Biology G11

LO 6

Under observation of
MS. Zainab Amer
 Great thanks for
Questions & their Reviewers Tasks supervisors

Mariam Waleed Mohamed Ragab Salma Ashraf (Founder)

Haneen Ahmed Ghada Mohamed Youssef Adly (Co-Founder)

Fatma Alzhraa Jowairiah Kareem Abd-Elhamid Ali (Head HR)

Yasmin Mohamed Mohamed Reda Habiba Ahmed (Vice Head HR)

Mina Sameh Rawan Mohamed Bavly Romany (HR)

MS. Zainab Amer

Collector of the task

Designer
Mariam Waleed
Youssef Adly
Quiz 1
Which one of the following diseases can be inherited?

A. Cystic Fibrosis
B. Salmonella
C. E-coli
D. Pneumonia
Answer A
Quiz 2
If two genes are found to have a recombination frequency of 25%, what does
this mean about the location of the two genes?

A.The genes are linked

B.The genes are located on the same chromosome and are on opposite ends of
the chromosome
C.The genes are located on the same chromosome and neither extremely close,
nor extremely far apart
D.The genes are on different chromosomes
Answer D
Quiz 3
3- Commonly, __________ of histones leads to the silencing of genes.

A.methylation
B.acetylation
C.phosphorylation
D.all of these
Answer A
Quiz 4
4-Researchers are studying a disease that causes neurological deficits in humans.
They have identified the disorder as autosomal dominant, but notice that about 20%
of people with the dominant disease allele do not express any of the associated
neurological impairment. What genetics term explains this phenomenon?
A. Sex-linked interitance
B. Reduced penetrance
C. Degeneracy of the genetic code
D. Variable expressivity
Answer B
Quiz 5
5-Consider a plant with the following characteristics.
Round leaves (R) are dominant to pointed leaves (r).
White flowers (W) are dominant to pink flowers (w)
Plants heterozygous for both traits are crossed.
What is the probability of obtaining a plant with pointed leaves and white flowers?

A.3/16
B.1/16
C.¼
D.5/16
Answer A
Quiz 6
6- In order to amplify the following DNA sequence using PCR, what is an acceptable
pair of oligonucleotide primers? (only the sense strand is shown)
ATGATCAGGCTAAATGCTAGTTTACCGGATGAGCAATGACGCGTACCATATAGGCAT
ATCCGATGCCATGATGGCCTACGGATCA

A. Forward: 5' ATGATCAGGCTAAATGCTA 3'

Reverse: 5' ACTAGGCATCCGGTAGTACC 3'
B. Forward: 5' ATGATCAGGCTAAATGCTA 3'
Reverse: 5' TGATCCGTAGGCCATCATGG 3'
C. Forward: 5' ATGATCAGGCTAAATGCTA 3'
Reverse: 5' CCATGATGGCCTACGGATCA 3'
D. Forward: 5' ATGATCAGG 3'
Reverse: 5' TGATCCGTA 3'
Answer B
Quiz 7
7- A young girl is diagnosed with Duchenne Muscular Dystrophy, and her
mother is pregnant with a baby boy. Which of the following must be true?

A. Her brother will have the disease

B. Her mother had the disease
C. Her father's father had the disease
D. Her father's mother was a carrier
E. Her father had the disease
Answer E
A.

Quiz 8
B.E.
C.
F.

8- Eye color in a certain species is decided by a single gene locus. Only two alleles
influence eye color in a population of this species that exists in Hardy-Weinberg
equilibrium. The dominant allele codes for brown eyes, while the recessive allele codes
for blue eyes.
If the frequency of the brown allele is 0.7, what percent of the population is heterozygous at
this locus?

A)phenotype
B)genotype
C)chromosome
D)allele
Answer A
Quiz 9
9- .Two populations of the same species over time grow distant from one another. At
what point will these two populations be considered different species?

A. When there is a physical barrier, such as a river, between the two populations
B. When they are no longer able to interbreed
C. When the populations begin to eat different foods
D. When the distance between them exceeds the carrying capacity
Answer B
Quiz 10
10- Rett syndrome is a sex-linked dominant disease found on the X-chromosome. If the
offspring of a certain cross have a 50% chance of receiving the disease, regardless of
gender, which of the following statements is true?

A. The father has the disease

B. The mother does not have the disease
C. The mother is homozygous for the disease
D. The mother is heterozygous for the disease
Answer D
Quiz 11
11- . A genetic disorder affects three generations of males in a family, but rarely affects
the females. What is one possible cause of this observation?

A. The mutation is autosomal recessive

B. The mutation is dominant and occurs on the X chromosome
C. The mutation is recessive and occurs on the X chromosome
D. The mutation is autosomal dominant
Answer C
Quiz 12
12- In a population of deer mice, the allele for white hair is recessive and the allele for brown hair
is dominant. If the population consists of 500 individuals and the frequency of homozygous brown
mice is 49%, what is the frequency of the recessive allele?
Assume the population is in Hardy-Weinberg equilibrium.

