 genome
with a 76bp gap (76±10bp) between each amplicon. Since the observed efficiency of multiplex PCR is
about 26% in amplifying the four DNA strands of a pair of human chromosomes, we assumed an efficiency
of 6% in amplifying a single-strand of cDNA. In addition, it has already been reported that 79% of variants
are recovered when directly amplifying 600 amplicons from a single cell using our technology44. Therefore,
we assume that 80% of amplicons would be amplified successfully. Using the same mathematical model
described above, we estimated that our specific SARS-CoV-2-designed panel can detect 1.15 copies of the
virus at 95% probability (Fig. 1C). Again, the LOD is independent of virus genome size.
We also designed a second pool of 171 multiplex PCR primers. These primers overlap with those
in the previous 172-primer pool. Together, these two overlapping pools of primers deliver full coverage
of the entire virus genome. If using both pools in detection, the calculated detection limit is 0.29 copies
at 95% probability.
Figure 1. Mathematical model, primer design and workflow
(A) A mathematical model of RT-PCR based on Poisson process. The LOD is 4.8 copies of virus at 95%
probability. (B) Two overlapping pools of multiplex PCR primers, shown on the right of the genome of
SARS-CoV-2, were designed to span the entire virus genome. Pool 1, containing 172 pairs of primers,
covers 56.9% of the viral genome and was used in the detection. Pool 2 contains 171 pairs of primers and
covers 56.4% of the genome. Both pools are used to cover the full length of the genome. (C) A
mathematical model of multiplex PCR with pool 1 of the primers. The LOD is 1.15 copies of virus at 95%
probability. (D) The workflow of the multiplex PCR method. The prepared libraries can be detected using
high-resolution electrophoresis, and sequenced together with other samples using high-throughput
sequencing.
Detecting limited copies of SARS-CoV-2
The workflow was designed so that the multiplex PCR products are further amplified in a secondary PCR,
while sample indexes and NGS sequencing primers are added (Fig. 1D). The PCR products were first
analyzed by electrophoresis to identify potential positives. Since dozens of amplicons could be amplified
from a single copy of SARS-CoV-2, electrophoresis peaks with defined peak sizes were expected. Multiplex
PCR amplifies SARS-CoV-2, as well as other coronaviruses due to their high sequence similarities. In that
context, electrophoresis analysis provides a fast and sensitive indication of infection from that family of
viruses. In addition, the generated library allows for further investigation through NGS sequencing to
provide definitive identification of the specific virus family member.
Two plasmids, containing the full sequence of S and N genes of SARS-CoV-2, respectively, were
used to validate our multiplex PCR method. 28 amplicons are expected to be amplified within our 172-
amplicon panel. To simulate the use of real clinical samples, these two plasmids were spiked into the cDNA
made from human total RNA. The copy number of each plasmid was determined by droplet-based digital
PCR in QX200 from Bio-Rad®45. The two plasmids were diluted from approximately 9,000 copies to below
one copy, and were amplified in multiplex PCR reactions. The library peaks of expected sizes were
obtained from 8,900 to 2.8 copies of plasmids (Fig. 2A). Quantification of peaks demonstrated a wide
dynamic range from 1 to about 1,000 copies of plasmids (Fig. 2B). The yield of the libraries started to
saturate when the copy number was 1,700. It is possible that the saturation point could be even lower
when all of the 172 amplicons are amplified from positive clinical samples, and the library peak could be
observed with even fewer copies of virus. In contrast, the detected quantities of a single target on N gene
by RT-PCR rapidly dropped when using 2.85 copies (Fig. 2B and Supplemental Fig. 3).
Estimated from the aforementioned mathematical model, 28 amplicons have a 16% chance to
detect one single copy. To test this hypothesis, we amplified about one copy of plasmid in multiplex PCR
reactions. The theoretical calculation gives a 66% probability to sample 1.1 copies, and a 12% chance to
detect them based on a multiplex PCR efficiency of 6%. In reality, we experimentally observed a
significantly higher 56% probability to detect 1.1 copies (Fig. 2C). These results suggest that the efficiency
of multiplex PCR is actually higher than the previously estimated 6% when single-stranded cDNA was
amplified.
When the amplified products were sequenced, we found that the recovered reads were within a
range of about 20-fold relative depth with about 1.4 to 2.8 plasmids, and uniformly distributed across the
GC range (Fig. 2D). When detecting down to 1.4 copies of plasmids, only the reads of one amplicon were
about 100-fold lower than the average. Approximately 96% of the amplicons were recovered with 14
