Tesis Igor Irastorza Epelde

DEPARTMENT OF CELL BIOLOGY AND HISTOLOGY
SCHOOL OF MEDICINE AND NURSING

UNIVERSITY OF THE BASQUE COUNTRY
STUDY OF HUMAN DENTAL PULP STEM

CELLS (hDPSCs) COMBINED WITH
TITANIUM, DECELLULARIZED ADIPOSE
TISSUE AND PLASMA DERIVED PRODUCTS
ON OSTEOINDUCTION FOR BONE TISSUE
ENGINEERING
Igor Irastorza Epelde

Leioa, 2021
Thesis directors:
Dr. Fernando Unda Rodriguez
Dr. Gaskon Ibarrete Bilbao
(c) 2021 Igor Irastorza Epelde

Table of contents
Table of contents
Abstract …………………………………………………………………………………………………..…….…………… 1
Abbreviations ………………………………………………………………………………………..…………………… 5
Introduction ……………………………………………………………………………………………………………… 11
Introduction to tissue engineering ………………………………………………………………………. 13
Stem cells ……………………………………………………………………………………………..…………….. 14
Adult stem cells …………………………………………………………………………………….…………. 15
Mesenchymal stem cells ……………………………………………………………….…………….. 17
Dental pulp stem cells (DPSC) ………………………………………………………………….. 18
General introduction ……………………………………………………………..…………… 18
Surface markers ………………………………………………………………..……………….. 20
Cell differentiation of DPSCs ……………………………………………………..………… 21
Bone marrow stem cells (BMSC) …………………………………………………..…………. 24
General introduction ……………………………………………………………….…………. 24
Surface markers …………………………………………………………………………………. 25
Cell differentiation of BMSCs ……………………………………….……………………… 26
Scaffolds for bone tissue engineering ………………………………………………………………….. 28
Titanium ………………………………………………………………………………………..………………… 30
Decellularized adipose tissue ……………………………………………………………..……………. 33
Growth factors ………………………………………………………………………………….………………… 34
Plasma derived products ………………………………………………………….…………………….. 35
Material and Methods ……………………………………………………………………………….…………….. 37
Hypothesis ……………………………………………………………………………………………….………………. 49
General Objectives …………………………………………………………………………………….…………….. 53
Results ……………………………………………………………………………………………………………………… 57
Discussion ……………………………………………………………………………………………..…………………. 95
Conclussions …………………………………………………………………………………………….……………. 109
Annex I (patents) ……………………………………………………………………………………..…………….. 113
Annex II (articles) …………………………………………………………………………………..……………….. 117
Bibliography ………………………………………………………………………………………….……………….. 133
Abstract
Abstract
Bone tissue engineering is a multidisciplinary and relatively new field that

consists on the application of engineering and life science to develop biological
substitutes to maintain, restore or improve damaged or lost tissue function. The main
three pillars of tissue engineering are scaffolds, stem cells and growth factors. With all
the technological advances in the last decades, due to new materials and surface
modifications, scaffolds for bone tissue engineering and dental implantology have
upgraded a lot. These upgrades have demonstrated a good osteoblastic differentiation
induction of different MSCs. Moreover, MSCs showed good features for the use in bone
tissue engineering such as high proliferation and differentiation potential. However, the
reason which MSC cell type is the best option for bone regeneration therapies is still
unclear. The main problem of the use of stem cells in autologous cell therapies is the
widespread use of animal origin serums like fetal bovine serum (FBS) for in vitro cell
cultures. To inactivate the immune response of the cell-grafted patients these serums
should be replaced.
In the present work, we studied the human Dental Pulp Stem Cells (hDPSCs)
adherence, proliferation, viability and osteo-differentiation potential when cultured on
widely used Ti6AL4V titanium surface and a new biomimetic porous surface (BAS TM), in
the presence or absence of osteoblastic differentiation media supplemented with
plasma rich in growth factors (PRGF) and platelet rich fibrin (PRF).
The results showed that hDPSCs showed a good adherence ability and non
affected viability and proliferation when cultured on Ti6AL4V and BAS titanium surfaces.
Moreover, both titanium surfaces demonstrated having osteoblastic differentiation
induction effect on hDPSCs without using osteoblastic differentiation media. Besides,
the two plasma derived products showed interesting results. On one hand, the PRGF
induced higher cell proliferation on in vitro hDPSC cultures becoming a good FBS
substitute for the use on autologous cell therapies. On the other hand, PRF enhanced
osteoblastic cell differentiation of hDPSCs with higher calcified bone matrix production.
Finally, the combination of PRF with BAS titanium surface maximized hDPSCs
osteoblastic differentiation to bone-producing cells. The results obtained on this work
provides experimental support to the commonly used fibrin clots on clinical practice to
enhance bone production around dental implants.
3
Once we studied the effects of these two titanium surfaces on hDPSCs, we

performed a comparative study of viability, proliferation and osteoblastic differentiation
potential between the most promising mesenchymal stem cells for bone regeneration
therapies, hDPSCs and hBMSCs. The results suggested a higher proliferation and
mineralized bone matrix production of hDPSCs compared to hBMSCs. Even more data is
needed to confirm these results, thanks to easier and less invasive isolation,
proliferation and differentiation differences mentioned, hDPSCs could be a better
option than hBMSCs for bone regeneration therapies.
Lastly, another problem in dental implantology is the loss of periodontal

ligament. The function of this tissue is to act like a cushion to absorb part of the
masticatory mechanical forces to protect the alveolar bone. Nowadays, the periodontal
regenerative therapy is based on the use of barrier membranes in alveolar ridge defects
to enhance the bone growth on the surrounding affected area before the placement of
dental implants. For this purpose, we studied the porcine decellularized adipose tissue
(pDAT). It demonstrated being a good support for the adhesion and viability of hDPSCs.
In addition, hDPSCs cultured on pDAT were able to differentiate showing the production
of intramembraneous ossification and formation of Sharpey fibre-like attachment
structures. Considering the available and abundant human derived adipose tissue
material source and that both, DAT and hDPSCs, can be obtained from the patients
themselves, their combination for personalized clinical therapies seems to be a great
opportunity for bone regeneration therapies and dental implantology.
Keywords: dental pulp stem cells, DPSC, bone marrow stem cells, BMSC, tissue
engineering, scaffold, cell differentiation, plasma-derived products, PRGF, PRF, titanium,
dezellularized adipose tissue, regenerative medicine.
4
Abbreviations
Abbreviations
ALP= Alkaline phosphatase

αMEM= α minimal essential medium
AMTP= Advanced medical therapy products
APC= Allophycocyanin
ARC= Adventitial reticular cell
ARS= Alizarin red
α-SMA= α-smooth muscle actin
AT-MSC= Adipose tissue MSC
BAS= Biomimetic advanced surface
BDNF= Brain derived neurotrophic factor
BGLAP= osteocalcin
BMPxxx= Bone morphogenetic protein xxx
BMSC= Bone marrow stem cell
BSA= Bovine serum albumin
CDxxx= Cluster differentiation
CFU-F= Colony forming unit fibroblasts
CMAP= The Connectivity Map
DAPI= 4´,6-diamino-2-phenilindol
DAT= Decellularized adipose tissue
DFSC= Dental follicle stem cell
DME= β-mercaptoethanol
DMEM= Dubbelco´s modified eagle´s medium
DPSC= Dental pulp stem cell
DSP= Dentin sialoprotein
DSPP= Dentin sialophosphoprotein
ECC= Embryonal carcinoma cell
EDTA= Ethylenediamine tetraacetic acid
EGF= Epidermal growth factor
EMD= Enamel matrix derivate
7
ESC= Embryonic stem cell

FBS= Fetal bovine serum
FGF= Fibroblast growth factor
FITC= fluorescein isothiocyanate
GDNF: Glial cell line derived neurotrophic factor
GOBP= Gene Ontology Biological Process
HA= Hydroxyapatite
hBMSC= Human BMSC
HBSS= Hank´s balanced salt solution
hDPSC= Human DPSC
HGF= Hepatocyte growth factor
HSC= Hematopoietic stem cell
IBMX= 3-isobutyl-1-methylxantine
ICM= Inner cell mass of the blastocyst
IL= Interleukins
iPSC= Induced pluripotent stem cell
ISTC= International society for cellular therapy
ITSx= Insulin-transferrin-selenium-x
mESC= Mouse ESC
MNC= Marrow mononuclear cell
MSC= Mesenchymal stem cells
NBT/BCIP= 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium
NeuN= Neuronal nuclei protein
NGF= Nerve growth factor
NSE= Neuron specific enolase
OSTERIX/SP7= Transcription factor 7
PBS= Phosphate buffered saline
pDAT= Porcine DAT
PDGF= Platelet derived growth factor
8
Abbreviations
PDL= Periodontal ligament

PDLSC= Periodontal ligament stem cell
PE= phycoerytrin
PFA= Paraformaldehide
PGA= Poly-glycolic acid
PLA= Poly-lactic acid
PRF= Plasma rich fibrin
PRGF= Plasma rich growth factor
PRP= Plasma rich plasma
RA= Retinoic acid
RUNX2= Runt-related transcriptional factor 2
SCAP= Stem cell from apical papilla
SEM= Scanning electron microscopy
SHED= Exfoliated deciduous teeth stem cell
SHxxx= Src homology xxx
SPARC= osteonectin
SPB= Sorensen phosphate buffer
SSEA-1= Stage specific embryo antigen 1
TEM= Transmission electron microscopy
TCP= Tricalcium phosphate
TGF-β= Transforming growth factor β
V-CAM 1= Vascular cell adhesion protein 1
VEGF= vascular endothelial growth factor
9
Introduction
Introduction
Introduction to tissue engineering
The term “Tissue engineering” was created in 1988 by the National Science
Foundation workshop as “the application of principles and methods of engineering and
life sciences toward the fundamental understanding of structure-function relationships
in normal and pathological mammalian tissues and the development of biological
substitutes to restore, maintain or improve tissue function”. Tissue engineering is a
multidisciplinary and relatively new field, which interconnects different disciplines as
clinical medicine, material science, mechanical engineering and genetics (Berthiaume et
al., 2011). Tissue engineering strives for functional restoration of lost or damaged tissues
by seeding cells and growth factors on three-dimensional scaffolds (Chaudhari et al.,
2016), conforming what is known as “tissue-engineering triad”, which can be set up in a
bioreactor in a controlled environment (Dlaska et al., 2015; O’Brien, 2011).
The main objective of tissue engineering is to restore, maintain, or improve

damaged tissues or whole organs. In the case of bone tissue, the natural remodeling,
regeneration and self-repairing that this tissue presents are big advantages. One of the
aims of new material investigation is to create biocompatible materials, which can
supply regenerative signals to the cells. Moreover, the tissue engineering field is also
focused on finding biomimetic materials with similar properties to the natural
environment improving proliferation, adhesion and differentiation (Dhandayuthapani et
al., 2011).
After blood transfusion, bone transplantation is the most common tissue

transplantation type, and due to the aging of the population, the demand is increasing
considerably (Kattimani et al., 2016). Bone tissue engineering field has set his eye on
stem cells connected with osteoblasts for future therapies (Stevens, 2008).
Taking into account bone tissue engineering criteria, craniofacial tissue engineering goes
forward by trying to develop biomaterials for the regeneration of dental and oral tissues,
like bone, salivary glands, periodontal ligaments, mucosa, cementum and dentin
(Rahman et al., 2018).
Particularly, periodontal regenerative therapy has a well-reported guided

bone/tissue regeneration technique, also named as “membrane protected bone
13
regeneration”. This technique is based on the use of barrier membranes in alveolar ridge
defects to enhance the bone growth on the surrounding affected area of dental
implants. The alveolar bone growth had to be enhanced first to give local mechanical
stability for the correct bone-implant interface creation (Pilipchuk et al., 2015).
Summarizing, the three pillars on which tissue engineering is sustained are stem
cells, scaffolds and growth factors (figure 1).
Cells
Biomaterials
Autologous
Natural
Heterologous
Synthetic
Differentiated
Hydrogels Tissue Stem cell
Meshes
engineering
Signals
Growth factors
Small molecules
Mechanical forces
Figure 1. The tissue engineering triad. A combination of cells cultured on a biomaterial scaffold with
appropriate biophysical and chemical signals coordinate to regenerate the desired tissue.
1. Stem cells
Stem cells must meet, to be defined as such, three main characteristics.

Clonality, the ability to self-renew, and the potential to differentiate into mature cells
of different tissues and organs (Potten and Loeffler, 1990).
The first described stem cells were obtained by the isolation of the embryonal
carcinoma cells (ECCs) from teratocarcinomas in 1954 (Stevens and Little, 1954). Ten
years later, the two main characteristics of these cells were described: their self-renewal
ability and their capacity to differentiate to the three different germ layers in vitro,
describing them as pluripotent stem cells (Kleinsmith and Pierce, 1964). In 1970, they
14
Introduction
were also described on in vivo models (Kahan and Ephrussi, 1970). Few years later, in
1981, they isolated the mouse embryonic stem cells (mESCs) from the inner cell mass of
the blastocyst (ICM) and in 1998, the human ESCs (Martin, 1980; Thomson et al., 1998).
In recent years, a new concept of stem cells was born, induced pluripotent stem cells
(iPSCs). In 2006, it was firstly described on mouse cells and in 2007 on human cells
(Takahashi et al., 2007; Takahashi and Yamanaka, 2006).
Depending on the developmental stage, the stem cells show different

differentiation potentials. According to this, they can be categorized into five groups:
Totipotent: These types of stem cells have the potential to create an entire individual.
They are able to form an entire embryo and the temporary support tissues (umbilical
cord and placenta). This potential lasts until the blastomeric stage (Posfai et al., 2021).
Pluripotent: After the blastocyst is formed, the pluripotent stem cells forming the IMC
are able to differentiate into the three germ layers. These stem cells are capable to
generate all the adult tissues and organs but not the temporary support tissues (Smith,
2001).
Multipotent: The differentiation potential of these stem cells is restricted to their

original organ or tissue, being their main function the reparation and maintenance of
adult tissues (Slack, 2000).
Oligopotent: These term refers to the stem cells which can only differentiate to very few
and restricted types of cells like the myeloid and lymphoid cells (Majo et al., 2008).
Unipotent: The unipotent stem cells are able only to produce one type of cell. They are
considered stem cells because of their self-renewal capacity, like muscular stem cells
(Seale et al., 2001).
1.1. Adult stem cells
When the blastocyst is developed, the ESCs from the ICM create the three germ
layers: endoderm, mesoderm and ectoderm. After the tissue and organ formation,
some stem cells are retained without a terminal differentiation as in the bone marrow,
blood, liver, skin, brain, teeth, bone or muscle (Denham et al., 2005; Vats et al., 2005).
15
The plasticity of these stem cells can vary from the potential to differentiate to many
different cell types (multipotent) to being able only to differentiate to a single type of
cell (unipotent) (Almeida-Porada et al., 2001; Wagers and Weissman, 2004). Besides, the
proliferation rate of these cells varies from tissue to tissue. The highest proliferative
stem cells can be found in high cell turnover tissues as bone marrow, skin or intestine
(Baulies et al., 2020; Lenkiewicz, 2019; Yadav et al., 2020). On the other hand, other
stem cells will only proliferate to replace damaged cells or in a response to an injury such
as in the liver, heart or the nervous system (Angelini et al., 2004; Duncan et al., 2009;
Mansergh et al., 2000) (figure 2).
Figure 2. Human adult stem cell locations. (Hodgkinson et al., 2009)
16
Introduction
1.1.1. Mesenchymal stem cells (MSCs)
It was 1990 when the term “mesenchymal stem cell “ started to be popular
thanks to its use by Caplan but it took until 2000 to be accepted by the scientific
community (Caplan, 1991; Horwitz and Keating, 2000). They are named MSCs the non-
hematopoietic stem cells with the capacity to differentiate to different mesenchymal
tissue cells. They can be isolated from various tissues and organs such as muscles,
cartilage, bone, tendons, adipose tissue and perivascular area (Chamberlain et al., 2007;
Crisan et al., 2008), and from umbilical cord, menstrual blood, placenta, large intestine
and dental pulp (Du et al., 2016; Ma et al., 2014; Portmann-Lanz et al., 2006; Tirino et
al., 2011).
Mesenchymal stem cells must fulfill certain requirements to be considered as

such. The Committee of Mesenchymal Stem Cells and Tissues of the international
Society for Cellular Therapy (ISCT) established these requirements in 2005: They must
be plastic adherent cells when cultured in vitro and must retain the potential for
chondrogenic, adipogenic and osteogenic differentiation. Moreover, their surface
marker expression must be negative to hematopoietic linage markers as CD14, CD34
and CD45, but positive for CD13, CD44, CD73, CD90 and CD105 (Dominici et al., 2006).
Different MSC populations have been described in the adult body. The first MSC
population to be described were the bone-marrow mesenchymal stem cells (BMSCs)
(Anjos-Afonso and Bonnet, 2007; Friedenstein et al., 1976). Then they followed different
MSC populations such as umbilical cord mesenchymal stem cells, discovered in 1991 and
confirmed as MSCs in 2004 (McElreavey et al., 1991; Wang et al., 2004), dental pulp
mesenchymal stem cells (Gronthos et al., 2000), cardiac mesenchymal stem cells
(Beltrami et al., 2003), pulmonary mesenchymal stem cells (Griffiths et al., 2005),
peripheral blood mesenchymal stem cells (Cao et al., 2005) or adipose tissue
mesenchymal stem cells (AT-MSCs) (Fraser et al., 2006). Despite most of the cell types
mentioned before come from the mesenchymal germ layer, the origin of oral cavity
mesenchymal stem cells, such as DPSCs, is in the neural crest, as DPSCs. Even been
widely classified as mesenchymal stem cells, the ectodermal germ layer origin gives
these cells have a higher ability to differentiate to neuron-like cells compared to MSCs,
being possible to call them ectomesenchymal stem cells (Ibarretxe et al., 2012a).
17
1.1.1.1. Dental pulp stem cells (DPSCs)

a. General characteristics
As mentioned before, DPSCs have a neural crest origin. During the

embryogenesis, ectodermal cells from the neural crest migrate to the oral region to
create different craniofacial structures as the dental pulp, the tongue, craniofacial
nerves, periodontal ligament, bones and muscles (Ibarretxe et al., 2012a; Shyamala et
al., 2015; Vega-Lopez et al., 2017). Due to this characteristic, DPSCs have the potential
to differentiate not only to mesenchymal-linage cells but also to neural-lineage cells
(Ibarretxe et al., 2012a).
enamel
crown dentin
pulp
gum
(gingiva)
cementum
root blood
vassels
periodontal
ligament
lateral
canals
nerve
Figure 3. The main structures of the tooth. (Yildirim, 2013)
DPSCs were described for the first time in 2000 as mesenchymal stem cells from
the dental pulp similar to BMSC (Gronthos et al., 2000). It was two years later when they
were named as dental pulp stem cells and they were characterized as highly clonogenic
18
Introduction
and proliferative cells (Gronthos et al., 2002). These cells are located in the “pulp
chamber” inside the dental crown (Figure 3). Dental pulp is a connective tissue with a
heterogeneous composition, including different cell types such as
odonto/osteoprogenitor cell populations, neural cells, vascular cells, fibroblasts (known
as pulpoblasts) and immune cells as granulocyte and macrophages (Goldberg and Smith,
2004). It is also important to mention that some studies located the DPSCs in the
vascular pericyte compartment (Shi and Gronthos, 2003).
Hard tissues as cementum, dentin and enamel compose the adult tooth as well
as the soft tissues, like the dental pulp. Dental formation starts with the interaction
between the MSCs and the oral ectodermal epithelial cells. Dentin is the first tissue being
formed, followed by enamel and the dental follicle. The epithelial cells form ameloblasts,
which create the enamel. On the other hand, MSCs are the responsible for generating
the dentin, cementum, periodontal ligament and pulp (Sedgley and Botero, 2012;
Thesleff and Aberg, 1999) (Figure 3).
One of the main functions of the dental pulp in the adult body is the repair and
maintenance of the dentin. In cases with severe damage as in deep caries, the DPSCs
migrate to the injury zone and they differentiate to odontoblasts to create reparative
dentin (Dimitrova-Nakov et al., 2014; Tziafas et al., 2000).
Even if the DPSCs are the most known and more commonly used dental stem cells
in research, we can find different stem cell population with different properties. The
dental follicle stem cells (DFSCs) can be isolated during tooth development from the
ectomesenchymal embryonic tissue where they are covering the tooth germ (Zhang et
al., 2019). They can differentiate in vitro to other cell linages apart from periodontal cells
(Honda et al., 2010). Moreover, stem cells from apical papilla (SCAP) are localized in the
apices of the root of developing tooth as in pre-erupting wisdom teeth with high
proliferative ability (Bakopoulou et al., 2011). As the other stem cell subpopulation of
this group, because of the ectomesenchymal origin, they are also able to differentiate
to angiogenic and neurogenic cells (Dagnino et al., 2020; Nada and El Backly, 2018).
Furthermore, periodontal ligament stem cells (PDLSCs) were found to have very similar
characteristics to DPSCs as pluripotency markers and differentiation potential (Liu et al.,
2018; Seo et al., 2004). Finally, primary exfoliated deciduous teeth stem cells (SHED) also
19
show pluripotency markers, neural markers and high proliferation rate (Kerkis et al.,
2006; Miura et al., 2003). Like the rest of the dental stem cells, SHED have demonstrated
the ability to differentiate into mesenchymal linage cells at the same time as to neural
cells (Karbalaie et al., 2021; Sordi et al., 2021; Zhang et al., 2016) (Figure 4).
Figure 4. Timeline about the highlights in the history of the isolation of dental-related stem cells.
(Karamzadeh and Eslaminejad, 2013).
b. DPSC surface markers
DPSCs demonstrated having cell marker differences as a consequence of the

heterogeneity of stem cells subpopulation within the dental pulp (Alraies et al., 2020;
Kawashima, 2012; Simonović et al., 2019).
Due to their neural crest origin, it is important to mention the expression of

mesenchymal (Vimentin, Collagen I), neural (Nestin, GFAP) and stem pluripotency
markers (OCT4, Nanog, Sox2) (Bae et al., 2021; Ibarretxe et al., 2012a; Wang et al., 2020).
Moreover, because of the variety of DPSC subpopulations, the expression of

surface markers is not well established. In general, these cells are considered a subtype
of MSCs because of the positive expression of the CD73 (5´-ectonucleatidase), CD90
(glycosylphosphatidylinositol-anchored glycoprotein) and CD105 (endoglin) markers.
Moreover, DPSCs also have a positive expression for CD27, CD29, CD44, CD146, CD166
CD271, V-CAM-1, SSEA4 and STRO-1. On the other hand, DPSCs are negative for CD14
(monocyte or macrophage marker), CD19 (B cell marker) and hematopoietic markers
CD34 and CD45 (Gang et al., 2007; Gronthos et al., 2003). Despite this being the most
20
Introduction
commonly reported marker expression pattern for DPSCs, some studies showed
expression of CD34 in certain DPSC subpopulations (Carnevale et al., 2018) (table 1).
DPSCS SHED PDLSCS DFPCS SCAPS GSCS BMSCS

CD (+) STRO-1 STRO-1 STRO-1 STRO-1 STRO-1 STRO-1 STRO-1
CD29 CD29 CD29 CD29 CD29 CD29 CD29
CD44 CD44 CD44 CD44 CD44 CD44
CD105 CD105 CD105 CD105 CD105 CD105 CD105
CD146 CD146 CD146 CD146 CD146
CD166 CD166 CD166 CD166
CD (-) CD14 CD14 CD14
CD19
CD34* CD34 CD34 CD34 CD34 CD34 CD34
Table 1. Cell surface marker profiles of dental-related stem cells and bone marrow stem cells. DPSCs:
Dental pulp stem cell, SHED: Stem cells from human exfoliated deciduous teeth, PDLSC: Periodontal
ligament stem cells, DFPC: Dental follicle precursor cells, SCAP: Stem cells from dental apical papilla, GSC:
Gingival stem cells and BMSC: Bone marrow stem cells. CD34*: certain DPSC subpopulation expressed
CD34 (Carnevale et al., 2018) (Own creation).
c. Cell Differentiation of DPSCs
As previously said, DPSCs have an ectomesenchymal origin. Due to this

characteristic they have the ability to differentiate to different connective tissues as
osteo/odontoblasts, adipocytes, chondroblasts and muscle cells (Gronthos et al., 2002;
Kawashima, 2012). Moreover, because of the neural crest origin, these cells have a
higher ability than other MSCs to differentiate to neuron-like cells (Luzuriaga et al.,
2021). In addition, some studies suggested the capacity to differentiate to endoderm-
lineage cells, suggesting that DPSCs could have pluripotency-like features (Atari et al.,
2011). However, even obtaining endodermal-like cells, the pluripotency of DPSCs has
not been conclusively demonstrated yet.
The osteogenic differentiation is one of the most well-known cell differentiation

fates of DPSCs. Even if in different studies the osteodifferentiation induction cocktail can
21
vary, dexamethasone, β-glycerol phosphate and L-ascorbic acid are constantly repeated,
as they are the most important components. These molecules are essential to activate
the expression of collagen type I, alkaline phosphatase, Run-related transcription factor
2 (RUNX2), osterix, osteopontin, osteocalcin and osteonectin, necessary for the
osteodifferentiation of the DPSCs (Ajlan et al., 2015; Atari et al., 2012a; Bhuptani and
Patravale, 2016; Goto et al., 2016; Riccio et al., 2010). Among all these genes, RUNX2 is
one of the first being expressed. RUNX2 is an early stage osteodifferentiation gene
whose activation provokes the expression of both dentin sialoprotein (DSP) and dentin
sialophosphoprotein (DSPP) (Han et al., 2014; Vimalraj et al., 2015; Xu et al., 2015).
For chondroblastic differentiation, the most used culture media contain L-

proline, L-ascorbic acid, dexamethasone, insulin-transferrin-selenium (ITSx), sodium
pyrubate and TGF-β3 (Hilkens et al., 2013; Jang et al., 2016; Nemeth et al., 2014). In the
chondroblastic differentiation TGF-β is an important protein superfamily, responsible
for cartilage differentiation/de-differentiation processes (Dexheimer et al., 2016).
Although they can be differentiated to chondrocytes, DPSCs had less chondroblastic
differentiation potential compares to other MSCs due to their population heterogeneity
and in vitro high oxygen levels (Pisciotta et al., 2020).
In the case of the adipogenic differentiation media, apart from dexamethasone,

there is need of insulin and 3-isobutyl-1-methylxantine (IBMX). The specific markers for
adipogenic differentiation are fatty acid binding protein 4, glucose transporter type 4,
lipoprotein lipase adipogenic markers and peroxisome proliferator-activated receptor ϒ.
As in chondroblastic differentiation, DPSCs had less adipogenic differentiation potential
than other MSCs (Grottkau et al., 2010; Lee et al., 2015a; Zhang et al., 2016).
DPSCs are also capable to differentiate to other cells types such as endothelial
cells (Luzuriaga et al., 2019a; Luzuriaga et al., 2020; Marchionni et al., 2009),
cardiomyocytes (Ferro et al., 2012) and smooth muscle (Song et al., 2016; Zhao et al.,
2012). In addition, recent studies obtained endothelial cell differentiation using serum-
free media, an interesting approach for autologous cell therapies (Luzuriaga et al.,
2019a; Luzuriaga et al., 2020).
22
Introduction
Apart from the differentiation to mesenchymal germ layer cells one of the most
interesting characteristic of DPSCs is their neural crest origin. Due to this origin, DPSCs
are able to differentiate to neuron-like cells. Many neuron differentiation inductive
media used in the last decade are based on neurotrophins and other small molecules
like NGF, GDNF, BDNF, epidermal growth factor (EGF), fibroblast growth factor (FGF),
sonic hedgehog, forskolin, heparin, NT-3 and retinoic acid (RA). It is also remarkable the
use of ITSx, N2, B27 and non-essential amino acids (Arthur et al., 2008; Chang et al.,
2014; Gervois et al., 2015; Kanafi et al., 2014; Király et al., 2011; Luzuriaga et al., 2019b;
Osathanon et al., 2014; Xiao and Tsutsui, 2013; Zhang et al., 2017) (figure 5).
DPSCs differentiation potential
Adipogenic Myogenic
Chondrogenic Neurogenic
Osteo/dentinogenic
Figure 5. DPSCs differentiation potential. (Aurrekoetxea et al., 2015).
23
DPSCs showed the potential to generate endodermal lineage cells (Atari et al.,
2012b). The ability to differentiate to endoderm germ-line cells as pancreatic cells was
demonstrated by obtaining cells capable to produce glucagon, somatostatin, insulin and
pancreatic polypeptide being the CD117+ cells the subpopulation with the best
differentiation potential. The WNT and PI3K/AKT pathways showed to have a key role
on this differentiation (Ishkitiev et al., 2013; Yagi Mendoza et al., 2018). Moreover,
hepatic-like differentiation had been carried with the use of dexamethasone, ITSx, HGF
and oncostatin M cultured in serum-free or low serum (1 %-2 %) media (Chen et al.,
2016; Han et al., 2017; Ishkitiev et al., 2012).
1.1.1.2. Bone marrow stem cells (BMSCs)

a. General characteristics
Friedenstein and colleagues discovered bone marrow mesenchymal stem cells in

1970 with the isolation method based on the adherence in plastic of the cells derived
from the bone marrow (Friedenstein et al., 1970). When these cells are cultured in
plastic, they form high proliferative compact colonies with fibroblast-like spindle-shaped
cells, termed colony forming unit fibroblasts (CFU-F) (Castro-Malaspina et al., 1980;
Gothard et al., 2013).
The CFU-Fs showed to have a low frequency, ranging from 1/10.000 to 1/100.000
of bone marrow mononuclear cells (MNCs) (Castro-Malaspina et al., 1980). The
frequency of BMSCs is much lower than hematopoietic stem cells (HSCs) also clustered
in the bone marrow, being 1% of the MNC fraction (Civin et al., 1996).
Moreover, the BMSCs cell cycle investigations showed that a small fraction of
these cells are proliferative (10 % at S + G2 + M), and all the rest at G0/G1 phase (Conget
and Minguell, 1999). Depending on patients variability, the proliferation potential of
BMSCs can vary from four doublings to going over 15 doublings (Digirolamo et al., 1999;
Phinney et al., 1999). Even if the proliferative cells are a small fraction, they have high
proliferation rate ex vivo. This proliferation potential can vary depending on the
procedure to harvest the cells, the frequency of BMSCs and the age of the donor (Blazsek
et al., 1999; Koç et al., 1999). Recent studies have improved in vitro proliferation of
24
Introduction
BMSCs using bioreactors (Bhat et al., 2021; Santos et al., 2011). Despite telomerase
activity being lost in somatic cell proliferation and differentiation causing cell death by
senescence, BMSCs maintain the telomerase activity (Pittenger et al., 1999). However,
after extensive passages, they show apoptosis and senescence signs (Dhanasekaran et
al., 2013).
It is being suggested that the main function of BMSCs is to contribute to the

formation and maintenance of the stromal microenvironment. The modulation of the
microenvironment, via inductive regulatory signals, is not only for other BMSCs but also
for other non-mesenchymal stromal and hematopoietic progenitor cells (Cheng et al.,
2000). This theory is strengthened by the data showing that the BMSCs produce
different matrix molecules, such as collagen, laminin, fibronectin and proteoglycans
(Chichester et al., 1993; Connelly et al., 2008; Pittenger et al., 1999). They also express
cell-to-cell adhesive interaction and matrix associated counter-receptor molecules.
Some investigations suggested that BMSCs, as DPSCs, are located in the vascular
pericyte, the cell lining of the outer surface of blood vessels (Shi and Gronthos, 2003;
Short et al., 2003; da Silva Meirelles et al., 2006). Besides, other studies indicates that
the BMSCs could be identical to bone marrow stromal supportive cells termed
adventitial reticular cells (ARCs). As a result, BMSCs are also referred as multipotent
mesenchymal stromal cells or marrow stromal stem cells (Gronthos et al., 2003; Horwitz
et al., 2005).
b. BMSC surface markers
BMSCs are characterized by the negative expression of markers as CD14