A. 0.51
B. 0.49
C. 0.30
D. 0.70
Answer C
Quiz 13
13. Which of the following represents a frameshift mutation to the given template
strand?
5'-AGCCTTAGC-3'

A. 5'-AGCGCTTAGC-3'
B. 5'-AGCCTTAGC-3'
C. 5'-TTTAGCCTTAGC-3'
D. 5'-TGCCTTAGC-3'
Answer A
Quiz 14
14- In a population of deer mice, the allele for white hair is recessive and the allele for
brown hair is dominant. If the population consists of 500 individuals and the
frequency of homozygous brown mice is 49%, what is the frequency of the recessive
allele? Assume the population is in Hardy-Weinberg equilibrium.

A. 0.30
B. 0.51
C. 0.49
D. 0.70
Answer A
Quiz 15
15- In a certain species of bird, yellow beaks are dominant to orange beaks, and blue
feathers are dominant to black feathers.
Two heterozygous birds are crossed. What fraction of the offspring would be expected
to have yellow beaks and blue feathers?

A. 9/16
B. 1/16
C. 1/4
D. 3/16
Answer A
Quiz 16
16- Which of the following describes a single genetic locus that controls
more than one trait?

A. Pleiotropic
B. Somatic
C. Polygenic
D. Epistatic
Answer A
Quiz 17
17- A scientist performs a series of experiments to determine the
recombination frequencies between the following genes. He acquires the
following data:
W-X: 3
X-Y: 2%
Y-Z: 13%
Z-W: 8%
Which of the following choices places the genes in the correct order relative
to one another?

A.W, X, Y, Z
B.X, W, Z, Y
C.Z, W, X, Y
D.Y, W, Z, X
Answer C
Quiz 18
18- Consider two traits in pea plants that exhibit complete dominance. Smooth peas
are dominant to wrinkled peas, and purple flowers are dominant to white flowers.
A pure breeding plant with purple flowers and wrinkled peas is crossed with a pure
breeding plant with white flowers and smooth peas. The first generation is self-
pollinated to produce the second generation.
What fraction of the second generation will be heterozygous for both traits?

A.9/16
B.½
C.¼
D.3/16
Answer C
Quiz 19
19- Red-green colorblindness is an X-linked recessive disorder. Which of the following
scenarios is not a possible method by which this disorder can be inherited?

A. A carrier mother and a normal father have a son who is colorblind.

B. A colorblind mother and normal father have a daughter who Is a carrier for the
condition.
C. A genotypically normal mother and a colorblind father have a son who is also
colorblind.
D. A carrier mother and a colorblind father have a daughter who is colorblind.
Answer C
A.

Quiz 20

20- Consider the pedigree. What is the probability of individual 22 being affected

A) 0%
B.25%
C. 50%
D. 100%
Answer D
Quiz 21

21- G1 is associated with which of the following cellular events?

A) normal growth and cell function

B) DNA replication
C) the beginning of mitosis
D) break down of the nuclear membrane
Answer A
Quiz 22
22- What is the name of the microtubule-organizing center found in animal cells as an
identifiable structure present during all phases of the cell cycle?

A) centriole
B) centrosome
C) centromere
D) kinetochore
Answer b
Quiz 23

23- In the cells of many eukaryotic species, the nuclear envelope has to disappear to

permit which of the following events in the cell cycle?

A) DNA synthesis
B) attachment of microtubules to kinetochores
C) separation of the centrosomes
D) condensation of the chromosomes
Answer B
Quiz 24

24- The mitotic spindle plays a critical role in which of the following
processes?

A) splitting of the cell (cytokinesis) following mitosis

B) triggering the compaction and condensation of chromosomes
C) dissolving the nuclear membrane
D) separation of sister chromatids
Answer D
Quiz 25

Metaphase is characterized by ________.

A) alignment of chromosomes on the equator of the cell

B) separation of the centromeres
C) cytokinesis
D) separation of sister chromatids
Answer A
Quiz 26

26- In what way do kinetochore microtubules facilitate the process of

splitting the centromeres?

A) They use motor proteins to hydrolyze the centromere at specific arginine

residues.
B) They create tension by pulling toward opposite poles.
C) They slide past each other like actin microfilaments.
D) They phosphorylate the centromere, thereby changing its conformation.
Answer B
Quiz 27
27- Certain cell types normally have several nuclei per cell. How could
such multinucleated cells be explained?

A) The cell underwent repeated cytokinesis but no mitosis.

B) The cell underwent repeated mitosis with simultaneous cytokinesis.
C) The cell underwent repeated mitosis, but cytokinesis did not occur.
D) The cell had multiple S phases before it entered mitosis.
Answer C
Quiz 28
28- At which phase of the cell cycle do centrioles begin to move apart in
animal cells?

A) anaphase
B) telophase
C) metaphase
D) prophase
Answer D
Quiz 29

In a diploid cell with 5 chromosome pairs (2n = 10), how many sister
chromatids will be found in a nucleus at prophase of mitosis?
A) 5
B) 10
C) 20
D) 40
Answer C
Quiz 30

If there are 40 centromeres in a cell at anaphase of mitosis, how many

chromosomes will be found in each daughter cell following cytokinesis?
A) 10
B) 20
C) 40
D) 80
Answer B
Quiz 31

Which of the following is NOT true concerning mitosis?