copies of plasmids, 77% with 2.8 copies, and 37% with 0.6 copies (Fig. 2E).
Figure 2. Detection of SARS-CoV-2 gene-containing plasmids by electrophoresis and sequencing
(A) Two plasmids, containing S and N genes of SARS-CoV-2, respectively, were diluted in human cDNA and
amplified in multiplex PCR with pool 1 (172 pairs of primers). The number of plasmid copies per reaction,
determined by ddPCR, were from 8,900 to 0.6. The resulting products obtained after multiplex PCR were
resolved by electrophoresis. The specific amplification products (the library) can still be seen with 2.8
copies of plasmids. (B) The library yields can be detected down to 0.6 copies of plasmids (n=4) by multiplex
PCR (black line), while only down to 2.8 copies can still be detected by RT-PCR (> 4.5-fold difference) (red
line). (C) Poisson process was used to estimate the chance of sampling around 1 copy of viral particles,
and the mathematical model was used to estimate the chance of detecting them (red line). There is 12%
of probability to detect 1.1 copies with a multiplex PCR efficiency of 6%. In reality, we observed a
significantly higher 56% probability for 1.1 copies and 100% probability for 1.4 copies. (D) After sequencing
1.4 to 2.8 copies of plasmids, the reads of all 28 amplicons spanning both N and S genes were clustered
within a 20-fold range of coverage (n=3). With 1.4 copies, only the reads of one amplicon were about 100-
fold lower than the average (n=3). (E) About 96% of amplicons were recovered with 14 copies of plasmids,
77% with 2.8 copies, and 37% with 0.6 copies (n=3).
Metagenomic method design for novel pathogens
In order to discover highly mutated viruses and unknown pathogens, we subsequently developed a user-
friendly multiplex-PCR-based metagenomic method. In this method, random hexamer-adapters were
used to amplify DNA or cDNA targets in a multiplex PCR reaction. The large amounts of non-specific
amplification products were removed by using Paragon Genomics’ proprietary background removing
reagent, thus resolving a library suitable for sequencing. For RNA samples, our reverse transcription
reagents were additionally used to convert RNA into cDNA, resulting in significantly reduced amount of
human ribosomal RNA species.
We sequenced a library made with 4,500 copies of N and S gene-containing plasmids spiked into
10 ng of human gDNA, which roughly represents 3,300 haploid genomes. Even though the molar ratios of
viral targets and human haploid genomes were comparable, N and S genes which encompass about 4kb
of targets, were a negligible fraction of the 3 billion base pairs of a human genome. If every region of the
human genome were amplified and sequenced at 0.6 million reads per sample, only one read of viral
target would be recovered. In fact, our results showed that 16% of the recovered bases, or 13% of the
recovered reads, were within the viral N and S genes (Fig. 3A and Supplemental Table 2). 80% and 78%
of SARS-CoV-2 and mitochondrial targets were covered, respectively (Fig. 3B), and the base coverage was
significantly higher than human targets (Fig. 3C). In contrast, only 0.08% of regions in human
chromosomes were amplified. Furthermore, the human exonic regions were preferentially amplified (Fig.
3D). This suggested that the random hexamers deselected a large portion of the human genome, while
favorably amplifying regions that were more “random” in base composition. Indeed, long gaps and
absence of coverage in very large repetitive regions were observed in human chromosomes (Fig. 3E). On
the contrary, the gaps in SARS-CoV-2 and mitochondrial regions were significantly shorter (Fig. 3F),
whereas the amplified targets overlapped and were longer than human targets (Fig. 3G).
The coverage was from 1000- to 10,000-fold for S and N genes, and 30- to 500-fold for the
mitochondrial chromosome (Fig. 3F). The coverage is roughly within a 10-fold range, as is observed in
human chromosomes (Fig. 3E). Therefore, increasing sequencing depth might not significantly improve
the coverage. This 10-fold difference in coverage has been routinely observed with our multiplex PCR
technology (Supplemental Table 3 and Supplemental Fig. 4). We were able to detect 80% of the regions
in S and N genes in libraries generated using 4,500 copies of plasmids, with an average base coverage of
5,000 for a total sequencing depth of 0.6 million reads. A few targets of 150 to 200 bp in length in S and
N genes were preferentially amplified. Even when copy number went down to a few copies (3-14), these
targets were still detected (Fig.4). They represented 14% and 11% of the target regions when 14 and 2.8
copies of plasmids were amplified, respectively.
Figure 3. Multiplex PCR-based metagenomic method for the detection of SARS-CoV-2 genes
(A) Random hexamer-adapters were used in multiplex PCR to amplify 4,500 copies of plasmids in the
background of 3,300 haploid human gDNA molecules. The resulting libraries were sequenced at an