(monocyte or macrophage marker), CD31 (PECAM) and hematopoietic markers CD34
and CD45 (Conget and Minguell, 1999; Jones et al., 2002; Pittenger et al., 1999). On the
contrary, these cells shows positive expression for specific antigens like α-smooth
muscle actin (α-sma), STRO-1, SH2, SH3 and SH4 (Haynesworth et al., 1992; Simmons
and Torok-Storb, 1991). Furthermore, they are also positive to adherence molecules as,
CD54 (ICAM-1), CD102 (ICAM-2), CD106 (VCAM-1) and CD166 (ALCAM-1) (Chichester et
al., 1993; Conget and Minguell, 1999; Prockop, 1997). They also have a positive
expression for CD13 (ANPEP), CD29 (β1 integrin), CD73 (NTSE), CD90 (THY1), CD105
25
(Endoglin) and SSEA-4 (stage-specific embryonic antigen) (Boiret et al., 2005; Delorme
and Charbord, 2007; Gang et al., 2007; Jones et al., 2006). Finally, it is important to point
CD271 (low-affinity nerve growth factor receptor), as one of the best bone marrow
subpopulation markers for BMSCs. This expression difference between subpopulations
is based on the high expression on these cells and low expression in all other marrow
cell populations (Bühring et al., 2007; Cuthbert et al., 2015) (Table 1).
c. Differentiation
The MSCs from the bone marrow are non-hematopoietic cells that exhibit
multilineage differentiation capacity. Many studies demonstrated the ability of these
cells to give rise to diverse mesenchymal derivatives like cartilage, cardiac muscle,
skeletal muscle, bone and adipose tissue (Arthur et al., 2009; Bianco et al., 2001; Conget
and Minguell, 1999; Matsuda et al., 2005; Prockop, 1997; Zheng et al., 2013). Contrary
to their original germ line, they have also the potential to differentiate into
neuroectodermal cells as neuron-like cells (Krampera et al., 2007; Sanchez-Ramos et al.,
2000; Zhang et al., 2012). Even so, this neuron-like cell differentiation potential is lower
than DPSCs differentiation ability (Isobe et al., 2016; Pagella et al., 2020).
The osteogenic differentiation of BMSCs is based on the supplementation of the

media with dexamethasone, L-ascorbic acid and β-glycerol phosphate (or other
phosphate-containing molecule to work as phosphate source) like DPSCs. These
molecules enhances the transcription of the gene RUNX2, one of the first genes involved
in osteodifferentiation process (Langenbach and Handschel, 2013).
Otherwise, for the adipogenic differentiation, the most used media cocktails are
based on dexamethasone, indomethacin and IBMX (Zheng et al., 2013).
Moreover, for the chondrogenic differentiation the essential molecules are

dexamethasone, sodium pyrubate, L-ascorbic acid, proline, (ITS) and TGF-β1 (Solchaga
et al., 2011). For these two, adipogenic and chondrogenic, differentiations, BMSCs
demonstrated higher differentiation potential that DPSCs (Isobe et al., 2016).
In addition, BMSCs are also capable to differentiate to other mesenchymal cell

such as, cadiomyocytes, skeletal muscle, tendon and hematopoietic-supporting stroma
(Guo et al., 2018; Matsuda et al., 2005; Tian et al., 2010; Wu et al., 2018) (figure 6).
26
Introduction
Since the BMSCs are mesenchymal origin cells, the aforementioned

differentiation outcomes can be considered as “natural”. Even so, these cells have the
potential to differentiate to neuron-like cells (cells expressing some neuron markers)
from neuroectodermal germ line. For this differentiation, there are two most used
media cocktails. On the one hand is the one using basic fibroblast growth factor (bFGF).
In various cell types and tissues four FGF receptors can be found with different
expression levels (Eswarakumar et al., 2005). This receptors can activate signaling
pathways as Src, Crk, phospholipase C-ϒ (PLC-ϒ) and SNT-1/FRS2, some of them involved
in neurogenic differentiation (Powers et al., 2000; Reuss and von Bohlen und Halbach,
2003). Some investigations conclude that the SNT-1/FRS2 signaling pathway activates
MAPK/ERK cascade, determinant for the secretion of neurotrophic factors (Abe and
Saito, 2000). On the other hand we have β-mercaptoethanol (BME) being able to induce
the expression of neuron specific enolase (NSE), NeuN and neurofilament-M after 7 days
of culture. (Khanabdali et al., 2016; Khang et al., 2012; Scintu et al., 2006).
27
Figure 6. Differentiation potential of bone marrow mesenchymal stem cells (BMSCs). (Muruganandan
et al., 2009).
2. Scaffolds for bone tissue engineering
The term scaffold refers to three-dimensional (3D) biomaterials that provide an

adequate environment for regeneration of tissues and organs. The purpose of creating
new biomaterials is to develop new scaffolds with similar properties to the natural
environment and multi-functional features (Dhandayuthapani et al., 2011) (Figure 7).
In bone tissue engineering, scaffolds must meet three characteristics to be used

as bone grafts: osteoconductivity, osteoinductivity and osteointegration (Albrektsson
and Johansson, 2001). Osteoconductivity indicates that the bone could grow in the graft,
while osteointegration is referred to the direct contact between the implant surface and
the bone. This could vary depending on the type of material, site of implantation, etc.
(Khan et al., 2005). Osteoinductivity is the property to induce the differentiation of
multipotent stem cells to bone-forming cells mediated by growth factors (Roberts and
Rosenbaum, 2012).
Historically, the main characteristic of the first-generation of biomaterials was

the biocompatibility. The purpose of these materials was to keep similar physical
properties of the replaced tissue while being inert. Ceramics (zirconia and alumina),
metals (titanium, stainless steel and alloys) and polymers (rubber, silicone,
polypropylene and polymethylmethacrylate) compose these first-generation
biomaterials for bone tissue engineering. Some of these scaffolds lead to a non-specific
immune response, ending with the encapsulation of the material by fibrotic connective
tissue, isolating it from the surrounding tissues (Anderson, 2001).
Moreover, trying to avoid those non-specific immune response, biointeractivity

was the goal for the second-generation. This was performed by coating first generation
materials surfaces with hydroxyapatite (HA) or β-tricalcium phosphate, allowing
mineralization. Other bone grafts used in this generation were biodegradable scaffolds.
With a rate of degradation matching bone-healing rate, the aim of this material is to
provide support to the bone generating cells while the body reabsorbs it. Natural
28
Introduction
polymers (hyaluronic acid and chitosan) and synthetic ones (polyglicolide and
polylactide) are common examples (Navarro et al., 2008).
The third-generation of scaffolds, in which we are nowadays, are bioresponsive

materials. Those are biomaterials capable of activating specific genes to promote
proliferation and differentiation of cells. This generation is based on tissue engineering,
promoting bone regeneration and vascularization using natural or synthetic scaffolds
coated with stem cells and growth factors (Amini et al., 2012; Hench and Polak, 2002;
Rahman et al., 2018).
Figure 7. Bone tissue engineering. Bone scaffold with autologous stem cells put in a bioreactor with
growth factors enable the growth of autologous bone grafts in vitro for bone repair applications in vivo.
(Ng et al., 2017).
Nowadays, natural or synthetic polymers and inorganic materials compose the

scaffolds for bone tissue engineering.
The most commonly used synthetic polymers are poly-glycolic acid (PGA), poly-
lactic acid (PLA) and their copolymers. Their degradation rate control and excellent
mechanical properties make them a good choice for cell transplantation for tissue
engineering (Dorati et al., 2017).
29
Moreover, natural biological components are proteins (collagen, fibrin gels, soy
and silk) and polysaccharides (alginate, chitin/chitosan, starch, and hyaluronic acid
derivates). They are a good option for enhancing cell adhesion, however, they allow less
control on the biodegradability and mechanical characteristics. Besides, they could
produce some immunogenicity (Dorati et al., 2017).
Finally, we can find inorganic materials such as, metals, tricalcium phosphate
(TCP), bioactive glasses, hydroxyapatite (HA), wollastonite and several combination of
them as HA-TCP biphasic ceramics. The best feature they have is the similarity to the
bone mineral phase (Kokubo and Takadama, 2006; Lakshmi and Sasikumar, 2015;
Stevens, 2008). The main disadvantage of these materials is the low or lack of
degradation so they cannot be reabsorbed, thus hindering the creation of new tissue.
One of the features that seems to be crucial for cell proliferation and
differentiation in recent investigations is the porosity of the scaffolds. Some studies
showed that pore sizes between 100 and 400 µm were the perfect size for the formation
of mature bone by enhancing vascularization and cell infiltration (Boyan et al., 2016a;
Murphy et al., 2010), while other studies suggested that 800 µm pore size was more
appropriate for the cell growth (Roosa et al., 2010). In contrast, small pore sizes (<100
µm) are related with fibrous tissue and non-mineralized osteoid formation (Iviglia et al.,
2019; Liu et al., 2018). At the same time, micropores have more surface area, promoting
ion exchange and cell and bone protein adhesion (Abbasi et al., 2019; Diaz-Rodriguez et
al., 2018; Morejón et al., 2019).
Another relevant characteristic of scaffolds to take account of is the form of the

material. Concave surfaces exhibit better tissue formation comparing to flat and convex
surfaces. In concave surfaces cell alignment is greater due to more density of actin and
myosin fibers while in convex surface the tissue growth is delayed (Bianchi et al., 2014;
Knychala et al., 2013).
2.1. Titanium
In the last half a century, titanium implants have been established as the best
option for teeth replacement due to their resistance, durability and their high
30
Introduction
osteointegration capacity (Albrektsson et al., 1981; Breine and Brånemark, 1980).

However, the lack of sufficient alveolar bone, bacterial infections (e.g. Perimplantitis),
implant surface microporosity or the lack of activation of surrounding mesenchymal
stem cells compromise the efficacy of these implants (Boyan et al., 2016a; Graziano et
al., 2008). Hence, new scaffolds, surface topography and stem cells based research for
the regeneration of maxillary and mandibular bone can lead to a substantial
improvement for clinical implantology.
Despite titanium proved to be the best material for dental implants, in the last
decades it has been demonstrated the importance of the design and manufacturing
different implant surfaces in order to enhance their osteointegraton (Gasik et al., 2015;
Rani et al., 2012; Rupp et al., 2018; Salou et al., 2015). Apart from the composition of
the titanium, it is important to consider the topography of its surface for a durable
anchorage of the titanium implant (Annunziata and Guida, 2015; Jemat et al., 2015; Le
Guéhennec et al., 2007; Naves et al., 2015).
Rough titanium surfaces, maximizing the contact surface with the surrounding
alveolar bone, has proven to have a better osteointegration compared to smooth
titanium ones (Coelho et al., 2009). The better integration in the bone could be
attributed to the microporosity of the titanium surface due to the promotion of
osteoblastic differentiation of surrounding mesenchymal cells. Lastly, these
mesenchymal cells are responsible for consolidation and bone healing after the
placement of the implant (Boyan et al., 2016a; Graziano et al., 2008).
As mentioned before, different investigations concluded that the small pores

(<180 µm) promoted cell differentiation at the beginning of implant healing, while large
pores (>300 µm) enhanced cell proliferation and bone growth (Coelho et al., 2015).
However, the porosity affects directly to the mechanical properties of the material so it
is essential a correct balance between porosity and toughness depending on the type of
the implant. Furthermore, other investigations also showed that porous titanium
scaffolds have weaker corrosion resistance due to dynamic flow of the body fluid
through. Porosity allows higher body fluid flow through the scaffold accelerating its
degradation (Chen et al., 2017).
31
Another important reason in the development of porous titanium is also to

decrease implant stiffness. It has seen that hard titanium surfaces decrease bone
creation and remodeling because of the negative implications of stress shielding,
causing bone reabsorption and finally, implant loosening (Ma et al., 2006; Świeczko-
Żurek, 2009) (figure 8).
Titanium solid core Figure 8. Porous surface made on

titanium dental implant. (Pałka and
Pokrowiecki, 2018).
The titanium alloys can be classified into three groups:
1- Α phase stabilizers: carbon (C), oxygen (O), aluminium (Al) and nitrogen (N).
2- Β phase stabilizers:
a. Isomorphous: tantalum (Ta), molybdenum (Mo), vanadium (V) and
niobum (Nb).
b. Eutectoid: silicon (Si), chromium (Cr), copper (Cu), hydrogen (H),
manganese (Mn), nickel (Ni) and iron (Fe).
3- Neutral additions: tin (Sn) and zirconium (Zr).
The activation of surrounding mesenchymal cells of the affected alveolar bone

area is essential to enhance the implant integration to the bone to improve durability,
resistance and avoid implant failure due to bacterial infections (e.g. Perimplantitis). For
this reasons, the combination of titanium implants with cellular allografts/autografts
promises to offer considerable advantages for clinical implantology.
32
Introduction
2.2. Decellularized Adipose Tissue (DAT)
Most of the actual dental implant roots are inert surface-micropatterned metal
alloys. The use of these implants alone or in combination with decellularized bone
matrix and plasma derived growth factors promotes the osteodifferentiation of
mesenchymal stem cells, generating bone directly in the implant surface (Anitua et al.,
2016; Boyan et al., 2016a; Mayer et al., 2018; Zanicotti et al., 2018). The main problem
of actual dental implants is developing periimplantitis. This is caused by the continuous
mechanical pressure transferred from the implant to the bone tissue during natural
mastication. In the worst scenario, periimplantitis leads to the loss of the dental implant
(Bertolini et al., 2019). In natural teeth, this problem is solved thanks to the periodontal
ligament (PDL), a highly innervated and vascularized connective tissue composed by
strong collagen bundles. These collagen fiber bundles are anchored to the dental root
cement and the alveolar bone by lightly calcified edges, also named as Sharpey´s
perforating fibers (Aaron, 2012). The principal PDL function is acting as a cushion to
absorb the masticatory forces to protect alveolar bone.
Decellularized Adipose Tissue (DAT) seems to be a promising biomaterial for

tissue engineering due to great characteristic such as malleability, accessibility and
bioactive properties (Yang et al., 2020). It had already showed in vivo biocompatibility
(Wang et al., 2013). One of the most interesting features of DAT is the softness of this
material, which may help in the creation of connective tissue interface between dental
implant root and the alveolar bone. DAT is obtained from white adipose tissue, a highly
vascularised tissue. It also helps the cell adhesion and integration because of the high
concentration of basement membrane proteins it contains such as collagen (type I, III
and IV), perlecan (sulphatated proteoglycan) and laminin (Yang et al., 2020). The
decellularization process has also been improved (Madarieta Pardo et al., 2017). It is
also important to mention that the DAT can be processed in different ways depending
on the application. In the case of bone tissue regeneration, the most promising
33
formulation is the solid foam due to the porosity and the high volume per weight ratio,
allowing nutrients, signals and cell mobility through the scaffold matrix (figure 9).
Figure 9. Macroscopic (A, B) and scanning electron microscopic (SEM) (C, D), images of native porcine
adipose tissue (A, C) and decellularized extracellular matrix (ECM) (B, D). Scale bar: 50 µm. (Choi et al.,
2012).
3. Growth factors
In the last decades, molecules as bone morphogenetic proteins (BMPs) and

enamel matrix derivate (EMD) have been using to promote the regeneration of damaged
or lost tissues (Dumic-Cule et al., 2018; Miron et al., 2016; Rao et al., 2013). However, in
recent years, platelet derived products have become a very promising tool for enhancing
cell regeneration and differentiation in tissue engineering.
3.1. Plasma derived products
With the purpose of enhancing local healing in the damaged zone, the concept
of concentrated platelets and autologous growth factors was born by collecting plasma
solutions (Anfossi et al., 1989; Fijnheer et al., 1990). The name given in the late 1990s
was platelet rich plasma (PRP) (Jameson, 2007; Marx et al., 1998; Whitman et al., 1997).
34
Introduction
PRP is composed of platelets that when activated releases growth factors enhancing cell
proliferation, adhesion and migration of the cells in the damaged zone (Jameson, 2007;
Marx, 2004). After PRP, a second plasma derived product was formulated using
anticoagulants, which was termed platelet-rich growth factor (PRGF) (Anitua, 1999).
Moreover, to avoid the biggest limitation of these two products, being difficult to
handle, a second generation of plasma derived product was created by Choukoun et al.
in 2001 to enhance hard and soft tissue regeneration in maxillofacial and oral surgery,
platelet rich fibrin (PRF) (Kumar and Shubhashini, 2013).
Among the growth factors and cytokines being released by activated platelets
the following can be included: transforming growth factor β1 (TGF-β1), platelet derived
growth factor (PDGF), vascular endothelial growth factor (VEGF), fibroblast growth
factor (FGF), epidermal growth factor (EGF) and interleukins (IL) as IL-1β, IL-4 and IL-6
(Dohan et al., 2006).
Despite the preparation of PRP and PRGF is almost the same, PRGF contains more
plasma proteins and coagulation factors, enhancing the effect comparing to PRP (Anitua,
1999).
The mixture of factors of both plasma-derived products, PRGF and PRF, induces
the proliferation and differentiation of the surrounding mesenchymal cells to
osteoblastic cells. One of the best characteristics of this product is the possibility to be
used as autologous personalized therapy (Anitua et al., 2013). The benefits of the use of
this product are widely exploited in different experimental and clinical tissue
regeneration therapies and especially in implant dentistry therapies (Anitua et al., 2016;
Masuki et al., 2016) (figure 10).
35
Figure 10. Images showing PRGF (left) and PRF (right).
PRGF is composed of a platelet-enriched plasma fraction. It is obtained by

centrifugation of patient´s blood sample and afterwards by activation with calcium
chloride. The calcium treatment triggers platelet degranulation, obtaining a polymerized
fibrin clot and a complex mixture of growth factors (Anitua et al., 2009; Jovani-Sancho
et al., 2016; Paknejad et al., 2012). The following centrifugation separates the fibrin clot
from the growth factors rich soluble fraction (Anitua et al., 2012).
To obtain PRF it is necessary a fast centrifugation after the blood extraction since
it is extracted in absence of anticoagulants. After the separation of blood fractions, the
clot containing platelet and leukocytes, can be easily manipulated and flattened into a
membrane. The most interesting feature of it is the progressive release of the growth
factors due to the degranulation of the platelet over time. After surgery, these growth
factors stimulate tissue healing upon enhancing cell proliferation and chemotaxis. The
fibrin clot is easy to manipulate, resistant, strong and flexible, giving them great
adaptability characteristics to be used in varied anatomical surfaces (Khurana et al.,
2017; Kumar et al., 2016).
Nowadays, the use of plasma rich in growth factors (PRGF) and platelet rich fibrin (PRF)
in the dental clinic to promote bone healing for the placement of the titanium implant
after the tooth extraction is widely extended. It is known as plasma-derived advanced
medical therapy products (AMTP) (Giannini et al., 2015; Kobayashi et al., 2016;
Nishiyama et al., 2016).
36
Materials and Methods
Material and Methods
hBMSC isolation and culture
The hBMSCs were obtained in the Laboratory for Cell and Tissue Engineering
(Ehrbarlab) of the University of Zurich (Zurich, Switzerland) with the following
procedure: the hBMSCs were obtained from aspirates of the bone marrow during
orthopedic surgical procedures of human healthy donors (average age 45 years old). The
aspirate was obtained after informed consent established by the local ethical committee
(University Hospital Basel; Prof. Kummer; approval date 26/03/2007 Ref. Number
78/07). For the isolation of nucleated cells, the red blood cells from the aspirate were
lysed using a buffer containing 0.15 M NH4Cl (Sigma, Switzerland), 1 mM KHCO3 (Sigma,
Switzerland) and 0.1 mM Na2EDTA (Fluka, Switzerland). hBMSC cells were cultured in
minimal essential medium (αMEM, Gibco, NY, USA) supplemented with 10 % FBS (Gibco,
NY, USA), 1 % penicillin-streptomycin (Gibco, NY, USA) and 5 ng/ml fibroblast growth
factor 2 (FGF2) (PeproTech, NJ, USA) at 37 °C in 5 % CO2. Passages between 3 and 8
maximum culture age were used on experimentation.
hDPSC isolation and culture
Human dental pulp stem cells (hDPSCs) were isolated from the third molar teeth
of young healthy patients (age 18-30) in dental clinics. All the patients signed an
informed consent. The competent authority (Ethics committee of the University of the
Basque Country) under the M10_2016_088 protocol had previously approved the
procedures officially.
Dental pulp extraction was performed by fracturing the molar. The obtained pulp
was digested with an enzymatic solution containing 3 mg/mL collagenase type I (Gibco,
NY, USA) and 4 mg/mL dispase (Sigma, MO, USA) in Hank´s balanced salt solution (HBSS,
Gibco, NY, USA), and then incubated at 37 °C for 1 hour. The enzymatic digestion
solution was neutralized with Dulbecco´s modified eagle medium (DMEM, Lonza,
Switzerland) supplemented with 10 % fetal bovine serum (FBS, HyClone, UT, USA). Then,
the cells were centrifuged at 1500 rpm for 5 minutes. The pellet was mechanically
disrupted by 18G needles (BD Microlance, Fisher Scientific, UK). After the disassociation,
39
the cells were seeded in 25 cm2 flask (Sarstedt, Nümbrecht, Germany) with DMEM
supplemented with 10 % FBS, 1 % penicillin-streptomycin (Gibco, NY, USA) and 1 % L-
glutamine (Sigma, MO, USA) at 37 °C in 5 % CO2. After reaching 80 % confluence, the
cells were subcultured to 75 cm2 flasks (Sarstedt, Nümbrecht, Germany). Passages
between 4 and 10 and maximum culture age were used on experimentation.
Osteogenic differentiation media
For hDPSC cultured on titanium surfaces and pDAT solid foams experimentation
the osteogenic media was composed by DMEM (10 % FBS, 1 % penicillin/streptomycin
and 1 % L-glutamine) supplemented with 50 µM ascorbic acid (Sigma, MO, USA), 20 mM
β-glycerolphosphate (Sigma, MO, USA) and 10 nM dexamethasone (Sigma, MO, USA).
For the comparative study of hDPSCs and hBMSCs the osteogenic media were composed
by DMEM (10 % FBS, 1 % penicillin/streptomycin and 1 % L-glutamine) supplemented
with 50 µM ascorbic acid, 10 mM β-glycerolphosphate and 100 nM dexamethasone. For
these comparative experiments, both control and osteogenic media were
supplemented with 5 ng/ml EGF (AF-100-15-500UG, PeproTech, NJ, USA) .
Titanium disc manufacture
Ti6Al4V 2 mm thick discs were obtained cutting a 5.5 mm diameter bar, provided
by Avinent Implant System SLU (Barcelona, Spain). For the manufacture of BAS™
(Biomimetic Advanced Surface) titanium surface, one face of the titanium disc was
treated by shot blasting using white corundum (Al2O3) F60 with projection particle sizes
of 212-300 μm. Next, the discs were washed in an ultrasonic bath for 10 min and rinsed
with deionized water. Afterwards, they were anodized by connecting them to a DC
power source anode and using calcium and phosphorus as an electrolyte in an aqueous
solution. A current was applied to this solution with a density of 0.75 mA/mm2 and the
potential was freely allowed to increase until reaching 130 V. Subsequently, the titanium
discs were rinsed by deionized water for 10 minutes in an ultrasonic bath. Ti6Al4V
titanium discs did not undergo any surface treatment or polishing.
40
pDAT decellularization and processing as a solid foam
Porcine adipose tissue was harvested in a local food company (Jaucha SL,
Navarra, Spain). The tissue was defrosted at room temperature, cleaned and creamed
by a beater. Then, tissue was homogenized on ice by Polyton (PT3100) with two different
rods at 1200 rpm for 5 minutes. To produce phase separation of lipids, homogenized
tissue was centrifuged at 900 g with ultrapure water for 5 minutes. Lipids were discarded
manually and proteins conserved. The protein pellets were treated overnight under
orbital shaking with isopropanol (Merk Life Science, Spain) at room temperature.
Afterwards, it was cleaned with PBS and treated using 1 % Triton X-100 and 0.1 %
ammonium hydroxide (Merk Life Science, Spain) in an orbital shaker for 36 hours at
room temperature. After cleaning the material again with PBS it was lyophilized to
completely dry up. Then, the tissue was milled by a mixer mill (Retsch MM400) to obtain
fine-grained powder suitable for processing. The resulting powder was frozen in liquid
nitrogen and storage at 4°C in a vacuum desiccator.
Solid foams were prepared by pDAT freeze-drying method. 0.5 M acetic acid was
added to 0.5 % pDAT, the solution was homogenized by magnetic stirring for 48 hours
at room temperature. Teflon moulds of 20 mm diameter and 3 mm thickness were used
for Scanning Electron Microscopy (SEM) with 1 ml solution. In the case of in vitro cell
culture assays, solid foams were formed in Millicell EZ-slide 8 well glass slides (Merk
Millipore) using 120 µl solution per well. The resulting slides were compatible for optic
and fluorescence microscopy. To obtain solid foams the samples were frozen at -20 °C
and freeze-dried (0.63 mbar and -10 °C). Solid foams for cell culture were sterilized by
ethylene oxide (Esterilizacion SL, Barcelona, Spain).
PRGF and PRF preparation
For the preparation of PRGF, blood from human healthy young donors was
collected in 5 ml blood collection tubes with 3.8 % sodium citrate anticoagulant (BD
Vacutainer, Plymouth, UK). After centrifugation at 580 g for 8 minutes, platelet-rich
fraction was transferred to 15 ml falcon tubes. Then, the platelets were activated with
41
10 % calcium chloride (Braun medical, Melsungen, Germany) for 1 hour at 37 °C.

Following the incubation, the plasma was centrifuged at 3000 g for 15 minutes at 4 °C
and filtered by 0.2 µm pore-size filters (Sarstedt, Nümbrecht, Germany). Then, the
plasma was aliquoted and stored at -20 °C until use. The PRGF was added in media
changes every two days (figure 11).
For obtaining PRF, blood was collected in tubes without anticoagulant (BD
Vacutainer, Plymouth, UK). The samples were immediately centrifuged at 580 g for 8
minutes to avoid the blood coagulation. After the coagulation and separation of blood
fraction and fibrin clot, the platelet-containing fibrin clot was separated from the
hematocrit fraction by scalpel and forceps. Then it was compressed between two glasses
by weight for 1 hour at room temperature. The fibrin clots were cut to obtain smaller
sections of around 1 cm2 (figure 11).
Anticoagulant
Platelet
activation
Centrifuge blood with CaCl2
PRGF
sample
Plasma PRF
Blood Buffy coat
withdraw Erytrocytes Fibrin
coagule
No anticoagulant formation Compression
device
Figure 11. Illustration of plasma-derived PRGF and PRF preparation. (Own creation).
Culture of hDPSCs and hBMSCs on titanium discs
When the cells reached 80 % confluence, they were detached from the bottom
of the flask with 0.05 % trypsin-EDTA, centrifuged and counted. Different densities of
cells were seeded on Ti6Al4V and BAS™ titanium discs, depending on the assay. To
42
improve attachment, 15.000 cells were seeded in a 70 µl drop on the discs, and
incubated for 3 hours at 37 °C. Afterwards, 700 µl of DMEM medium was added for 24
well plates and 4 ml for 6 well plates.
Culture of hDPSCs on porcine Decellularised Adipose Tissue (pDAT)
When the cells reached 80 % confluence, they were detached from the bottom
of the flask with 0.05 % trypsin-EDTA, centrifuged and counted. pDAT (Tecnalia,
Donostia, Spain) was placed in 24 well plates (Sarstedt, Nümbrecht, Germany) and 8 well
Ibidi plates (Ibidi, Munich, Germany). After hydrating the pDAT with DMEM medium, the
hDPSCs were seeded in a concentration of 10.000-20.000 cells/well (depending on the
assay). The medium was changed every 2-3 days.
Calcein/ propidium iodide assay
After 4 days of culture, the cells were washed with PBS. This step was followed
by an incubation of the cells with 3 µM calcein-AM (Molecular probes, OR, USA) and 2.5
μM propidium iodide (Sigma, MO, USA) for 30 minutes at 37 °C. Afterwards, the cells
were washed with PBS three times and photographed by using an Axioskop fluorescence
microscope (Zeiss, Overkochen, Germany) and a Nikon DS-Qi1 camera (Nikon, Tokyo,
Japan).
Immunocytochemistry
After culture, the cells were washed with PBS and fixed in 4 % paraformaldehyde
(PFA) at room temperature for 10 minutes. Then, the cells were incubated for 10
minutes with 10 % goat serum (Invitrogen, CA, USA) at room temperature. The blocking
step was followed by overnight incubation at 4 °C in 0.1 % Triton X-100/ 1 % BSA/ PBS
with the following antibodies: BGLAP (ab93876, Rabbit polyclonal, Abcam, Cambridge,
UK), Caspase-3 (ab32351, Rabbit monoclonal, Abcam, Cambridge, UK), Ki67 (ab15580,
Rabbit polyclonal, Abcam, Cambridge, UK), Osterix (ab22552, Rabbit polyclonal, Abcam,
Cambridge, UK) and SPARC (ab14174, Rabbit polyclonal, Abcam, Cambridge, UK). Alexa
43
488 conjugated rabbit IgG (A11008, Abcam, Cambridge, UK) was used as secondary
antibody for primary antibody localization in 1 % BSA/ PBS for 1 hour at room
temperature. The nuclei were stained with 4’,6-diamino-2-phenilindol (DAPI, Invitrogen,
CA, USA). The images were taken using an Axioskop fluorescence microscope (Zeiss,
Overkochen, Germany) and Nikon DS-Qi1 camera (Nikon, Tokyo, Japan) and by Leica
DM6000 B microscope (Leica, Wetzlar, Germany), Leica DFC420 C camera with
3.3.3.16958 Leica application suite X (Leica, Wetzlar, Germany).
Flow cytometry
The phenotype of hDPSCs and hBMSCs was confirmed by flow cytometry

analysis. For each antibody, 500.000 cells were enzymatically detached and incubated
in PBS 0.15 % bovine serum-albumin (BSA, Sigma, MO, USA) with CD45-APC 1:50
(304011, Biolegend, CA, USA), CD73-APC 1:50 (17-0739-41, eBioscience, MA, USA),
CD90-FITC 1:50 (328107, Biolegend, CA, USA) and CD105-PE 1:50 (12-1057, eBioscience,
MA, USA) for 40 minutes on ice. The cells were washed by PBS 0.15 % BSA and finally
resuspended in 500 μl of PBS. The analysis was performed using a Gallios flow cytometer
(Beckman Coulter, CA, USA) and data were analyzed using Kaluza 1.1 software (Beckman
Coulter, CA, USA).
Scanning electron microscopy (SEM)
The cells cultured on both titanium surfaces were fixed with 2 % glutaraldehyde
(Sigma, MO, USA) in 0.1 M Sorensen phosphate buffer (SPB, Thermo Fisher Scientific,
MA, USA) for 1 hour at 4 °C. The samples were washed 3 times with 4-8 % sucrose in 0.1
M SPB and followed by other three washes in 0.1 M SPB. Then, the cells were dehydrated
with 15 minutes series of ethanol (30 %, 50 %, 70 %, 90 % and 100 %) and a final wash
by hexamethyldisilazane (Sigma, MO, USA). After dehydration, the samples were air-
dried and sputten coated by 15 nm gold. The images were taken using a scanning
electron microscope (SEM) (S4800, Hitachi High Technologies, Tokyo, Japan). Moreover,
images of titanium discs without cells were also obtained by SEM.
44
Transmission electron microscopy (TEM)
The samples were fixed with 2 % glutaraldehyde for 15 minutes and embedded
in Epon Polarbed resin (Electron Microscopy Science, Hatfield, PA, USA). 70 nm ultrathin
sections were deposited onto 150 mesh copper grids (150 Square Mesh xopper 3,05
mm, AGAR Scientific, UK). Post-staining was performed with 2 % uranyl acetate in
distilled water (AGAR Scientific, UK) and 0.2 % lead in citrate in distilled water (AGR1210,
AGAR Scientific, UK). The images were taken in a Philips EM208S transmission electron
microscope with an integrated Jeol JEM 1400 Plus camera.
RNA extraction and retrotranscription
Cell pellets were stored frozen at -80 °C until use. The RNA extraction was
performed using RNeasy mini kit (Qiagen, Hilden, Germany). RNA concentration and
purity was measured by 260/280 nm absorbance in Nanodrop Synergy HT device
(Biotek, VT, USA). cDNA synthesis was made by retrotranscription was made starting
from 1000 ng of RNA using iScript cDNA Kit (Biorad, CA, USA). The retrotranscription
cycle started with 5 minutes at 25 °C, followed by 20 minutes at 46 °C and finished by 1
minute at 95 °C. Once the retrotranscription finished the lid stayed at 4 °C until the
samples were frozen at -20 °C.
RNA sequencing
hDPSCs and hBMSCs were cultured on plastic, Ti6AL4V and BAS titanium surfaces
in presence or absence of osteoblastic differentiation media for 14 days. 24 seeded discs
were used for each condition, after tripsinization the cells were put together and the
RNA was extracted using Qiagen RNA extraction kit. The RNA extracted from hDPSCs
and hBMSCs were sequenced by the Genomic center of the University of Zurich using
Illumina (Illunmina, CA, USA) obtaining 25.000 RNA lectures per sample. The gene
expression were analyzed by presence/absence (ON/OFF) term of different condition
45
comparison and the threshold was set at limit of 10 raw reads to categorize a gene as
effectively expressed (ON). Statistical significantly activated pathways were analyzed by
“Pathway Enrichment Analysis” using The Connectivity Map (CMAP) and Gene Ontology
enrichment Biological Process (GOBP) by the Genome Analysis Platform of the CIC
bioGUNE (CIC bioGUNE, Derio, Spain).
Quantitative real-time PCR (qPCR)
Power SYBR Green PCR Master Mix (Applied biosystems, CA, USA) was used to
perform the Q-PCR. The initial step for the amplification program was at 95 °C for 10
minutes, followed by 40 cycles of 95°C for 20 seconds, 59 °C for 1 minute. The
housekeeping genes used were β-actin 5´-GTTGTCGACGACGAGCG-3´ and 5´-
GCACAGAGCCTCGCCTT-3´ and Gapdh 5´ CTTTTGCGTCGCCAG -3´ and 5´-
TTGATGGCAACAATATCCAC -3´. The target genes forward and reverse sequences were
as follows: collagen I (COL I) 5´ -GGCCCCCTGGTATGACTGGCT-3´ and 5´-
CGCCACGGGGACCACGAATC-3´, osteonectin (SPARC) 5´-GAAAGAAGATCCAGGCCCTC-3´
and 5´-CTTCAGACTGCCCGGAGA-3´, osteocalcin (BGLAP) 5´-CGCCTGGGTCTCTTCACTAC-
3´ and 5´-CTCACACTCCTCGCCCTATT-3´, dentin sialophosphoprotein (DSPP) 5´-
TGCCCAAATGCAAAAATATG-3´ and 5´-GTGGGCCACTTTCAGTCTTC-3´, osterix (OSX) 5´-
TGAGGAGGAAGTTCACTATG-3´ and 5´-CATTAGTGCTTGTAAAGGGG-3´and runx2
(RUNX2) 5´-CACTCACTACCACACCTACC-3´ and 5´-TTCCATCAGCGTCAACAC-3´. The target
gene expression was normalized against the housekeeping genes.
Alkaline phosphatase (ALP) assay
Briefly, the cells were fixed with 4 % PFA for 1 minute and washed 3 times by
0.05 % Tween 20-PBS. For the ALP staining, 5-bromo-4-chloro-3-indolyl phosphate/nitro
blue tetrazolium (NBT/BCIP; Sigma, MO, USA) was used as a substrate and the staining
was checked every 3 minutes. After the staining was concluded, cells were washed three
times for 5 minutes with PBS. The images were taken using a Zeiss Stemi 2000-C
stereoscopic microscope (Zeiss, Germany) and Canon PowerShot A80 camera (Canon,
Tokyo, Japan). For ALP enzymatic activity quantification, cells were detached by 0.05 %
46
Trypsin-ethylenediaminetetraacetic acid (EDTA) (Trypsin, Gibco, NY, USA). The

enzymatic activity absorbance was measured at 420 nm using a Synergy HT microplate
reader (BioTek, VT, USA) equipped with the Gen5 1.11 program.
Alizarin Red (ARS) assay
To prove the osteogenic potential of hDPSCs and hBMSCs, Alizarin Red was used
to stain extracellular calcium deposits. After 21 days of culture, the cells were fixed for
10 minutes with 4% paraformaldehyde. The samples were washed with distilled water
and then stained in dark using 2 % ARS (Acros organics, Sigma, MO, USA), pH 4.2 at room
temperature for 45 minutes. The staining was then washed with distilled water,
followed by 3 rinses of 5 minutes each until no ARS remaining was observed. The images
were taken by a Zeiss Stemi 2000-C stereoscopic microscope (Zeiss, Germany) and a
Canon PowerShot A80 camera (Canon, Tokyo, Japan). Afterwards, for quantification, the
Alizarin Red stained calcium-containing deposits were dissolved in acetic acid (Sigma,
MO, USA) and the absorbance of solubilized ARS was measured at 405 nm using a
Synergy HT microplate reader (BioTek, VT, USA).
Statistical analysis
Statistical analyses were carried out using the IBM SPSS Statistical software (v.
26.0), calculating the mean and standard error for each condition. The data from the
different experimental conditions were compared using a Mann Whitney test or ANOVA
followed by the Bonferroni or Games-Howell test depending on the homogeneity of the
variances. The confidence intervals were fixed at 95 % (p < 0.05), 99 % (p < 0.01) and
99.9 % (p < 0.001).
47
Hypothesis
Hypothesis
In the last decades, dental implants and scaffolds for bone tissue engineering and
dental implantology have improved a lot. New materials, surface topography and
roughness changes showed to have a direct impact on mesenchymal stem cell
differentiation to osteoblasts. With all these new scaffolds that had shown a good
induction of osteoblastic differentiation potential due to upgrades in porosity,
roughness or shape, the best option for clinical use is still unclear. Thanks to their high
proliferation and differentiation potential, MSCs seemed to be the future of bone tissue
engineering; however, the debate about the best MSCs for bone regeneration therapies
is still open. Finally, tissue engineering is facing the challenge of a widespread use of
animal-derived sera like fetal bovine serum (FBS), which must be replaced in order to
inactivate the immune response of the cell grafted patients.
With the aim to create a substitute for crucial tissue as periodontal ligament to
avoid implant loose due to periimplantitis, we hypothesized that biomimetic BAS TM
titanium surfaces and Decellularized Adipose Tissue (DAT) would provide a more
effective implant material and scaffold for stem cell osteogenic differentiation for bone
tissue engineering. Furthermore, the easily extracted, highly proliferative and
osteodifferentiable human dental pulp stem cells (hDPSCs) would be a very good option
for autologous regenerative cell therapies. Lastly, plasma-derived products like Plasma
rich in growth factors (PRGF) and Platelet rich fibrin (PRF) could provide an excellent FBS
substitute for in vitro cell cultures. Since it is possible to obtain these plasma products
from the patients themselves, this would avoid non-desirable immune responses on
regenerative cell therapies.
51
General Objectives
General Objectives
The main objective of this work was the study of hDPSCs osteoblastic
differentiation potential and interactions with biomaterials for bone tissue engineering.
To this end, we assessed the effect of Ti6AL4V and BASTM titanium surfaces and porcine
Decellularized Adipose Tissue (pDAT), in combination with plasma-derived products and
osteoblastic differentiation media.
Specific objectives
1. Evaluation of cell viability and proliferation of hDPSCs when cultured on Ti6AL4V