A- Animal cells have centrioles while plant cells do not.
B- Both plant and animal cells undergo cytokinesis.
C- Mitosis allows growth and increase in size in both plants and animals.
D- Animal cells form a cell plate during cytokinesis while plant cells do not.
Answer D
Quiz 32

The term that refers to division of the cytoplasm is:

A- Cytokinesis
B- Anaphase
C- Apoptosis
D. Karyokinesis
Answer A
Quiz 33

33. Mitotic anaphase differs from mitotic metaphase in possessing:

A. Same number of chromosomes and same number of chromatids.
b. Half number of chromosomes and half number of chromatids
c. Half number of chromosomes and same number of chromatids
D. Same number of chromosomes and half number of chromatids
Answer D
Quiz 34

34. How many mitotic divisions are needed for a single cell to make 128
cells?
a. 7
b.l4
c.28
d. 32
Answer A
Quiz
35
35. A cell with 20 chromosomes undergoes mitosis. How many daughter
cells are created?....... daughter-cells, each has .......... chromosomes.
a. 2, 10
B. 1, 10
C. l ,20
D. 2,20
Answer D
Quiz
36
36. Where does spindle fibres attach to during metaphase?
a) kinetochore of the chromosome
(b) kinetosome of the chromosome
c) centromere of the chromosome
(d) telomere of the chromosome
Answer A
Quiz
37
37. Nucleolus and endoplasmic reticulum start disappearing at
(a) late prophase
(b) early prophase
c) late metaphase
(d) early metaphase
Answer B
Quiz
38
38. A protein complex, that links sister chromatids, is
(a) actin
(b) cohesin
(c) myosin
(d) actomyosin
Answer B
Quiz
39
39. Formation of cell plate starts at
(a) G2 phase
(b) prophase
(c) telophase
(d) S phase
Answer C
Quiz
40
40 :How does the sexual life cycle increase the genetic variation in a species?
A) By allowing independent assortment of chromosomes
B) By allowing fertilization
C) By increasing gene stability
D) By conserving chromosomal gene order
E) By decreasing mutation frequency
.
Answer A
Quiz
41
41:For a species with a haploid number of 23 chromosomes, how many
different combinations of maternal and paternal chromosomes are possible
for the gametes?
A) 23
B) 46
C) 460
D) 920
E) About 8 million
Answer E
Quiz
42
42: Independent assortment of chromosomes is a result of
A) the random and independent way in which each pair of homologous
chromosomes lines up at the metaphase plate during meiosis I.
B) the random nature of the fertilization of ova by sperm.
C) the random distribution of the sister chromatids to the two daughter cells
during anaphase II.
D) the relatively small degree of homology shared by the X and Y
chromosomes.
E) All of the above
Answer A
Quiz
43
43. When pairs of homologous chromosomes separate during anaphase I,
A) the maternal chromosomes all move to the same daughter cell.
B) the sister chromatids remain attached to one another.
C) recombination is not yet complete.
D) the synaptonemal complex is visible under the light microscope.
Answer B
 Quiz
44
44. Natural selection and recombination due to crossing over during meiosis
I are related in which of the following ways?
A) Recombinants are usually selected against.
B) Non-recombinant organisms are usually favored by natural selection if there
is
environmental change.
C) Most recombinants reproduce less frequently than do non-recombinants.
D) Recombinants may have combinations of traits that are favored by natural
selection.
E) Recombination does not affect natural selection.
Answer D
Quiz 45
45. Base your answer to the following question on the diagram below shows a process
that can occur during meiosis.

The most likely result of this process is

A- a new combination of inheritable traits that can appear in the offspring

B- an inability to pass either of these chromosomes on to offspring .
C: a loss of genetic information that will produce a genetic disorder in the
offspring
D: an increase in the chromosome number of the organism in which this process
occurs
Answer A
Quiz 46

46- Hemophilia is caused by an X-linked recessive allele. In the pedigree

shown below which two individuals in the pedigree must be carriers of
hemophilia?
A. I-1 and II-1
B. I-4 and II-2
C. II-1 and II-2
D. III-2 and III-3
Answer A
 Quiz
47
If the haploid number of an organism is 8, how many different varieties
of gametes are possible, not considering the effects of crossing over?
A. 16
B. 64
C. 128
D. 256
Answer D
Quiz
48
A cell replicates its DNA and then starts to divide by meiosis. What is
the expected arrangement of chromosomes if crossing over has taken
place between the two genes shown?
Answer C
Quiz
48
48-Chiasmata are what we see under a microscope that let us know which of
the following is occurring?
A) Asexual reproduction
B) Meiosis II
C) Anaphase II
D) Crossing over
E) Separation of homologs
Answer D
Quiz
49
49 The frequency of crossing over between any two linked genes will be
which of the following?
A) Higher if they are recessive
B) Dependent on how many alleles there are
C) Determined by their relative dominance
D) The same as if they were not linked
E) Proportional to the distance between them
Answer E
Quiz
50
The diagram below shows a change in chromosomes during cell division.
What process most likely caused this result?