average of 0.6 million total reads. Of the total bases recovered, 16% were on SARS-CoV-2 S and N genes.
(B) 80% of S and N genes, and 78% of the human mitochondrial chromosome were amplified with >= 1X
coverage, while only 0.08% of the human chromosomes were. (C) On average, S and N genes were covered
at 2,346X, mitochondria at 77X, and human chromosomes at 20X. (D) Human exons were relatively over-
amplified about 4-fold higher compared to their actual ratio within the genome. (E) Gaps and long regions
of absence of amplification were observed for human chromosomes. An example shown here is
chromosome Y. Small gaps were additionally found in the enlarged cluster of amplification. The long
absent region (red double arrow) overlapped with the repetitive regions on Y chromosome. (F)
Representation of the recovered regions in S and N genes and the human mitochondrial chromosome.
The coverage was from 1,000- to 10,000-fold for S and N genes, and 30- to 500-fold for the mitochondrial
chromosome. (G) The length of the majority of chromosomal amplification products are clustered around
100bp, while the amplified regions for the S and N genes, as well as the mitochondrial chromosome, were
significantly longer.
Figure 4. Metagenomic method for the detection of limited copies of SARS-CoV-2 genes
Even when low number of plasmids were used (3 to 14 copies), several targets of 150 to 200 bp in S and
N genes were still detected at a total sequencing depth of about 1 million reads. These targets represented
19%, 14%, and 11% of S and N genes when 71, 14 and 2.8 copies of plasmids were used, respectively.
Discussion
Tremendous efforts have been made from around the world to provide a fast and reliable diagnostic
method for SARS-CoV-2. RT-PCR is currently the preferential and most frequently used detection strategy.
Yet, we found that the LOD for RT-PCR sits at around 5 copies with 95% confidence, independent of the
size of the target genome. Consequently, to overcome the instability of RNA and the genomic sequence
variability of virus genome due to evolution, more sensitive and robust methods are required.
Here, we report the development of a multiplex PCR assay for high-sensitivity identification of
SARS-CoV-2 infection. With 172 pairs of primers, this method enables the detection of low copy numbers,
potentially degraded fragments of the viral genome, or even a mutated variant, with high confidence. The
172 pairs of primers cover about 56% of the genome of SARS-CoV-2. When detecting limited copies of
virus, fewer targets are successfully amplified. In the case of one copy of virus, we estimate that 20% of
the viral genome, or 6kb of sequences, could be amplified. These are sufficient to produce a conspicuous
peak in electrophoresis for an initial indication of positives. The use of NGS sequencing can provide nucleic
acid-level information to further confirm the identification, and provide additional evidence for
phylogenetic analysis. In addition, our method is robust, accurate and easily performed from different
levels of expertise in various laboratory settings.
Furthermore, we also propose a metagenomic method for the potential identification of unknown
pathogens. Metagenomic technology usually requires about 20 to 100 million of sequencing reads in order
to detect minuscule numbers of targets embedded in the massive amounts of human background.
However, our method appears to selectively amplify target sequences. This bias permits the obtention of
around 16% of target bases by sequencing at a depth of about 1 million total reads. It is thus especially
suitable for the detection of novel pathogens and highly genetically unstable pathogens, such as influenza
viruses. The exact mechanism of deselecting human sequences is currently under investigation. The
random hexamer preference, chromosomal structure, sequence composition, target length, circularity,
methylation status, telomeric and centromeric regions, as well as the edge effect, may influence such
outcome. Ultimately, the observed preferential amplification towards more “random” sequences could
provide us with an advantageous edge for the continuous improvement of this method.
Materials and Methods
Sample preparation
The Universal Human Reference RNA was from Agilent Technologies, Inc. (Cat#74000). The plasmids
containing either S or N gene of SARS-CoV-2 (pUC-S and pUC-N, respectively) were purchased from Sangon
Biotech, Shanghai, China. The PCR primers used in ddPCR and RT-PCR reactions for S gene are 5’-
TGTACTTGGACAATCAAAAAGAGTTGAT and 5’-AGGAGCAGTTGTGAAGTTCTTTTC; for N gene are 5’-
GGGGAACTTCTCCTGCTAGAAT and 5’-CAGACATTTTGCTCTCAAGCTG, respectively. 343 pairs of multiplex
PCR primers covering the entire genome of SARS-CoV-2 (the panel) were designed by Paragon Genomics,
Inc. and separated into two pools. Pool 1, containing 172 pairs of primers, was used in the detection of
SARS-CoV-2 by multiplex PCR.