and BAS titanium surfaces.
2. Assessment of the effect of plasma-derived products PRGF and PRF in hDPSCs
proliferation and osteoblastic differentiation.
3. Study of the synergistic effects of combining plasma-derived products in cultures
of hDPSCs with Ti6AL4V and BAS titanium growth surfaces in the presence or
absence of osteoblastic differentiation media, in terms of cell proliferation and
osteoblastic differentiation.
4. Comparison of the proliferation and osteoblastic differentiation potential of
hDPSCs and hBMSCs when cultured on Ti6AL4V and BAS titanium surfaces with
the presence or absence of osteoblastic induction media.
5. Evaluation of hDPSCs adherence and viability when cultured in Decellularized
Adipose Tissue (DAT) scaffolds.
6. Study of DAT scaffold effect on hDPSCs osteoblastic differentiation on in vitro
cultures in combination with osteoblastic differentiation media.
55
Results
Results
Isolation, culture and characterization by flow cytometry of the hDPSCs
Human dental pulp stem cells (hDPSCs) were isolated from third molars and
cultured in DMEM supplemented with fetal bovine serum (10 %), penicillin/
streptomycin (1 %) and L-Glutamine (1 %). After 2-3 weeks, the cells formed multiple
adherent colonies reaching subconfluence. On culture, the hDPSCs showed spindle-like
fibroblast shape morphology; the cells maintained this feature as well as being highly
proliferative for several passages (Figure 12).
A B
C D
Figure 12. Culture of hDPSCs in vitro. Phase-contrast microscopy images for adherent hDPSCs in culture
under subconfluence (A, C) and confluence (B, D) at low and high magnification. Adapted from (Irastorza
et al., 2019).
For the evaluation of the cellular markers of the hDPSCs, we analyzed the cell
markers by flow cytometry using antibodies against the following CD (clusters of
differentiation) antigens: CD45, CD73, CD90 and CD105. The hDPSCs were negative for
CD45, the hematopoietic marker. On the other hand, they were positive for
mesenchymal stem cell markers CD73 (100 %), CD90 (100 %) and CD105 (100 %). With
these results, we can conclude the mesenchymal stem cell phenotype of the dental pulp
stem cells on culture (Gronthos et al., 2003) (Figure 13).
59
CD 45 A B CD 73
3.0% 100.0%
CD 90 C D CD 105
100.0% 99.9%
Figure 13. Stem cell markers of the hDPSCs by flow cytometry. Flow cytometry revealed that hDPSCs
were all negative for the hematopoietic marker CD45 (A) and all positive for the mesenchymal stem cell
markers CD73, CD90 and CD105 (B, C, D, respectively). Adapted from (Irastorza et al., 2019).
Scanning electron microscopy of Ti6AL4V and BAS™ titanium surfaces for

microtopographical analysis
Cell-free raw titanium surfaces SEM images (Ti6AL4V) displaying concentrically

parallel grooves (Figure 14A, B), on the other hand, the rough titanium surface (BAS™)
showed a surface with numerous pits and bumps and uniformly dispersed small micro
pores (< 10 µm) through the whole surface (Figure 14C, D).
60
Results
A B
Ti6AL4V
C D
BAS®
Figure 14. SEM images of Ti6AL4V and BAS titanium surfaces. Scanning electron microscopy images of
titanium surfaces, Ti6AL4V (A, B) and BAS (C, D) with small and high magnifications. Adapted from
(Irastorza et al., 2019).
Cell adhesion, migration and viability of hDPSCs on Ti6AL4V and BAS™ titanium
surfaces
hDPSCs were seeded on Ti6A14V and BAS™ titanium surfaces, 20,000 cells/disc,
for 4 days. The hDPSCs strongly adhered and spread all over the smooth titanium surface
Ti6AL4V. The cells grew following the orientation of the disc´s groove pattern and
showed several cell elongations similar to lamellipodia (Figure 15 A). On the other hand,
the hDPSCs seeded on BAS titanium surface adhered by adapting their morphology to
the porous surface, penetrating deeper into the porous structure (Figure 15 B). In both
titanium surfaces the cell adhesion showed to be consistent and maintained throughout
the entire culture time.
We performed a cell viability and death assay of the hDPSCs seeded on both
titanium surfaces by culturing them in the presence of Calcein-AM (green fluorescence)
and propidium iodide (red fluorescence). The fluorescence images showed that the
hDPSCs were 100 % calcein positive on both titanium discs, demonstrating the high
61
viability of the hDPSCs grown on the smooth and rough titanium surfaces (Figure 15C,
D). Moreover, none of the hDPSCs showed PI red fluorescence, demonstrating that cell
death was negligible in these cultures.
In addition, where the nuclei of the hDPSCs had been stained in blue by DAPI,
revealed that the cells followed the groove directions on the Ti6A14V surface orientating
themselves in a spiral form (Figure 15 E), whereas the hDPSCs had no preferential
orientation while been seeded in the BAS titanium (Figure 15 F).
A C E
Ti6AL4V
B D F
BAS®
Figure 15. SEM images, viability, orientation and mobility of hDPSCs on titanium surfaces. Scanning
electron microscopy images of both titanium surfaces with hDPSC cells seeded on them (A, B,
respectively). Fluorescent microscopy images of the hDPSCs cultured for 4 days on both titanium discs to
test viability by calcein (green) and cell death by propidium iodide (red) (C, D). Scale bar: 100 µm.
Fluorescent microscopy image mosaic showing the entire titanium discs with hDPSCs nuclei stained in
blue with DAPI on Ti6A14V (E) and on BAS (F). Scale bar: 2 mm. Adapted from (Irastorza et al., 2019).
Cell proliferation assay of hDPSCs combined with PRGF grown on Ti6AL4V and BAS TM
titanium surfaces
The photometric/fluorometric quantification of the viable proliferating cells was

precluded due to the opacity of the titanium surfaces. Because of this, the total number
of viable cells (interphase or mitosis) were counted assessing their nuclear morphology
by using the DNA fluorescent stain DAPI. The images revealed that the nuclear
morphology was regular for interphase cells whereas condensed chromosomes could
62
Results
be seen in mitotic cells. As presumed, most hDPSCs appeared to be in interphase,

nevertheless, some cells were at different stages of mitosis, being most of them in
metaphase and early and late anaphase. These results indicated the normal growth and
proliferation of the hPDSCs. Even so, when the hDPSCs were grown in the presence of
soluble PRGF, the number of proliferative cells was significantly higher (20 to 50 %; p <
0.05) after 4 days of culture with respect to control conditions (Figure 16F). These results
indicated that culturing the hDPSCs in presence of plasma-derived supplements induces
an increase of the cell proliferation on titanium surfaces. To corroborate these results,
an immunoassay of Ki67 was performed. The Ki67 positive hDPSCs, cultured in presence
of PRGF and grown on both titanium surfaces, were counted showing again a significant
increase of the proliferative cells (Figure 16A-E).
Control PRGF ®
A B
Ti6AL4V
Ki67/ DAPI
C D
BAS®
E Ki67 counting F DAPI counting

2 * * 2 * *
Number of cells
Number of cells
1,5 1,5
1 1
0,5 0,5
0 0
Control Ti/PRGF Ti Control BAS/PRGF BAS Control Ti/PRGF Ti Control BAS/PRGF BAS
63
Figure 16. Proliferation assay of the hDPSCs cultured on presence of PRGF on titanium surfaces.
Immunofluorescence images of hDPSCs for Ki67 proliferation marker (green) and the nuclei stained with
DAPI (blue) in control conditions on Ti6AL4V (A) and BAS (C) titanium discs, and cultured in presence of
20 % PRGF on Ti6AL4V (B) and BAS (D) discs for 4 days. PRGF treatment increased the number of Ki67+
cells. Scale bar: 50 µm. Graphs illustrating comparison of total amount of cycling cells (KI67+) between
control (normalized number of cells) and PRGF conditions (E) and total number of nuclei (DAPI; F) of
hDPSCs grown on both titanium surfaces. Statistical significance was set at p ≤ 0.05. Adapted from
(Irastorza et al., 2019).
Alkaline phosphatase activity of hDPSCs cultured on Ti6AL4V and BAS™ titanium

surfaces
Examination of ALP activity level is a common marker of stem cells early

osteoblast differentiation. Alkaline phosphatase enzyme is essential for extracellular
matrix mineralization (Orimo, 2010). To promote osteoblastic differentiation, the
hDPSCs seeded on the Ti6AL4V and BAS titanium discs were cultured for 7 days in
presence of a widely used osteoblastic differentiation induction media consisting of the
supplementation of control media with dexamethasone, ascorbic acid and β-glycerol
phosphate (Winning et al., 2019). Moreover, two different plasma derived products,
PRGF and PRF, were also added to the culture media. ALP activity level rised markedly
on the hDPSCs cultured with osteoblastic differentiation medium in both titanium
surfaces. However, even in presence of the differentiation medium, the hDPSCs grown
with PRGF did not increase their alkaline phosphatase activity (Figure 17A, B). This result
is consistent with the high proliferation rates that hDPSCs showed when being cultured
with PRGF (Figure 16). However, the hDPSCs seeded on smooth titanium discs and
grown in the presence of PRF increased their ALP activity in comparison to the control
conditions. Besides, even without the differentiation treatment, the hDPSCs grown on
BAS titanium with PRGF also increased their ALP activity compared to the control. This
result is possibly due to the high cell density because of the cell proliferation increase,
induced by PRGF, as seen before (Figure 16).
64
Results
A Control PRGF PRF

Control
Ti6AL4V
Differentiation
Control
BAS
Differentiation
®
10
B 9
8
7
Normalized ALP
absorbance
6
5
4
*
3
2
1
0
CL GL PL CDL GDL PDL CR GR PR CDR GDR PDR
Control Differentiation Control Differentiation
Ti6AL4V BAS
65
Figure 17. Alkaline phosphatase assay of hDPSCs cultured on both titanium surfaces, in
presence/absence of osteoblastic differentiation media and plasma derived products (PRGF and PRF).
Images of alkaline phosphatase staining of the hDPSCs cultured on Ti6AL4V and BAS titanium discs for 14
days with osteoblastic differentiation media, PRF and PRGF (A). Graph illustrating the normalized
quantification of the ALP activity (B). Graph acronym meaning: C (control), G (PRGF), P (PRF), D
(differentiation medium), L (Ti6AL4V titanium) and R (BAS titanium). Statistical significance was set at (*)
p ≤ 0.05. Scale bar: 1 mm. Adapted from (Irastorza et al., 2019).
Alizarin red staining of hDPSCs grown on Ti6AL4V and BASTM titanium surfaces on
terminal osteogenic differentiation
The main evidence of terminal osteogenic differentiation of the stem cells is the
formation of calcified bone matrix nodules. This staining was performed by Alizarin red,
which stains the calcified extracellular bone matrix nodules in red. The hDPSCs were
seeded on plastic, Ti6AL4V and BAS titanium surfaces, grown with the osteoblastic
differentiation media for 14 days before alizarin red staining. Images taken by the
stereoscopic microscope demonstrated that there was no alizarin red staining on the
hDPSCs cultured on plastic in control condition. On the contrary, the hDPSCs grown on
both titanium surfaces, showed alizarin stained red spots corresponding to calcified
bone matrix depositions. These bone matrix depositions could be identified at the
macroscopic level and even in control conditions, being more consistent on the BAS
titanium surface (Figure 18C-J). Therefore, as assessed by alizarin red staining, the effect
of titanium surfaces demonstrated by itself to be enough to induce the hDPSCs
osteoblastic differentiation. Comparing to controls, the effect of the pharmacological
osteoblastic induction media seemed not to produce an additional increase of the total
number of stained matrix depositions spots when the hDPSCs were grown on the
titanium discs. The calcium depositions of the HDPSCs treated with the osteoblastic
induction cocktail give the impression of being more intensely stained with alizarin red,
particularly on the cells seeded on BAS titanium (Figure 18. I, J). The biggest evidence of
the effect of osteoblastic differentiation induction media could be found on the hDPSCs
cultured on plastic. On this condition, the differentiation cocktail composed by β-
glycerophosphate, dexamethasone and ascorbic acid, lead to a high number of
66
Results
mineralized bone matrix depositions with respect to the control conditions (Figure 18A,
B).
Control Differentiation
A B
C D
Ti6AL4V
E F
G H
BAS®
I J
67
Figure 18. Alizarin red staining assay of hDPSCs grown on Ti6AL4V and BAS titanium surfaces. Alizarin
red staining of deposited bone matrix spots in control conditions on plastic (A), Ti6AL4V (C, E) and BAS (H,
E) in comparison with the cells treated with osteoblastic differentiation media for 14 days on plastic (B),
Ti6AL4V (D, F) and BAS (I, J). Scale bar (A, B): 100 µm; scale bar (C, D, G, and H): 2mm; scale bar (E, F, I and
J): 0.5 mm. Adapted from (Irastorza et al., 2019).
Effect of PRGF and PRF supplementation on hDPSCs osteoblastic differentiation

cultured on BASTM titanium surface
After showing the hDPSCs potential to differentiate to bone-producing cells on

both titanium surfaces, we investigated the effect of PRGF and PRF on hDPSCs
osteodifferentiation. To evaluate the effect of the two plasma derived products, PRGF
and PRF, they were added to the hDPSCs seeded on BAS titanium surface in control and
differentiation conditions for 21 days. The bone matrix depositions produced by hDPSCs
were found in all conditions in presence or absence of PRGF and PRF. However, the
decrease of stained mineralized nodules was evident in both hDPSCs conditions grown
with the supplementation of PRGF (Figure 19 A). On the contrary, even not showing an
increase of the total number of mineralized nodules, the hDPSCs cultured in presence
of PRF produced a more intense staining of the deposited bone matrix spots. This result
was assessed by photometric quantification after the dissolution of the alizarin red
precipitates (Figure 19 B).
A Control PRGF PRF

Control
Differentiation
68
Results
2,5 B
Normalized ARS absorbance *
2
1,5
*
0,5
0
CR GR PR CDR GDR PDR
Figure 19. Alizarin red staining and photometric quantification of hDPSCs grown in presence of PRGF
and PRF on BAS titanium surface. Alizarin red staining of hDPSCs cultures on BAS titanium surface in
control and osteoblastic differentiation conditions and in presence or absence of PRGF and PRF for 21
days (A). Normalized photometric quantification of Alizarin red staining (B). Graph acronym meaning: C
(control), G (PRGF), P (PRF) and D (differentiation medium). Statistical significance was set at (*) p ≤ 0.05.
Scale bar: 250 μm. Adapted from (Irastorza et al., 2019).
RT-QPCR of osteoblastic differentiation markers of the hDPSCs cultured on Ti6AL4V

and BASTM titanium surfaces in presence or absence of plasma-derived products, PRGF
and PRF
The staining of the mineralized bone matrix deposits by alizarin red showed the
osteoblastic differentiation of the hDPSCs cultured in the presence of PRGF and PRF.
However, how the osteoblastic differentiation molecular signaling pathways were
affected by the plasma derived products remained unclear. To shed light to this
question, we chose representative gene markers involved on the different stages of the
osteoblastic differentiation. This battery of gene markers was composed by Collagen I
(main organic compound of the bone extracellular matrix), RUNX2 (immature osteoblast
marker), SPARC (osteonectin, intermediate secretory osteoblast marker) and
OSTERIX/SP7 (fully mature secretory osteoblast marker).
The RT-QPCR results showed that even the hDPSCs cultured without osteoblastic
differentiation media expressed Col-I, RUNX2, SPARC and OSTERIX when they were
69
seeded on both titanium surfaces (Figure 20). Besides, most of the conditions where
the hDPSCs were grown in presence of PRGF or PRF, revealed an increase of the
expression of these markers. The expression of Collagen 1 between control and plasma
derived products containing conditions showed certain variability. Nevertheless, the
conditions where the hDPSCs were cultured in presence of PRGF and PRF demonstrated
a remarkable increase of the expression of pre-osteoblastic markers RUNX2 and SPARC.
Between these two markers, we have to mention especially SPARC marker, whose
expression levels in the conditions containing PRGF and PRF raised 6-11 fold with respect
to the controls, either in presence or absence of the osteoblastic differentiation
treatment (Figure 20 C). Even when the PRGF and PRF demonstrated having an
enhancing effect in the osteoblastic differentiation process of the hDPSCs as
demonstrated by the raise of expression of the pre-osteoblastic markers RUNX2 and
SPARC, we found other interesting differences between these two plasma-derived
products. On contrary to RUNX2 and SPARC expression increase can make us think, the
expression levels of fully mature osteoblast marker OSTERIX was only increased on the
conditions containing PRF. It is important to mention that the hDPSCs in control
conditions expresses Collagen 1, RUNX2 and SPARC, being naturally on an osteoblastic
pre-differentiated stage. It is noticeable the significant augment (10-30 fold) of OSTERIX
gene expression in all conditions containing PRF, either in presence or absence of the
osteoblastic differentiation media (Figure 20 D). Nevertheless, it is also remarkable that
the conditions where the hDPSCs were cultured in presence of PRGF did not have an
increase of the expression of this marker but the expression of OSTERIX was even lower
than in control conditions.
70
Results
Collagen I RunX2
A B
* *
3,5
mRNA Fold Change
mRNA Fold Change

3,5
3
3
2,5 2,5
2 2
1,5 1,5
1 1
0,5 0,5
0 0
SPARC Osterix
C D
** *
16 ** 35
mRNA Fold Change
14 mRNA Fold Change 30

12 25
10
20
8
6 15
4 10 **
2 5
0 0
Figure 20. QPCR of osteoblastic differentiation gene expression of hDPSCs cultured on Ti6AL4V and
BASTM titanium surfaces in presence or absence of PRGF and PRF. Normalized mRNA expression of
hDPSCs after 14 days of culture for Collagen I, RUNX2, SPARC and OSTERIX. Statistical significance was set
at (*p ≤ 0.05) and (**p ≤ 0.01). CL: control Ti6aI4V; CR: control BAS; CDL: control/ Ti6aI4V/differentiation
treatment; CDR: control/BAS/differentiation treatment; GL: Ti6aI4V/PRGF; GR: BAS/PRGF; GDL: Ti6aI4V/
PRGF/differentiation treatment; GDR: BAS/PRGF/differentiation treatment; PL: TI6AI4V/PRF; PR:
BAS/PRF; PDL: TI6AI4V/PRF/differentiation treatment; PDR: BAS/PRF/differentiation treatment. Adapted
from (Irastorza et al., 2019).
Comparative study of cellular death by Caspase 3 between hDPSCs and hBMSCs

cultured on Ti6AL4V and BASTM titanium surfaces at 24 and 48 hours
BMSCs are other MSCs with extensively investigated osteoblastic differentiation

potential. Nowadays, the election of the best stem cell choice for bone regeneration
therapies is still unclear. Because of this, we performed a comparative study of viability,
proliferation and osteoblastic differentiation between these two cell types. Caspase 3 is
71
a widely used marker of cell death by apoptosis. To assess the differences in cellular
death between hDPSCs and hBMSCs, influenced by titanium surfaces, both types of cells
were seeded on Ti6AL4V and BAS titanium discs for 24 and 48 hours. After that period
we performed an immunofluorescence assay to detect apoptotic cells (caspase 3 +). The
results demonstrated that none of the two titanium surfaces had any cytotoxic effect on
hDPSCs and hBMSCs at 24 and 48 hours. Both types of cells showed having only one or
two apoptotic cell in the whole disc, being dying cell proportion less than 0.1 %. The cell
nuclei were stained in blue with DAPI (Figure 21).
24H Coverslips Ti6AL4V BAS

BMSC
DPSC
48H
BMSC
DPSC
Figure 21. Immunofluorescence images of cell death marker Caspase 3 in hDPSCs and hBMSCs cultured
for 24 and 48 hours on coverslips, Ti6AL4V and BAS titanium surfaces. Immunofluorescence images of
hDPSCs and hBMSCs stained with apoptotic cell marker Caspase 3 (green) and nuclei stained with DAPI
72
Results
(blue) seeded on coverslips, Ti6AL4V and BAS titanium discs for 24 and 48 hours. The images
demonstrated that both titanium surfaces had no cytotoxic effect on hDPSCs and hBMSCs finding only
one or two positive cells for Caspase 3 in the whole disc. Scale bar: 100 µm.
Comparative study of cell proliferation between hDPSCs and hBMSCs cultured on

Ti6AL4V and BASTM titanium surfaces at 24 and 48 hours
To assess cell proliferation difference between hDPSCs and hBMSCs when

cultured on coverslips, Ti6AL4V and BAS titanium discs for 24 and 48 hours, we
performed an immunofluorescence assay for the detection of proliferative cell marker
Ki67 (green) and nuclei stained with DAPI (blue). Due to the opacity of the titanium discs,
a manual count of total number of cells (DAPI +) and total proliferative cells (ki67 +) was
required. As expected, the majority of both types of cells were found in interphase,
however, we found some interesting differences between hDPSCs and hBMSCs and also
because of the influence of the titanium surfaces (Figure 22 A). As we can see in the
graphs of normalized Ki67/DAPI, after the first 24 hours, there is a significant difference
between hDPSCs and hBMSCs proliferation proportion in coverslips, having the first
ones bigger proliferation rate. This proportion is also bigger in hDPSCs when cultured on
Ti6AL4V and BAS titanium discs, being slightly higher in Ti6AL4V titanium surface in both
types of cells than in BAS. After 48 hour of culture, hDPSCs and hBMSCs proliferation
rate on cristal seemed to equalize, not having significant differences. However, in
Ti6AL4V titanium, hDPSCs demonstrated a significant higher proliferation rate than the
hBMSCs. Finally, BAS titanium surface showed interesting results where the
proliferation rate of hDPSCs is also significantly higher respect to hBMSC. In addition,
hDPSCs proliferation rate increased almost reaching control conditions. On the other
hand, hBMSCs exhibit lower proliferation than even after 24 hour of culture, being the
lowest proliferation rate of the experiment (Figure 22 B).
73
A
BMSC Coverslips Ti6AL4V BAS
24H
DPSC
BMSC
48H
DPSC
B Ki67/DAPI Ki67/DAPI
* 24H 48H *
2,5 1,4
Normalized Ki67/DAPI
1,2
Normalized Ki67/DAPI
2 *
1
1,5 0,8
1 0,6
0,4
0,5
0,2
0 0
Coverslips Ti6AL4V BAS Coverslips Ti6AL4V BAS
BMSC DPSC
74
Results
Figure 22. Proliferation assay between hDPSCs and hBMSCs in coverslips, Ti6AL4V and BAS titanium
surfaces at 24 and 48 hour of culture. Images taken by immunofluorescence microscope of hDPSCs and
hBMSCs stained with proliferation marker Ki67 (green) and the nuclei counterstained with DAPI (blue) at
24 and 48 hours of culture (A). Graphs showing the proliferation rate difference between both types of
cells while being cultured on different surfaces (B). Scale bar: 100 µm. Statistical significance was set at
(*p ≤ 0.05).
Immunofluorescence images of osteoblastic differentiation markers SPARC and

Osterix of hDPSCs and hBMSCs cultured on Ti6AL4V and BASTM titanium surfaces in
presence or absence of osteoblastic differentiation media.
With the aim of studying the expression of osteoblastic differentiation markers

hDPSCs and hBMSCs were seeded on both titanium discs and were grown with control
and osteoblastic induction media for 14 days. After fixation, we performed an
immunofluorescence assay for the detection of Osteonectin (SPARC) and Osterix. The
nuclei of both cells were counterstained with DAPI. We observed that after 14 days of
culture both cells expressed SPARC independently of the culture medium (Figure 23).
SPARC seemed to localize in the cytosol with higher congregations around the nuclei.
Moreover, only the hBMSCs seeded on Ti6AL4V titanium and treated with
differentiation media showed a somewhat enhance of SPARC expression. On the other
hand, Osterix showed higher expression in hBMSCs than in hDPSCs in all conditions
(Figure 24). Contrary to SPARC, Osterix (transcription factor) was located in the nuclei.
Even been more expressed on hBMSCs, this cells did not have big differences between
control and osteoblastic treatment in contrast to hDPSC, were we saw an enhance
expression of Osterix after growing in presence of osteoblastic differentiation media.
75
Ti6AL4V
BMSC
BAS
Ti6AL4V
DPSC
BAS
Figure 23. Immunofluorescence images of osteoblastic differentiation marker SPARC in hDPSCs and
hBMSCs seeded on Ti6AL4V and BAS titanium discs and grown in presence or absence of osteoblastic
differentiation media. hDPSCs and hBMSCs were cultured on both titanium discs and grown with control
and osteoblastic induction media for 14 days. After fixation, they were stained for osteoblastic
differentiation marker SPARC (green) and counterstained with DAPI (nuclei). Scale bar: 100 µm.
76
Results
Ti6AL4V
BMSC
BAS
Ti6AL4V
DPSC
BAS
Figure 24. Immunofluorescence images of osteoblastic differentiation marker Osterix in hDPSCs and
hBMSCs seeded on Ti6AL4V and BAS titanium discs and grown in presence or absence of osteoblastic
differentiation media. hDPSCs and hBMSCs were cultured on both titanium discs and grown with control
and osteoblastic induction media for 14 days. After fixation, they were stained for osteoblastic
differentiation marker Osterix (green) and counterstained with DAPI (nuclei). Scale bar: 100 µm.
77
Comparison of mineralized bone matrix deposits by Alizarin red of hDPSCs and

hBMSCs cultured on Ti6AL4V and BASTM titanium surfaces
Extracellular calcified bone matrix nodules are the confirmation of fully

differentiated osteoblastic cells. These deposits were stained by Alizarin red obtaining
an orange/red color. The hDPSCs and the hBMSCs were seeded on plastic, Ti6AL4V and
BAS titanium surfaces for 21 days in presence or absence of osteoblastic differentiation
media. In general, the hDPSCs seemed to have slightly more mineralization than the
hBMSCs in all conditions but it was not enough to reach statistical significance. However,
the hDPSCs seeded on both titanium discs and cultured with osteoblastic differentiation
media demonstrated having more mineralization in comparison with the hBMSCs
cultured in the same condition (Figure 25), but it still needs to be repeated to make firm
conclusions. In addition, this hDPSCs cultured on titanium discs and treated with
osteoblastic differentiation media are the only conditions where the mineralization
augmented respect to the control conditions. These results corroborated the
osteoblastic differentiation induction effect of titanium surfaces to hDPSCs. After the
staining of the calcified nodules with Alizarin red, the samples were treated with Acetic
acid to dissolve alizarin red so it can be measured in a microplate reader.
Normalized Alizarin red absorbance
3,5
2,5 BMSC
2 DPSC
1,5
0,5
78
Results
Figure 25. Graph illustrating Alizarin red absorbance of hDPSCs and hBMSCs cultured on plastic, Ti6AL4V
and BAS titanium surfaces grown in presence or absence of osteoblastic differentiation media. After
culturing the cells for 21 days and dying the extracellular bone matrix deposits, the Alizarin red was
dissolved in Acetic acid. A microplate reader measured the absorbance.
RNA sequencing of hDPSCs and hBMSCs cultured on plastic, Ti6AL4V and BAS TM
titanium surfaces in presence or absence of osteoblastic differentiation media
To investigate the up and downregulation of different genes and pathways

involved in the osteoblastic differentiation process, the hDPSCs and the hBMSCs were
seeded on plastic, Ti6AL4V and BAS titanium discs and cultured for 14 days in presence
or absence of osteoblastic differentiation media. After the culture, the cells were
detached and RNA was extracted using a Qiagen RNA extraction kit and sequenced by
Illumina in the Genomic center of the University of Zurich obtaining 25.000 RNA lectures
per sample. The data was analyzed by “Pathway Enrichment Analysis” with The
Connectivity Map (CMAP) and Biological Process Gene Ontology (GOBP) by the Genome
Analysis Platform of the CIC bioGUNE.
We focused on the comparative study of genes that were differentially

expressed, in terms of presence/absence (ON/OFF) between the different experimental
conditions. We set the threshold limit of 10 raw reads to categorize a gene as effectively
expressed (ON) in each condition. The quantity of differently expressed genes were
found in the comparison of different conditions (Table 2).
Comparative conditions Genes

DPSC-C-FLASK VS BMSC-C-FLASK 69
DPSC-C-FLASK VS DPSC-C-TI 7
BMSC-C-FLASK VS BMSC-C-TI 16
BMSC-C-TI VS BMSC-C-BAS 23
DPSC-C-FLASK VS DPSC-T-FLASK 34
BMSC-C-FLASK VS BMSC-T-FLASK 43
DPSC-C-FLASK VS DPSC-T-TI 17
DPSC-T-TI VS DPSC-T-BAS 1
BMSC-C-FLASK VS BMSC-T-TI 64
BMSC-T-TI VS BMSC-T-BAS 35
79
Table 2. Table illustrating the quantity of genes expressed in one condition and not in the other.
Different quantity of genes expression patterns were found when comparing different conditions.
Abbreviations: DPSC: dental pulp stem cells; BMSC: bone marrow stem cells; C: control media; T:
osteoblastic differentiation media; Flask: plastic culture surface; TI: Ti6AL4V titanium and BAS: Biomimetic
Advanced Surface titanium.
The comparative analysis of the ON/OFF genes between different conditions

showed some interesting results. hDPSCs and hBMSCs grown with control media over
plastic demonstrated the differential expression of many HOX genes between hBMSCs
and hDPSCs (Table 3). In addition, the expression of genes specifically involved in
osteoblastic differentiation such as SPARC, OSTERIX/SP7 and ZBTB16 showed to be
increased when both cells types were cultured with osteoblastic differentiation media
and/or seeded on titanium surfaces (Table 3). The case of ZBTB16 was worth mentioning
as this was the only gene whose expression was triggered in both cell types (hDPSCs and
hBMSCs) under osteoblastic differentiation (pharmacological treatment and/or
titanium) conditions, suggesting its possible role as a master gene for osteogenesis.
Finally, the neurotrophin receptor and hDPSCs stemness marker NTRK3 and a related
gene GFRA2, were expressed in control conditions but we found a shutdown of
expression in hDPSCs cultured on titanium with osteoblastic differentiation media (Table
3).
Identifier Gene- Description DPSC-C- BMSC-C-

name FLASK FLASK
DPSC-C- ENSG00000037965 HOXC8 homeobox C8 0 76
FLASK VS
BMSC-C-
FLASK
ENSG00000078399 HOXA9 homeobox A9 0 66
ENSG00000106511 MEOX2 mesenchyme 0 185
homeobox 2
ENSG00000108511 HOXB6 homeobox B6 0 19
ENSG00000123388 HOXC11 homeobox C11 0 36
ENSG00000170370 EMX2 empty spiracles 0 19
homeobox 2
80
Results
ENSG00000175879 HOXD8 homeobox D8 0 21

DPSC-C- DPSC-C-
Flask Ti
DPSC-C- ENSG00000170374 SP7 Sp7 transcription factor 0 71
FLASK VS
DPSC-C-
TI
DPSC-C- DPSC-T-
Flask Flask
DPSC-C- ENSG00000109906 ZBTB16 zinc finger and BTB 0 182
FLASK VS domain containing 16
DPSC-T-
FLASK
ENSG00000140538 NTRK3 neurotrophic receptor 12 0
tyrosine kinase 3
ENSG00000168546 GFRA2 GDNF family receptor 107 0
alpha 2
BMSC-C- BMSC-T-
Flask Flask
BMSC-C- ENSG00000109906 ZBTB16 zinc finger and BTB 0 673
BMSC-T-
FLASK
DPSC-C- DPSC-T-
Flask Ti
DPSC-T-
TI
tyrosine kinase 3
ENSG00000170374 SP7 Sp7 transcription factor 0 51
BMSC-C- BMSC-T-
Flask Ti
BMSC-C- ENSG00000107742 SPOCK2 SPARC (osteonectin), 0 10
FLASK VS cwcv and kazal like
BMSC-T- domains proteoglycan
TI 2
ENSG00000152583 SPARCL1 SPARC like 1 0 45
Table 3. Gene expression differences between the comparisons of different conditions. Abbreviations:
DPSC: dental pulp stem cells; BMSC: bone marrow stem cells; C: control media; T: osteoblastic
differentiation media; Flask: plastic culture surface; TI: Ti6AL4V titanium and BAS: Biomimetic Advanced
Surface titanium.
81
Apart from individual gene expression comparisons, we performed a pathway

enrichment analysis with The Connectivity Map (CMAP) and Gene Ontology enrichment
(GO). On one hand, CMAP is a collaborative effort that utilizes transcriptional expression
data to evidence relationships between cell physiology, diseases and therapeutics. On
the other hand, GO is a resource to develop and use ontologies to support biologically
meaningful annotation of genes and their products. The analyses are divided in three
categories: Cellular component (CC), Biological process (BP) and Molecular function
(MF). In the present work, we used GOBP for the pathways analysis (Tables 4, 5). Both
CMAP and GOBP analysis pipelines highlight the signaling pathways and processes that
are predicted to be affected between different experimental conditions, providing an
associated probability (p) value and a list of the differential genes (Count) within the
total amount of genes (Size) for each described pathway. We set a threshold of a
minimum of two affected genes and a significant associated p value (p< 0.05) for a
pathway to be included in the output data.
CMAP ID Size Count pvalueadj Genes Description

DPSC-C- ALCALAY_AML_NP 133 8 6.98724e-09 COCH, HOXA1, Genes up-regulated
FLASK MC_UP HOXA10, HOXA5, in acute myeloid
VS HOXA7, HOXB3, leukemia (AML)
BMSC- HOXB6, HOXB7
C-FLASK
VERHAAK_AML_NP 173 7 1.16885e-06 EREG, HOXA10, Genes up-regulated
M1_MUT_VS_WT_ HOXA5, HOXA7, in acute myeloid
UP HOXB3, HOXB6, leukemia (AML)
TNFSF10
TAKEDA_NUP8_HO 125 6 3.89713e-06 EREG, HOXA3, Hematopoietic
XA9_16D_UP HOXA5, HOXA7, disorder
HOXB3, TNFSF10
BOQUEST_CD31PL 552 8 0.000117134 BST2, CHI3L1,
US_VS_CD31MINU COCH, CSF2RB,
S_UP DOK5, HOXB7,
STEAP4, TNFSF10
TAKEDA_NUP8_HO 143 5 0.000184436 BST2, HOXA3, effects of NUP98-
XA9_3D_UP HOXA5, HOXA7, HOXA9 on gene
HOXB3 transcription at 3
days after
transduction UP
TAKEDA_NUP8_HO 66 4 0.000205999 HOXA3, HOXA5, effects of NUP98-
XA9_6H_UP HOXB3, HOXC6 HOXA9 on gene
82
Results
transcription at 6
hours after
transduction UP
XA9_8D_UP HOXA7, HOXB3 HOXA9 on gene
transcription at 8
days after
transduction UP
transcription at 10
days after
transduction UP
DPSC-C- BASSO_GERMINAL 93 3 0.0191607 BATF, BCL2A1, Gene up-regulated
FLASK _CENTER_CD40_UP HLA-DQB1 by CD40 signaling
VS in Ramos cells
DPSC-T-
FLASK
CMV_HCMV_TIME 25 2 0.0377068 RSAD2, TNFSF10 Genes up-regulated
COURSE_12HRS_U after infection with
P HCMV at 12 h
VERHAAK_AML_NP 173 3 0.040305 BCL2A1, Genes up-regulated
M1_MUT_VS_WT_ SERPINA1, in acute myeloid
UP TNFSF10 leukemia (AML)
CARIES_PULP_UP 200 3 0.0462674 BCL2A1, HLA- Immune/cytokine
DQB1, SERPINA1 response
Table 4. Pathway enrichment analysis performed with The Connectivity map (CMAP). Pathway
enrichment comparative analysis between hDPSCs and hBMSCs grown on plastic and titanium surfaces,
in the presence or absence of osteoblastic differentiation media. The absent comparisons are not in the
table because they did not meet the established n= 2 and p< 0.05 requirements. Abbreviations: DPSC:
dental pulp stem cells; BMSC: bone marrow stem cells; C: control media; T: osteoblastic differentiation
media; Flask: plastic culture surface; TI: Ti6AL4V titanium and BAS: Biomimetic Advanced Surface
titanium.
83
GOBP ID Size Count pvalueadj Genes Description