a. crossing over
b. a frame shift mutation
c. base deletion
d. base insertion
Answer A
Quiz
51
During Meiosis I crossing over can occur. What is the MOST common result
of crossing over?
a. new tRNA
b. new combinations of alleles.
c. new DNA nucleotides
d. new number of chromosome
Answer B
Quiz
52
New combinations of linked genes are due to which of the following?
A) Nondisjunction
B) Crossing over
C) Independent assortment
D) Mixing of sperm and egg
Answer B
Quiz
53
Two genes A and B are linked together as shown below. If the genes are far
enough apart such that crossing over between the alleles occurs
occasionally, which statement is true of the gametes?
A b
a B
A. All of the gametes will be Ab and aB.
B. There will be 25% Ab, 25% aB, 25% ab and 25% AB.
C. There will be approximately equal numbers of Ab and ab gametes.
D. The number of Ab gametes will be greater than the number of ab gametes.
Answer D
Quiz
54

Which of the following best describes the formation of a zygote?

A- A sperm cell nucleus and an egg cell nucleus fuse.
B- A cell's DNA replication and mitosis are accelerated.
C- A succession of cell divisions produces a solid mass of cells.
D- A cel1 with 46 chromosomes divides tofom1 cells with 23 chromosomes
each.
Answer A
Quiz
55
60.A haploid cell doesn't undergo
• Mitosis
• Meiosis
• ATP production
• DNA replication
• Transcription
Answer B
Quiz
56
Which of the following is true for a typical human gamete?
l. It contains a haploid number of genes
ll. It will always contain an X or a Y chromosome
lll. It is a result of mitosis
lV. It has undergone genetic recombination
•l and ll only
•l and 11l only
•ll and 111 only
•ll, lll and lV only
•l,ll and IV only
Answer E
Quiz
57
After culturing the anther of a plant, a few diploid plants were found along
with haploid plants. The diploid plants could have arisen from
•Generative cell of pollen
•Cells of anther wall
•Vegetative cell of pollen
•Exine of pollen wall
Answer B
Quiz
58
When a cut portion of plant forms a full adult plant, it is called as
•Cutting
•Layering
•Grafting
•Stock
Answer A
Quiz
59
............... cannot takes place in haploid cells.
• Mitosis
• Meiosis
• Cell division
• Growth
• Digestion
Answer B
Quiz
60