Reverse transcription
50ng of Universal Human Reference RNA was converted into cDNA using random primers and
SuperScript™ IV Reverse Transcriptase by following the supplier recommended method (Thermo Fisher
Scientific, Cat# 18090050). After reverse transcription, cDNA was purified with 2.4X volume of magnetic
beads, and washed twice with 70% ethanol. Finally, the purified cDNA was dissolved in 1X TE buffer and
used per multiplex PCR reaction.

Multiplex PCR panel design

Panel design is based on the SARS-CoV-2 sequence NC_045512.2
(https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2/). In total, 343 primer pairs, distributed into two
pools, were selected by a proprietary panel design pipeline to cover the whole genome except for 92
bases at its ends. Primers were optimized to preferentially amplify the SARS-CoV-2 cDNA versus
background human cDNA or genomic DNA. They were also optimized to uniformly amplify the covered
genome.

Multiplex PCR
Plasmids pUC-S and pUC-N were combined with human cDNA and used in each multiplex PCR reaction.
Paragon Genomics’ CleanPlex® multiplex PCR reagents and protocol were used. Briefly, a 10µl multiplex
PCR reaction was made by combining 5X mPCR mix, 10X Pool 1 of the panel, plasmid pUC-S, pUC-N and
cDNA. The reaction was run in a thermal cycler (95°C for 10min, then 98°C for 15sec, 60°C for 5min for 10
cycles), then terminated by the addition of 2µl of stop buffer. The reaction was then purified by 29µl of
magnetic beads, followed by a secondary PCR with a pair of primers for 25 cycles. The secondary PCR
added sample indexes and sequencing adapters, allowing for sequencing of the resulting products by high
throughput sequencing. A final bead purification was performed after the secondary PCR, followed by
library interrogation using a Bioanalyzer 2100 instrument with Agilent High Sensitivity DNA Kit (Agilent
Technologies, Inc. Part# 5067-4626).