DPSC-C- GO:0009952 104 12 1,32926E-12 HOXA1, HOXA5, HOXA7, anterior/posterior
FLASK VS HOXA10, HOXB3, pattern
BMSC-C- HOXB6, HOXB7, HOXC6, specification
FLASK HOXC8, HOXC9,
HOXC10, HOXC11
GO:0048704 80 7 8,00122E-06 HOXA1, HOXA5, HOXA7, embryonic
HOXB3, HOXB6, HOXB7, skeletal system
HOXC9 morphogenesis
GO:0009792 607 13 9,5092E-05 HOXA1, HOXA5, HOXA7, embryo
HOXB3, HOXB6, HOXB7, development
HOXC6, HOXC9, ending in birth or
HOXC11, MEOX2, PITX2, egg hatching
TBX18, HEY2
GO:0001568 531 10 0,00607727 CHI3L1, EREG, HOXA1, blood vessel
2 HOXA3, HOXA5, HOXA7, development
HOXB3, MEOX2, PITX2,
HEY2
GO:0065007 7094 38 0,00910242 BST2, CHI3L1, CSF2RB, biological
5 CSTA, EREG, HAS1, regulation
HOXA1, HOXA3, HOXA7,
HOXA9, HOXA10,
HOXB3, HOXB7, HOXC4,
HOXC6, HOXC8, HOXC9,
HOXC10, HOXC11,
HOXD8, LSP1, MEOX2,
OPCML, PITX2, SIM1,
ZIC1, TNFSF10, WISP3,
TBX18, RASSF9, ABCC9,
CNKSR2, DOK5, SUCNR1,
HHIP, EBF2, NDNF,
FOXP2
GO:0032774 3408 26 0,01596934 EREG, HOXA1, HOXA3, RNA biosynthetic
HOXA5, HOXA7, HOXA9, process
HOXA10, HOXB3,
HOXC10, HOXC11,
HOXD8, MEOX2, PITX2,
SIM1, ZIC1, TBX18,
HEY2, EBF2, SPX, FOXP2
GO:0072358 414 8 0,01691315 CHI3L1, EREG, HOXA1, cardiovascular
5 HOXA3, HOXA5, HOXA7, system
HOXB3, MEOX2 development
GO:0009954 30 3 0,02275033 HOXA10, HOXC10, proximal/distal
7 HOXC11 pattern formation
DPSC-C- GO:0042755 26 2 0,02335918 LEP, TACR1 eating behavior
FLASK VS 4
DPSC-C-
TI
84
Results
GO:0046887 93 2 0,03149338 LEP, TACR1 positive regulation

5 of hormone
secretion
GO:0050880 127 2 0,03149338 LEP, TACR1 regulation of
5 blood vessel size
GO:0002520 737 3 0,04081726 LEP, RSAD2, SP7 immune system
7 development
GO:0050867 258 2 0,04102342 HLA-DQB1, TACR1 positive regulation
of cell activation
GO:0009914 281 2 0,04869166 LEP, TACR1 hormone
6 transport
BMSC-C- GO:0010719 22 2 0,02250505 LDLRAD4, TBX5 negative
FLASK VS 5 regulation of
BMSC-C epithelial to
TI mesenchymal
transition
BMSC-C- GO:0035912 5 2 0,04224312 HEY2, DLL4 dorsal aorta
FLASK VS 7 morphgenesis
BMSC-T-
FLASK
DPSC-C- GO:0060218 13 2 0,02773949 BATF, SP7 hematopoietic
FLASK VS 1 stem cell
DPSC-T- differentiation
TI
Table 5. Pathway enrichment analysis performed with Gene Ontology Biological Process enrichment
(GOBP). Pathway enrichment comparative analysis between hDPSCs and hBMSCs grown on plastic and
titanium surfaces, in the presence or absence of osteoblastic differentiation media. The absent
comparisons are not in the table because they did not meet the established n= 2 and p< 0.05
requirements. Abbreviations: DPSC: dental pulp stem cells; BMSC: bone marrow stem cells; C: control
media; T: osteoblastic differentiation media; Flask: plastic culture surface; TI: Ti6AL4V titanium and BAS:
Biomimetic Advanced Surface titanium.
SEM images of decellularized porcine adipose tissue (pDAT) processed as solid foam
The porcine adipose tissue was extracted and the decellularization was
performed using isopropanol and Triton X-100, a non-ionic detergent. Once the
decellularization process concluded, in order to be used as a biological scaffold for cell
cultures in vitro, the solid foam was formed by freeze-drying method (Figure 26A, B).
SEM images demonstrated the highly interconnected porous structure. The pore size
varied between 50 and 100 µm (Figure 26C, D).
85
A B
C D
Figure 26. Images of decellularized porcine adipose tissue for in vitro use and porous structure details
by SEM. Macroscopic images of decellularized porcine adipose tissue for in vitro use in combination with
cells cultures (A, B). SEM images of the porous structure of pDAT showing 50-100 µm prous size (C, D).
Viability of hDPSCs cultured on plastic and pDAT by Calcein-AM/ popidium iodide
To exclude the cytotoxic effect of pDAT, 15.000 hDPSCs cells were seeded on
both empty well (plastic) and pDAT solid foams for 4 days. Cell viability assay was
performed culturing the hDPSCs in presence of live cell dyer Calcein-AM (green
fluorescence) and death cell dyer propidium iodide (red fluorescence). Fluorescence
microscope images demonstrated that the hDPSCs grown on both surfaces had almost
100% live cells, with all the cells dyed with green fluorescence. Only sporadically were
cells found dyed in red with propidium iodide showing the lack of cytotoxicity of pDAT
(Figure 27). The main difference we found between this two surfaces was the higher
amount of cells found in control plastic (Figure 27A, B). Higher amount of hDPSCs that
apparently we had in plastic could be due to monolayer growing they have in plastic in
comparison to the 3 dimensional pDAT surface.
86
Results
Plastic pDAT
A C
B D
Figure 27. Calcein-AM/ propidium iodire images of hDPSCs cultured on plastic and pDAT solid foams.
HDPSCs were seeded at 15.000 cell/well for 4 days and stained with live cell marker Calcein-AM (green)
and death cell marker propidium iodide (red). The cells grown on plastic (A, B) showed higher amount of
hDPSCs than pDAT (C, D) due to monolayer growing. Scale bar (A, C): 100 µm; (B, D): 50 µm.
hDPSCs culture on solid foam pDAT and bone-producing osteoblastic cell markers
immunofluorescence.
pDAT solid foam was integrated to 8-well Minicell EZ slides (Merck Millipore
PEZGS0816) for in vitro use in cell culture. The hDPSCs were seeded al 15.000 cell/ well
density and grown for 14 days in presence of control media (DMEM) and osteoblastic
differentiation media. Cell nuclei stained with DAPI showed less number of cells on pDAT
porous structure than in plastic wells were the hDPSCs had grown as an adherent
monolayer (Figure 28A). After the 14 days of culture, immunofluorescence assay was
performed for the detection of osteoblastic differentiation markers Osteocalcin (BGLAP)
and Osteonectin (SPARC). hDPSCs seeded in plastic and pDAT expressed this two
87
osteoblastic differentiation markers. The hDPSCs grown on pDAT scaffold had

significantly higher amounts of BGLAP and SPARC relative intensity, both in control and
osteoblastic differentiation conditions (Figures 28B, C; 29B, C).
500
B
% normalized IF intensity
BGLAP ***
400
300
A Control Differentiation
200
Plastic
100
0
DMEM DMEM
control pDAT
C
500
***
400
pDAT
300
200
100
0
Osteo Osteo
Control pDAT
Figure 28. Osteocalcin (BGLAP) immunofluorescence images of hDPSCs cultured in plastic and pDAT in
presence or absence of osteoblastic differentiation media and intensity quantification.
Immunofluorescence images of hDPSCs seeded on plastic or pDAT-containing EZ-slide wells and cultured
with control and osteoblastic induction media for 2 weeks (A). Quantification of relative BGALP IF labeling
respect to the cell number in different conditions by ImageJ (B, C). Scale bar: 50 µm. Statistical significance
was set at (***p ≤ 0.001).
88
Results
300
SPARC 250
200
A Control Differentiation
150
100
Plastic
50
0
DMEM DMEM
C Control pDAT
350
***
300
pDAT
250
200
150
100
50
0
Osteo Osteo
Control pDAT
Figure 29. Osteonectin (SPARC) immunofluorescence images of hDPSCs cultured in plastic and pDAT in
presence or absence of osteoblastic differentiation media and intensity quantification.
Immunofluorescence images of hDPSCs seeded on plastic or pDAT-containing EZ-slide wells and cultured
with control and osteoblastic induction media for 2 weeks (A). Quantification of relative SPARC IF labeling
respect to the cell number in different conditions by ImageJ (B, C). Scale bar: 50 µm. Statistical significance
was set at (***p ≤ 0.001).
ALP staining and quantification of hDPSCs cultured on plastic and pDAT in presence or
absence of osteoblastic differentiation media.
hDPSCs were seeded on plastic and pDAT for 14 days with control and
osteoblastic differentiation media. After that period, the cells were dyed for alkaline
phosphatase enzyme, mineralizing bone cells characteristic enzyme. The images showed
89
the hDPSCs had ALP enzymatic activity in both surfaces (Figure 30A). The quantification
of ALP demonstrated being significantly higher in the cells grown in presence of
osteoblastic differentiation media both in plastic and pDAT (Figure 30B, C).
Control Differentiation B **
A 300
% relative ALP absorbance

250
200
150
100
Plastic
50
0
Plastic
C 1000 **

800
600
pDAT
400
200
0
Osteo
DMEM
pDAT
Figure 30. ALP activity quantification of hDPSCs cultured on plastic and pDAT and grown on presence or
absence of osteoblastic differentiation media. The hDPSCs were cultured for 14 days on empty well
(plastic) or pDAT-containing EZ-slide wells with control or osteoblastic differentiation media. ALP activity
was detected by the purple/black precipitate detection (A). Quantification of ALP activity was performed
measuring the relative ALP absorbance with ImageJ. Statistical significance was set at (**p ≤ 0.01).
Alizarin red staining and quantification of hDPSCs seeded on plastic and pDAT solid
foam grown in presence or absence of osteoblastic differentiation media.
Alizarin red is a calcium-binding dyer witch dyies in an orange/red colour the

deposits of mineralized bone matrix. The hDPSCs were seeded in plastic and pDAT and
grown with control and osteoblastic induction media for 4 weeks. After this time, the
plastic wells ended with high cell confluence with occasional Alizarin red positive cells
90
Results
(Figure 31A). Nevertheless, the highest Alizarin red precipitate density was found in the
hDPSCs grown on pDAT (Figure 31A). Semi-quantitative measurement indicated that in
both surfaces the osteoblastic differentiation media caused more intense staining
(Figure 31B). Moreover, we used bright field images combined with
immunofluorescence staining for DAPI in order to observe the relative cellular location
respect to bone matrix deposits. The hDPSCs appeared to be more densely located
within the borders of mineralized areas. Moreover, the few hDPSC cells found in close
contact with calcified nodules had healthy-looking cell nuclei (Figure 31A).
A DAPI Alizarin Merged

Plastic
Differentiation
Plastic
Differentiation
% relative ARS absorbance
B 300 200 *
250
150
200
150 100
100
50
50
0 0
DMEM Osteo DMEM Osteo
Plastic pDAT
91
Figure 31. Alizarin red-DAPI double staining of hDPSCs cultured on plastic and pDAT solid foams in
presence or absence of osteoblastic differentiation media. hDPSCs were seeded on empty wells (plastic)
or pDAT solid foams with control media and osteoblastic induction media for 4 weeks before performing
Alizarin red staining. The cells were counterstained with DAPI. The bright field images and
immunofluorescence images were merged to study the hDPSCs location in mineralized bone matrix
nodules areas (A). Quantification of relative Alizarin red absorbance after background subtraction (B).
Scale bar: 50 µm. Statistical significance was set at (*p ≤ 0.05).
TEM images of hDPSCs cultured in pDAT scaffolds crating large Sharpey-like collagen
fiber bundles
With the aim of studying in detail the bone-like ECM ultra-structure the hDPSCs
cultured in pDAT solid foams created, TEM images were taken. Small collagen fibers
spread in large areas in the pDAT matrix scaffold were observed in control conditions
beside some interspersed lipid droplets coming from the remains of decellularized
adipose tissue. Interestingly, when hDPSCs were cultured on pDAT in presence of
osteoblastic differentiation media, sharp transitions between thin collagen areas and
thick and mineralized collagen areas were also identified (Figure 32; yellow dashed
lines). This thick collagen fiber bundles had higher electron density and they were
connected to the rest of the pDAT solid foam, which was composed by thinner and less
calcified collagen fibers. In the electrodense collagen areas within the solid foam,
intramembranous ossification sites were also found (arrowheads in figure 33A, B).
Mineralized bone matrix was also observed anchored to the rest of the collagen fibers
in electrodense areas by Sharpey-like fibers (asterisk in Figure 33B). This electrodense
collagen areas and intramembranous ossification sites were not observed in solid foams
without cell seeding (data not shown), indicating the de novo generation of these
structures by hDPSCs.
92
Results
pDAT Control pDAT Differentiation

A B
C D
E F
Figure 32. TEM images of the ultrastructure features of hDPSC cultured in pDAT solid foams. hDPSCs
were cultured for 4 weeks with control media (left column) and osteoblastic differentiation media (right
column). It coul be observed the transition area between hDPSCs produced bone ECM with thicker and
more calcified collagen fibers and thinner collagen fibers of pDAT solid foam matrix (yellow dashed line).
Higher amount of electrodense collagen fibers were found in osteoblastic differentiation conditions
(bottom high-magnification images). Scale bars: 1 µm (A, C and D); 500 nm (B); 200 nm (E and F).
93
B
* *
*
*
* *
Figure 33. TEM images of intramembranous ossification sites and Sharpey-like fibers generated by
hDPSCs cultured in the pDAT solid foams. Transition between non-calcified collagen areas and calcified
thick collagen fiber bundle areas of hDPSCs seeded in pDAT solid foams (dashed line). Intramembranous
ossification sites were found on this thick collagen containing electrodense structures. Magnification of
arrowheads marked areas in the right panels (A). Presence of perforating Sharpey-like fibers on the edges
of intramembranous ossification sites (asterisk in right panels), showing anchoring to the rest of the
collagen matrix. Magnification of arrowheads marked areas in the right panels (B). Scale bars: 2 µm (top
left image); 1 µm (bottom left image); 500 nm (top right images); 200 nm (bottom right images).
94
Discussion
Discussion
One of the aims of this study was the evaluation of the hDPSCs combined with
autologous plasma components on biomimetic titanium dental implant materials for
bone regeneration in vitro. Within this framework, this study was focused on testing the
possible enhancements in the osteoblastic differentiation process by assessing the
deposition of secreted bone-matrix of hDPSCs cultured on standard Ti6AL4V and
biomimetic BASTM (Avinent implant system) titanium surfaces in combination of plasma-
derived products PRGF and PRF. After Gronthos et al. isolated hDPSCs for the first time
(Gronthos et al., 2000), a lot of different laboratories have confirmed the capability of
those neural crest derived stem cells to differentiate into different cell lineages of
different germ layers (Nuti et al., 2016). These differentiations include bone-producing
osteoblastic cell differentiation being one of the most interesting in the field of
implantology (Giuliani et al., 2013; Tatullo, 2017).
Mesenchymal stem cell differentiation into functional bone-matrix secreting

osteoblasts and osteocytes is constituted at least by three stages. Each one of these
steps are characterized by the expression of specific gene markers. In the first step,
mesenchymal stem cells commit to osteo-chondroprogenitor cells, triggering the
expression of the transcription factor RUNX2. The expression of this gene commits
mesenchymal stem cells to become bone-linage osteoprogenitor cells. In the second
stage, MSCs transform into secretory osteoblasts, producing and secreting calcium-
binding proteins BGLAP (osteocalcin) and SPARC (osteonectin). The combination of
these two proteins with extracellular Collagen I forms the organic (osteoid) part of the
bone extracellular matrix. Afterwards, hydroxyapatite mineral starts being deposited on
this immature bone matrix mineralizing it. The mineralization process by crystal
nucleation and growth is carried out thanks to the reaction of Ca2+ and PO4- ions
catalyzed by Alkalyne Phosphatase activity. At this point, MSCs also express fully mature
differentiated osteoblast markers, like the transcription factor OSTERIX. The expression
of this transcription marker is maintained in mature osteocytes, after the mature
calcified bone matrix surrounds the osteoblasts. These mature osteocytes also keep
expressing, albeit at lower levels, SPARC and Collagen I as well as other bone matrix
proteins for bone matrix remodeling throughout time (Figure 34).
97
In the last decade, there have been important improvements of the

biocompatibility of titanium materials for clinical use by changes on the composition and
surface of dental titanium implants. These changes were made especially with the
purpose of inducing osteoblast differentiation of MSCs and bone deposition around the
titanium pillar. Previous studies had already demonstrated the potential of
mesenchymal stem cells to adhere, proliferate and differentiate into osteoblasts when
cultured on titanium surfaces even when seeded without supplementing the media with
osteogenic differentiation factors (Olivares-Navarrete et al., 2010). The results of this
study confirmed those previous reports, showing that mesenchymal stem cells, in our
case hDPSCs derived from human healthy donors, could change their behavior
depending on the substrate they were cultured on. The attachment of hDPSCs to the
titanium surface on its own was enough to induce mature osteoblastic differentiation
with the potential to create bone matrix mineralized deposits stainable with Alizarin red.
These results differ from what is commonly found when hDPSCs are cultured on
standard cell culture plastics, where the osteoblastic differentiation does not happen
until the cells are grown for several days with β-glycerolphophate, ascorbic acid and
dexamethasone (Langenbach and Handschel, 2013). The stimulation of mesenchymal
stem cell osteoblastic differentiation is one of the most important advantages of
titanium surfaces. It has been demonstrated that both the macro and micro roughness
of titanium surfaces play an important role in cell attachment, proliferation and
osteoblastic differentiation (Boyan et al., 2016b; Coelho et al., 2009). hDPSCs show
osteoblast differentiation, production of considerable amounts of bone morphogenetic
proteins, bone proteins and vascular endothelial growth factors when cultured on
porous titanium surfaces (Perrotti et al., 2013). Recent works suggests that
osteoinductivity is enhanced by chemically modified micro rough titanium surfaces,
representing a big advantage for dental clinic application (Boyan et al., 2016b; DE Colli
et al., 2018). In the present study, a small but significant difference was found in the
levels of expression of OSTERIX when comparing hDPSCs grown with control media (no
osteoblastic induction) on Ti6AL4V (smooth) and BAS (rough) titanium surfaces.
However, osteoblastic differentiation of hDPSCs cultured on BAS titanium surface was
greatly enhanced due to the presence of platelet rich fibrin (PRF), either combined or
98
Discussion
not with osteoblastic differentiation media. In these conditions, OSTERIX mRNA

expression levels were raised by more than one order of magnitude.
hDPSCs in vitro expansion and maintenance were also tested for both Ti6AL4V
(smooth) and BAS (rough) titanium surfaces. Both surfaces preserved cell viability,
allowing a good cell proliferation. This was assessed by the detection of Ki67 positive
cells in basal conditions. The hDPSCs cultured on Ti6AL4V titanium surface showed
higher cell mobility compared to BAS titanium due to the flat surface. Despite both
plasma derived products allowed a good hDPSC growth, cell proliferation was
significantly enhanced by the addition of 20 % PRGF to the culture media, but not by
insoluble PRF. This difference may be caused by the different application method of both
plasma products. PRF membranes were put into the culture wells and maintained over
the duration of the experiment, releasing molecules gradually. On the contrary, the
soluble plasma fraction PRGF was added to the culture media at 20 % concentration and
renewed with each media change every 2-3 days. It is possible to hypothesize that high
concentration of growth factors induced hDPSCs the high concentration of growth
factors, caused by the addition of soluble PRGF to the culture medium, would induce
the proliferation of hDPSCs. This would have a negative effect over mature osteoblastic
differentiation, as both processes (cell proliferation vs differentiation) are antagonist to
each other. In hDPSCs cultured with PRGF, osteoblastic pre-commitment marker
expression RUNX2 and SPARC mRNA levels were actually increased. But somehow these
hDPSCs failed to differentiate into mature osteoblast cells, as seen by a lower expression
of OSTERIX and a decreased amount of secreted bone matrix detected by Alizarin red.
In contrast, hDPSC cultures supplemented with PRF membranes would arguably
generate conditions where by a slow gradual growth factor release from the fibrin clot
would favor the mature osteoblast differentiation of hDPSCs. It is noteworthy that the
combination of plasma rich fibrin with biomimetic BAS titanium surface was the most
effective condition to induce in vitro osteoblastic differentiation of hDPSCs grown on
titanium surfaces. This is where BAS rough titanium surface demonstrated being a better
option with respect to the smooth Ti6AL4V titanium, as OSTERIX expression levels could
be substantially enhanced when we combined BAS titanium with PRF.
99
To achieve a full translation of this methodology to the dental clinic, more in vivo
studies will be necessary. In spite of not being the most abundant source of
mesenchymal stem cells in the human adult body, for the fields of implantology and
craniomaxilofacial surgery, hDPSCs are particularly interesting cells. For oral and
maxillofacial trauma patient who lose several teeth in an accidental episode, this holds
especially true. They might very well benefit from an approach whereby clinicians took
advantage of the lost dental pieces to extract autologous hDPSCs to aid in the
reconstruction of the completely affected bone area. Whatever the case, when cultured
on microporous biomimetic titanium surfaces such as BASTM, hDPSCs respond with
efficacy to osteoblastic differentiation protocols, especially in combination with platelet
rich fibrin clot.
TITANIUM SURFACE PRGF (soluble; 20%)

(Ti6Al4V, BAS) PRF (insoluble)
Non-committed Pre-committed Committed
Collagen I Runx2 Runx2

(high) OsteoN
OsteoN Collagen I
Collagen I (high)
Osterix
DIFFERENTIATION PRF (insoluble)

TREATMENT
(DEXA, BGP, ASC)
100
Discussion
Figure 34. Summary of plasma derived product effects on hDPSCs osteoblastic differentiation processes
on culture. Summary of the theoretical model of the different effects caused by the supplementation with
pharmacological differentiation reagents, growth substrates (Ti6AL4V and BAS) and plasma derived
products (PRGF and PRF) over the osteoblastic differentiation process. Mesenchymal stem cells grows in
vitro in an undifferentiated state. They can be induced to commit osteoblastic differentiation where in
the first stages cells will enhance the expression of the transcription factor RUNX2, as they will express
progressively higher amounts of Collagen I and calcium-binding proteins like SPARC. In the final stage of
osteoblastic differentiation, the cells acquire the ability to mineralize the extracellular matrix, forming the
mature bone tissue. At the cellular/molecular level, this is characterized by the rise of the expression of
OSTERIX, the mature osteoblast/osteocyte gene marker. Pharmacological reagents, plasma-derived PRGF
and PRF as well as titanium surfaces appear all to influence the preosteoblast transition of hDPSCs. This is
confirmed by the detection of higher levels of RUNX2 and SPARC expression and/or phosphatase alkaline
staining found in all these conditions. However, hDPSCs cultured with soluble PRGF did not achieve
mature osteoblast stage, possibly due to proliferation/differentiation signaling conflict. On contrary,
hDPSCs seeded in the presence of PRF clots showed the highest expression levels of osteoblastic
differentiation, especially on BAS biomimetic titanium surface combined with osteoblastic induction
reagents.
The previous study showed the good cell viability, proliferation and osteoblastic
differentiation features of hDPSCs grown over titanium surfaces. Mesenchymal stem
cells had demonstrated being a great option for their use in bone tissue engineering due
to their capacity to adhere, proliferate and differentiate to different cell types when
seeded on different biomaterials. However, with all the different mesenchymal stem cell
sources found in the human adult body it is still unclear which one is the best option for
the use on tissue engineering. For the effective development of bone and dental
regeneration therapies, different types of post-natal stem cells need to be compared to
determine the best MSC option. To bring light to this question, we next performed a
comparative study between hDSPCs and hBMSCs, a promising MSC type due to its
natural bone differentiation ability.
The aim of this comparative study was to compare the viability, proliferation and
osteoblastic differentiation between hDPSCs and hBMSCs cultured on Ti6AL4V and
BASTM titanium surfaces in the presence or absence of osteoblastic differentiation
media. For the evaluation of these results, we have to take into account the patients age
101
difference between hDPSC and hBMSC donors for the evaluation of the results, which
was 16-30 years for hDPSCs and 45 years for BMSCs.
Both hDPSCs and hBMSCs seeded on Ti6AL4V and BAS titanium discs showed no
cytotoxic effect from the titanium surfaces. These two types of cells showed almost 100
% viability while being seeded on titanium surfaces where only isolated single cells were
found stained by propidium iodide. On the contrary, the cell proliferation assay did
exhibit significant differences between hDPSCs and hBMSCs. The comparative cell
proliferation experiment showed a greater growth potential of hDPSCs compared to
hBMSCs when seeded on both titanium surfaces after 24 and 48 hours. When the cells
were cultured on coverslips this difference was only observed after the initial 24 hours
of culture while at 48 hours both cells had similar proliferative activity. These results
confirmed what was shown in other articles where the cells had been seeded in different
biomaterials (Amid et al., 2021; Ponnaiyan and Jegadeesan, 2014).
The appearance of the mineral phase deposited by hDPSCs and hBMSCs on

coverslips, TiAL4V and BAS titanium surfaces also differed. Alizarin red staining
quantification demonstrated a higher bone mineral production of the hDPSCs compared
to hBMSC. In addition, within different conditions the hDPSCs grown on Ti6AL4V and
BAS titanium in the presence of osteoblastic induction media where the ones with the
highest bone mineral production. As shown in other related studies, hDPSCs exhibited a
higher mineralization ability than hBMSCs when cultured on these two titanium surfaces
(Davies et al., 2015; Mohanram et al., 2020).
Apart from this, the RNA sequencing was analyzed following expression/ lack of
expression criteria. To achieve this aim, we performed a comparative RNA expression
analysis between pairs of different conditions to find out the genes that were expressed
in one condition and not in the other. We chose a presence/absence (ON/OFF)
comparison to detect specific sets of genes, whose expression would be specifically
triggered in osteogenic differentiation enhancement conditions, to potentially identify
new gene targets and signaling pathways involved in the osteoblastic differentiation of
hDPSCs and hBMSCs.
102
Discussion
The main difference in terms of genes expression between hDPSCs and hBMSCs
grown in plastic with control media was the HOX gene family expressed by hBMSCs. HOX
genes are responsible for embryonic MSC proliferation and for the regional
specifications and related tissue-specificity (Ackema and Charité, 2008). Previous studies
had demonstrated the differences in the HOX expression pattern in mandibular neural
crest cells and adult mandibles, in contrast to distal mesoderm-derived mesenchyme
and bones (Dong et al., 2014; Lee et al., 2015b; Wehrhan et al., 2011). It have been
suggested that this gene family could be related to the site-specificity of MSCs,
depending on the anatomical position (Wang et al., 2009). These HOX genes expression
difference could explain the different cellular behavior associated to autogenous cell
grafts of different embryonic origins (Leucht et al., 2008). The results obtained on this
study are consistent with previous studies which demonstrated the HOX gene
expression decrease in mandibles compared to that of long bones (Lee et al., 2015b;
Leucht et al., 2008).
Focusing specifically on osteoblastic differentiation related genes, we found that

the osteoblastic differentiation marker OSTERIX/SP7 expression showed to be induced
in hDPSCs when culturing them on titanium surfaces in the presence or absence of
osteoblastic differentiation media. In the hBMSCs differences were not found because
these cells already had a basal SP7 expression in these control conditions. These results
are consistent with the previous experiments where we observed that the OSTERIX/SP7
expression could be enhanced by differentiation media as well as by the titanium
surfaces. In addition, two SPARC related genes, SPOCK2 and SPARCL1, showed to be
silent in hBMSCs grown in control conditions while they were expressed when the cells
were cultured on Ti6AL4V titanium surfaces with the osteoblastic differentiation media.
Finally, ZBTB16 is the last osteogenic differentiation gene we have to mention. ZBTB16
is a zinc finger transcriptional factor that contains a domain for protein-protein
interactions and nine Kruppel-type zinc finger domains for DNA binding. OSTERIX/SP7
binds ZBTB16 gene promotor to start its transcription (Figure 35). In this study, we found
that neither hDPSCs nor hBMSCs had any expression of this gene when cultured with
control media but both cell types showed a remarkable expression of ZBTB16 when
grown with osteoblastic differentiation media. These results are related with some
103
previous studies, which concluded that ZBTB16 gene is involved on dexamethasone

mediated osteogenic differentiation. For this reason, ZBTB16 was only expressed when
the cells were cultured with osteoblastic differentiation media (Felthaus et al., 2014a;
Felthaus et al., 2014b; Onizuka et al., 2016). Overall, the RNAseq analyses made over
hDPSCs and hBMSCs in different culture conditions suggest a possible role of ZBTB16 as
a master regulator of osteogenesis.
Osx
Sp1
ZBTB16
Sp1
Figure 35. Osterix binds to the Sp1 sequence of the ZBTB16 promoter region.
Among other interesting differentially expressed genes, NTRK3 and GFRA2 genes
were expressed in hDPSCs seeded on plastic with control media but this expression
disappeared by the effect of the differentiation media and/or titanium surface.
Neurotrophin receptor genes, and particularly NTRK3, had been suggested to be hDPSCs
stemness markers, hence these results are consistent with previous studies (Luzuriaga
et al., 2019b).
It is also important to mention the lack of difference in expressed genes between

hDPSCs grown on Ti6AL4V and BAS titanium surfaces. The few genes that were
differentially expressed in those conditions were few, and followed an inconsistent
pattern. This result demonstrated the similar gene expression induction effects of both
titanium discs. Therefore, we can conclude that whatever differences in the pattern of
gene expression between cells cultured on these titanium surfaces, they would have to
be sought in slight changes in gene expression levels, rather than in the triggering of the
expression of any particular master gene related to osteogenesis.
After analyzing the differential expression of individual potential genes of

interest, we resorted to a comprehensive Pathway Enrichment Analysis, to identify
clusters of genes and signaling pathways that would be affected in hDPSCs and hBMSCs
104
Discussion
in our different culture conditions. We used the connectivity map (CMAP) and gene
ontology biological process (GOBP) to identify the most likely affected signaling
pathways in each experimental comparison. We selected those pathways that
presented at least two differentially expressed genes and a significant p value of <0.05.
These databases showed the different biological processes and diseases where these
genes are involved. Most of the outputs of the CMAP comparative analysis between
hBMSCs and hDPSCs were related to HOX genes, being related to diverse processes
ranging from acute myeloid leukemia to hematopoietic disorders. On the other hand,
GOBP related the expression of different clusters of genes to anterior/posterior pattern
specification, blood vessel development, cardiovascular system development,
regulation of blood vessel size, hormone transport and hematopoietic stem cell
differentiation. The significant differences detected on pathways related to
anterior/posterior pattern specification and hematopoietic stem cell differentiation can
be clearly related to the different embryonic origin and physiological function of hDPSCs
and hBMSCs.
As seen in previous studies, even with higher expression of some osteoblastic

differentiation related genes by hBMSCs, the bone mineral production is always higher
in hDPSCs (Davies et al., 2015; Mohanram et al., 2020). These results were also
confirmed in this investigation by the detection of mineral with Alizarin red. Moreover,
cell proliferation was also higher in hDPSCs than in hBMSCs. It is also important to
mention that the isolation methodology is different for these two types of cells. The
procedure to obtain hDPSCs is easier and less aggressive than the one of hBMSCs. With
all these data, we can suggest that hDPSCs represent a better source of mesenchymal
stem cells for the use in bone and dental tissue engineering than hBMSCs (Amid et al.,
2021; Mohanram et al., 2020).
As already mentioned, the dental implants have upgraded considerably over the
last years, improving implant survival rate. This survival achieved around 95 % after 10
years post-loading (Moraschini et al., 2015) and almost 88 % after 20 years post-loading
(Chrcanovic et al., 2018). However, with the increase of life expectancy and population
105
ageing in developed countries, the demand for very long-term durable dental implants
seems likely to be maintained in the future.
Over the last decades, dental implant osseointegration has obtained big
improving results; however, some significant challenges remain. One of the biggest
problems in oral implantology is the Marginal Bone Loss (MLS), which is directly
correlated to implant loss due to the mechanical stress that the alveolar bone suffers
because of masticatory function in the absence of a functional PDL. The entire
masticatory load is transferred to alveolar bone tissue because dental implants are
directly anchored on it, which can lead to its resorption. There are many studies
associating a high MLB with a high risk of periimplantitis and implant failure (Chrcanovic
et al., 2018; Coli and Jemt, 2021; Galindo-Moreno et al., 2015). The most effective
strategy to reduce periimplantitis and MBL has been proposed to be the reconstruction
of PDL, which naturally acts like a cushion between alveolar bone and the dental piece
by absorbing mechanical forces. However, PDL regeneration and engineering
constitutes an extraordinary challenge (Lee et al., 2020). Any material used to substitute
PDL should firmly anchor to both alveolar bone and the dental implant while conserving
a highly vascularized tissue strip in between. In practice, this problem could only be
solved by seeding osteogenic and vasculogenic stem cells on biomaterials.
In the context of PDL regeneration by stem cell therapy, the best scenario would
be that the stem cells cultured on the biomaterial came from the patients themselves
(autologous graft), with which under adequate manipulation we could avoid immune
rejection issues. As previously mentioned, some of the most promising stem cell types
for dental implantology are hDPSCs. These cells are particularly well suited for
cryopreservation and autologous transplant (Ibarretxe et al., 2012b; Raik et al., 2020).
Another important characteristic of hDPSCs is the high capacity of differentiation to a
very large variety on both mesenchymal and non-mesenchymal cell types they have in
the absence of xenogenic cell culture compounds like animal serum. Interestingly, the
capacity of hDPSCs to differentiate to both vasculogenic and osteogenic cells has been
shown in serum free media. We recently published and patented an animal serum free
methodology to obtain vasculogenic cells (endothelia and pericytes) (Luzuriaga et al.,
106
Discussion
2020; Pineda Martí et al., 2020). This method could be potentially applied to hDPSCs
seeded on biomaterials to vascularize scaffolds as pDAT for their utilization in cell
therapies.
In this investigation, we combined hDPSCs with pDAT solid foams obtained by

following a patented decellularisation protocol (Madarieta Pardo et al., 2017). Adipose
tissue represents a very accesible source of basement membrane adhesion proteins
with biological activity (Yang et al., 2020). In the context of bone regeneration, it was
very important to corroborate the differentiation of hDPSC to osteoblastic cells and
production of mineralized bone matrix tissue was very important to corroborate when
cultured on pDAT. We focused on the permissiveness of pDAT solid foam to support
hDPSCs osteoblastic differentiation when these cells are seeded on this biomaterial. One
of the most important problems to solve for PDL engineering will be the optimization of
the pDAT solid foam culture system with the combination of two different previously
differentiated hDPSC-derived cell types for the creation of differentiated vascular and
bone tissue areas, which would imitate the structure and function of the lost PDL tissue.
The results obtained in this investigation confirms that pDAT solid foams could
establish a very important biomaterial for PDL and dental bone regeneration. This
formulation of pDAT significantly enhanced secreted bone matrix by hDPSCs, as
evaluated by phosphatase alkaline and Alizarin red staining. The hDPSCs cultured on the
scaffold showed no loss of viability under experimental conditions. hDPSCs were seeded
at relatively low initial desities (15.000 cells/well; 21.428 cells/cm2) and also low volume
of pDAT scaffold (120 µl/well) to couple it for long-term cell culture in vivo in EZ-slides.
Maintaining higher cell densities over longer periods would possibly require better
nutrient and oxygen supply through a vascular network (Nakamura et al., 2019). Further
in vivo experiments will be necessary to test the potential of this material on the healing
of bone tissue and PDL lesions.
Finally, we also observed the production of thick calcified collagen fiber bundles
and intramembranous ossification sites of hDPSCs cultured on pDAT. This calcification
sties were attached to the pDAT scaffold by Sharpey´s fibres. All these results support
107
that the combination of hDPSCs, or other mesenchymal stem cells, with pDAT is not only
a good osteoblastic differentiation induction ECM environment but could also help on
the graft and surrounding hard tissue attachment. In the case of bone healing, this
attachment has a particular interest, where physical anchoring of the scaffold to the
bone tissue is necessary. Transplantation experiments in vivo will be needed to
corroborate these findings, where apart of being a vehicle of stem cells, the scaffold
would act as a bioinductive ECM which in the best scenario would enhance the calcified
attachment to hard bone tissue and also bone mesenchymal stem cells recruitment and
activation of the host bone tissue.
108
Conclusions
Conclusions
In the last decades, different mesenchymal stem cells had proven their potential
to be used in bone tissue engineering. Their high proliferation and multi-linage
differentiation ability make these cells ideal candidates for regeneration therapies.
Moreover, the improvements on implants and scaffolds manufacturing give rise to
different scaffold upgrades in porosity, roughness or durability. These modifications are
focused on enhancing biocompatibility for stem cell growth and differentiation. Finally,
the use of plasma derived growth factors showed to be a perfect solution for in vitro
autologous stem cell proliferation and differentiation in bone tissue engineering
therapies, avoiding non-desirable immune responses because of the use of animal
derived serums in cell cultures.
The following conclusions have been drawn from the results obtained in this work:
1. hDPSCs showed non affected cell viability and proliferation when cultured on
Ti6AL4V and BAS titanium surfaces.
2. Both titanium surfaces had osteoinductive effect on hDPSCs without the need of
osteoblastic differentiation media.
3. The plasma derived product PRGF induced cell proliferation on in vitro hDPSC
cultures while PRF maximized osteoblastic cell differentiation of hDPSCs and
calcified bone matrix production.
4. The combination of BAS titanium surface with plasma derived PRF enhanced
differentiation of hDPSCs to bone-producing cells. These results provide strong
experimental support to the widespread use of plasma derived fibrin clots in
common clinical practice to enhance bone production around microporous
titanium implant surfaces.
5. The comparative study of hDPSCs and hBMSCs cultured on Ti6AL4V and BAS
titanium surfaces suggested a higher cell proliferation and mineralization of
hDPSCs compared to hBMSCs, but, more data are needed to make a firm
conclusion. Due to the easier and less invasive isolation, higher proliferation and
bone mineral depositions hDPSCs could be a better option than hBMSCs for bone
regeneration therapies.
111
6. Porcine decellularized adipose tissue (pDAT) provided a good support to hDPSCs

adhesion and viability.
7. pDAT supported hDPSCs osteoblastic differentiation with production of calcified
bone matrix by intramembraneous ossification and formation of Sharpey fibre-
like attachment structures.
Taking into account the relatively abundant and available source of human-derived raw
adipose tissue material and that both DAT and hDPSCs can be isolated from human
donors; this seems a great opportunity for their combined use in personalized clinical
therapies for the healing of bone lesions and dental implantology.
112
Annex I
Patents
114
Annex I
(12) INTERNATIONAL APPLICATION PUBLISHED UNDER TUE PATENT COOPERATION TREATY (PCT)
(19) World Intellectual