60.How many divisions must occur in a cell of root tip to form 128 cells?
• 128
• 127
• 64
• 8
Answer D
Quiz 61
Select the correct matched pair.
(1) S phase - DNA replication
(2) Zygotene - Synapsis
(3) Diplotene - Crossing over
(4) Meiosis - Both haploid and dipolid cells
(5) G2​ phase - Quiescent stage
• (1) and (2) only
• (3) and (4) only
• (3) and (5) only
• (5) and (4) only
Answer A
Quiz
62
Meiosis results in
• 2 HAPLOID CELLS
• 4 HAPLOID CELLS
• 4 DIPLOID CELLS
• 2 DIPLOID CELLS
Answer B
Quiz
63
A Goat has 60 chromosomes in its body cells. What is the haploid number?
•60
•30
•100
•120
Answer B
Quiz
64
One round of meiotic division gives rise to _____ haploid cells.
• 1
•2
• 3
•4
Answer D
Quiz
65
__________ in males occurs with a much lower level of chromosomal
abnormalities than in females.
• Meiosis
• Mitosis
• Translation
• Transcription
Answer A
Quiz
66
Presence of an extra copy of which chromosome leads to the Doen syndrome?
• chromosome 9
• chromosome 11
• chromosome 17
• chromosome 21
Answer D
Quiz
67
Animals show mitosis in
•Haploid somatic cells
•Diploid somatic cells
•All type of haploid cells
•A and B are correct
Answer B
 Quiz
68
Mitosis produces cells with haploid or diploid number of chromosomes?
•Haploid
•Diploid
Answer B
Quiz
69
Body cells have diploid or haploid number of chromosomes?
•Haploid
•Diploid
Answer B
Quiz
70
Which of the following about the law of segregation is false
A) It states that each of two alleles for a given trait segregate into different
.gametes
B) It can be explained by the segregation of homologous chromosomes during
.meiosis
.C) It can account for the 3:1 ratio seen in the F2 generation of Mendelʹs crosses
D) It can be used to predict the likelihood of transmission of certain genetic
.diseases within families
E) It is a method that can be used to determine the number of chromosomes in a
plant
Answer E
 Quiz
71
The fact that all seven of the pea plant traits studied by Mendel obeyed the
principle of independent assortment most probably indicates which of the
?following
.A) None of the traits obeyed the law of segregation
.B) The diploid number of chromosomes in the pea plants was 7
.C) All of the genes controlling the traits were located on the same chromosome
D) All of the genes controlling the traits behaved as if they were on different
.chromosomes
.E) The formation of gametes in plants occurs by mitosis only
Answer D
Quiz
72
Mendel was able to draw his ideas of segregation and independent assortment
?because of the influence of which of the following
A) His reading and discussion of Darwinʹs Origin of Species
B) The understanding of particulate inheritance he learned from renowned
scientists of his time
C) His discussions of heredity with his colleagues at major universities
D) His reading of the scientific literature current in the field
E) His experiments with the breeding of plants such as peas
Answer E
Quiz
73
Mendelʹs observation of the segregation of alleles in gamete formation has its
?basis in which of the following phases of cell division
A) Prophase I of meiosis
B) Prophase II of meiosis
C) Metaphase I of meiosis
D) Anaphase I of meiosis
E) Anaphase of mitosis
Answer D
 Quiz
74
It was important that Mendel examined not just the F1 generation in his breeding
experiments, but the F2 generation as well, because
.A) he obtained very few F1 progeny, making statistical analysis difficult
.B) parental traits that were not observed in the F1 reappeared in the F2
C) analysis of the F1 progeny would have allowed him to discover the law of
.segregation, but not the law of independent assortment
.D) the dominant phenotypes were visible in the F2 generation, but not in the F1
E) many of the F1 progeny died
Answer B
Quiz
75
If doubly heterozygous SsNn cactuses were allowed to self-pollinate, the F2
?would segregate in which of the following ratios
A) 3 sharp-spined : 1 spineless
B) 1 sharp-spined : 2 dull-spined : 1 spineless
C) 1 sharp spined : 1 dull-spined : 1 spineless
D) 1 sharp-spined : 1 dull-spined
E) 9 sharp-spined : 3 dull-spined : 4 spineless
Answer E
Quiz
76
A cross between a true-breeding sharp-spined cactus and a spineless cactus
would produce
.A) all sharp-spined progeny
.B) 50% sharp-spined, 50% dull-spined progeny
C) 25% sharp-spined, 50% dull-spined, 25% spineless progeny
.D) all spineless progeny
E) It is impossible to determine the phenotypes of the progeny
Answer A
Quiz
77
In cattle, roan coat color (mixed red and white hairs) occurs in the heterozygous
(Rr) offspring of red (RR) and white (rr) homozygotes. Which of the following
?crosses would produce offspring in the ratio of 1 red : 2 roan : 1 white
A) red × white
B) roan × roan
C) white × roan
D) red × roan
E) The answer cannot be determined from the information provided
Answer B
Quiz
78
Skin color in a certain species of fish is inherited via a single gene with four
different alleles. How many different types of gametes would be possible in this
?system
A) 1
B) 2
C) 4
D) 8
E) 16
Answer C
Quiz
79
Crossing over is important because....
A) It prevents mutations from entering the gametes.
B) It allows for even distribution of chromosomes in the gametes.
C) It allows for more genetic diversity of gametes.
D) It allows for genetic uniformity of gametes
Answer C
Quiz
80
Crossing over occurs in...
A) Prophase 1
B) Prophase 2
C) Metaphase 1
D) Metaphase 2
Answer A
Quiz
81
81. Law of Segregation is when...
A) alleles separate individually from each other
B) genes for each trait separate individually from each other
C) one allele masks the presence of another allele
D) homologous chromosomes pair with other genes
Answer A
Quiz
82
One version of a gene...
A) autosome
B) sex chromosome
C) hybrid
D) allele
Answer D
Quiz
83
aving two different alleles for a gene...
A) Homozygous
B) Heterozygous
C) Dominant
D) Recessive
Answer B
Quiz
84
Which of Mendel's laws states that alleles are separated during meiosis?
A) Law of Dominance
B) Law of Segregation
C) Law of Independent Assortment
D) Law of Meiosis
Answer B
 Quiz
85
According to the Law of Segregation, alleles are separated during the
process of _____________.
A) Mitosis
B) Meiosis
C) Osmosis
D) Translation
Answer B
Quiz
86
The passing of traits from parent to offspring
A) Heredity
B) Genetics
C) Hybrid
D) Probability
Answer A
Quiz
87
Magda is a tall, 11 year old drummer. She has a scar on her right cheek. She
is good at swimming. Which of her traits did Magda most likely inherit?
A) height
B) the scar
C) ability to swim
D) ability to play drums
 Answer A
Explanation: There is a 50% chance that the
children will be heterozygous (Aa) and a 25%
chance that they will be homozygous dominant
(AA). Children with either of these genotypes will
have this trait expressed in their phenotypes.
Quiz
88
98. Which of the following is homozygous recessive?
A) rr
B) AA
C) TT
D) Ff
Answer A
Quiz 89
Which of the following is a phenotype?
A) BB
B) Bb
C) bb
D) Blue eyes
 Answer D
.
Quiz 90
How do you know what type of organism this chromosome sample came
from?
A. It is a human because it is diploid with two copies of 23 chromosomes.
B. It is not a human because it is quadroploid with 46 chromosomes.
C. It is a human because it is haploid with 23 chromosomes.
D. It is not a human because it is diploid with two copies of 23 chromosomes.
 Answer C
.
Quiz 91
A dog has 78 chromosomes in its body cells. What is the diploid number?
answer choices
A. 78
B. 39
C. 1
D. 100
 Answer A
.
Quiz 92
Which of these statements is not true about fertilization?
a) The gametes are haploid
b) Gametes develop from diploid cells
c) It involves the fusion of two gametes
d) Gametes have an incomplete set of chromosomes
 Answer D
.
Quiz 93
How many cells are formed at the end of meiosis I?
a) 2 haploid cells
b) 4 diploid cells
c) 2 diploid cells
d) 4 haploid cells
 Answer C
.
Quiz 94
In a diploid cell with 5 chromosome pairs (2n = 10), how
many sister chromatids will be found in a nucleus at
prophase of mitosis?
A) 5
B) 10
C) 20
D) 40
 Answer C
.
Quiz 95
The diploid chromosome number for the house fly is 12. The haploid
number of chromosomes found in their gametes would be ______.
A)1
B)3
C)6
D)12
E)24
 Answer C
.
Quiz 96
Which of the following characteristics of mitosis is NOT correct?