RT-PCR
Plasmids pUC-S and pUC-N, in combination with human cDNA, were used in each reaction. Paragon
Genomics’ CleanPlex® secondary PCR mix was used with 100nM of each PCR primers in 10ul reactions.
The PCR thermal cycling protocol used was 95°C for 10min, then 98°C for 15sec, 60°C for 30sec for 45
cycles.

Multiplex-PCR-based metagenomic method

Paragon Genomics’ CleanPlex® metagenomic reagents and protocol were used. Briefly, a 10µl multiplex
PCR reaction was made by combining 5X mPCR mix, 10X random hexamer-adapters and the template DNA.
The PCR thermal cycling protocol used was 95°C for 10min, then 98°C for 15sec, 25°C for 2min, 60°C for
5min for 10 cycles. The reaction was then terminated by the addition of 2µl of stop buffer, and purified
by 29µl of magnetic beads. The resulting solution was treated with 2µl of CleanPlex® reagent at 37°C for
10min to remove non-specific amplification products. After a magnetic bead purification, the product was
further amplified in a secondary PCR with a pair of primers for 25 cycles to produce the metagenomic
library. This metagenomic library was further purified by magnetic beads before sequencing.

ddPCR
ddPCR was performed on QX200 from Bio-Rad®. Plasmids pUC-S and pUC-N at the estimated copy
numbers 1 (6 repeats), 2 (3 repeats), and 100 (3 repeats) were tested. In each reaction, the ddPCR thermal
cycling protocol used was 95°C for 5min, then 95°C for 30sec, 60°C for 1min with 60 cycles, 4°C for 5min
and 90°C for 5min, 4°C hold. The resulting data was analyzed by following the supplier recommended
method.