Property
(10) International Pu blication
Organization
09 January 2020 (09.01.2020) WIPOI PCT
International Bureau Number

(43) International Publication WO 2020/007878 Al
Date
(51) International Patent Classification: (ES). ENCINAS PÉREZ, Juan Manuel;
A61K35/28 (2015.01) C12N 5/0775 (2010.01) ACHUCARRO BASQUE
(21) International Application Number:
CENTER FOR NEUROSCIENCE FUNDAZIOA,
PCT/EP2019/067769
Science Park ofthe UPV/EHU, Scdc Building, 3rd
(22) International Filing Date: floor, Bam Sarfiena, 48940 LEIOA (ES).
02 July 2019 (02.07.2019) 'BARRETXE BILBAO, Gaskon; Dcp. Bio. Ccl.
(25) Filing Language: English Facultad dc Medicina y Ellfcrmcría,
(26) Publication Language: English
(30) Priority Data: UPV/EHU, 48940 LEIOA (ES). IRASTORZA
18382492.9 03 July 2018 (03.07.2018) EPELDE, Igor; Dcp. Bio. Ccl. Facultad dc
Medicina y Enfcrmcría, UPV/EHU, 48940 LEIOA
(71) Applicants: UNIVERSIDAD DEL PAís VASCO - CES).
EUSKAL HERRIKO UNIBERTSITATEA [ES/ESI•,
OTRI, (74) Agent: ZBM PATENTS - ZEA, BARLOCCI &
Edificio Rectorado, C.Barrio Sarriena s/n, 48940 MARKVARDSEN; Rambla Catalunya 123, 08008
LEIOA (ES). ACIIUCARRO BASQUE CENTER FOR Barcelona CES).
NEU-
ROSCIENCE FUNDAZIOA [ES/ESI•, Science Park (81) Designated States (unless otherwise indica/ed,
of the ./ôr evey:v kind ofna/Ìona/ pro/ec/Ìon
available): AE, AG, AL, AM AO, AT, AU, AZ, BA,
UPV/EHU, Sede Building, 3rd floor, Barrio
BB, BG, Bil, BN, BR, BW, BY, BZ,
Sarriena, s/n, 48940 LEIOA (ES).
(72) Inventors: PINEDA MARTÍ, José Ramón; ACHUCAR-
CA, Cll, CL, CN, CO, CR, CU, CZ, DE, D], DR, DM,
RO BASQUE CENTER FOR NEUROSCIENCE FUN- DO,
DAZIOA, Science Park of the UPV/EHU, Sede HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KM, RN,
Building, 3rd floor, Barrio Sarriena, sin, 48940 KP, KR, KW, KZ, LA, LC, LK, LR, LS, W, LY, MA,
LEIOA (ES). LUZURIAGA GONZÁLEZ, Jon; Dep. MD, ME, MG, MK, MN, MW, NIX, MY, MZ, NA,
Bio. cel. Facultad de Medicina y Enfermería, NG, M, NO, NZ, 0M, PA, PE, PG, PH, PL, PT, QA,
UPV/EHU, 48940 LEIOA (ES). UNDA RO, RS, RU, RW, SA, SC, SD, SE, SG, SK, SL, SM,
RODRÍGUEZ, Fernando; Dep. Bio. cel. Facultad ST, SV, sy, TH, TJ, TM, TN, TR, TT, TZ, UA, UG,
de Medicina y Enfermeffa, UPV/EHU, 48940 US, UZ, VC, VN, ZA, ZM, ZW.
LEIOA (ES). PASTOR ALONSO, Oier•, (84) Designated States (unless otherwise indica/ed,
ACHUCARRO BASQUE CENTER FOR for evuy kind of regional pro/ec/Žon available):
NEUROSCIENCE FUN- ARIPO (B W, GM,
DAZIOA, Science Park of the UPV/EHU, Sede
Building, 3rd floor, San-iena, sin, 48940 LEIOA UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU,
TJ, TM), European (AL, AT, BE, BG, CM, cy, CZ,
115
DE, DR, EE, ES, Fl, FR, GB, GR, HR, HU, IE, IS, IT, as to applicant's
LT, W, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, entitlement to apply for and he granted a
SE, Sl, SK, SM, TR), OAPI (BF, BJ, CF, CG, Cl, CM, patent (Rule 4.1 7(ii))
GA, GN, GQ, GW, KM, ML, MR, NE, SN, TD, TG). Published:
with international search
Declarations under Rule 4.17:
report (Art. 21 (3)) with sequence listing
part of description (Rule 5.2(a))
(54) Title: CELLULAR AGGREGATES FOR USE IN
VASCULARISATION THERAPY
(57) Abstract: Thc prcscnl invcnlion provides a
scrum-frcc cndothclial cell diffcrcnlialion cullurc
medium comprising (a) a basal cullurc medium and
(b) an cndothclial cell diffcrcnlialion combination of
EGF-FGFand VEGF prolcin, whcrcin lhc amount of
EGF is highcr than lhc amount of FGF prolcin. Thc
prcscnl invcnlion furlhcr provides a process for lhc
preparation of cellular aggrcgalc suspensions
comprising differentiated endothelial cells from
dental stem cells using the serum-free medium, as
well as the use of the rcsulling suspension in
therapy.
116
Annex II
Articles
Annex II
REVIEW
published:16 October 2015
doi:10.3389/fphys.2015.0028 9
Dental pulp stem cells as a

Edited by:
Thimios Mitsiadis,
multifaceted tool for
University of Zurich, Switzerland bioengineering and the
Reviewed by:
Gianpaolo Papaccio, regeneration of
Second University of Naples, Italy
Zhi Chen, craniomaxillofacial tissues
Wuhan University, China
*Correspondence: Maitane Aurrekoetxea †, Patricia Garcia-Gallastegui †, Igor Irastorza,
Fernando Unda
Jon Luzuriaga, Verónica Uribe-Etxebarria, Fernando Unda* and
fernando.unda@ehu.eus;
Gaskon Ibarretxe Gaskon Ibarretxe*
gaskon.ibarretxe@ehu.eus
† Department of Cell Biology and Histology, Faculty of Medicine and Dentistry, University
These authors have contributed of the Basque Country, Leioa, Spain
equally to this work.
Specialty section: Dental pulp stem cells, or DPSC, are neural crest-derived cells
This article was submitted to with an outstanding capacity to differentiate along multiple cell
Craniofacial
Biology, a section of lineages of interest for cell therapy. In particular, highly
the journal Frontiers in efficient osteo/dentinogenic differentiation of DPSC can be
Physiology
achieved using simple in vitro protocols, making these cells a
Received: 31 July 2015
Accepted: 01 October 2015 very attractive and promising tool for the future treatment of
Published: 16 October 2015 dental and periodontal diseases. Among craniomaxillofacial
Citation: organs, the tooth and salivary gland are two such cases in
Aurrekoetxea M, Garcia-Gallastegui
P, which complete regeneration by tissue engineering using
Irastorza I, Luzuriaga J, DPSC appears to be possible, as research over the last
Uribe-Etxebarria V, Unda F and
decade has made substantial progress in experimental
Ibarretxe G (2015) Dental pulp stem
cells as a multifaceted tool for models of partial or total regeneration of both organs, by cell
bioengineering and the regeneration
of craniomaxillofacial tissues. Front. recombination technology. Moreover, DPSC seem to be a
Physiol. 6:289. doi: particularly good choice for the regeneration of nerve tissues,
10.3389/fphys.2015.00289
including injured or transected cranial nerves. In this context,
the oral cavity appears to be an excellent testing ground for
new regenerative therapies using DPSC. However, many
issues and challenges need yet to be addressed before these
cells can be employed in clinical therapy. In this review, we
point out some important aspects on the biology of DPSC with
regard to their use for the reconstruction of different
craniomaxillofacial tissues and organs, with special emphasis
on cranial bones, nerves, teeth, and salivary glands. We
suggest new ideas and strategies to fully exploit the capacities
of DPSC for bioengineering of the aforementioned tissues.
Keywords: DPSC, differentiation, tooth, bone, salivary gland, nerve, cell therapy
119
Annex II
ORIGINALRESEARC H
published:30 March 2016
doi:10.3389/fcell.2016.0002 5
Wnt/β-Catenin Regulates the Activity of

Edited by:
Epiprofin/Sp6, SHH, FGF, and BMP to
Cesare Indiveri, Coordinate the Stages of Odontogenesis
University of Calabria, Italy
Maitane Aurrekoetxea1, Igor Irastorza1, Patricia García-Gallastegui1,
Reviewed by: Lucia Jiménez-Rojo2, Takashi Nakamura3, Yoshihiko Yamada4, Gaskon
Agnes Bloch-Zupan, Ibarretxe1 and Fernando J. Unda1*
University of Strasbourg, France
1
Andreas Eisenreich, Department of Cell Biology and Histology, Faculty of Medicine and Dentistry, University of
Charité - University Medicine Berlin, the Basque Country UPV/EHU, Leioa, Spain, 2 Center of Dental Medicine, Institute of Oral
Germany Biology, University of Zurich, Zurich, Switzerland, 3 Division of
*Correspondence: Molecular Pharmacology and Cell Biophysics, Department of Oral Biology, Graduate School
Fernando J. Unda of Dentistry, Tohoku University,
fernandoundarodriguez@gmail.com Sendai, Japan, 4 Laboratory of Cell and Developmental Biology, National Institute of Dental
and Craniofacial Research,
Specialty section: National Institutes of Health, Bethesda, MD, USA
This article was submitted to
Cellular Biochemistry,
a section of the journal Background: We used an in vitro tooth development model to
Frontiers in Cell and Developmental
Biology
investigate the effects of overactivation of the Wnt/β-catenin
Received: 31 December 2015
pathway during odontogenesis by bromoindirubin oxime reagent
Accepted: 14 March 2016 (BIO), a specific inhibitor of GSK-3 activity.
Published: 30 March 2016
Results: Overactivating the Wnt/β-catenin pathway at tooth
Citation:
Aurrekoetxea M, Irastorza I, initiation upregulated and ectopically expressed the epithelial
García-Gallastegui P, Jiménez-Rojo markers Sonic Hedgehog (Shh), Epiprofin (Epfn), and Fibroblast
L, Nakamura T, Yamada Y, Ibarretxe
G and Unda FJ (2016) Wnt/β-Catenin growth factor8 (Fgf8), which are involved in the delimitation of
Regulates the Activity of odontogenic fields in the oral ectoderm.This result indicated an
Epiprofin/Sp6, SHH, FGF, and BMP
to ectopic extension of the odontogenic potential. During tooth
Coordinate the Stages of morphogenesis, Fibroblast growth factor4 (Fgf4), Fibroblast
Odontogenesis. Front. Cell
Dev. Biol. 4:25. doi: growth factor10 (Fgf10), Muscle segment homeobox 1 (Msx-1),
10.3389/fcell.2016.00025
Bone Morphogenetic protein 4 (Bmp4), and Dickkopf WNT
signaling pathway inhibitor 1 (Dkk1) were overexpressed in first
molars cultured with BIO. Conversely, the expression levels of
Wingless integration site 10b (Wnt-10b) and Shh were reduced.
Additionally, the odontoblast differentiation markers Nestin and
Epfn showed ectopic overexpression in the dental mesenchyme of
BIO-treated molars. Moreover, alkaline phosphatase activity
increased in the dental mesenchyme, again suggesting aberrant,
ectopic mesenchymal cell differentiation. Finally, Bmp4
downregulated Epfn expression during dental morphogenesis.
Conclusions: We suggest the presence of a positive feedback loop
wherein Epfn and β-catenin activate each other.The balance of the
expression of these two molecules is essential for proper tooth
development. We propose a possible link between Wnt, Bmp, and
Epfn that would critically determine the correct patterning of dental
cusps and the differentiation of odontoblasts and ameloblasts.
Keywords: Wnt/β-catenin, tooth development, GSK-3, BIO-culture, Epiprofin/Sp6,
odontogenesis
121
Annex II
Cellular Physiology Cell Physiol Biochem 2019;52:1361-1380

DOI:DOI: 10.33594/00000009 © 2019 The Aut Cell hor(s). Published by © 2019 The
and Biochemistry 10.33594/000000096 6 Physiol Bioc Author(s)
Published online: 11 May
1361 hem Press GmbH&Co. KGPublished
by Cell Physiol Biochem
2019Published online: 11 May
2019
Original Paper Luzuriaga et al.: BDNF and NT3 Reprogram Huma Press GmbH&Co. KG, Duesseldorf
Accepted: 6 May 2019 n Dental Pulp Stem Cells to
Neuralwww.cellphysiolbiochem.com
Crest Progenitors
This article is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International
License (CC BY-NC-ND). Usage and distribution for commercial purposes as well as any distribution of modified
material requires written permission.
BDNF and NT3 Reprogram Human Ectomesenchymal Dental Pulp

Stem Cells to Neurogenic and Gliogenic Neural Crest Progenitors
Cultured in Serum-Free Medium
Jon Luzuriagaa Jose Ramon Pinedaa,b Igor Irastorzaa
Veronica Uribe-Etxebarriaa Patricia García-Gallasteguia
Juan Manuel Encinasb,d Pablo Chameroc Fernando Undaa
Gaskon Ibarretxea
a
Department of Cell Biology and Histology, Faculty of Medicine and Nursing, University of the
Basque Country, UPV/EHU, Leioa, Spain, bAchucarro Basque Center for Neuroscience, UPV/EHU
Scientific Park,
Leioa, Spain, cLaboratoire de Physiologie de la Reproduction et des Comportements UMR 0085
INRA/
CNRS/IFCE/Université de Tours, Nouzilly, France, dIkerbasque, The Basque Foundation for
Science, Bilbao, Spain
Key Words: Serum-free culture media • Calcium imaging • Cell differentiation •

Dental Pulp Stem Cells • Brain Derived Neurotrophic Factor
Abstract
Background/Aims: Human Dental Pulp Stem Cells (hDPSCs) are one of the most
promising types of cells to regenerate nerve tissues. Standard DMEM+10% fetal
bovine serum (FBS) culture medium allows a fast expansion of hDPSC as a surface-
adherent cell monolayer. However, the use of FBS also compromises the clinical use
of these protocols, and its longterm presence favors hDPSCs differentiation toward
mesenchymal cell-derived lineages, at the expense of a reduced capability to
generate neural cells. The objective of this work was to characterize the role of
neurotrophin signaling on hDPSCs using a serum-free culture protocol, and to assess
the neurogenic and gliogenic capacity of hDPSCs for future nerve tissue
bioengineering and regeneration. Methods: We compared the different expression
of neurotrophin receptors by RT-PCR, Q-PCR, and IF of hDPSCs cultured with
different growth media in the presence or absence of serum. Moreover, we assessed
the response of hDPSCs to stimulation of neurotransmitter receptors by live cell
calcium imaging under these different media. Finally, we compared the osteogenic
potential of hDPSCs by Alizarin red staining, and the differentiation to
gliogenic/neurogenic fates by immunostaining for Schwann lineage
Gaskon Ibarretxe Cell Biology & Histology Department, Faculty of Medicine and Nursing, University of the Basque
Country, UPV/ and Jose R. Pineda EHU; Achucarro Basque Center for Neuroscience Fundazioa, Barrio Sarriena s/n; Sede
Building 3rd floor, Leioa,
Bizkaia, 48940 (Spain) Tel. (+34) 946013218, E-Mail gaskon.ibarretxe@ehu.eus; jr.pineda@achucarro.org
123
Annex II
European Cells and Materials Vol. 38 2019 (pages 201-214) I Irastorza et al.
hDPSCs with PRF and PRGF on biomimetic titaniumDOI: 10.22203/eCM.v038a14 ISSN 1473-2262
ADHESION, INTEGRATION AND OSTEOGENESIS OF HUMAN

DENTAL PULP STEM CELLS ON BIOMIMETIC IMPLANT SURFACES
COMBINED WITH PLASMA DERIVED PRODUCTS
I. Irastorza1, J. Luzuriaga1, R. Martinez-Conde2, G. Ibarretxe1 and F. Unda1*
1Department of Cell Biology and Histology. Faculty of Medicine and Nursing,

University of the Basque Country, UPV/EHU, Leioa, 48940, Bizkaia, Spain.
2Department of Stomatology II. Faculty of Medicine and Nursing, University of the Basque
Country, UPV/EHU, Leioa, 48940, Bizkaia, Spain.

Abstract
Dental implants are the usual therapy of choice in the dental clinic to replace a loss of natural teeth.
Over recent decades there has been an important progress in the design and manufacturing of
titanium implant surfaces with the goal of improving their osteointegration. In the present work, the
aim was to evaluate the usefulness of hDPSCs (human dental pulp stem cells), in combination with
autologous plasma components, for in vitro bone generation on biomimetic titanium dental implant
materials. In this context, the combination of hDPSCs stimulated by PRGF or PRF and cultured on
standard Ti6A14V and biomimetic BAS™ (Avinent Implant System) titanium surfaces were studied
in order to evaluate possible enhancements in the osteoblastic differentiation process out of human
mesenchymal cells, as well as bone matrix secretion on the implant surface. The results obtained in
this in vitro model of osteogenesis suggested a combination of biomimetic rough titanium surfaces,
such as BAS™, with autologous plasma-derived fibrin-clot membranes such as PRF and/or insoluble
PRGF formulations, but not with an addition of water-soluble supplements of plasma-derived growth
factors, to maximise osteoblastic cell differentiation, bone generation, anchorage and osteointegration
of titanium-made dental implants.
Keywords: Dental pulp stem cells, titanium implants, osteoblast differentiation, platelet rich in
growth factors, platelet rich fibrin, biomimetic advanced surface.
*Address for correspondence: Fernando Unda, Cell Biology and Histology Department. Faculty of
Medicine and Nursing, University of the Basque Country, UPV/EHU, Leioa, 48940, Bizkaia, Spain.
Telephone number: +34 946012857 Email: fernandoundarodriguez@gmail.com
Copyright policy: This article is distributed in accordance with Creative Commons Attribution
Licence (http://creativecommons.org/licenses/by-sa/4.0/).
125
Annex II
biomedicines
Article
Vasculogenesis from Human Dental Pulp Stem Cells

Grown in Matrigel with Fully Defined Serum-Free Culture
Media
Jon Luzuriaga 1 , Jon Irurzun 1, Igor Irastorza 1, Fernando Unda 1, Gaskon Ibarretxe 1,*,† and
Jose R. Pineda 1,2,*,†
1 Cell Biology and Histology Department, University of the Basque Country (UPV/EHU), 48940 Leioa, Spain;
jon.luzuriaga@ehu.eus (J.L.); jirurzun002@ikasle.ehu.eus (J.I.); igor.irastorza@ehu.eus (I.I.);
fernando.unda@ehu.eus (F.U.)
2 Achucarro Basque Center for Neuroscience, University of the Basque Country (UPV/EHU), 48940 Leioa, Spain
* Correspondence: gaskon.ibarretxe@ehu.eus (G.I.); joseramon.pinedam@ehu.eus or
jr.pineda@achucarro.org (J.R.P.); Tel.: +34-946-013-218 (G.I.); +34-946-012-426 (J.R.P.) † These
authors contributed equally to this work.
Received: 20 October 2020; Accepted: 5 November 2020; Published: 9 November 2020
Abstract: The generation of vasculature is one of the most important challenges in tissue
engineering and regeneration. Human dental pulp stem cells (hDPSCs) are some of the most
promising stem cell types to induce vasculogenesis and angiogenesis as they not only secrete
vascular endothelial growth factor (VEGF) but can also differentiate in vitro into both
endotheliocytes and pericytes in serum-free culture media. Moreover, hDPSCs can generate
complete blood vessels containing both endothelial and mural layers in vivo, upon transplantation
into the adult brain. However, many of the serum free media employed for the growth of hDPSCs
contain supplements of an undisclosed composition. This generates uncertainty as to which of its
precise components are necessary and which are dispensable for the vascular differentiation of
hDPSCs, and also hinders the transfer of basic research findings to clinical cell therapy. In this work,
we designed and tested new endothelial differentiation media with a fully defined composition
using standard basal culture media supplemented with a mixture of B27, heparin and growth
factors, including VEGF-A165 at different concentrations. We also optimized an in vitro Matrigel
assay to characterize both the ability of hDPSCs to differentiate to vascular cells and their capacity
to generate vascular tubules in 3D cultures. The description of a fully defined serum-free culture
medium for the induction of vasculogenesis using human adult stem cells highlights its potential as
a relevant innovation for tissue engineering applications. In conclusion, we achieved efficient
vasculogenesis starting from hDPSCs using serum-free culture media with a fully defined
composition, which is applicable for human cell therapy purposes.
Keywords: stem cells; DPSCs; neovasculogenesis; endothelial cells; Matrigel; vasculature
Biomedicines 2020, 8, 483; doi:10.3390/biomedicines8110483 www.mdpi.com/journal/biomedicines
127
Annex II
cells
Article
Wnt-3a Induces Epigenetic Remodeling in Human Dental

Pulp Stem Cells
Verónica Uribe-Etxebarria 1,2, Patricia García-Gallastegui 1, Miguel Pérez-Garrastachu 1,
María Casado-Andrés 1,3, Igor Irastorza 1, Fernando Unda 1, Gaskon Ibarretxe 1,*,† and
Nerea Subirán 4,†
1 Cell Biology and Histology Department, University of the Basque Country (UPV/EHU), Barrio Sarriena, S/N,
48940 Leioa, Spain; vero18791@gmail.com (V.U.-E.); patricia.garcia@ehu.eus (P.G.-G.);
mperez282@gmail.com (M.P.-G.); mdcasado002@gmail.com (M.C.-A.); iirastorza004@gmail.com (I.I.);
2 Pathology Department, New York University, 550 1st Avenue, New York, NY 10016, USA
3 Unité Mixte de Recherche UMR1029. INSERM-Université de Bordeaux, 33000 Bordeaux, France
4 Physiology Department, University of the Basque Country (UPV/EHU), Barrio Sarriena, S/N, 48940 Leioa,
Spain; nerea.subiran@ehu.eus
* Correspondence: gaskon.ibarretxe@ehu.eus; Tel.: +34-94-601-3218 †
These authors contributed equally to this work.
Received: 12 November 2019; Accepted: 4 March 2020; Published: 7 March 2020
Abstract: Dental pulp stem cells (DPSCs) from adult teeth show the expression of a very
complete repertoire of stem pluripotency core factors and a high plasticity for cell
reprogramming. Canonical
WntandNotchsignalingpathwaysregulatestemnessandtheexpressionofpluripotencycorefactor
sin DPSCs, and even very short-term (48 h) activations of the Wnt pathway induce a profound
remodeling of DPSCs at the physiologic and metabolic levels. In this work, DPSC cultures were
exposed to treatments modulating Notch and Wnt signaling, and also induced to
differentiate to osteo/adipocytes. DNA methylation, histone acetylation, histone
methylation, and core factor expression levels where assessed by mass spectroscopy,
Western blot, and qPCR. A short-term activation of Wnt signaling by WNT-3A induced a
genomic DNA demethylation, and increased histone acetylation and histone methylation in
DPSCs. The efficiency of cell reprogramming methods relies on the ability to surpass the
epigenetic barrier, which determines cell lineage specificity. This study brings important
information about the regulation of the epigenetic barrier by Wnt signaling in DPSCs, which
could contribute to the development of safer and less aggressive reprogramming
methodologies with a view to cell therapy.
Keywords: dental pulp stem cells; chromatin remodeling; cell cycle; pluripotency; DNA
methylation; histone acetylation; histone methylation; Notch pathway; Wnt pathway
129
Annex II
BASIC SCIENCE
Nanomedicine: Nanotechnology, Biology, and Medicine
31 (2021) 102314
Original Article nanomedjournal.com
Nanostructured scaffolds based on bioresorbable polymers and graphene

oxide induce the aligned migration and accelerate the neuronal
differentiation of neural stem cells
Yurena Polo, MSca,1, Jon Luzuriaga, PhDb,1, Jagoba Iturri, PhDc, Igor Irastorza, MScb,
José Luis Toca-Herrera, PhDc, Gaskon Ibarretxe, PhDb, Fernando Unda, PhDb, Jose-Ramon
Sarasua, PhDd, Jose Ramon Pineda, PhDb,e,⁎, Aitor Larrañaga, PhDd,
a
Polimerbio SL, Donostia-San Sebastian, Spain
b
Department of Cell Biology and Histology, Faculty of Medicine and Nursing, University of the Basque Country (UPV/EHU),
Leioa, Spain
c
Institute for Biophysics, Department of Nanobiotechnology, BOKU University of Natural Resources and Life Sciences, Vienna,
Austria dGroup of Science and Engineering of Polymeric Biomaterials (ZIBIO Group), Department of Mining, Metallurgy
Engineering and Materials Science & POLYMAT, University of the Basque Country (UPV/EHU), Bilbao, Spain
e
Achucarro Basque Center for Neuroscience, University of the Basque Country (UPV/EHU), Leioa, Spain
Revised 17 September 2020
Abstract
Withinthe field of neural tissue engineering,there is a huge need for the development of materials that promote the
adhesion,aligned migration and differentiation of stem cells into neuronal and supportive glial cells. In this study, we
have fabricated bioresorbable elastomeric scaffolds combining an ordered nanopatterned topography together with a
surface functionalization with graphene oxide (GO) in mild conditions. These scaffolds allowed the attachment of
murine neural stem cells (NSCs) without the need of any further coating of its surface with extracellular matrix adhesion
proteins. The NSCs were able to give rise to both immature neurons and supporting glial cells over the nanostructured
scaffolds in vitro, promoting their aligned migration in cell clusters following the nanostructured grooves. This system
has the potential to reestablish spatially oriented neural precursor cell connectivity, constituting a promising tool for
future cellular therapy including nerve tissue regeneration. © 2020 Elsevier Inc. All rights reserved.
Key words: Micro- and nanopatterning; Neural stem cells; Migration; Cell differentiation; Graphene oxide; Biodegradable polymer
Funding sources: Basque Government (GV/EJ) Regeneration of the nervous system still remains very challenging
Department of Education, Linguistic Politics and due to its limited plasticity and poor ability to heal ments for this
Culture (GIC 15/52, IT-927-16), MINECO «Ramón y
specific biomedical application play a pivotal role. Much progress
Cajal» program RYC-2013-13450 (JRP), MINECO
PID2019104766RB-C21, The University of The Basque
has been made in determining the ideal features a biomaterial
Country (UPV/EHU) by GIU16/66, UFI 11/44, should have for its use as a neural replacement graft, and in
COLAB19/03 and IKERTU-2020.0155. GV/EJ IT831- understanding the interactions of growing axons within
13, Hazitek ZE-2019/00012-IMABI and ELKARTEK thesebiomaterials;however,theregenerationlevelsinducedbythe
KK-2019/ 00093. Polimerbio and Y. P. have a Bikaintek biomaterial usually do not match those obtained by nerve tissue
PhD grant (20-AF-W2-201800001) and J.L. has a autografts and the development of new and effective nerve
UPV/EHU grant DOKBERRI 2019 (DOCREC19/49). regeneration therapies is still an urgent clinical need.2,3
Conflict of interest: The authors declare that there is no
conflict of interest. The biomaterials for nerve tissue regeneration should be
Correspondence to: J.R. Pineda, Cell Signaling lab,biocompatible and biodegradable, while providing structural cues
University of the Basque Country (UPV/EHU), Leioa, Spain. that promote oriented axon regeneration and guidance signals
Correspondence to: A. Larrañaga, Group of Science from extracellular matrix (ECM)-like components. Additionally,
and Engineering of Polymeric Biomaterials (ZIBIO they shouldalsopresentlong-
Group), University of the Basque Country (UPV/EHU). termstoragecapabilityandeaseofhandling/ suturing.4–6 One
E-mail addresses: joseramon.pinedam@ehu.eus, (J.R. important aspect to take in consideration is that the
Pineda), aitor.larranagae@ehu.eus. (A. Larrañaga).
1
https://doi.org/10.1016/j.nano.2020.102314
1549-9634/© 2020 Elsevier Inc. All rights reserved.
131
Bibliography
Bibliography
Aaron JE (2012) Periosteal Sharpey’s fibers: a novel bone matrix regulatory system?
Front Endocrinol (Lausanne) 3: 98. doi:10.3389/fendo.2012.00098.
Abbasi N, Abdal-hay A, Hamlet S, Graham E, Ivanovski S (2019) Effects of Gradient and

Offset Architectures on the Mechanical and Biological Properties of 3-D Melt Electrowritten
(MEW) Scaffolds. ACS Biomater. Sci. Eng. 5: 3448–3461. doi:10.1021/acsbiomaterials.8b01456.
Abe K, Saito H (2000) Neurotrophic effect of basic fibroblast growth factor is mediated
by the p42/p44 mitogen-activated protein kinase cascade in cultured rat cortical neurons. Brain
Res Dev Brain Res 122: 81–85. doi:10.1016/s0165-3806(00)00054-7.
Ackema KB, Charité J (2008) Mesenchymal stem cells from different organs are
characterized by distinct topographic Hox codes. Stem Cells Dev 17: 979–991.
doi:10.1089/scd.2007.0220.
Ajlan SA, Ashri NY, Aldahmash AM, Alnbaheen MS (2015) Osteogenic differentiation of
dental pulp stem cells under the influence of three different materials. BMC Oral Health 15: 132.
doi:10.1186/s12903-015-0113-8.
Albrektsson T, Brånemark PI, Hansson HA, Lindström J (1981) Osseointegrated titanium

implants. Requirements for ensuring a long-lasting, direct bone-to-implant anchorage in man.
Acta Orthop Scand 52: 155–170.
Albrektsson T, Johansson C (2001) Osteoinduction, osteoconduction and

osseointegration. Eur Spine J 10 Suppl 2: S96-101. doi:10.1007/s005860100282.
Almeida-Porada G, Porada C, Zanjani ED (2001) Adult stem cell plasticity and methods
of detection. Rev Clin Exp Hematol 5: 26–41. doi:10.1046/j.1468-0734.2001.00027.x.
Alraies A, Waddington RJ, Sloan AJ, Moseley R (2020) Evaluation of Dental Pulp Stem
Cell Heterogeneity and Behaviour in 3D Type I Collagen Gels. Biomed Res Int 2020: 3034727.
doi:10.1155/2020/3034727.
Amid R, Kadkhodazadeh M, Enssi M, Dehanvi F (2021) In Vitro Activity of Dental Pulp

Stem Cells versus the Bone Marrow Stem Cells Cultured in Presence of a Bone Allograft. J Long
Term Eff Med Implants 31: 7–14. doi:10.1615/JLongTermEffMedImplants.2020036956.
Amini AR, Laurencin CT, Nukavarapu SP (2012) Bone tissue engineering: recent advances
and challenges. Crit Rev Biomed Eng 40: 363–408. doi:10.1615/critrevbiomedeng.v40.i5.10.
Anderson JM (2001) Biological Responses to Materials. Annual Review of Materials

Research 31: 81–110. doi:10.1146/annurev.matsci.31.1.81.
Anfossi G, Trovati M, Mularoni E, Massucco P, Calcamuggi G, Emanuelli G (1989)

Influence of propranolol on platelet aggregation and thromboxane B2 production from platelet-
rich plasma and whole blood. Prostaglandins Leukot Essent Fatty Acids 36: 1–7.
doi:10.1016/0952-3278(89)90154-3.
Angelini A, Castellani C, Vescovo G, Thiene G (2004) Pathological evidence of stem cell

regeneration in the heart. Int J Cardiol 96: 499–504. doi:10.1016/j.ijcard.2004.07.001.
Anitua E (1999) Plasma rich in growth factors: preliminary results of use in the
preparation of future sites for implants. Int J Oral Maxillofac Implants 14: 529–535.
135
Anitua E, Alkhraisat MH, Orive G (2012) Perspectives and challenges in regenerative

medicine using plasma rich in growth factors. J Control Release 157: 29–38.
doi:10.1016/j.jconrel.2011.07.004.
Anitua E, Orive G, Pla R, Roman P, Serrano V, Andía I (2009) The effects of PRGF on bone
regeneration and on titanium implant osseointegration in goats: a histologic and
histomorphometric study. J Biomed Mater Res A 91: 158–165. doi:10.1002/jbm.a.32217.
Anitua E, Tejero R, Zalduendo MM, Orive G (2013) Plasma rich in growth factors
promotes bone tissue regeneration by stimulating proliferation, migration, and autocrine
secretion in primary human osteoblasts. J. Periodontol. 84: 1180–1190.
doi:10.1902/jop.2012.120292.
Anitua E, Troya M, Zalduendo M, Tejero R, Orive G (2016) Progress in the Use of