A)Mitosis occurs in somatic cells.

B)2N --> 2N
C)2N --> N
D)Mitosis is important for growth and repair of multicellular organisms.
E) Mitosis occurs when unicellular organisms reproduce asexually
 Answer C
.
Quiz 97
Which of the following sequences shows the correct life cycle for humans?

A) diploid egg + diploid sperm --> haploid zygote --> mitosis --> haploid adult -->
meiosis --> diploid gametes
B)diploid egg + diploid sperm --> haploid zygote --> meiosis --> haploid adult -->
mitosis --> diploid gametes
C) haploid egg + haploid sperm --> diploid zygote --> mitosis --> diploid adult -->
meiosis --> haploid gametes
D)haploid egg + haploid sperm --> diploid zygote --> meiosis --> diploid adult -->
mitosis --> haploid gametes
 Answer C
.
Quiz 98
Which of the following statements is NOT correct?
A) Gametes contain half the number of chromosomes found in
somatic cells.
B) Somatic cells have the diploid number of chromosomes.
C) The haploid number of chromosomes in humans is 23.
D) The diploid number of chromosomes in humans is 23 pairs.
E) Each human parent contributes eleven and a half pairs of
chromosomes to the zygote
 Answer E
.
Quiz 99
If the DNA content of a diploid cell in the G1 phase of the cell cycle
is x, then the DNA content of the same cell at metaphase of meiosis
I would be
A) 0.25x.
B) 0.5x.
C) x.
D) 2x.
E) 4x.
 Answer D
.
Quiz 100
1- Which characteristic is not a piece of information obtained from a
karyotype?
A. Sex of the individual
B. Number of autosomes
C. Number of sex chromosomes
D. Number of Giiemsa bands
E. Placement of centromere
 Answer D
.
Quiz 101
A sperm has
A. Both an X and a Y chromosome
B. An X OR a Y chromosome
C. Only a Y chromosome
D. None of the above
 Answer B
.
Quiz 102
What makes this person's karyotype abnormal?
A. An extra autosome
B. A missing sex chromosome
C. An extra sex chromosome
D. None of the above
 Answer A
.
Quiz 103
The number and appearance of chromosomes in an organism is
called a ______.
A-Karyotype
B-Chromosome set
C-Karyogram
D-autosome
 Answer A
.
Quiz 104
How does the X chromosome differ from the Y chromosome in
humans?
A- The Y chromosome is longer.
B- Some genes on the X chromosome are absent from the Y
chromosome.
C- The genes are the same but some on the Y chromosome are not
expressed.
D- The X chromosome determines sex.
 Answer B
.
Quiz 105
By looking at this karyotype you can determine that this person ___
A-has downs syndrome
B-has monosomy
C-is normal
D-has trisomy 13(platau syndrome)
 Answer D
.
Quiz 106
What can you determine about this person based on their karyotype?
A-They have Downs Syndrome
B-They have Turner's Syndrome
C-They have Edward's Syndrome
D-They are completely Normal
 Answer A
.
 Quiz 107
What can you determine about this person based on their karyotype?
A-They have Turner's Syndrome (Monosomy X)
B-They have Downs Syndrome
C-They are normal
D-They are male
 Answer A
.
Quiz 108
When chromosomes fail to separate correctly during anaphase of
meiosis, what can occur?
A-extra chromosomes are found in the sex cell
B-chromosomes of the sex cell are doubled
C-chromosomes of the sex cell are halved
D-meiosis never completes
 Answer A
.
Quiz 109
nondisjunction can result in
A-trisomy conditions
B-monosomy conditions
C-additional sex chromosomes
D-all of these
 Answer D
.
Quiz 110
Down's syndrome occurs because of a(n)
A-missing sex chromosome
B-extra sex chromosome
C-additional 21st chromosome
D-additional 18th chromosome
 Answer C
.
Quiz 111
Which of the following is incorrect with respect to mutation?
a) Sudden
b) Continuous
c) Change in chromosomes and genes
d) Leads to variation in DNA
 Answer B
.
Quiz 112
Which of the following is not a type of mutation?
a) Gene mutation
b) Chromosomal aberrations
c) Genomatic mutations
d) Colourful mutations
 Answer D
.
Quiz 113
Which of the following is a classic example of point mutation?
a) Phenylketonuria
b) Sickle cell anaemia
c) Haemophilia
d) Thalassemia
 Answer B
.
Quiz 114
Which of the following is also known as the removal of one or more
bases from the nucleotide chain?
a) Deletion
b) Insertion
c) Transition
d) Transversion
 Answer A
.
Quiz 115
What is the substitution of a purine base with a pyrimidine
base known as?
a) Deletion
b) Transition
c) Addition
d) Transversion
 Answer D
.
Quiz 116
Which of the following is not responsible for the formation of
chromosomes?
a) DNA
b) Proteins
c) RNA
d) Endoplasmic reticulum
 Answer D
.
Quiz 117
Intercalary aberrations are a part of which of the following?