High throughput sequencing and data analysis

High throughput sequencing was performed using Illumina® iSeq™ 100 and MiSeq™ Sequencing Systems
and MGI sequencers (DNBSEQ-G400 and its research-grade CoolMPS™ sequencing kits). The resulting
data was analyzed by Paragon Genomics’ Bioinformatics team with proprietary pipelines and algorithms.
References
1. Li, Q., et al., Early Transmission Dynamics in Wuhan, China, of Novel Coronavirus-Infected
Pneumonia. N Engl J Med, 2020.
2. Zhou, P., et al., A pneumonia outbreak associated with a new coronavirus of probable bat origin.
Nature, 2020.
3. [An update on the epidemiological characteristics of novel coronavirus pneumoniaCOVID-19].
Zhonghua Liu Xing Bing Xue Za Zhi, 2020. 41(2): p. 139-144.
4. Ayittey, F.K., et al., Economic Impacts of Wuhan 2019-nCoV on China and the World. J Med Virol,
2020.
5. Wu, A., et al., Genome Composition and Divergence of the Novel Coronavirus (2019-nCoV)
Originating in China. Cell Host Microbe, 2020.
6. Zhu, N., et al., A Novel Coronavirus from Patients with Pneumonia in China, 2019. N Engl J Med,
2020.
7. Paraskevis, D., et al., Full-genome evolutionary analysis of the novel corona virus (2019-nCoV)
rejects the hypothesis of emergence as a result of a recent recombination event. Infect Genet
Evol, 2020. 79: p. 104212.
8. Lu, R., et al., Genomic characterisation and epidemiology of 2019 novel coronavirus: implications
for virus origins and receptor binding. Lancet, 2020.
9. Ceraolo, C. and F.M. Giorgi, Genomic variance of the 2019-nCoV coronavirus. J Med Virol, 2020.
10. Yu, F., et al., Measures for diagnosing and treating infections by a novel coronavirus responsible
for a pneumonia outbreak originating in Wuhan, China. Microbes Infect, 2020.
11. Zhang, N., et al., Recent advances in the detection of respiratory virus infection in humans. J Med
Virol, 2020.
12. Zhang, W., et al., Molecular and serological investigation of 2019-nCoV infected patients:
implication of multiple shedding routes. Emerg Microbes Infect, 2020. 9(1): p. 386-389.
13. Lamb, L.E., et al., Rapid Detection of Novel Coronavirus (COVID-19) by Reverse Transcription-
Loop-Mediated Isothermal Amplification. medRxiv, 2020: p. 2020.02.19.20025155.
14. Yu, L., et al., Rapid colorimetric detection of COVID-19 coronavirus using a reverse tran-
scriptional loop-mediated isothermal amplification (RT-LAMP) diagnostic plat-form: iLACO.
medRxiv, 2020: p. 2020.02.20.20025874.
15. To, K.K., et al., Consistent detection of 2019 novel coronavirus in saliva. Clin Infect Dis, 2020.
16. Chen, W., et al., Detectable 2019-nCoV viral RNA in blood is a strong indicator for the further
clinical severity. Emerg Microbes Infect, 2020. 9(1): p. 469-473.
17. Xie, C., et al., Comparison of different samples for 2019 novel coronavirus detection by nucleic
acid amplification tests. Int J Infect Dis, 2020.
18. Lin, C., et al., Comparison of throat swabs and sputum specimens for viral nucleic acid detection
in 52 cases of novel coronavirus (SARS-Cov-2) infected pneumonia (COVID-19). medRxiv, 2020: p.
2020.02.21.20026187.
19. Corman, V.M., et al., Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Euro
Surveill, 2020. 25(3).
20. Chu, D.K.W., et al., Molecular Diagnosis of a Novel Coronavirus (2019-nCoV) Causing an
Outbreak of Pneumonia. Clin Chem, 2020.
21. Shirato, K., et al., Development of Genetic Diagnostic Methods for Novel Coronavirus 2019
(nCoV-2019) in Japan. Jpn J Infect Dis, 2020.
22. Ai, T., et al., Correlation of Chest CT and RT-PCR Testing in Coronavirus Disease 2019 (COVID-19)
in China: A Report of 1014 Cases. Radiology, 2020: p. 200642.
23. Xie, X., et al., Chest CT for Typical 2019-nCoV Pneumonia: Relationship to Negative RT-PCR
Testing. Radiology, 2020: p. 200343.
24. Li, Y.Y., et al., [Comparison of the clinical characteristics between RNA positive and negative