Autologous Regenerative Platelet-based Therapies in Implant Dentistry. Curr Pharm Biotechnol
17: 402–413.
Anjos-Afonso F, Bonnet D (2007) Nonhematopoietic/endothelial SSEA-1+ cells define

the most primitive progenitors in the adult murine bone marrow mesenchymal compartment.
Blood 109: 1298–1306. doi:10.1182/blood-2006-06-030551.
Annunziata M, Guida L (2015) The Effect of Titanium Surface Modifications on Dental

Implant Osseointegration. Front Oral Biol 17: 62–77. doi:10.1159/000381694.
Arthur A, Rychkov G, Shi S, Koblar SA, Gronthos S (2008) Adult human dental pulp stem
cells differentiate toward functionally active neurons under appropriate environmental cues.
Stem Cells 26: 1787–1795. doi:10.1634/stemcells.2007-0979.
Arthur A, Zannettino A, Gronthos S (2009) The therapeutic applications of multipotential

mesenchymal/stromal stem cells in skeletal tissue repair. J Cell Physiol 218: 237–245.
doi:10.1002/jcp.21592.
Atari M, Barajas M, Hernández-Alfaro F, Gil C, Fabregat M, Ferrés Padró E, Giner L, Casals

N (2011) Isolation of pluripotent stem cells from human third molar dental pulp. Histol
Histopathol 26: 1057–1070. doi:10.14670/HH-26.1057.
Atari M, Caballé-Serrano J, Gil-Recio C, Giner-Delgado C, Martínez-Sarrà E, García-

Fernández DA, Barajas M, Hernández-Alfaro F, Ferrés-Padró E, Giner-Tarrida L (2012a) The
enhancement of osteogenesis through the use of dental pulp pluripotent stem cells in 3D. Bone
50: 930–941. doi:10.1016/j.bone.2012.01.005.
Atari M, Gil-Recio C, Fabregat M, García-Fernández D, Barajas M, Carrasco MA, Jung H-

S, Alfaro FH, Casals N, Prosper F, Ferrés-Padró E, Giner L (2012b) Dental pulp of the third molar:
a new source of pluripotent-like stem cells. J Cell Sci 125: 3343–3356. doi:10.1242/jcs.096537.
Aurrekoetxea M, Garcia-Gallastegui P, Irastorza I, Luzuriaga J, Uribe-Etxebarria V, Unda

F, Ibarretxe G (2015) Dental pulp stem cells as a multifaceted tool for bioengineering and the
regeneration of craniomaxillofacial tissues. Front Physiol 6. doi:10.3389/fphys.2015.00289.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4607862/.
Bae S, Kang B, Lee H, Luu H, Mullins E, Kingsley K (2021) Characterization of Dental Pulp
Stem Cell Responses to Functional Biomaterials Including Mineralized Trioxide Aggregates. J
Funct Biomater 12. doi:10.3390/jfb12010015.
136
Bibliography
Bakopoulou A, Leyhausen G, Volk J, Tsiftsoglou A, Garefis P, Koidis P, Geurtsen W (2011)

Comparative analysis of in vitro osteo/odontogenic differentiation potential of human dental
pulp stem cells (DPSCs) and stem cells from the apical papilla (SCAP). Arch Oral Biol 56: 709–721.
doi:10.1016/j.archoralbio.2010.12.008.
Baulies A, Angelis N, Li VSW (2020) Hallmarks of intestinal stem cells. Development 147.
doi:10.1242/dev.182675.
Beltrami AP, Barlucchi L, Torella D, Baker M, Limana F, Chimenti S, Kasahara H, Rota M,

Musso E, Urbanek K, Leri A, Kajstura J, Nadal-Ginard B, Anversa P (2003) Adult cardiac stem cells
are multipotent and support myocardial regeneration. Cell 114: 763–776. doi:10.1016/s0092-
8674(03)00687-1.
Berthiaume F, Maguire TJ, Yarmush ML (2011) Tissue engineering and regenerative

medicine: history, progress, and challenges. Annu Rev Chem Biomol Eng 2: 403–430.
doi:10.1146/annurev-chembioeng-061010-114257.
Bertolini MM, Del Bel Cury AA, Pizzoloto L, Acapa IRH, Shibli JA, Bordin D (2019) Does
traumatic occlusal forces lead to peri-implant bone loss? A systematic review. Braz Oral Res 33:
e069. doi:10.1590/1807-3107bor-2019.vol33.0069.
Bhat S, Chiew GGY, Ng JX, Lin X, Seetharam RN (2021) Optimization of culture conditions
for human bone marrow-derived mesenchymal stromal cell expansion in macrocarrier-based
tide motion system. Biotechnol J: e2000540. doi:10.1002/biot.202000540.
Bhuptani RS, Patravale VB (2016) Porous microscaffolds for 3D culture of dental pulp
mesenchymal stem cells. Int J Pharm 515: 555–564. doi:10.1016/j.ijpharm.2016.10.040.
Bianchi M, Urquia Edreira ER, Wolke JGC, Birgani ZT, Habibovic P, Jansen JA, Tampieri A,
Marcacci M, Leeuwenburgh SCG, van den Beucken JJJP (2014) Substrate geometry directs the in
vitro mineralization of calcium phosphate ceramics. Acta Biomater 10: 661–669.
doi:10.1016/j.actbio.2013.10.026.
Bianco P, Riminucci M, Gronthos S, Robey PG (2001) Bone marrow stromal stem cells:
nature, biology, and potential applications. Stem Cells 19: 180–192. doi:10.1634/stemcells.19-
3-180.
Blazsek I, Delmas Marsalet B, Legras S, Marion S, Machover D, Misset JL (1999) Large

scale recovery and characterization of stromal cell-associated primitive haemopoietic
progenitor cells from filter-retained human bone marrow. Bone Marrow Transplant 23: 647–
657. doi:10.1038/sj.bmt.1701616.
Boiret N, Rapatel C, Veyrat-Masson R, Guillouard L, Guérin J-J, Pigeon P, Descamps S,

Boisgard S, Berger MG (2005) Characterization of nonexpanded mesenchymal progenitor cells
from normal adult human bone marrow. Exp Hematol 33: 219–225.
doi:10.1016/j.exphem.2004.11.001.
Boyan BD, Cheng A, Olivares-Navarrete R, Schwartz Z (2016a) Implant Surface Design

Regulates Mesenchymal Stem Cell Differentiation and Maturation. Adv. Dent. Res. 28: 10–17.
doi:10.1177/0022034515624444.
137
Boyan BD, Cheng A, Olivares-Navarrete R, Schwartz Z (2016b) Implant Surface Design

Regulates Mesenchymal Stem Cell Differentiation and Maturation. Adv Dent Res 28: 10–17.
doi:10.1177/0022034515624444.
Breine U, Brånemark PI (1980) Reconstruction of alveolar jaw bone. An experimental

and clinical study of immediate and preformed autologous bone grafts in combination with
osseointegrated implants. Scand J Plast Reconstr Surg 14: 23–48.
doi:10.3109/02844318009105733.
Bühring H-J, Battula VL, Treml S, Schewe B, Kanz L, Vogel W (2007) Novel markers for
the prospective isolation of human MSC. Ann N Y Acad Sci 1106: 262–271.
doi:10.1196/annals.1392.000.
Cao C, Dong Y, Dong Y (2005) [Study on culture and in vitro osteogenesis of blood-
derived human mesenchymal stem cells]. Zhongguo Xiu Fu Chong Jian Wai Ke Za Zhi 19: 642–
647.
Caplan AI (1991) Mesenchymal stem cells. J. Orthop. Res. 9: 641–650.

doi:10.1002/jor.1100090504.
Carnevale G, Pisciotta A, Riccio M, Bertoni L, De Biasi S, Gibellini L, Zordani A, Cavallini

GM, La Sala GB, Bruzzesi G, Ferrari A, Cossarizza A, de Pol A (2018) Human dental pulp stem cells
expressing STRO-1, c-kit and CD34 markers in peripheral nerve regeneration. J Tissue Eng Regen
Med 12: e774–e785. doi:10.1002/term.2378.
Castro-Malaspina H, Gay RE, Resnick G, Kapoor N, Meyers P, Chiarieri D, McKenzie S,

Broxmeyer HE, Moore MA (1980) Characterization of human bone marrow fibroblast colony-
forming cells (CFU-F) and their progeny. Blood 56: 289–301.
Chamberlain G, Fox J, Ashton B, Middleton J (2007) Concise review: mesenchymal stem

cells: their phenotype, differentiation capacity, immunological features, and potential for
homing. Stem Cells 25: 2739–2749. doi:10.1634/stemcells.2007-0197.
Chang C-C, Chang K-C, Tsai S-J, Chang H-H, Lin C-P (2014) Neurogenic differentiation of
dental pulp stem cells to neuron-like cells in dopaminergic and motor neuronal inductive media.
J Formos Med Assoc 113: 956–965. doi:10.1016/j.jfma.2014.09.003.
Chaudhari AA, Vig K, Baganizi DR, Sahu R, Dixit S, Dennis V, Singh SR, Pillai SR (2016)
Future Prospects for Scaffolding Methods and Biomaterials in Skin Tissue Engineering: A Review.
Int J Mol Sci 17. doi:10.3390/ijms17121974.
Chen X, Fu Q, Jin Y, Li M, Yang R, Cui X, Gong M (2017) In vitro studying corrosion

behavior of porous titanium coating in dynamic electrolyte. Mater Sci Eng C Mater Biol Appl 70:
1071–1075. doi:10.1016/j.msec.2016.03.044.
Chen YK, Huang AHC, Chan AWS, Lin LM (2016) Human dental pulp stem cells derived
from cryopreserved dental pulp tissues of vital extracted teeth with disease demonstrate
hepatic-like differentiation. J Tissue Eng Regen Med 10: 475–485. doi:10.1002/term.1763.
Cheng L, Qasba P, Vanguri P, Thiede MA (2000) Human mesenchymal stem cells support
megakaryocyte and pro-platelet formation from CD34(+) hematopoietic progenitor cells. J Cell
Physiol 184: 58–69. doi:10.1002/(SICI)1097-4652(200007)184:1<58::AID-JCP6>3.0.CO;2-B.
138
Bibliography
Chichester CO, Fernández M, Minguell JJ (1993) Extracellular matrix gene expression by

human bone marrow stroma and by marrow fibroblasts. Cell Adhes Commun 1: 93–99.
doi:10.3109/15419069309095685.
Choi YC, Choi JS, Kim BS, Kim JD, Yoon HI, Cho YW (2012) Decellularized extracellular
matrix derived from porcine adipose tissue as a xenogeneic biomaterial for tissue engineering.
Tissue Eng Part C Methods 18: 866–876. doi:10.1089/ten.TEC.2012.0009.
Chrcanovic BR, Kisch J, Albrektsson T, Wennerberg A (2018) A retrospective study on

clinical and radiological outcomes of oral implants in patients followed up for a minimum of 20
years. Clin Implant Dent Relat Res 20: 199–207. doi:10.1111/cid.12571.
Civin CI, Trischmann T, Kadan NS, Davis J, Noga S, Cohen K, Duffy B, Groenewegen I,
Wiley J, Law P, Hardwick A, Oldham F, Gee A (1996) Highly purified CD34-positive cells
reconstitute hematopoiesis. J Clin Oncol 14: 2224–2233. doi:10.1200/JCO.1996.14.8.2224.
Coelho PG, Granjeiro JM, Romanos GE, Suzuki M, Silva NRF, Cardaropoli G, Thompson
VP, Lemons JE (2009) Basic research methods and current trends of dental implant surfaces. J.
Biomed. Mater. Res. Part B Appl. Biomater. 88: 579–596. doi:10.1002/jbm.b.31264.
Coelho PG, Jimbo R, Tovar N, Bonfante EA (2015) Osseointegration: hierarchical

designing encompassing the macrometer, micrometer, and nanometer length scales. Dent
Mater 31: 37–52. doi:10.1016/j.dental.2014.10.007.
Coli P, Jemt T (2021) Are marginal bone level changes around dental implants due to
infection? Clin Implant Dent Relat Res. doi:10.1111/cid.12971.
Conget PA, Minguell JJ (1999) Phenotypical and functional properties of human bone
marrow mesenchymal progenitor cells. J Cell Physiol 181: 67–73. doi:10.1002/(SICI)1097-
4652(199910)181:1<67::AID-JCP7>3.0.CO;2-C.
Connelly JT, Wilson CG, Levenston ME (2008) Characterization of proteoglycan

production and processing by chondrocytes and BMSCs in tissue engineered constructs.
Osteoarthritis and Cartilage 16: 1092–1100. doi:10.1016/j.joca.2008.01.004.
Crisan M, Yap S, Casteilla L, Chen C-W, Corselli M, Park TS, Andriolo G, Sun B, Zheng B,
Zhang L, Norotte C, Teng P-N, Traas J, Schugar R, Deasy BM, Badylak S, Buhring H-J, Giacobino J-
P, Lazzari L, Huard J, Péault B (2008) A perivascular origin for mesenchymal stem cells in multiple
human organs. Cell Stem Cell 3: 301–313. doi:10.1016/j.stem.2008.07.003.
Cuthbert RJ, Giannoudis PV, Wang XN, Nicholson L, Pawson D, Lubenko A, Tan HB,
Dickinson A, McGonagle D, Jones E (2015) Examining the Feasibility of Clinical Grade CD271+
Enrichment of Mesenchymal Stromal Cells for Bone Regeneration. PLoS One 10.
doi:10.1371/journal.pone.0117855.
Dagnino APA, Chagastelles PC, Medeiros RP, Estrázulas M, Kist LW, Bogo MR, Weber
JBB, Campos MM, Silva JB (2020) Neural Regenerative Potential of Stem Cells Derived from the
Tooth Apical Papilla. Stem Cells Dev 29: 1479–1496. doi:10.1089/scd.2020.0121.
Davies OG, Cooper PR, Shelton RM, Smith AJ, Scheven BA (2015) A comparison of the in
vitro mineralisation and dentinogenic potential of mesenchymal stem cells derived from adipose
139
tissue, bone marrow and dental pulp. J Bone Miner Metab 33: 371–382. doi:10.1007/s00774-
014-0601-y.
DE Colli M, Radunovic M, Zizzari VL, DI Giacomo V, DI Nisio C, Piattelli A, Calvo Guirado

JL, Zavan B, Cataldi A, Zara S (2018) Osteoblastic differentiating potential of dental pulp stem
cells in vitro cultured on a chemically modified microrough titanium surface. Dent Mater J 37:
197–205. doi:10.4012/dmj.2016-418.
Delorme B, Charbord P (2007) Culture and characterization of human bone marrow

mesenchymal stem cells. Methods Mol Med 140: 67–81. doi:10.1007/978-1-59745-443-8_4.
Denham M, Conley B, Olsson F, Cole TJ, Mollard R (2005) Stem cells: an overview. Curr
Protoc Cell Biol Chapter 23: Unit 23.1. doi:10.1002/0471143030.cb2301s28.
Dexheimer V, Gabler J, Bomans K, Sims T, Omlor G, Richter W (2016) Differential

expression of TGF-β superfamily members and role of Smad1/5/9-signalling in chondral versus
endochondral chondrocyte differentiation. Sci Rep 6: 36655. doi:10.1038/srep36655.
Dhanasekaran M, Indumathi S, Lissa RP, Harikrishnan R, Rajkumar JS, Sudarsanam D

(2013) A comprehensive study on optimization of proliferation and differentiation potency of
bone marrow derived mesenchymal stem cells under prolonged culture condition.
Cytotechnology 65: 187–197. doi:10.1007/s10616-012-9471-0.
Dhandayuthapani B, Yoshida Y, Maekawa T, Kumar DS (2011) Polymeric Scaffolds in

Tissue Engineering Application: A Review. Review Article. International Journal of Polymer
Science. Hindawi, September 11. doi:https://doi.org/10.1155/2011/290602.
https://www.hindawi.com/journals/ijps/2011/290602/.
Diaz-Rodriguez P, Sánchez M, Landin M (2018) Drug-Loaded Biomimetic Ceramics for

Tissue Engineering. Pharmaceutics 10. doi:10.3390/pharmaceutics10040272.
Digirolamo CM, Stokes D, Colter D, Phinney DG, Class R, Prockop DJ (1999) Propagation
and senescence of human marrow stromal cells in culture: a simple colony-forming assay
identifies samples with the greatest potential to propagate and differentiate. Br J Haematol 107:
275–281. doi:10.1046/j.1365-2141.1999.01715.x.
Dimitrova-Nakov S, Baudry A, Harichane Y, Kellermann O, Goldberg M, Dr ès Sciences

Naturelles (2014) Pulp stem cells: implication in reparative dentin formation. J Endod 40: S13-
18. doi:10.1016/j.joen.2014.01.011.
Dlaska CE, Andersson G, Brittberg M, Suedkamp NP, Raschke MJ, Schuetz MA (2015)
Clinical Translation in Tissue Engineering—The Surgeon’s View. Curr Mol Bio Rep 1: 61–70.
doi:10.1007/s40610-015-0013-3.
Dohan DM, Choukroun J, Diss A, Dohan SL, Dohan AJJ, Mouhyi J, Gogly B (2006) Platelet-
rich fibrin (PRF): a second-generation platelet concentrate. Part II: platelet-related biologic
features. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 101: e45-50.
doi:10.1016/j.tripleo.2005.07.009.
Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, Krause D, Deans R,

Keating A, Prockop D, Horwitz E (2006) Minimal criteria for defining multipotent mesenchymal
stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 8:
315–317. doi:10.1080/14653240600855905.
140
Bibliography
Dong R, Du J, Wang L, Wang J, Ding G, Wang S, Fan Z (2014) Comparison of long

noncoding RNA and mRNA expression profiles in mesenchymal stem cells derived from human
periodontal ligament and bone marrow. Biomed Res Int 2014: 317853.
doi:10.1155/2014/317853.
Dorati R, DeTrizio A, Modena T, Conti B, Benazzo F, Gastaldi G, Genta I (2017)

Biodegradable Scaffolds for Bone Regeneration Combined with Drug-Delivery Systems in
Osteomyelitis Therapy. Pharmaceuticals 10: 96. doi:10.3390/ph10040096.
Du X, Yuan Q, Qu Y, Zhou Y, Bei J (2016) Endometrial Mesenchymal Stem Cells Isolated

from Menstrual Blood by Adherence. Stem Cells Int 2016: 3573846. doi:10.1155/2016/3573846.
Dumic-Cule I, Peric M, Kucko L, Grgurevic L, Pecina M, Vukicevic S (2018) Bone

morphogenetic proteins in fracture repair. International Orthopaedics (SICOT) 42: 2619–2626.
doi:10.1007/s00264-018-4153-y.
Duncan AW, Dorrell C, Grompe M (2009) Stem Cells and Liver Regeneration.
Gastroenterology 137: 466–481. doi:10.1053/j.gastro.2009.05.044.
Eswarakumar VP, Lax I, Schlessinger J (2005) Cellular signaling by fibroblast growth

factor receptors. Cytokine Growth Factor Rev 16: 139–149. doi:10.1016/j.cytogfr.2005.01.001.
Felthaus O, Gosau M, Klein S, Prantl L, Reichert TE, Schmalz G, Morsczeck C (2014a)

Dexamethasone-related osteogenic differentiation of dental follicle cells depends on ZBTB16
but not Runx2. Cell Tissue Res 357: 695–705. doi:10.1007/s00441-014-1891-z.
Felthaus O, Gosau M, Morsczeck C (2014b) ZBTB16 induces osteogenic differentiation

marker genes in dental follicle cells independent from RUNX2. J Periodontol 85: e144-151.
doi:10.1902/jop.2013.130445.
Ferro F, Spelat R, D’Aurizio F, Puppato E, Pandolfi M, Beltrami AP, Cesselli D, Falini G,

Beltrami CA, Curcio F (2012) Dental pulp stem cells differentiation reveals new insights in Oct4A
dynamics. PLoS One 7: e41774. doi:10.1371/journal.pone.0041774.
Fijnheer R, Pietersz RN, de Korte D, Gouwerok CW, Dekker WJ, Reesink HW, Roos D
(1990) Platelet activation during preparation of platelet concentrates: a comparison of the
platelet-rich plasma and the buffy coat methods. Transfusion 30: 634–638. doi:10.1046/j.1537-
2995.1990.30790385523.x.
Fraser JK, Wulur I, Alfonso Z, Hedrick MH (2006) Fat tissue: an underappreciated source
of stem cells for biotechnology. Trends Biotechnol 24: 150–154.
doi:10.1016/j.tibtech.2006.01.010.
Friedenstein AJ, Chailakhjan RK, Lalykina KS (1970) The development of fibroblast

colonies in monolayer cultures of guinea-pig bone marrow and spleen cells. Cell Tissue Kinet 3:
393–403. doi:10.1111/j.1365-2184.1970.tb00347.x.
Friedenstein AJ, Gorskaja JF, Kulagina NN (1976) Fibroblast precursors in normal and
irradiated mouse hematopoietic organs. Exp Hematol 4: 267–274.
Galindo-Moreno P, León-Cano A, Ortega-Oller I, Monje A, O Valle F, Catena A (2015)

Marginal bone loss as success criterion in implant dentistry: beyond 2 mm. Clin Oral Implants
Res 26: e28–e34. doi:10.1111/clr.12324.
141
Gang EJ, Bosnakovski D, Figueiredo CA, Visser JW, Perlingeiro RCR (2007) SSEA-4
identifies mesenchymal stem cells from bone marrow. Blood 109: 1743–1751.
doi:10.1182/blood-2005-11-010504.
Gasik M, Braem A, Chaudhari A, Duyck J, Vleugels J (2015) Titanium implants with

modified surfaces: meta-analysis of in vivo osteointegration. Mater Sci Eng C Mater Biol Appl 49:
152–158. doi:10.1016/j.msec.2014.12.074.
Gervois P, Struys T, Hilkens P, Bronckaers A, Ratajczak J, Politis C, Brône B, Lambrichts I,

Martens W (2015) Neurogenic maturation of human dental pulp stem cells following
neurosphere generation induces morphological and electrophysiological characteristics of
functional neurons. Stem Cells Dev 24: 296–311. doi:10.1089/scd.2014.0117.
Giannini S, Cielo A, Bonanome L, Rastelli C, Derla C, Corpaci F, Falisi G (2015) Comparison

between PRP, PRGF and PRF: lights and shadows in three similar but different protocols. Eur Rev
Med Pharmacol Sci 19: 927–930.
Giuliani A, Manescu A, Langer M, Rustichelli F, Desiderio V, Paino F, De Rosa A, Laino L,

d’Aquino R, Tirino V, Papaccio G (2013) Three years after transplants in human mandibles,
histological and in-line holotomography revealed that stem cells regenerated a compact rather
than a spongy bone: biological and clinical implications. Stem Cells Transl Med 2: 316–324.
doi:10.5966/sctm.2012-0136.
Goldberg M, Smith AJ (2004) CELLS AND EXTRACELLULAR MATRICES OF DENTIN AND

PULP: A BIOLOGICAL BASIS FOR REPAIR AND TISSUE ENGINEERING. Crit Rev Oral Biol Med 15:
13–27. doi:10.1177/154411130401500103.
Gothard D, Dawson JI, Oreffo ROC (2013) Assessing the potential of colony morphology
for dissecting the CFU-F population from human bone marrow stromal cells. Cell Tissue Res 352:
237–247. doi:10.1007/s00441-013-1564-3.
Goto N, Fujimoto K, Fujii S, Ida-Yonemochi H, Ohshima H, Kawamoto T, Noshiro M,

Shukunami C, Kozai K, Kato Y (2016) Role of MSX1 in Osteogenic Differentiation of Human Dental
Pulp Stem Cells. Stem Cells Int 2016: 8035759. doi:10.1155/2016/8035759.
Graziano A, d’Aquino R, Cusella-De Angelis MG, De Francesco F, Giordano A, Laino G,

Piattelli A, Traini T, De Rosa A, Papaccio G (2008) Scaffold’s surface geometry significantly affects
human stem cell bone tissue engineering. J. Cell. Physiol. 214: 166–172. doi:10.1002/jcp.21175.
Griffiths MJD, Bonnet D, Janes SM (2005) Stem cells of the alveolar epithelium. Lancet
366: 249–260. doi:10.1016/S0140-6736(05)66916-4.
Gronthos S, Brahim J, Li W, Fisher LW, Cherman N, Boyde A, DenBesten P, Robey PG, Shi
S (2002) Stem cell properties of human dental pulp stem cells. J Dent Res 81: 531–535.
doi:10.1177/154405910208100806.
Gronthos S, Mankani M, Brahim J, Robey PG, Shi S (2000) Postnatal human dental pulp
stem cells (DPSCs) in vitro and in vivo. Proc. Natl. Acad. Sci. U.S.A. 97: 13625–13630.
doi:10.1073/pnas.240309797.
Gronthos S, Zannettino ACW, Hay SJ, Shi S, Graves SE, Kortesidis A, Simmons PJ (2003)
Molecular and cellular characterisation of highly purified stromal stem cells derived from human
bone marrow. J Cell Sci 116: 1827–1835. doi:10.1242/jcs.00369.
142
Bibliography
Grottkau BE, Purudappa PP, Lin Y (2010) Multilineage differentiation of dental pulp stem
cells from green fluorescent protein transgenic mice. Int J Oral Sci 2: 21–27.
doi:10.4248/IJOS10015.
Guo X, Bai Y, Zhang L, Zhang B, Zagidullin N, Carvalho K, Du Z, Cai B (2018) Cardiomyocyte

differentiation of mesenchymal stem cells from bone marrow: new regulators and its
implications. Stem Cell Research & Therapy 9: 44. doi:10.1186/s13287-018-0773-9.
Han N, Zheng Y, Li R, Li X, Zhou M, Niu Y, Zhang Q (2014) β-catenin enhances

odontoblastic differentiation of dental pulp cells through activation of Runx2. PLoS One 9:
e88890. doi:10.1371/journal.pone.0088890.
Han Y-J, Kang Y-H, Shivakumar SB, Bharti D, Son Y-B, Choi Y-H, Park W-U, Byun J-H, Rho
G-J, Park B-W (2017) Stem Cells from Cryopreserved Human Dental Pulp Tissues Sequentially
Differentiate into Definitive Endoderm and Hepatocyte-Like Cells in vitro. Int J Med Sci 14: 1418–
1429. doi:10.7150/ijms.22152.
Haynesworth SE, Baber MA, Caplan AI (1992) Cell surface antigens on human marrow-
derived mesenchymal cells are detected by monoclonal antibodies. Bone 13: 69–80.
doi:10.1016/8756-3282(92)90363-2.
Hench LL, Polak JM (2002) Third-generation biomedical materials. Science 295: 1014–
1017. doi:10.1126/science.1067404.
Hilkens P, Gervois P, Fanton Y, Vanormelingen J, Martens W, Struys T, Politis C,

Lambrichts I, Bronckaers A (2013) Effect of isolation methodology on stem cell properties and
multilineage differentiation potential of human dental pulp stem cells. Cell Tissue Res 353: 65–
78. doi:10.1007/s00441-013-1630-x.
Hodgkinson T, Yuan X-F, Bayat A (2009) Adult stem cells in tissue engineering. Expert
Rev Med Devices 6: 621–640. doi:10.1586/erd.09.48.
Honda MJ, Imaizumi M, Tsuchiya S, Morsczeck C (2010) Dental follicle stem cells and
tissue engineering. J Oral Sci 52: 541–552. doi:10.2334/josnusd.52.541.
Horwitz EM, Keating A (2000) Nonhematopoietic mesenchymal stem cells: what are
they? Cytotherapy 2: 387–388.
Horwitz EM, Le Blanc K, Dominici M, Mueller I, Slaper-Cortenbach I, Marini FC, Deans RJ,
Krause DS, Keating A, International Society for Cellular Therapy (2005) Clarification of the
nomenclature for MSC: The International Society for Cellular Therapy position statement.
Cytotherapy 7: 393–395. doi:10.1080/14653240500319234.
Ibarretxe G, Crende O, Aurrekoetxea M, García-Murga V, Etxaniz J, Unda F (2012a)

Neural crest stem cells from dental tissues: a new hope for dental and neural regeneration. Stem
Cells Int 2012: 103503. doi:10.1155/2012/103503.
Ibarretxe G, Crende O, Aurrekoetxea M, García-Murga V, Etxaniz J, Unda F (2012b)

Neural crest stem cells from dental tissues: a new hope for dental and neural regeneration. Stem
Cells Int 2012: 103503. doi:10.1155/2012/103503.
Irastorza I, Luzuriaga J, Martinez-Conde R, Ibarretxe G, Unda F (2019) Adhesion,

integration and osteogenesis of human dental pulp stem cells on biomimetic implant surfaces
143
combined with plasma derived products. Eur Cell Mater 38: 201–214.
doi:10.22203/eCM.v038a14.
Ishkitiev N, Yaegaki K, Imai T, Tanaka T, Nakahara T, Ishikawa H, Mitev V, Haapasalo M

(2012) High-purity hepatic lineage differentiated from dental pulp stem cells in serum-free
medium. J Endod 38: 475–480. doi:10.1016/j.joen.2011.12.011.
Ishkitiev N, Yaegaki K, Kozhuharova A, Tanaka T, Okada M, Mitev V, Fukuda M, Imai T

(2013) Pancreatic differentiation of human dental pulp CD117+ stem cells. Regen Med 8: 597–
612. doi:10.2217/rme.13.42.
Isobe Y, Koyama N, Nakao K, Osawa K, Ikeno M, Yamanaka S, Okubo Y, Fujimura K,

Bessho K (2016) Comparison of human mesenchymal stem cells derived from bone marrow,
synovial fluid, adult dental pulp, and exfoliated deciduous tooth pulp. International Journal of
Oral and Maxillofacial Surgery 45: 124–131. doi:10.1016/j.ijom.2015.06.022.
Iviglia G, Kargozar S, Baino F (2019) Biomaterials, Current Strategies, and Novel Nano-
Technological Approaches for Periodontal Regeneration. J Funct Biomater 10.
doi:10.3390/jfb10010003.
Jameson CA (2007) Autologous Platelet Concentrate for the Production of Platelet Gel.
Laboratory Medicine 38: 39–42. doi:10.1309/3UA5HWYVKNCE01AR.
Jang J-H, Lee H-W, Cho KM, Shin H-W, Kang MK, Park SH, Kim E (2016) In vitro
characterization of human dental pulp stem cells isolated by three different methods. Restor
Dent Endod 41: 283–295. doi:10.5395/rde.2016.41.4.283.
Jemat A, Ghazali MJ, Razali M, Otsuka Y (2015) Surface Modifications and Their Effects
on Titanium Dental Implants. Biomed Res Int 2015: 791725. doi:10.1155/2015/791725.
Jones EA, English A, Kinsey SE, Straszynski L, Emery P, Ponchel F, McGonagle D (2006)
Optimization of a flow cytometry-based protocol for detection and phenotypic characterization
of multipotent mesenchymal stromal cells from human bone marrow. Cytometry B Clin Cytom
70: 391–399. doi:10.1002/cyto.b.20118.
Jones EA, Kinsey SE, English A, Jones RA, Straszynski L, Meredith DM, Markham AF, Jack
A, Emery P, McGonagle D (2002) Isolation and characterization of bone marrow multipotential
mesenchymal progenitor cells. Arthritis Rheum 46: 3349–3360. doi:10.1002/art.10696.
Jovani-Sancho MDM, Sheth CC, Marqués-Mateo M, Puche-Torres M (2016) Platelet-Rich

Plasma: A Study of the Variables that May Influence Its Effect on Bone Regeneration. Clin Implant
Dent Relat Res 18: 1051–1064. doi:10.1111/cid.12361.
Kahan BW, Ephrussi B (1970) Developmental potentialities of clonal in vitro cultures of

mouse testicular teratoma. J. Natl. Cancer Inst. 44: 1015–1036.
Kanafi M, Majumdar D, Bhonde R, Gupta P, Datta I (2014) Midbrain cues dictate

differentiation of human dental pulp stem cells towards functional dopaminergic neurons. J Cell
Physiol 229: 1369–1377. doi:10.1002/jcp.24570.
Karamzadeh R, Eslaminejad MB (2013) Dental-Related Stem Cells and Their Potential in

Regenerative Medicine. Regenerative Medicine and Tissue Engineering. IntechOpen, May 22.
144
Bibliography
doi:10.5772/55927. https://www.intechopen.com/books/regenerative-medicine-and-tissue-
engineering/dental-related-stem-cells-and-their-potential-in-regenerative-medicine.
Karbalaie KH, Tanhaei S, Rabiei F, Kiani-Esfahani A, Masoudi NS, Nasr-Esfahani MH,

Baharvand H (2021) Stem Cells from Human Exfoliated Deciduous Tooth Exhibit Stromal-Derived
Inducing Activity and Lead to Generation of Neural Crest Cells from Human Embryonic Stem
Cells. Cell J 23: 140–142. doi:10.22074/cellj.2021.7931.
Kattimani VS, Kondaka S, Lingamaneni KP (2016) Hydroxyapatite–-Past, Present, and

Future in Bone Regeneration. Bone Tissue Regen Insights 7: BTRI.S36138.
doi:10.4137/BTRI.S36138.
Kawashima N (2012) Characterisation of dental pulp stem cells: a new horizon for tissue
regeneration? Arch Oral Biol 57: 1439–1458. doi:10.1016/j.archoralbio.2012.08.010.
Kerkis I, Kerkis A, Dozortsev D, Stukart-Parsons GC, Gomes Massironi SM, Pereira LV,
Caplan AI, Cerruti HF (2006) Isolation and characterization of a population of immature dental
pulp stem cells expressing OCT-4 and other embryonic stem cell markers. Cells Tissues Organs
184: 105–116. doi:10.1159/000099617.
Khan SN, Cammisa FP, Sandhu HS, Diwan AD, Girardi FP, Lane JM (2005) The biology of
bone grafting. J Am Acad Orthop Surg 13: 77–86.
Khanabdali R, Saadat A, Fazilah M, Bazli KFK, Qazi R-M, Khalid RS, Hasan Adli DS,
Moghadamtousi SZ, Naeem N, Khan I, Salim A, Shamsuddin SA, Mohan G (2016) Promoting
effect of small molecules in cardiomyogenic and neurogenic differentiation of rat bone marrow-
derived mesenchymal stem cells. Drug Des Devel Ther 10: 81–91. doi:10.2147/DDDT.S89658.
Khang G, Kim HL, Hong M, Lee D (2012) Neurogenesis of bone marrow-derived

mesenchymal stem cells onto β-mercaptoethanol-loaded PLGA film. Cell Tissue Res 347: 713–
724. doi:10.1007/s00441-011-1232-4.
Khurana R, Kudva PB, Husain SY (2017) Comparative evaluation of the isolation and
quantification of stem cells derived from dental pulp and periodontal ligament of a permanent
tooth and to assess their viability and proliferation on a platelet-rich fibrin scaffold. J Indian Soc
Periodontol 21: 16–20. doi:10.4103/jisp.jisp_182_16.
Király M, Kádár K, Horváthy DB, Nardai P, Rácz GZ, Lacza Z, Varga G, Gerber G (2011)
Integration of neuronally predifferentiated human dental pulp stem cells into rat brain in vivo.
Neurochem Int 59: 371–381. doi:10.1016/j.neuint.2011.01.006.
Kleinsmith LJ, Pierce GB (1964) Multipotentiality of single embrional carcinoma cells.