a) Deletion
b) Addition
c) Inversion
d) Translocation
 Answer A
.
Quiz 118
What does the given type of aberrations in the figure represent?
a) Deletions
b) Duplications
c) Translocation
d) Inversion
 Answer B
.
Quiz 119
How does deletion occur?
a) When a part of a chromosome is duplicated
b) When a part of a chromosome is left out
c) When a part of a chromosome is lost
d) When a part of a chromosome is translocated
 Answer C
.
Quiz 120
What is translocation?
a) Shifting of part of chromosomes to the outside wall of nucleus
b) Shifting of a chromosome to another chromosome
c) Shifting of a part of a chromosome to another homologous
chromosome
d) Shifting of a part of a chromosome to another non-homologous
chromosome
 Answer D
.
Quiz 121
Segmental changes of chromosome having an evolutionary
significance, is of which of the following?
a) Deletion
b) Translocation
c) Inversion
d) Addition
 Answer B
.
Quiz 122
In which of the following organisms, an inversion occurs
frequently?
a) Drosophila
b) Moth
c) Honey bees
d) Butterflies
 Answer A
.
Quiz 123
Genomatic mutation is of how many types?
a) One
b) Two
c) Three
d) Four
 Answer B
.
Quiz 124
Any change in the nucleotide sequence of the DNA of a gene is
called
A) a mutation.
B) an advantage.
C) a codon.
D) an anticodon.
E) a translocation
 Answer A
.
Quiz 125
In a cross between two heterozygous (Aa), results will be:
A) in the ratio 1:3 homozygous to heterozygous
B) in the ratio 1:1 homozygous to heterozygous
C) in the ratio 1 :3 heterozygous to homozygous
D) all heterozygous
 Answer B
.
Quiz 126
In crossing a homozygous recessive with a heterozygote, what is the
chance of getting an offspring with the homozygous recessive
phenotype?
A) 75%
B) 25%
C) 50%
D) 0%
 Answer C
.
Quiz 127
When a gene for a given trait comes in alternative versions that
specify different forms of the trait (for example, purple-flower and
white-flower versions of a flower color gene), the versions of the
gene are called
A) loci.
B) supergenes.
C) chromosomes.
D) alleles.
 Answer D
.
Quiz 128
In males, the gene for colour blindness is located in________.
(a) X-chromosome
(b) Y-chromosome
(c) Both X and Y chromosome
(d) Either X-chromosome or Y-chromosome
 Answer A
.
Quiz 129
Who proposed the chromosomal theory of inheritance?
(a) Sutton
(b) Boveri
(c) Correns
(d) Both (a) and (b)
 Answer D
.
Quiz 130
Which of the following is called the sex-linked disease?
(a) Leukemia
(b) Alzheimer’s
(c) Malignancy
(d) Colour blindness
 Answer D
.
Quiz 131
A fully expressed allele is referred to as ________.
(a) Dominant
(b) Recessive
(c) Homologous
(d) Heterozygous
 Answer A
.
Quiz 132
During the anaphase stage in a bone marrow cell, each of the
chromosomes has_______.
(a) No chromatids
(b) One chromatid
(c) Two chromatids
(d) Several chromatids
 Answer B
.
Quiz 133
Most of the genetic disorders are caused due to _________.
(a) Mutation
(b) The gender of an individual
(c) The gross chromosomal abnormalities
(d) All of the above
 Answer A
.
Quiz 134
A human being has _____ autosomes and ______ sex
chromosomes.
A- 23, 1
B- 22 pairs, 1 pair
C- 23, 23
D- 2, 2
 Answer B
.
Quiz 135
A section of chromosomes that codes for a trait can be called
a(n):
A- Nucleotide
B- Base-pair
C- Gene
D- Nucleus
 Answer C
.
Quiz 136
Somatic cells of a human have ____ chromosomes and are called
____
A- 10, haploid
B- 92, diploid
C- 23, haploid
D- 46, diploid
 Answer D
.
Quiz 137
A person who receives an extra chromosome could have:
A- Heightened intelligence
B- Down Syndrome
C- Red eyes
D- Polygenic traits
 Answer B
.
Quiz 138
Each chromosome consists of two identical:
A- Genes
B- Nuclei
C- Chromatids
D- Bases
 Answer C
.
Quiz 139
If a person receives an X and a Y chromosome, that person is:
A- Female
B- Male
C- Red eyed
D- Mentally challenged
 Answer B
.
Quiz 140
Two alleles for pea plant height are designated T (tall) and t (dwarf).
These alleles are found on:
A- Genes
B- Sex chromosomes
C- Ribosomes
D- Homologous chromosomes
 Answer D
.
Quiz 141
An animal has 40 chromosomes in its gametes, how many
chromosomes would you expect to find in this animal's brain
cells?
A- 1
B- 20
C- 40
D- 80
 Answer D
.
Quiz 142
A picture of a person's chromosomes is called a(n):
A- Karyotype
B- Syndrome
C- Chromatin
D- Fingerprint
 Answer A
.
Quiz 143
During which phase of mitosis is DNA replicated?
A- Interphase
B- Prophase
C- Anaphase
D- Telophase
 Answer A
.
Quiz 144
In males, the gene for color blindness is located in________.