patients clinically diagnosed with 2019 novel coronavirus pneumonia]. Zhonghua Jie He He Hu Xi
Za Zhi, 2020. 43(0): p. E023.
25. Zhang, Y., et al., 病毒核酸提取前的高温灭活过程显著降低可检出病毒核酸模板量.
chinaXiv:202002.00034v1.
26. Dennis Lo, Y.M. and R.W.K. Chiu, Racing towards the development of diagnostics for a novel
coronavirus (2019-nCoV). Clin Chem, 2020.
27. Liu, Y., et al., Clinical and biochemical indexes from 2019-nCoV infected patients linked to viral
loads and lung injury. Sci China Life Sci, 2020.
28. Bernard Stoecklin, S., et al., First cases of coronavirus disease 2019 (COVID-19) in France:
surveillance, investigations and control measures, January 2020. Euro Surveill, 2020. 25(6).
29. Thompson, R.N., Novel Coronavirus Outbreak in Wuhan, China, 2020: Intense Surveillance Is Vital
for Preventing Sustained Transmission in New Locations. J Clin Med, 2020. 9(2).
30. Reusken, C., et al., Laboratory readiness and response for novel coronavirus (2019-nCoV) in
expert laboratories in 30 EU/EEA countries, January 2020. Euro Surveill, 2020.
31. Lin, L. and T.S. Li, [Interpretation of "Guidelines for the Diagnosis and Treatment of Novel
Coronavirus (2019-nCoV) Infection by the National Health Commission (Trial Version 5)"].
Zhonghua Yi Xue Za Zhi, 2020. 100(0): p. E001.
32. [Diagnosis and clinical management of 2019 novel coronavirus infection: an operational
recommendation of Peking Union Medical College Hospital (V2.0)]. Zhonghua Nei Ke Za Zhi,
2020. 59(3): p. 186-188.
33. Cleemput, S., et al., Genome Detective Coronavirus Typing Tool for rapid identification and
characterization of novel coronavirus genomes. Bioinformatics, 2020.
34. Shen, K., et al., Diagnosis, treatment, and prevention of 2019 novel coronavirus infection in
children: experts' consensus statement. World J Pediatr, 2020.
35. Malik, Y.S., et al., Emerging novel Coronavirus (2019-nCoV) - Current scenario, evolutionary
perspective based on genome analysis and recent developments. Vet Q, 2020: p. 1-12.
36. Li, X., et al., Potential of large 'first generation' human-to-human transmission of 2019-nCoV. J
Med Virol, 2020.
37. Li, X., et al., Transmission dynamics and evolutionary history of 2019-nCoV. J Med Virol, 2020.
38. Ji, W., et al., Homologous recombination within the spike glycoprotein of the newly identified
coronavirus may boost cross-species transmission from snake to human. J Med Virol, 2020.
39. Benvenuto, D., et al., The 2019-new coronavirus epidemic: Evidence for virus evolution. J Med
Virol, 2020.
40. Benvenuto, D., et al., The global spread of 2019-nCoV: a molecular evolutionary analysis. Pathog
Glob Health, 2020: p. 1-4.
41. Giovanetti, M., et al., The first two cases of 2019-nCoV in Italy: Where they come from? J Med
Virol, 2020.
42. Tessema, S.K., et al., Sensitive, highly multiplexed sequencing of microhaplotypes from the
<em>Plasmodium falciparum</em> heterozygome. bioRxiv, 2020: p.
2020.02.25.964536.
43. Chen, L., et al., RNA based mNGS approach identifies a novel human coronavirus from two
individual pneumonia cases in 2019 Wuhan outbreak. Emerg Microbes Infect, 2020. 9(1): p. 313-
319.
44. Ericson, N.,et al., Amplicon-Based Targeted Sequencing of Single Circulating Tumor Cells, Journal
of Molecular Diagnostics, AMP Abstract, 1168
45. Dong, L., et al., Comparison of four digital PCR platforms for accurate quantification of DNA copy
number of a certified plasmid DNA reference material. Scientific Reports, 2015. 5(1): p. 13174.
Acknowledgements
The authors would like to thank Jian Xu of MGI, BGI-Shenzhen for technical support in MGI sequencing,
Dr. Jin Billy Li of Stanford University for the coordination of academic support, Dr. Alexander E. Urban of
Stanford University for suggestions in preparing the manuscript, and Dr. Zihuai He of Stanford University
for discussion on a potential mathematical model of the metagenomic method.