Cancer Res. 24: 1544–1551.
Knychala J, Bouropoulos N, Catt CJ, Katsamenis OL, Please CP, Sengers BG (2013) Pore
geometry regulates early stage human bone marrow cell tissue formation and organisation. Ann
Biomed Eng 41: 917–930. doi:10.1007/s10439-013-0748-z.
Kobayashi E, Flückiger L, Fujioka-Kobayashi M, Sawada K, Sculean A, Schaller B, Miron RJ

(2016) Comparative release of growth factors from PRP, PRF, and advanced-PRF. Clin Oral
Investig 20: 2353–2360. doi:10.1007/s00784-016-1719-1.
145
Koç ON, Peters C, Aubourg P, Raghavan S, Dyhouse S, DeGasperi R, Kolodny EH, Yoseph
YB, Gerson SL, Lazarus HM, Caplan AI, Watkins PA, Krivit W (1999) Bone marrow-derived
mesenchymal stem cells remain host-derived despite successful hematopoietic engraftment
after allogeneic transplantation in patients with lysosomal and peroxisomal storage diseases.
Exp Hematol 27: 1675–1681. doi:10.1016/s0301-472x(99)00101-0.
Kokubo T, Takadama H (2006) How useful is SBF in predicting in vivo bone bioactivity?
Biomaterials 27: 2907–2915. doi:10.1016/j.biomaterials.2006.01.017.
Krampera M, Marconi S, Pasini A, Galiè M, Rigotti G, Mosna F, Tinelli M, Lovato L,

Anghileri E, Andreini A, Pizzolo G, Sbarbati A, Bonetti B (2007) Induction of neural-like
differentiation in human mesenchymal stem cells derived from bone marrow, fat, spleen and
thymus. Bone 40: 382–390. doi:10.1016/j.bone.2006.09.006.
Kumar KR, Genmorgan K, Abdul Rahman SM, Rajan MA, Kumar TA, Prasad VS (2016)
Role of plasma-rich fibrin in oral surgery. J Pharm Bioallied Sci 8: S36–S38. doi:10.4103/0975-
7406.191963.
Kumar RV, Shubhashini N (2013) Platelet rich fibrin: a new paradigm in periodontal
regeneration. Cell Tissue Bank 14: 453–463. doi:10.1007/s10561-012-9349-6.
Lakshmi R, Sasikumar S (2015) Influence of needle-like morphology on the bioactivity of

nanocrystalline wollastonite--an in vitro study. Int J Nanomedicine 10 Suppl 1: 129–136.
doi:10.2147/IJN.S79986.
Langenbach F, Handschel J (2013) Effects of dexamethasone, ascorbic acid and β-

glycerophosphate on the osteogenic differentiation of stem cells in vitro. Stem Cell Res Ther 4:
117. doi:10.1186/scrt328.
Le Guéhennec L, Soueidan A, Layrolle P, Amouriq Y (2007) Surface treatments of

titanium dental implants for rapid osseointegration. Dent Mater 23: 844–854.
doi:10.1016/j.dental.2006.06.025.
Lee CP, Colombo JS, Ayre WN, Sloan AJ, Waddington RJ (2015a) Elucidating the cellular
actions of demineralised dentine matrix extract on a clonal dental pulp stem cell population in
orchestrating dental tissue repair. J Tissue Eng 6: 2041731415586318.
doi:10.1177/2041731415586318.
Lee J-S, Kim S-K, Gruber R, Kim C-S (2020) Periodontal healing by periodontal ligament
fiber with or without cells: A preclinical study of the decellularized periodontal ligament in a
tooth replantation model. J Periodontol 91: 110–119. doi:10.1002/JPER.19-0126.
Lee J-T, Choi S-Y, Kim H-L, Kim J-Y, Lee H-J, Kwon T-G (2015b) Comparison of gene
expression between mandibular and iliac bone-derived cells. Clin Oral Invest 19: 1223–1233.
doi:10.1007/s00784-014-1353-8.
Lenkiewicz AM (2019) Epidermal Stem Cells. Adv Exp Med Biol 1201: 239–259.
doi:10.1007/978-3-030-31206-0_12.
Leucht P, Kim J-B, Amasha R, James AW, Girod S, Helms JA (2008) Embryonic origin and
Hox status determine progenitor cell fate during adult bone regeneration. Development 135:
2845–2854. doi:10.1242/dev.023788.
146
Bibliography
Liu N, Zhou M, Zhang Q, Yong L, Zhang T, Tian T, Ma Q, Lin S, Zhu B, Cai X (2018) Effect
of substrate stiffness on proliferation and differentiation of periodontal ligament stem cells. Cell
Prolif 51: e12478. doi:10.1111/cpr.12478.
Luzuriaga J, Irurzun J, Irastorza I, Unda F, Ibarretxe G, Pineda JR (2020) Vasculogenesis

from Human Dental Pulp Stem Cells Grown in Matrigel with Fully Defined Serum-Free Culture
Media. Biomedicines 8. doi:10.3390/biomedicines8110483.
Luzuriaga J, Pastor-Alonso O, Encinas JM, Unda F, Ibarretxe G, Pineda JR (2019a) Human

Dental Pulp Stem Cells Grown in Neurogenic Media Differentiate Into Endothelial Cells and
Promote Neovasculogenesis in the Mouse Brain. Front. Physiol. 10.
doi:10.3389/fphys.2019.00347.
https://www.frontiersin.org/articles/10.3389/fphys.2019.00347/full.
Luzuriaga J, Pineda JR, Irastorza I, Uribe-Etxebarria V, García-Gallastegui P, Encinas JM,

Chamero P, Unda F, Ibarretxe G (2019b) BDNF and NT3 Reprogram Human Ectomesenchymal
Dental Pulp Stem Cells to Neurogenic and Gliogenic Neural Crest Progenitors Cultured in Serum-
Free Medium. Cell Physiol Biochem 52: 1361–1380. doi:10.33594/000000096.
Luzuriaga J, Polo Y, Pastor-Alonso O, Pardo-Rodríguez B, Larrañaga A, Unda F, Sarasua J-

R, Pineda JR, Ibarretxe G (2021) Advances and Perspectives in Dental Pulp Stem Cell Based
Neuroregeneration Therapies. Int J Mol Sci 22. doi:10.3390/ijms22073546.
Ma G-F, Ali A, Verzijl N, Hanemaaijer R, TeKoppele J, Konttinen YT, Salo J (2006)

Increased collagen degradation around loosened total hip replacement implants. Arthritis
Rheum 54: 2928–2933. doi:10.1002/art.22064.
Ma S, Xie N, Li W, Yuan B, Shi Y, Wang Y (2014) Immunobiology of mesenchymal stem

cells. Cell Death Differ. 21: 216–225. doi:10.1038/cdd.2013.158.
Madarieta Pardo I, García Urquia N, Fernandez García R (2017) Method for Producing a
Decellularized Tissue Matrix. July 6.
https://patentscope.wipo.int/search/en/detail.jsf?docId=WO2017114902.
Majo F, Rochat A, Nicolas M, Jaoudé GA, Barrandon Y (2008) Oligopotent stem cells are
distributed throughout the mammalian ocular surface. Nature 456: 250–254.
doi:10.1038/nature07406.
Mansergh FC, Wride MA, Rancourt DE (2000) Neurons from stem cells: implications for
understanding nervous system development and repair. Biochem Cell Biol 78: 613–628.
Marchionni C, Bonsi L, Alviano F, Lanzoni G, Di Tullio A, Costa R, Montanari M, Tazzari

PL, Ricci F, Pasquinelli G, Orrico C, Grossi A, Prati C, Bagnara GP (2009) Angiogenic potential of
human dental pulp stromal (stem) cells. Int J Immunopathol Pharmacol 22: 699–706.
doi:10.1177/039463200902200315.
Martin GR (1980) Teratocarcinomas and mammalian embryogenesis. Science 209: 768–

776.
Marx RE, Carlson ER, Eichstaedt RM, Schimmele SR, Strauss JE, Georgeff KR (1998)
Platelet-rich plasma: Growth factor enhancement for bone grafts. Oral Surg Oral Med Oral
Pathol Oral Radiol Endod 85: 638–646. doi:10.1016/s1079-2104(98)90029-4.
147
Marx RE (2004) Platelet-rich plasma: evidence to support its use. J Oral Maxillofac Surg
62: 489–496. doi:10.1016/j.joms.2003.12.003.
Masuki H, Okudera T, Watanebe T, Suzuki M, Nishiyama K, Okudera H, Nakata K,

Uematsu K, Su C-Y, Kawase T (2016) Growth factor and pro-inflammatory cytokine contents in
platelet-rich plasma (PRP), plasma rich in growth factors (PRGF), advanced platelet-rich fibrin (A-
PRF), and concentrated growth factors (CGF). Int J Implant Dent 2: 19. doi:10.1186/s40729-016-
0052-4.
Matsuda C, Takagi M, Hattori T, Wakitani S, Yoshida T (2005) Differentiation of Human

Bone Marrow Mesenchymal Stem Cells to Chondrocytes for Construction of Three-dimensional
Cartilage Tissue. Cytotechnology 47: 11–17. doi:10.1007/s10616-005-3751-x.
Mayer Y, Ginesin O, Khutaba A, Machtei EE, Zigdon Giladi H (2018) Biocompatibility and
osteoconductivity of PLCL coated and noncoated xenografts: An in vitro and preclinical trial. Clin
Implant Dent Relat Res 20: 294–299. doi:10.1111/cid.12596.
McElreavey KD, Irvine AI, Ennis KT, McLean WH (1991) Isolation, culture and
characterisation of fibroblast-like cells derived from the Wharton’s jelly portion of human
umbilical cord. Biochem Soc Trans 19: 29S. doi:10.1042/bst019029s.
Miron RJ, Sculean A, Cochran DL, Froum S, Zucchelli G, Nemcovsky C, Donos N,

Lyngstadaas SP, Deschner J, Dard M, Stavropoulos A, Zhang Y, Trombelli L, Kasaj A, Shirakata Y,
Cortellini P, Tonetti M, Rasperini G, Jepsen S, Bosshardt DD (2016) Twenty years of enamel
matrix derivative: the past, the present and the future. J Clin Periodontol 43: 668–683.
doi:10.1111/jcpe.12546.
Miura M, Gronthos S, Zhao M, Lu B, Fisher LW, Robey PG, Shi S (2003) SHED: stem cells
from human exfoliated deciduous teeth. Proc Natl Acad Sci U S A 100: 5807–5812.
doi:10.1073/pnas.0937635100.
Mohanram Y, Zhang J, Tsiridis E, Yang XB (2020) Comparing bone tissue engineering

efficacy of HDPSCs, HBMSCs on 3D biomimetic ABM-P-15 scaffolds in vitro and in vivo.
Cytotechnology 72: 715–730. doi:10.1007/s10616-020-00414-7.
Moraschini V, Poubel LA da C, Ferreira VF, Barboza E dos SP (2015) Evaluation of survival

and success rates of dental implants reported in longitudinal studies with a follow-up period of
at least 10 years: a systematic review. Int J Oral Maxillofac Surg 44: 377–388.
doi:10.1016/j.ijom.2014.10.023.
Morejón L, Delgado JA, Antunes Ribeiro A, Varella de Oliveira M, Mendizábal E, García I,

Alfonso A, Poh P, van Griensven M, Balmayor ER (2019) Development, Characterization and In
Vitro Biological Properties of Scaffolds Fabricated From Calcium Phosphate Nanoparticles. Int J
Mol Sci 20. doi:10.3390/ijms20071790.
Murphy CM, Haugh MG, O’Brien FJ (2010) The effect of mean pore size on cell
attachment, proliferation and migration in collagen-glycosaminoglycan scaffolds for bone tissue
engineering. Biomaterials 31: 461–466. doi:10.1016/j.biomaterials.2009.09.063.
148
Bibliography
Muruganandan S, Roman AA, Sinal CJ (2009) Adipocyte differentiation of bone marrow-

derived mesenchymal stem cells: cross talk with the osteoblastogenic program. Cell Mol Life Sci
66: 236–253. doi:10.1007/s00018-008-8429-z.
Nada OA, El Backly RM (2018) Stem Cells From the Apical Papilla (SCAP) as a Tool for
Endogenous Tissue Regeneration. Front Bioeng Biotechnol 6: 103.
doi:10.3389/fbioe.2018.00103.
Nakamura N, Ito A, Kimura T, Kishida A (2019) Extracellular Matrix Induces Periodontal

Ligament Reconstruction In Vivo. Int J Mol Sci 20. doi:10.3390/ijms20133277.
Navarro M, Michiardi A, Castaño O, Planell JA (2008) Biomaterials in orthopaedics. J R

Soc Interface 5: 1137–1158. doi:10.1098/rsif.2008.0151.
Naves MM, Menezes HHM, Magalhães D, Ferreira JA, Ribeiro SF, de Mello JDB, Costa HL
(2015) Effect of Macrogeometry on the Surface Topography of Dental Implants. Int J Oral
Maxillofac Implants 30: 789–799.
Nemeth CL, Janebodin K, Yuan AE, Dennis JE, Reyes M, Kim D-H (2014) Enhanced
chondrogenic differentiation of dental pulp stem cells using nanopatterned PEG-GelMA-HA
hydrogels. Tissue Eng Part A 20: 2817–2829. doi:10.1089/ten.TEA.2013.0614.
Ng J, Spiller K, Bernhard J, Vunjak-Novakovic G (2017) Biomimetic Approaches for Bone

Tissue Engineering. Tissue Eng Part B Rev 23: 480–493. doi:10.1089/ten.TEB.2016.0289.
Nishiyama K, Okudera T, Watanabe T, Isobe K, Suzuki M, Masuki H, Okudera H, Uematsu

K, Nakata K, Kawase T (2016) Basic characteristics of plasma rich in growth factors (PRGF): blood
cell components and biological effects. Clin Exp Dent Res 2: 96–103. doi:10.1002/cre2.26.
Nuti N, Corallo C, Chan BMF, Ferrari M, Gerami-Naini B (2016) Multipotent

Differentiation of Human Dental Pulp Stem Cells: a Literature Review. Stem Cell Rev 12: 511–
523. doi:10.1007/s12015-016-9661-9.
O’Brien FJ (2011) Biomaterials & scaffolds for tissue engineering. Materials Today 14:
88–95. doi:10.1016/S1369-7021(11)70058-X.
Olivares-Navarrete R, Hyzy SL, Hutton DL, Erdman CP, Wieland M, Boyan BD, Schwartz Z
(2010) Direct and indirect effects of microstructured titanium substrates on the induction of
mesenchymal stem cell differentiation towards the osteoblast lineage. Biomaterials 31: 2728–
2735. doi:10.1016/j.biomaterials.2009.12.029.
Onizuka S, Iwata T, Park S-J, Nakai K, Yamato M, Okano T, Izumi Y (2016) ZBTB16 as a
Downstream Target Gene of Osterix Regulates Osteoblastogenesis of Human Multipotent
Mesenchymal Stromal Cells. J Cell Biochem 117: 2423–2434. doi:10.1002/jcb.25634.
Orimo H (2010) The mechanism of mineralization and the role of alkaline phosphatase
in health and disease. J Nippon Med Sch 77: 4–12. doi:10.1272/jnms.77.4.
Osathanon T, Sawangmake C, Nowwarote N, Pavasant P (2014) Neurogenic

differentiation of human dental pulp stem cells using different induction protocols. Oral Dis 20:
352–358. doi:10.1111/odi.12119.
Pagella P, Miran S, Neto E, Martin I, Lamghari M, Mitsiadis TA (2020) Human dental pulp
stem cells exhibit enhanced properties in comparison to human bone marrow stem cells on
149
neurites outgrowth. The FASEB Journal 34: 5499–5511.

doi:https://doi.org/10.1096/fj.201902482R.
Paknejad M, Shayesteh YS, Yaghobee S, Shariat S, Dehghan M, Motahari P (2012)

Evaluation of the Effect of Plasma Rich in Growth Factors (PRGF) on Bone Regeneration. J Dent
(Tehran) 9: 59–67.
Pałka K, Pokrowiecki R (2018) Porous Titanium Implants: A Review. Advanced

Engineering Materials 20: 1700648. doi:https://doi.org/10.1002/adem.201700648.
Perrotti V, Palmieri A, Pellati A, Degidi M, Ricci L, Piattelli A, Carinci F (2013) Effect of

titanium surface topographies on human bone marrow stem cells differentiation in vitro.
Odontology 101: 133–139. doi:10.1007/s10266-012-0067-0.
Phinney DG, Kopen G, Righter W, Webster S, Tremain N, Prockop DJ (1999) Donor

variation in the growth properties and osteogenic potential of human marrow stromal cells. J
Cell Biochem 75: 424–436.
Pilipchuk SP, Plonka AB, Monje A, Taut AD, Lanis A, Kang B, Giannobile WV (2015) Tissue
engineering for bone regeneration and osseointegration in the oral cavity. Dent Mater 31: 317–
338. doi:10.1016/j.dental.2015.01.006.
Pineda Martí JR, Luzuriaga González J, Unda Rodríguez F, Pastor Alonso O, Encinas Pérez
JM, Ibarretxe Bilbao G, Irastorza Epelde I (2020) Cellular Aggregates for Use in Vascularisation
Therapy. January 9. https://patentscope.wipo.int/search/en/detail.jsf?docId=WO2020007878.
Pisciotta A, Bertani G, Bertoni L, Di Tinco R, De Biasi S, Vallarola A, Pignatti E, Tupler R,

Salvarani C, de Pol A, Carnevale G (2020) Modulation of Cell Death and Promotion of
Chondrogenic Differentiation by Fas/FasL in Human Dental Pulp Stem Cells (hDPSCs). Front Cell
Dev Biol 8. doi:10.3389/fcell.2020.00279.
Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, Moorman MA,
Simonetti DW, Craig S, Marshak DR (1999) Multilineage potential of adult human mesenchymal
stem cells. Science 284: 143–147. doi:10.1126/science.284.5411.143.
Ponnaiyan D, Jegadeesan V (2014) Comparison of phenotype and differentiation marker

gene expression profiles in human dental pulp and bone marrow mesenchymal stem cells. Eur J
Dent 8: 307–313. doi:10.4103/1305-7456.137631.
Portmann-Lanz CB, Schoeberlein A, Huber A, Sager R, Malek A, Holzgreve W, Surbek DV

(2006) Placental mesenchymal stem cells as potential autologous graft for pre- and perinatal
neuroregeneration. Am. J. Obstet. Gynecol. 194: 664–673. doi:10.1016/j.ajog.2006.01.101.
Posfai E, Schell JP, Janiszewski A, Rovic I, Murray A, Bradshaw B, Yamakawa T, Pardon T,

El Bakkali M, Talon I, De Geest N, Kumar P, To SK, Petropoulos S, Jurisicova A, Pasque V, Lanner
F, Rossant J (2021) Evaluating totipotency using criteria of increasing stringency. Nat Cell Biol 23:
49–60. doi:10.1038/s41556-020-00609-2.
Potten CS, Loeffler M (1990) Stem cells: attributes, cycles, spirals, pitfalls and
uncertainties. Lessons for and from the crypt. Development 110: 1001–1020.
150
Bibliography
Powers CJ, McLeskey SW, Wellstein A (2000) Fibroblast growth factors, their receptors
and signaling. Endocr Relat Cancer 7: 165–197. doi:10.1677/erc.0.0070165.
Prockop DJ (1997) Marrow stromal cells as stem cells for nonhematopoietic tissues.
Science 276: 71–74. doi:10.1126/science.276.5309.71.
Rahman SU, Nagrath M, Ponnusamy S, Arany PR (2018) Nanoscale and Macroscale

Scaffolds with Controlled-Release Polymeric Systems for Dental Craniomaxillofacial Tissue
Engineering. Materials (Basel) 11. doi:10.3390/ma11081478.
Raik S, Kumar A, Rattan V, Seth S, Kaur A, Bhatta Charyya S (2020) Assessment of Post-
thaw Quality of Dental Mesenchymal Stromal Cells After Long-Term Cryopreservation by
Uncontrolled Freezing. Appl Biochem Biotechnol 191: 728–743. doi:10.1007/s12010-019-
03216-6.
Rani VVD, Vinoth-Kumar L, Anitha VC, Manzoor K, Deepthy M, Shantikumar VN (2012)

Osteointegration of titanium implant is sensitive to specific nanostructure morphology. Acta
Biomater 8: 1976–1989. doi:10.1016/j.actbio.2012.01.021.
Rao SM, Ugale GM, Warad SB (2013) Bone Morphogenetic Proteins: Periodontal
Regeneration. N Am J Med Sci 5: 161–168. doi:10.4103/1947-2714.109175.
Reuss B, von Bohlen und Halbach O (2003) Fibroblast growth factors and their receptors
in the central nervous system. Cell Tissue Res 313: 139–157. doi:10.1007/s00441-003-0756-7.
Riccio M, Resca E, Maraldi T, Pisciotta A, Ferrari A, Bruzzesi G, De Pol A (2010) Human

dental pulp stem cells produce mineralized matrix in 2D and 3D cultures. Eur J Histochem 54:
e46. doi:10.4081/ejh.2010.e46.
Roberts TT, Rosenbaum AJ (2012) Bone grafts, bone substitutes and orthobiologics: the
bridge between basic science and clinical advancements in fracture healing. Organogenesis 8:
114–124. doi:10.4161/org.23306.
Roosa SMM, Kemppainen JM, Moffitt EN, Krebsbach PH, Hollister SJ (2010) The pore size
of polycaprolactone scaffolds has limited influence on bone regeneration in an in vivo model. J
Biomed Mater Res A 92: 359–368. doi:10.1002/jbm.a.32381.
Rupp F, Liang L, Geis-Gerstorfer J, Scheideler L, Hüttig F (2018) Surface characteristics of

dental implants: A review. Dent Mater 34: 40–57. doi:10.1016/j.dental.2017.09.007.
Salou L, Hoornaert A, Stanovici J, Briand S, Louarn G, Layrolle P (2015) Comparative bone

tissue integration of nanostructured and microroughened dental implants. Nanomedicine
(Lond) 10: 741–751. doi:10.2217/nnm.14.223.
Sanchez-Ramos J, Song S, Cardozo-Pelaez F, Hazzi C, Stedeford T, Willing A, Freeman TB,

Saporta S, Janssen W, Patel N, Cooper DR, Sanberg PR (2000) Adult Bone Marrow Stromal Cells
Differentiate into Neural Cells in Vitro. Experimental Neurology 164: 247–256.
doi:10.1006/exnr.2000.7389.
Santos F dos, Andrade PZ, Abecasis MM, Gimble JM, Chase LG, Campbell AM, Boucher
S, Vemuri MC, Silva CL da, Cabral JMS (2011) Toward a clinical-grade expansion of mesenchymal
stem cells from human sources: a microcarrier-based culture system under xeno-free
conditions. Tissue Eng Part C Methods 17: 1201–1210. doi:10.1089/ten.tec.2011.0255.
151
Scintu F, Reali C, Pillai R, Badiali M, Sanna MA, Argiolu F, Ristaldi MS, Sogos V (2006)
Differentiation of human bone marrow stem cells into cells with a neural phenotype: diverse
effects of two specific treatments. BMC Neurosci 7: 14. doi:10.1186/1471-2202-7-14.
Seale P, Asakura A, Rudnicki MA (2001) The Potential of Muscle Stem Cells.

Developmental Cell 1: 333–342. doi:10.1016/S1534-5807(01)00049-1.
Sedgley CM, Botero TM (2012) Dental stem cells and their sources. Dent Clin North Am
56: 549–561. doi:10.1016/j.cden.2012.05.004.
Seo B-M, Miura M, Gronthos S, Bartold PM, Batouli S, Brahim J, Young M, Robey PG,
Wang C-Y, Shi S (2004) Investigation of multipotent postnatal stem cells from human periodontal
ligament. Lancet 364: 149–155. doi:10.1016/S0140-6736(04)16627-0.
Shi S, Gronthos S (2003) Perivascular niche of postnatal mesenchymal stem cells in

human bone marrow and dental pulp. J Bone Miner Res 18: 696–704.
doi:10.1359/jbmr.2003.18.4.696.
Short B, Brouard N, Occhiodoro-Scott T, Ramakrishnan A, Simmons PJ (2003)

Mesenchymal stem cells. Arch Med Res 34: 565–571. doi:10.1016/j.arcmed.2003.09.007.
Shyamala K, Yanduri S, Girish HC, Murgod S (2015) Neural crest: The fourth germ layer.
J Oral Maxillofac Pathol 19: 221–229. doi:10.4103/0973-029X.164536.
da Silva Meirelles L, Chagastelles PC, Nardi NB (2006) Mesenchymal stem cells reside in
virtually all post-natal organs and tissues. J Cell Sci 119: 2204–2213. doi:10.1242/jcs.02932.
Simmons PJ, Torok-Storb B (1991) Identification of stromal cell precursors in human

bone marrow by a novel monoclonal antibody, STRO-1. Blood 78: 55–62.
Simonović J, Toljić B, Rašković B, Jovanović V, Lazarević M, Milošević M, Nikolić N,

Panajotović R, Milašin J (2019) Raman microspectroscopy: toward a better distinction and
profiling of different populations of dental stem cells. Croat Med J 60: 78–86.
Slack JM (2000) Stem cells in epithelial tissues. Science 287: 1431–1433.
Smith AG (2001) Embryo-derived stem cells: of mice and men. Annu. Rev. Cell Dev. Biol.
17: 435–462. doi:10.1146/annurev.cellbio.17.1.435.
Solchaga LA, Penick KJ, Welter JF (2011) Chondrogenic Differentiation of Bone Marrow-
Derived Mesenchymal Stem Cells: Tips and Tricks. Methods Mol Biol 698: 253–278.
doi:10.1007/978-1-60761-999-4_20.
Song B, Jiang W, Alraies A, Liu Q, Gudla V, Oni J, Wei X, Sloan A, Ni L, Agarwal M (2016)
Bladder Smooth Muscle Cells Differentiation from Dental Pulp Stem Cells: Future Potential for
Bladder Tissue Engineering. Stem Cells Int 2016: 6979368. doi:10.1155/2016/6979368.
Sordi MB, Curtarelli RB, da Silva IT, Fongaro G, Benfatti CAM, de Souza Magini R, Cabral
da Cruz AC (2021) Effect of dexamethasone as osteogenic supplementation in in vitro osteogenic
differentiation of stem cells from human exfoliated deciduous teeth. J Mater Sci Mater Med 32:
1. doi:10.1007/s10856-020-06475-6.
Stevens LC, Little CC (1954) Spontaneous Testicular Teratomas in an Inbred Strain of

Mice. Proc. Natl. Acad. Sci. U.S.A. 40: 1080–1087.
152
Bibliography
Stevens MM (2008) Biomaterials for bone tissue engineering. Materials Today 11: 18–
25. doi:10.1016/S1369-7021(08)70086-5.
Świeczko-Żurek B (2009) Porous Materials Used as Inserted Bone Implants. Advances in

Materials Science 9: 51–60. doi:10.2478/v10077-009-0010-4.
Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, Yamanaka S (2007)

Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131:
861–872. doi:10.1016/j.cell.2007.11.019.
Takahashi K, Yamanaka S (2006) Induction of pluripotent stem cells from mouse

embryonic and adult fibroblast cultures by defined factors. Cell 126: 663–676.
doi:10.1016/j.cell.2006.07.024.
Tatullo M ed. (2017) MSCs and Innovative Biomaterials in Dentistry. Humana Press. Stem
Cell Biology and Regenerative Medicine. //www.springer.com/us/book/9783319556444.
Thesleff I, Aberg T (1999) Molecular regulation of tooth development. Bone 25: 123–
125. doi:10.1016/s8756-3282(99)00119-2.
Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall VS, Jones
JM (1998) Embryonic stem cell lines derived from human blastocysts. Science 282: 1145–1147.
Tian H, Bharadwaj S, Liu Y, Ma H, Ma PX, Atala A, Zhang Y (2010) Myogenic

Differentiation of Human Bone Marrow Mesenchymal Stem Cells on a 3D Nanofibrous Scaffold
for Bladder Tissue Engineering. Biomaterials 31: 870–877.
doi:10.1016/j.biomaterials.2009.10.001.
Tirino V, Paino F, d’Aquino R, Desiderio V, De Rosa A, Papaccio G (2011) Methods for the
identification, characterization and banking of human DPSCs: current strategies and
perspectives. Stem Cell Rev 7: 608–615. doi:10.1007/s12015-011-9235-9.
Tziafas D, Smith AJ, Lesot H (2000) Designing new treatment strategies in vital pulp
therapy. J Dent 28: 77–92. doi:10.1016/s0300-5712(99)00047-0.
Vats A, Bielby RC, Tolley NS, Nerem R, Polak JM (2005) Stem cells. Lancet 366: 592–602.
doi:10.1016/S0140-6736(05)66879-1.
Vega-Lopez GA, Cerrizuela S, Aybar MJ (2017) Trunk neural crest cells: formation,
migration and beyond. Int J Dev Biol 61: 5–15. doi:10.1387/ijdb.160408gv.
Vimalraj S, Arumugam B, Miranda PJ, Selvamurugan N (2015) Runx2: Structure, function,

and phosphorylation in osteoblast differentiation. Int J Biol Macromol 78: 202–208.
doi:10.1016/j.ijbiomac.2015.04.008.
Wagers AJ, Weissman IL (2004) Plasticity of adult stem cells. Cell 116: 639–648.
doi:10.1016/s0092-8674(04)00208-9.
Wang D-R, Wang Y-H, Pan J, Tian W-D (2020) Neurotrophic effects of dental pulp stem
cells in repair of peripheral nerve after crush injury. World J Stem Cells 12: 1196–1213.
doi:10.4252/wjsc.v12.i10.1196.
153
Wang H-S, Hung S-C, Peng S-T, Huang C-C, Wei H-M, Guo Y-J, Fu Y-S, Lai M-C, Chen C-C
(2004) Mesenchymal stem cells in the Wharton’s jelly of the human umbilical cord. Stem Cells
22: 1330–1337. doi:10.1634/stemcells.2004-0013.
Wang KC, Helms JA, Chang HY (2009) Regeneration, repair and remembering identity:
the three Rs of Hox gene expression. Trends Cell Biol 19: 268–275.
doi:10.1016/j.tcb.2009.03.007.
Wang L, Johnson JA, Zhang Q, Beahm EK (2013) Combining decellularized human

adipose tissue extracellular matrix and adipose-derived stem cells for adipose tissue
engineering. Acta Biomater 9: 8921–8931. doi:10.1016/j.actbio.2013.06.035.
Wehrhan F, Hyckel P, Amann K, Ries J, Stockmann P, Schlegel K, Neukam F, Nkenke E

(2011) Msx-1 is suppressed in bisphosphonate-exposed jaw bone analysis of bone turnover-
related cell signalling after bisphosphonate treatment. Oral Dis 17: 433–442.
doi:10.1111/j.1601-0825.2010.01778.x.
Whitman DH, Berry RL, Green DM (1997) Platelet gel: an autologous alternative to fibrin
glue with applications in oral and maxillofacial surgery. J Oral Maxillofac Surg 55: 1294–1299.
doi:10.1016/s0278-2391(97)90187-7.
Winning L, El Karim IA, Lundy FT (2019) A Comparative Analysis of the Osteogenic

Potential of Dental Mesenchymal Stem Cells. Stem Cells and Development 28: 1050–1058.
doi:10.1089/scd.2019.0023.
Wu J, Zhang W, Ran Q, Xiang Y, Zhong JF, Li SC, Li Z (2018) The Differentiation Balance of
Bone Marrow Mesenchymal Stem Cells Is Crucial to Hematopoiesis. Stem Cells Int 2018:
1540148. doi:10.1155/2018/1540148.
Xiao L, Tsutsui T (2013) Characterization of human dental pulp cells-derived spheroids

in serum-free medium: stem cells in the core. J Cell Biochem 114: 2624–2636.
doi:10.1002/jcb.24610.
Xu J, Li Z, Hou Y, Fang W (2015) Potential mechanisms underlying the Runx2 induced

osteogenesis of bone marrow mesenchymal stem cells. Am J Transl Res 7: 2527–2535.
Yadav P, Vats R, Bano A, Bhardwaj R (2020) Hematopoietic Stem Cells Culture, Expansion
and Differentiation: An Insight into Variable and Available Media. Int J Stem Cells 13: 326–334.
doi:10.15283/ijsc19157.
Yagi Mendoza H, Yokoyama T, Tanaka T, Ii H, Yaegaki K (2018) Regeneration of insulin-

producing islets from dental pulp stem cells using a 3D culture system. Regen Med 13: 673–687.
doi:10.2217/rme-2018-0074.
Yang J-Z, Qiu L-H, Xiong S-H, Dang J-L, Rong X-K, Hou M-M, Wang K, Yu Z, Yi C-G (2020)
Decellularized adipose matrix provides an inductive microenvironment for stem cells in tissue
regeneration. World J Stem Cells 12: 585–603. doi:10.4252/wjsc.v12.i7.585.
Yildirim S (2013) Dental Pulp Stem Cells. New York: Springer-Verlag. SpringerBriefs in
Stem Cells. doi:10.1007/978-1-4614-5687-2.
https://www.springer.com/gp/book/9781461456865.
154
Bibliography
Zanicotti DG, Duncan WJ, Seymour GJ, Coates DE (2018) Effect of Titanium Surfaces on
the Osteogenic Differentiation of Human Adipose-Derived Stem Cells. Int J Oral Maxillofac
Implants 33: e77–e87. doi:10.11607/jomi.5810.
Zhang H-T, Liu Z-L, Yao X-Q, Yang Z-J, Xu R-X (2012) Neural differentiation ability of
mesenchymal stromal cells from bone marrow and adipose tissue: a comparative study.
Cytotherapy 14: 1203–1214. doi:10.3109/14653249.2012.711470.
Zhang J, Ding H, Liu X, Sheng Y, Liu X, Jiang C (2019) Dental Follicle Stem Cells: Tissue
Engineering and Immunomodulation. Stem Cells Dev 28: 986–994. doi:10.1089/scd.2019.0012.
Zhang J, Lian M, Cao P, Bao G, Xu G, Sun Y, Wang L, Chen J, Wang Y, Feng G, Cui Z (2017)
Effects of Nerve Growth Factor and Basic Fibroblast Growth Factor Promote Human Dental Pulp
Stem Cells to Neural Differentiation. Neurochem Res 42: 1015–1025. doi:10.1007/s11064-016-
2134-3.
Zhang N, Chen B, Wang W, Chen C, Kang J, Deng SQ, Zhang B, Liu S, Han F (2016)
Isolation, characterization and multi-lineage differentiation of stem cells from human exfoliated
deciduous teeth. Mol Med Rep 14: 95–102. doi:10.3892/mmr.2016.5214.
Zhao X, Gong P, Lin Y, Wang J, Yang X, Cai X (2012) Characterization of α-smooth muscle
actin positive cells during multilineage differentiation of dental pulp stem cells. Cell Prolif 45:
259–265. doi:10.1111/j.1365-2184.2012.00818.x.
Zheng Y-H, Xiong W, Su K, Kuang S-J, Zhang Z-G (2013) Multilineage differentiation of
human bone marrow mesenchymal stem cells in vitro and in vivo. Exp Ther Med 5: 1576–1580.
doi:10.3892/etm.2013.1042.
155
ZELULEN BIOLOGIA ETA HISTOLOGIA SAILA
MEDIKUNTZA ETA ERIZAINTZA FAKULTATEA
EUSKAL HERRIKO UNIBERTSITATEA
HEZUR EHUN INJENIARITZAN