(a) X-chromosome
(b) Y-chromosome
(c) Both X and Y chromosome
(d) Either X-chromosome or Y-chromosome
 Answer A
.
Quiz 145
Which of the following is called the sex-linked disease?
(a) Leukemia
(b) Alzheimer
(c) Malignancy
(d) Color blindness
 Answer D
.
Quiz 146
Which of the following statements is true about the ends of the
chromosome?
(a) The ends of the chromosome are called Satellites
(b) The ends of the chromosome are called Centromeres
(c) The ends of the chromosome are called Telomeres
(d) The ends of the chromosome are called Kinetochore
 Answer C
.
Quiz 147
How many sex chromosomes are present in a human being?
(a) 1 pair
(b) 2 pairs
(c) 3 pairs
(d) 4 pairs
 Answer A
.
Quiz 148
Who was the first person to observe the chromosomes?
(a) Fleming
(b) Waldeyer
(c) Strasburger
(d) Hofmeister
 Answer D
.
Quiz 149
A fully expressed allele is referred to as ________.
(a) Dominant
(b) Recessive
(c) Homologous
(d) Heterozygous
 Answer A
.
Quiz 150
During the anaphase stage in a bone marrow cell, each of the
chromosomes has_______.
(a) No chromatids
(b) One chromatid
(c) Two chromatids
(d) Several chromatids
 Answer B
.
Quiz 151
Most of the genetic disorders are caused due to _________.
(a) Mutation
(b) The gender of an individual
(c) The gross chromosomal abnormalities
(d) All of the above
 Answer A
.
Quiz 152
The thread-like structures, which appear inside the nucleus at
the time of cell division, are called __________.
(a) Asters
(b) Centrioles
(c) Chromosomes
(d) Spindle fibers
 Answer C
.
Quiz 153
The Process of Sperms with egg produces
A- Zygote
B- Egg
C- None of these
D- Both 1 and 2
 Answer A
.
Quiz 154
Where the Fertilization in mammals occurs
A- Penis
B- Oviduct
C- Vasa Deferentia
D- None of these
 Answer B
.
Quiz 155
What Chemical Substance is present in the Cortex of Eggs?
A- Chemotaxis
B- Luteinizing
C- Estrogen
D- Testosterone
 Answer A
.
Quiz 156
External Fertilization Occurs in
A- Humans
B- Amphibians
C- Mammals
D- Dogs
 Answer B
.
Quiz 157
In the body of Female which type of Fertilization Occurs?
A- External
B- Internal
C- Asexual
D- Both 1 and 2
 Answer B
.
Quiz 158
What helps in the penetration of the egg by the sperm?
A- Fertilization membrane
B- Antifertilizin
C- Sperm lysin
D- Fertilizin
 Answer C
.
Quiz 159
Sperm lysin, Produced by Sperms in mammals is known as
A- Cryanogamone
B- Hyaluronic Acid
C- Androgamone
D- Hyaluronidase
 Answer B
.
Quiz 160
The Process of Egg Development without Fertilization is known as
A- Parthenogenesis
B- Metagenesis
C- Gametogenesis
D- Oogenesis
 Answer A
.
Quiz 161
This is a minute cell which Separates from the animal egg in
the process of maturation is known as
A- Primary oogonia
B- Secondary oogonia
C- Primary spermatogonia
D- Polar bodies
 Answer D
.
Quiz 162
What is the Nutritive Medium for the ejaculated Sperms is given by
A- Fallopian tube
B- Uterine lining
C- Seminal fluid
D- Vaginal fluid
 Answer C
.
Quiz 163
.…………………….. is the Most important event in the
reproduction process.
A- Fertilization
B- Implantation
C- None of the above
D- Fertilization and Implantation
 Answer D
.
Quiz 164
Fertilization is carried out by the fusion of …………………………..
A- Male and male gametes
B- Female and Female Gametes
C- Male and Female Gametes
D- None of these
 Answer C
.
Quiz 165
The fertilization process in humans takes place in several
stages involving both chemical and Physical events.
A- True
B- False
 Answer A
.
Quiz 166
How long does Sperm Live?
A- 12 hours
B- 24 hours
C- 48 hours
D- 72 hours
 Answer D
.
Quiz 167
During Coitus the Population of Vagina with Semen is known as
A- Insemination
B- Outsemination
C- Copulation
D- Fertilization
 Answer A
.
Resources
Campbell test bank 12 edition
Exam 2017/ 2018
Exam 2016/ 2017