Author contributions
C.L., D.N.D., Z.L. conceived the study and drafted the manuscript. C.L., D.N.D., J.S., V.K., L.Y.L., L.L., R.F.,
G.B., J.L., A.O., G.L., Z.L. performed experiments, analysis and revised the manuscript. B.Z., A.E.U.
performed ddPCR experiments and analysis. A.B., H.T. performed MGI sequencing and analysis.

Conflict of Interest
The authors declare no competing interests.

Additional files

Supplemental Fig 1. A mathematical model of RT-PCR.

Supplemental Fig 2. Multiplex PCR efficiency as determined by using CleanPlex® UMI technology by
Paragon Genomics.

Supplemental Fig 3. Comparison of LOD between multiplex PCR and regular PCR.

Supplemental Fig 4. Performance statistics of the amplicons retrieved from multiplex PCR method
highlighting a 10-fold range read depth.

Supplemental Table 1. Multiplex PCR efficiency as determined by using CleanPlex® UMI technology by
Paragon Genomics.
Supplemental Table 2. Sequencing results of the multiplex PCR-based metagenomic method using 4,500
copies of plasmids containing S and N genes of SARS-CoV-2, spiked in 10ng of human gDNA.

Supplemental Table 3. Performance statistics of the amplicons retrieved from our multiplex PCR method
highlighting a 10-fold range read depth.
Supplementary Information

Supplemental Fig 1. A mathematical model of RT-PCR.

The same model was used to estimate the LOD of both RT-PCR and multiplex PCR, through changing the
amplicon length and number, the virus genome size, as well as the intended detected copies and PCR
efficiency. We found that the probability of detecting 1 copy of SARS-CoV-2 is 26% by using RT-PCR, and
the LOD is independent of the length of virus genome.
Supplemental Fig 2. Multiplex PCR efficiency as determined by using CleanPlex® UMI technology by
Paragon Genomics.
A. The underlying mechanism of CleanPlex® UMI technology by Paragon Genomics, which uses three
cycles of multiplex PCR to label targets with UMI. The redundant UMIs generated in the third cycle of PCR
are destroyed by removing the single-stranded regions by nuclease digestion. The resulting products are
further amplified by using a pair of universal primers, while sample indexes and sequencing adapters are
introduced. B. The UMIs are initially sorted based on the UMI itself, and further on the occurrence of
identical UMIs on either the 5′ or 3′ end of amplicons after sequencing, thus allowing the identification of
the original template. The position of identical UMIs on either the 5′ or 3′ end of amplicons can further
indicate whether the final amplification products are from the pool of the sense or antisense strand of the
original templates.
Supplemental Fig 3. Comparison of LOD between multiplex PCR and regular PCR.
A total of 35 cycles was used in multiplex PCR, while 45 cycles was used for regular PCR. The resulting
amplification products from multiplex PCR were processed as described in the Materials and Methods.
The PCR products were directly resolved using high sensitivity DNA chips on a Bioanalyzer 2100 instrument.
X-axis indicates fragment size (bp) and y-axis indicates fluorescence units. The arrows point to the
expected specific amplification products. The number of copies is indicated on the left.
Supplemental Fig 4. Performance statistics of the amplicons retrieved from multiplex PCR method
highlighting a 10-fold range read depth.
The number of sequencing reads for a majority of the recovered amplicons (Supplemental Table 2) were
within a 10-fold range, representing a uniformity of 92.62 ± 1.96% at 0.2X mean (red line).
Supplemental Table 1. Multiplex PCR efficiency as determined by using CleanPlex® UMI technology by
Paragon Genomics.
A 53-amplicon panel was amplified with 20 to 80 ng of gDNA (NA12878) by using CleanPlex® UMI
technology by Paragon Genomics, the mechanism of which is depicted in Supplemental Fig 2. The
efficiency of multiplex PCR was found to be 26%, calculated from the recovered numbers of UMI clusters
that contained >= 3 members (UMI (>=3)).
Supplemental Table 2. Sequencing results of the multiplex PCR-based metagenomic method using
4,500 copies of plasmids containing S and N genes of SARS-CoV-2, spiked in 10ng of human gDNA.
Supplemental Table 3. Performance statistics of the amplicons retrieved from our multiplex PCR
method highlighting a 10-fold range of read depth.
To simulate multiplex PCR with random hexamers as primers, we used a panel of 27,296 pairs of primers
to perform multiplex PCR. These primers were divided into 2 overlapping primer pools, and amplification
was initially performed in two separate reactions. The number of sequencing reads for a majority of the
recovered amplicons were within a 10-fold range, representing a uniformity of 92.62 ± 1.96% at 0.2X mean.