ERABILTZEKO GIZA HORTZ MUINEKO
ZELULA AMEN (gDPSCs)
OSTEODESBERDINTZAPEN
GAITASUNAREN AZTERKETA TITANIO,
GANTZ EHUN DEZELULARIZATU ETA
PLASMATIK ERATORRITAKO
PRODUKTUEKIN KONBINATUA
Leioa, 2021
Tesi zuzendariak:
Dr. Fernando Unda Rodriguez
Dr. Gaskon Ibarrete Bilbao
Edukien taula
Edukien taula
Laburpena …………………………………………………………………….………………………..…….…………… 1
Laburdurak ………………………………………………………………………………….………..…………………… 5
Sarrera ..…………………………………………………………………………………………………………………… 11
Ehun ingeniaritzari buruzko sarrera ….………………………………………..………………………. 13
Zelulak amak ………………………………………………………………………………………..…………….. 14
Zelula ama helduak ……..……………………………………………………………………….…………. 16
Zelula ama mesenkimalak ….……………………………………………………..….……..…….. 17
Hortz mamiko zelula amak (DPSC) …………………………………………………..…….. 18
Ezaugarri orokorrak ……………………………………………………………..……….…… 18
Azalera markatzaileak ….…………………………………………………..……………….. 20
DPSC-en desberdintzapena ……………………………………………………..………… 22
Hezur muineko zelula amak (BMSC) ….………………………………………..…………. 25
Ezaugarri orokorrak ..…………………………………………………………….………..…. 25
Azalera markatzaileak ….……………………………………………………………………. 26
BMSC-en desberdintzapena ..…………………………………….…………………….… 27
Hezur ehun ingeniaritzarako aldamioak (Scaffolds) ……………………………………………. 29
Titanioa ..……………………………………………………………………………………..……………….… 31
Dezelularizatutako ehun adiposoa ….……………………………………………..……………….. 34
HAzkuntza faktoreak ….…………………………………………………………………….………………… 35
Plasmatik eratorritako produktuak ….………………………………….…………………………. 36
Metodologia ..…………………………………………………………………………….……………………………. 39
Hipotesia ..…………………………………………………………………………………………….…………………. 51
Helburu nagusiak ..………………………………………………………………………………….……………….. 55
Emaitzak …..……………………………………………………………………………………………………………… 59
Eztabaida ……………………………………………………………………………………………..……………….…. 97
Ondorioak …………………………………………………………………………………………….……………….. 111
I Eranskina (patenteak) ..………………………………………………………………………..………………. 115
II Eranskina (artikuluak) ..……………………………………………………………………..………………... 119
Bibliografia ..……………………………………………………………………………………….…………………. 135
Laburpena
Laburpena
Hezur ehun ingeniaritza, arlo erlatiboki berri eta multi-disziplinarra da eta mindu
edo galdutako ehunen funtzioa mantendu, hobetu eta birsortzeko ingeniaritza eta bizi
zientzien aplikazioan oinarritzen da ordezko biologikoak garatzeko. Ehun ingeniaritzaren
oinarrizko hiru zutabeak aldamioak (scaffold), ama zelulak eta hazkuntza faktoreak dira.
Azken hamarkadetako teknologia aurrerapenekin eta material berri eta azaleren
aldaketekin, hezur ehun ingeniaritzan eta hortz inplantologian erabiltzeko scaffoldek
hobekuntza handiak jasan dituzte. Aldaketa hauen, MSC-en desberdintzapen
osteoblastiko indukzio ezaugarri onak erakutsi dituzte. Gainera, MSC-ek ugalketa handia
eta desberdintzapen gaitasun onak dituztela erakutsi dituzte hezur ehun ingeniaritzan
erabiliak izateko. Hala ere, zein MSC zelula mota den hezur birsorkuntza terapietarako
aukerarik onena oraindik ez dago garbi. Ama zelula autologoen erabileraren arazorik
handiena, zelulen in vitro hazkuntzetan ohikoak diren animali jatorriko serumen
erabilera da, behi suero fetala (BSF) bezala. Ama zelulak txertaturiko pazienteen
erantzun immunea ekiditeko, suero hauen ordezkapena beharrezkoa da.
Ikerketa honetan, giza hortz mamiko ama zelulen (gDPSC) itsaspen, ugalketa,
bideragarritasuna eta desberdintzapen osteoblastiko gaitasuna aztertu dira zabalki
erabilitako Ti6AL4V titanio eta berria den azalera porotsu biomimetikodun (BAS TM)
titanio gainean haztean, desberdintzapen osteoblastiko medioaren presentzian edo
gabezian, plasmatik eratorritako hazkuntza faktoreetan aberatsa den plasma (PRGF) eta
plaketetan aberatsa den fibrina-z (PRF) osaturik.
Emaitzek, gDPSC-en itsaspen ona eta kaltetu gabeko bideragarritasun eta

ugalketa zutela frogatu zuten Ti6AL4V eta BAS titanio gainean haztean. Hare gehiago, bi
titanio azalerek, gDPSC-engan desberdintzapen osteoblastiko indukzio efektua zutela
erakutsi zuten desberdintzapen mediorik erabili gabe. Bestalde, plasmatik eratorritako
bi produktuen emaitza interesgarriak erakutsi zizkiguten. Alde batetik, PRGF-ak zelulen
ugalketa tasa handitu zuten in vitro, BSF-aren ordezkari ona izan daitekeela erakutsiz
zelulen terapia autologoetarako. Beste aldetik, PRF-ak gDPSC-en desberdintzapen
osteoblastikoa handitu zuen kaltzifikaturiko hezur matrize produkzioa handituz.
Azkenik, BAS titanioa eta PRF-aren konbinazioak gDPSC-en hezur sortazile zeluletarako
desberdintzapen osteoblastikoa maximizatu zuen. Lan honetan lorturiko emaitzek, gaur
3
egun klinika praktikan hortz inplanteen inguruko hezur sorrera bultzatzeko ohikoak
diren fibrina koaguluen erabilera bermatzen du.
Behin titaniozko bi azaleren gDPSC-etan duten eragina aztertuta,

bideragarritasun, ugalketa eta desberdintzapen osteoblastiko gaitasunaren ikerketa
konparatiboa egin genuen hezur birsortze terapietarako interesgarrienak ziren bi ama
zelula mesenkimalen artean, gDPSC eta gBMSC-ak. Emaitzen, gDPSC-en ugalketa eta
hezur matrize mineralizazio handiagoa iraoki zuten gBMSC-ekin alderatuta. Nahiz eta
emaitza hauek berresteko datu gehiagoren beharra dagoen, isolatze errazago eta ez ain
inbaditzaile eta ugalketa zein desberdintzapen osteoblastiko gaitasunen
ezberdintasunengatik, gDPSC-ak gBMSC-ak baino aukera hobea izan daitezke hezur
birsortze terapietarako.
Azkenik, hortz inplantologiaren beste arazo bat, lotailu periodontalaren galera

da. Ehun honen funtzioa, hezur albeolarra murtxikatze indar mekanikoetatik babestea
da kuxin funtzioa betez. Gaur egun, periodonto birsortze terapiak hesi mintzen
erabileran datza, hortz inplantea jarri baina lehenago kalteturiko lekuan hezur sorrera
handituz. Helburu honetarako, txerri jatorriko dezelularizatutako ehun adiposoa (pDAT)
aztertu dugu. Gainera, pDAT-an hazitako gDPSC-ek desberdintzapen osteoblastikoa
erakutsi zuten, mintz-barneko osifikazio guneak eta Sharpey gisako itsaspen fibra
egiturak formatuz. Gizakian aurki daitekeen ehun adiposo iturri handia kontuan izanik
eta biak, pDAT eta gDPSC-ak, paziente berberetik lortuak izan daitezkenez, hauen
konbinazioa aukera aparta izan daiteke hezur birsortze eta hortz inplantologia terapia
kliniko pertsonalizatuetarako.
Hitz gakoak: hortz mamiko ama zelulak, DPSC, hezur muineko ama zelulak, BMSC, ehun
ingeniaritza, scaffold, zelula desberdintzapena, plasmatik eratorritako produktuak,
PRGF, PRF, titanioa, dezelularizatutako ehun adiposoa, birsortze medikuntza.
4
Laburdurak
Laburdurak
ALP= Fosfatasa alkalinoa

αMEM= α minimal essential medium
AMTP= Medikuntzako terapia produktu aurreratuak
APC= Alofikozianina
ARC= Adbentizioko zelula erretikularrak
ARS= Alizarin gorria
α-SMA= α-muskulo leuneko aktina
AT-MSC= Ehun adiposoko MSC-ak
BAS= Azalera biomimetiko aurreratuak
BDNF= Burmuin jatorriko faktore neurotrofikoak
BGLAP= osteokaltzina
BMPxxx= Hezur morfogenetiko proteina xxx
BMSC= Hezur muineko zelula amak
BSA= Behi serum albumina
CDxxx= Cluster differentiation
CFU-F= Colony forming unit fibroblasts
CMAP= The Connectivity Map
DAPI= 4´,6-diamino-2-phenilindol
DAT= dezelularizatutako ehun adiposoa
DFSC= Hortz folikuluko zelula amak
DME= β-merkaptoethanola
DMEM= Dubbelco´s modifikaturiko eagle´s medioa
DPSC= Hortz mamiko zelula amak
DSP= Dentina sialoproteina
DSPP= Dentina sialofosfoproteina
ECC= enbrioiko kartzinoma zelula
EDTA= Ethylenediamine tetraacetic acid
EGF= Hazkuntza faktore epiermikoa
EMD= Esmalteko matrize deribatua
7
ESC= Zelula ama enbrionarioa

FBS= Behi serum fetala
FGF= Fibriblastoen hazkuntza faktorea
FITC= isotiozianato fluoreszeina
GDNF: zelula glial jatorriko faktore neurotrofikoak
GOBP= Gene Ontology Biological Process
HA= Hidroxiapatita
gBMSC= Giza BMSC-ak
HBSS= Hank´s balanced salt solution
gDPSC= Giza DPSC-ak
HGF= Hepatozitoen hazkuntza faktoreak
HSC= Zelula ama hematopoietikoak
IBMX= 3-isobutil-1-metilxantina
ICM= Blastozisto barneko zelula masa
IL= Interleukinak
iPSC= Induziturik zelula ama pluripotenteak
ISTC= Terapia zelularraren sozietate internazionala
ITSx= Insulin-transferrin-selenium-x
sESC= Sagu ESC-ak
MNC= Muineko zelula mononuklearrak
MSC= Zelula ama mesenkimalak
NBT/BCIP= 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium
NeuN= Neuronen proteina nuklearra
NGF= Nerbioen hazkuntza faktorea
NSE= Neuronen enolase espezifikoa
OSTERIX/SP7= 7 transkripzio faktorea
PBS= Phosphate buffered saline
tDAT= Txerri DAT-a
PDGF= Plaketetatik eratorritako hazkuntza faktoreak
8
Laburdurak
PDL= Lotailu periodontala

PDLSC= Lotailu periodontaleko zelula amak
PE= Fikoeritrina
PFA= Paraformaldehidoa
PGA= Azido poli-glikolikoa
PLA= Azido poli-laktikoa
PRF= Plaketetan aberatsa den fibrina
PRGF= Hazkuntza faktoreetan aberatsa den plasma
PRP= Plaketetan aberatsa den plasma
RA= Azido erretinoikoa
RUNX2= Runt-related transcriptional factor 2
SCAP= Papila apikaleko zelula amak
SEM= Ekorkuntz mikroskopio elektronikoa
SHED= Hortz erorkorren zelula amak
SHxxx= Src homology xxx
SPARC= Osteonektina
SPB= Sorensen fosfato bufferra
SSEA-1= Stage specific embryo antigen 1
TEM= Transmisiozko mikroskopio elektronikoa
TCP= Trikaltzio fosfatoa
TGF-β= β hazkuntza faktore eraldatzailea
V-CAM 1= Vascular cell adhesion protein 1
VEGF= Endotelio baskulaturaren hazkuntza faktoreak
9
Sarrera
Sarrera
Ehun ingeniaritzari buruzko sarrera
Ehunen ingeniaritza terminoa 1988an sortu zen National Science Foundation

tailerrean "ingeniaritza eta bizitza zientzien printzipio eta metodoen aplikazioa
ugaztunen ehun normal eta patologikoen egitura-funtzioen erlazioak ulertu eta ehunen
funtzioa berreskuratu, mantendu eta hobetzeko ordezko biologikoen garapenean”
bezala. Ehun ingeniaritza diziplina anitzeko eta arlo erlatiboki berria da, zeinak
medikuntza kliniko, materialen zientzia, ingeniaritza mekaniko eta genetika bezalako
diziplinak interkonektatzen dituen (Berthiaume et al., 2011). Ehun ingeniaritzak, galdu
edo mindutako ehun funtzioen berreskurapena planteatzen du zelulen ereinketa,
hazkuntza faktoreak eta hiru dimentsiotako aldamioak erabiliz (Chaudhari et al., 2016),
hauek “ehun ingeniaritza hirukotea” bezala ezagutzen dira, zeinak bio-erreaktoreetan
konfiguratuak izan daitezke ingurumen kontrolatuan (Dlaska et al., 2015; O’Brien, 2011).
Ehun ingeniaritzaren helburu nagusia mindutako ehun edo organismoa

berreskuratu, mantendu edo hobetzea da. Hezur ehunaren kasuan, ehun honek
aurkezten dituen birmoldaketa naturala, birsorkuntza eta auto-konponketa abantaila
handiak dira. Material berrien ikerketaren helburu nagusienetako bat material
bateragarriak sortzea da, zeinak zelulei birsorkuntza seinaleak horni ditzaketen. Gainera,
ehun ingeniaritza arloa, ingurumen naturalaren antzeko ezaugarriak dituzten material
biomimetikoen aurkikuntzara bideratua dago, zelulen ugaltze, itsaspen eta
desberdintzapena hobetzeko asmoz (Dhandayuthapani et al., 2011).
Odol transfusioen ostean, ehun transplante mota ohikoena hezur

transplanteak dira, eta biztanleriaren zahartzea dela eta, mota onetako eskariak
handitzen hari dira (Kattimani et al., 2016). Hezur ehun ingeniaritzak osteoblastoekin
erlazionaturiko zelula amei begia bota die etorkizuneko terapietan erabiliak izateko
(Stevens, 2008).
Hezur ehun ingeniaritzaren irizpideak kontuan izanik, garezur-aurpegiko ehun

ingeniaritza pauso bat aurrerago doa hezur, listu guruin, lotailu periodontal, mukosako
zementu eta dentina bezalako aho eta hortz ehunen birsorkuntzarako biomaterialen
garapenean (Rahman et al., 2018).
13
Bereziki, periodontoaren birsorkuntza terapiek ongi informaturiko hezur/ehun

birsorkuntza teknika gidatu dute, “mintzez babesturiko hezur birsorpena” bezala
ezagutua. Teknika honen oinarria hesi-mintzen erabileran datza gandor albeolarreko
akatsetan, hortz inplanteen inguruan kalteturiko hezurraren hazkundea areagotuz.
Hezurra, inplante-hezur interfazea baino lehenago garatzen da, estabilitate mekanikoa
emanez (Pilipchuk et al., 2015).
Laburbilduz, ehun ingeniaritzaren hiru zutabeak zelula amak, aldamioak, eta

hazkuntza faktoreak dira (1. irudia).
Zelulak
Biomaterialak
Autologoak
Naturalak
Heterologoak
Sintetikoak
Desberdinduak
Hidrogelak Ehun Ama zelulak
Meshes
ingeniaritza
Seinaleak
Hazkuntza faktoreak
Molekula txikiak
Indar mekanikoak
1. Irudia. Ehun ingeniaritza hirukotea. Scaffoldetan ereindako zelula amak seinale biofisiko eta kimiko
aproposekin koordinatua ehunen birsortzea bultzatzeko konbinazioa.
1. Zelula amak
Zelula amek, zelula ama bezala deituak izateko, hiru ezaugarri nagusi bete
behar dituzte. Klonalitate, auto-berritze gaitasuna eta ehun eta organo ezberdinetako
zelula helduetara desberdintzeko abilezia (Potten and Loeffler, 1990).
Deskribatutako lehen zelula amak, teratokartzinomatik isolaturiko enbrioi

kartzinoma zelulak (ingelesez, embryonal carcinoma cells, ECCs) izan ziren 1950-ean
(Stevens and Little, 1954). Hamalau urte beranduago, zelula hauen bi ezaugarri nagusi
14
Sarrera
deskribatu zituzten, auto-berritze gaitasuna eta hiru hozi-geruzetako zeluletara

desberdintzeko abilezia in vitro. Zelula hauek zelula ama pluripotente bezala izendatuak
izan ziren (Kleinsmith and Pierce, 1964). In vivo modeloetan deskribatuak izan ziren
1970-ean (Kahan and Ephrussi, 1970). Urte batzuk beranduago, 1981-ean, blastozisto
barneko zelula masatik (ingelesez, inner cell mass of the blastocyst, ICM) isolatu zituzten
sagu enbrioi zelula amak (mESCs) eta giza ESC-ak 1998-an (Martin, 1980; Thomson et al.,
1998). Azken urteetan, zelula amen kontzeptu berri bat jaio zen, induzitutako zelula ama
pluripotenteak (iPSCs). 2006-an saguetan deskribatuak izan ziren lehen aldiz eta 2007-
an giza zeluletan (Takahashi et al., 2007; Takahashi and Yamanaka, 2006).
Garapen aldiaren arabera, zelula ama hauen desberdintzapen gaitasun

ezberdina erakuts ditzakete. Honen arabera, bost taldeetan sailkatuak izan daitezke:
Totipotenteak: Mota honetako zelula amek gizabanako osoa sortzeko gaitasuna dute.
Enbrioi oso zein denboraldiko sostengu ehunak (plazenta eta zilbor-hestea) sortzeko
gaitasuna dute. Abilezia hau aldi blastomeriko arte mantentzen da (Posfai et al., 2021).
Pluripotenteak: blastozistoa sortu ostean, IMC-a osatzen duten zelula ama

pluripotenteak hiru hozi-geruzetara desberdintzeko gaitasuna dute. Zelula ama hauek
ehun eta organo heldu guztiak sor ditzakete bainan ez denboraldiko sostengu ehunak
(Smith, 2001).
Multipotenteak: Zelula ama hauen desberdintzapen gaitasuna beraien ehun edo

organoko jatorriari mugatua dago. Hauen funtzio nagusiak, ehun helduen konponketa
eta mantentze-lanak dira (Slack, 2000).
Oligopotenteak: zelula ama hauek desberdintzapen abilezia oso mugatua dute zelula
mota oso gutxietara desberdindu ahal izanik, adibidez, zelula mieloide eta linfoideak
(Majo et al., 2008).
Unipotenteak: zelula ama hauek zelula mota bakarra sortuko dute, gihar zelula amak
adibidez. Zelula ama gisa ezagutzen zaie auto-berritze gaitasuna dela eta (Seale et al.,
2001).
15
1.1. Zelula ama helduak
Blastozistoa garatzen denean ICM-ko ESC-ak hiru hozi-geruzak sortzen dituzte:

endodermoa, mesodermoa eta ektodermoa. Ehun eta organoen garapenaren ostean,
zelula ama batzuk desberdintzapen terminalik gabe mantentzen dira hezur muin, odol,
gibel, azal, burmuin, hortz edo giharretan bezala (Denham et al., 2005; Vats et al., 2005).
Zelula ama hauen desberdintzapen plastizitate abilezia asko alda daiteke, zelula mota
ezberdin askoetara desberdintzeko gaitasunetik hasita (multipotentea) zelula mota
bakarrera desberdintzerarte (Unipotentea) (Almeida-Porada et al., 2001; Wagers and
Weissman, 2004). Gainera, zelula hauen ugaltzeko gaitasuna asko alda daiteke ehunetik
ehunera. Ugaltze handieneko zelulak zelula berritze altuko ehunetan aurki daitezke,
hezur muin, azal edo hestean bezala (Baulies et al., 2020; Lenkiewicz, 2019; Yadav et al.,
2020). Bestalde, beste zelula ama batzuk kalteturiko zelulen edo zauri baten
erantzunean bakarrik ugalduko dira, gibel, bihotz edo nerbio sisteman bezala. (Angelini
et al., 2004; Duncan et al., 2009; Mansergh et al., 2000) (2. irudia).
2. Irudia. Zelula amen lokalizazioa gizaki helduan. (Hodgkinson et al., 2009)
16
Sarrera
1.1.1. Zelula ama mesenkimalak (MSCs)
1990-ko hamarkadan zabaldu zen “zelula ama mesenkimal” kontzeptua Caplan-

en erabilerari esker baina zientzia komunitateak ez zuen onartu 2000. urterarte (Caplan,
1991; Horwitz and Keating, 2000). Zelula ama mesenkimal bezala izendatzen dira ehun
mesenkimal ezberdinetako zeluletara desberdintzeko gaitasuna duten zelula ama ez
hetatopoietikoak. Zelula hauek gihar, kartilago, hezur, lotailu, gantz-ehun eta
baskulatura ondoko guneak bezalako ehun edo organo ezberdinetatik isolatuak izan
daitezke (Chamberlain et al., 2007; Crisan et al., 2008). Baita zilbor-heste, odol
menstrual, plazenta, heste-lodi eta hortz egituretatik ere (Du et al., 2016; Ma et al.,
2014; Portmann-Lanz et al., 2006; Tirino et al., 2011).
Zelula ama mesenkimalek zenbait baldintza bete behar dituzte horrela

kontsidera daitezen. Terapia Zelularrentzako Elkarte Internazionala-k (TZEI) 2005-ean
ezarri zituzten baldintza hauek: in vitro hakundeetan plastikoan istaskorrak izan behar
dira eta kondrozito, adipozito eta osteozitoetara desberdintzeko gaitasuna eduki behar
dute. Gainera, zelula hematopoietikoentzako zehatzak diren azalera markatzaileetarako
(CD14, CD34 eta CD45) negatiboak izan behar dira, eta positiboak CD13, CD44, CD73,
CD90 eta CD105-entzako (Dominici et al., 2006).
Gorputz helduan MSC populazio ezberdinak deskribatuak izan dira. Hezur muineko
zelula ama mesenkimalak (ingelesez, bone marrow stem cells, BMSCs) izan ziren lehenik
deskribaturiko MSC-ak (Anjos-Afonso and Bonnet, 2007; Friedenstein et al., 1976).
Hauei jarraituz, zilbor hesteko zelula ama mesenkimalak (ingelesez, umbilical cord
mesenchymal stem cells) 1991-n aurkituak eta 2004 urtean baieztatuak MSC bezala
(McElreavey et al., 1991; Wang et al., 2014), hortz mamiko zelula ama mesenkimalak
(ingelesez, dental pulp stem cells, DPSCs) (Gronthos et al., 2000), zelula ama mesenkimal
kardiakoak (Beltrami et al., 2003), biriketako zelula ama mesenkimalak (Griffiths et al.,
2005), odol periferiko-ko zelula ama mesenkimalak (Cao et al., 2005) edo gantz-ehuneko
zelula ama mesenkimalak (ingelesez, Adipose tissue mesenchymal stem cells, AT-MSCs)
(Fraser et al., 2006) deskribatu ziren. Naiz eta lehen deskribaturiko zelula moten jatorria
hozi-geruza mesenkimala izan, aho barrunbeko zelula ama askoren jatorria gandor
neuralean kokatzen da, DPSC-en kasuan bezala. Zelula hauek ama zelula mesenkimal
17
moduan sailkatuak izan diren arren, hozi-geruza ektodermal jatorriak neurona-antzeko

zeluletara desberdintzeko gaitasun handiagoa ematen diote MSC-ekin alderatuz, hori
dela eta zelula ama ektomesenkimal bezala deituak izan daitezke (Ibarretxe et al.,
2012a).
1.1.1.1. Hortz mamiko zelula amak (DPSCs)

a. Ezaugarri orokorrak
Lehen esan bezala, DPSC-ak gandor neuraleko jatorria dute. Enbriogenesian

zehar, gandor neuraleko zelula ectodermikoak aho barrunbera migratzen dira garezur-
aurpegiko egitura ezberdinak sortzeko. Egitura hauen adibide dira hortz mamia,
mingaina, garezur-aurpegiko nerbioak, lotailu periodontala, hezurrak eta giharrak
(Ibarretxe et al., 2012a; Shyamala et al., 2015; Vega-Lopez et al., 2017). Ezaugarri honi
esker, DPSC-ek leinu mesenkimaleko zelulez gain leinu neuraleko zeluletara
desberdintzeko gaitasuna dute (Ibarretxe et al., 2012a).
esmaltea
koroia dentina
pulpa
hortzoia
zementua
sustraia odol
hodiak
lotailu
periodontala
Alboko
kanalak
nerbioa
3. irudia. Hortzaren egitura orokorrak. (Yildirim, 2013)-etik moldatua.
18
Sarrera
DPSC-ak 2000. urtean deskribatu ziren lehen aldiz hortz mamiko zelula ama
mesenkimal moduan, BMSC-en antzera (Gronthos et al., 2000). Bi urte pasa ziren hortz
mamiko zelula ama gisa deituak izan ziren arte, ezaugarritzat klonogenizitate eta
ugalketa maila altuko zelulak izanik (Gronthos et al., 2002). Zelula hauek “mami
ganbera”-n kokaturik daude, hortz koroiaren barnean (3. irudia). Hortz mamia
konposizio heterogeneoko ehun konektiboa da eta odonto/osteoprogenitore zelula,
zelula neural, baskulatura zelula, fibroblasto eta granulozito eta makrofagoak bezalako
zelula inmuneak bezalako zelula mota ezberdinez osaturik dago (Goldberg and Smith,
2004). Onez gain, garrantzitsua da ikerketa batzuk DPSC-ak perizito baskularraren
konpartimentuan kokatu dituztela esatea (Shi and Gronthos, 2003).
Hortz mami moduko ehun biguinez gain, hortz helduak zementu, dentina eta
esmaltea bezalako ehun gogorrez osaturik daude. Hortzen sorreraren hasiera MSC-en
eta aho zelula ektodermal epitelialen arteko elkarrekintzekin hasten da. Dentina da
sortzen lehena eta honi jarraituz, esmaltea eta hortz folikulua. Zelula epitelialetatik
eratorritako ameloblastoek sortzen dute esmaltea. Beste alde batetik, MSC-ak dira
dentina, zementu, lotailu periodontal eta hortz mamiaren sortzaile (Sedgley and Botero,
2012; Thesleff and Aberg, 1999).
Gorputz helduan, hortz mamiaren funtzio nagusia dentinaren konponketa eta

mantentze-lana da. Txantxarra moduko kalte larrietan DPSC-ak kalteturiko
ingurumenera migratzen dute eta odontoblastoetara desberdindu ostean dentina
konpontzailea sortzen dute (Dimitrova-Nakov et al., 2014; Tziafas et al., 2000) (4. irudia).
Nahiz eta DPSC-ak izan ikerketan ondoen ezaguturiko eta normalki erabilitako
hortz zelula amak, ezaugarri ezberdinetako zelula ama populazio ezberdinak aurki
ditzakegu. Hortz folikuluko zelula amak (ingelesez, dental follicle stem cells, DFSCs) hortz
garapenean ehun enbrioniko ektomesenkimaletik isolatu daitezke non hortz-hozia
inguratzen hari diren (Zhang et al., 2019). Zelula periodontaletaz gain, beste zelula leinu
batzuetara desberdinduak izan daitezke in vitro (Honda et al., 2010). Hauez gain, papilla
puntako zelula amak (ingelesez, stem cells from apical papilla, SCAP), garapenean
dauden hortzen sustrai erpinetan kokatzen diren hazkuntza ratio handiko zelulak dira
(Bakopoulou et al., 2011). Talde honetako beste zelula amen antzera, beraien jatorri
19
ektomesenkimala dela eta, zelula angiogeniko eta neuraletara desberdintzeko

ahalmena dute (Dagnino et al., 2020; Nada and El Backly, 2018). Honez gain, lotailu
periodontaleko zelula amek (ingelesez, periodontal ligament stem cells, PDLSCs) DPSC-
en antzerako pluripotentzia markatzaile eta desberdintzapen gaitasuna dute (Liu et al.,
2018; Seo et al., 2004). Azkenik, hasieran esfoliaturiko hortz erorkorretako zelula amek
ere (ingelesez, primary exfoliated deciduous teeth stem cells, SHED) markatzaile
pluripotentzial zein neuralak eta ugaltze ratio handia erakusten dute (Kerkis et al., 2006;
Miura et al., 2003). Beste hortz ama zelulek gisa, SHED-ek zelula mesenkimal eta zelula
neuraletara desberdintzeko abilezia erakutsi dute (Karbalaie et al., 2021; Sordi et al.,
2021; Zhang et al., 2016) (4. irudia).
4. irudia. Hortzekin erlazionaturiko zelula amen historiaren denbora-lerroa. (Karamzadeh and

Eslaminejad, 2013).
b. DPSC-en azalera markatzaileak
DPSC-ek markatzaileen arteko ezberdintasuna erakutsi dute hortz mamiko zelula

amen subpopulazioen eraginez (Alraies et al., 2020; Kawashima, 2012; Simonović et al.,
2019).
Zelula hauen jatorri ektomesenkimala dela eta, garrantzitsua da markatzaile

mesenkimal (Vimentina, I. Kolagenoa), neural (Nestina, GFAP) eta pluripotentzialen
(OCT4, Nanog, Sox2) adierazpena aipatzea (Bae et al., 2021; Ibarretxe et al., 2012a;
Wang et al., 2020).
20
Sarrera
Hare gehiago, DPSC subpopulazio barietateari esker, azalera markatzaileen

adierazpena ez dago oso ongi ezarria. Orokorki, zelula hauek MSC-en mota gisa
ezagutzen dira CD73 (5´-eknonukleatidasa), CD90 (glikosilfosfatidilinositolari loturiko
glikoproteina) eta CD105 (endoglina) azalera markatzaileen adierazpen
positiboarengatik. Gainera, DPSC-ek adierazpen positiboa dute CD27, CD29, CD44,
CD146, CD166, CD271, V-CAM-1, SSEA4 eta STRO-1 azalera markatzaileentzat. Bestalde,
adierazpen negatiboa dute CD14 (monozito eta makrofago markatzailea), CD19 (B zelula
markatzailea) eta CD34 zein CD45 markatzaile hematopoietikoentzako (Gang et al.,
2007; Gronthos et al., 2003). Nahiz eta honako hau izan DPSC-en azalera markatzaileen
adierazpen ohikoena, CD34 markatzailearentzako positiboa diren zelulak ere ikertuak
izan dira (Carnevale et al., 2018) (1. tabla).
DPSCs SHED PDLSCs DFPCs SCAPS GSCs BMSCs

CD (+) STRO-1 STRO-1 STRO-1 STRO-1 STRO-1 STRO-1 STRO-1
CD44 CD44 CD44 CD44 CD44 CD44
CD105 CD105 CD105 CD105 CD105 CD105 CD105
CD146 CD146 CD146 CD146 CD146
CD166 CD166 CD166 CD166
CD (-) CD14 CD14 CD14
CD19
CD34* CD34 CD34 CD34 CD34 CD34 CD34
1. taula. Hortzekin erlazionaturiko zelula amen eta hezur muineko zelula amen azalera markatzaile
profila. DPSC: Hortz mamiko zelula amak, SHED: Hortz erorkorretatik lorturiko zelula amak, PDLSC: lotailu
periodontalaren zelula amak, DFPC: hortz folikuluaren zelula aitzindariak, SCAP: hortz papila apikaleko
zelula amak, GSC: hortzoi-ko zelula amak eta BMSC: hezur muineko zelula amak. CD34*: DPSC-en zenbait
azpi-populaziok CD34 adierazi zuten (Carnevale et al., 2018) (autoreak egina).
21
c. DPSC-en desberdintzapena
Lehen aipatu bezala, DPSC-ek jatorri ektomesenkimala dute. Ezaugarri hau dela
eta, osteo/odontoblasto, adipozito, kondrozito eta muskulu zeluletara desberdintzeko
gaitasuna dute (Gronthos et al., 2002; Kawashima, 2012). Honez gain, gandor neural
jatorriari esker, MSC zelulek baina neurona-antzerako zeluletara desberdintzeko
ahalmena handiagoa dute (Luzuriaga et al., 2021). Gainera, ikerketa batzuk
endodermoko zeluletara desberdintzeko abilezia dutela iradoki dute, DPSC-ek
pluripotentzi-antzeko ezaugarria dutela esanez (Atari et al., 2011). Zoritxarrez, naiz eta
endodermo-antzeko zelulak lortu, DPSC-en pluripotentzi gaitasuna ez da eztabaidaezin-
ki frogatua izan.
Desberdintzapen osteogenikoa, DPSC-en desberdintzapena ezagunena da. Nahiz

eta ikerkuntza ezberdinetan osteo-desberdintzapen indukzio koktelak aldaketak jasan
ditzakeen, dexametasona, β-glizerol fosfatoa eta L-azido askorbikoa denbora guztian
errepikatzen diren osagaik garrantzitsuenak dira. Molekula hauek ezinbestekoak dira I
motako kolagenoa, fosfatasa alkalinoa, Run-erlazionaturiko 2 faktorea (RUNX2), osterix,
osteopontina, osteokaltzina eta osteonektinaren adierazpena aktibatzeko. Gene hauen
adierazpenak nahitaezkoak dira DPSC-en osteo-desberdintzapenean (Ajlan et al., 2015;
Atari et al., 2012a; Bhuptani and Patravale, 2016; Goto et al., 2016; Riccio et al., 2010).
Gene hauen artean, RUNX2 da adierazten lehena. Osteo-desberdintzapenaren
hasierako etapan RUNX2-aren adierazpenak dentina sialoproteina (DSP) eta dentina
sialofosfoproteinaren (DSPP) espresioa eragiten du (Han et al., 2014; Vimalraj et al.,
2015; Xu et al., 2015).
Desberdintzapen kondrozitikoaren kasuan, gehien erabilitako hazkuntza

medioaren osagarri nagusiak L-prolina, L-azido askorbikoa, dexametasona, intsulina-
transferrina-selenio (ITSx), sodio pirubatoa eta TGF-β3-a dira (Hilkens et al., 2013; Jang
et al., 2016; Nemeth et al., 2014). Kondrozitoetarako desberdintzapen prozesuan
proteina superfamilia garrantzitsuena TGF-β da, zeinak kartilago desberdintzapen/des-
desberdintzapen prozesua kontrolatzen duten (Dexheimer et al., 2016). DPSC-ek beste
MSC batzuk baino desberdintzapen kondrozitikorako gaitasun txikiagoa dute; hau,
22
Sarrera
DPSC-en populazio heterogeneo eta in vitro hazkuntzen oxigeno maila handiengatik da

(Pisciotta et al., 2020).
Desberdintzapen adipozitikoan, dexametasonaz gain hazkuntza medioa intsulina

eta 3-isobutil-1-metilxantinaz (IBMX) osatua egoten da. Adipozito desberdintzapena
berresteko gantz azido lotzaileen 4. proteina, 4. motako glukosa garraiatzailea,
lipoproteina lipasa markatzaile adipogenikoa eta peroxisoma ugaritzaileak aktibatutako
ϒ hartzaileen adierazpenak beharrezkoak dira. DPSC-ek beste MSC batzuk baina
desberdintzapen adiposo abilezia txikiagoa dute (Grottkau et al., 2010; Lee et al., 2015a;
Zhang et al., 2016).
Bestalde, DPSC-ak zelula endotelial (Luzuriaga et al., 2019a; Luzuriaga et al.,

2020; Marchionni et al., 2009), kardiomiozito (Ferro et al., 2012) eta muskulu leuna
(Song et al., 2016; Zhao et al., 2012) bezalako zelula motetara ere desberdindu daitezke.
Gainera, duela gutxiko ikerketek, zelula endotelial desberdintzapena lortu dute serum-
ik gabeko medioak erabiliz, aurrera pausu handia terapia zelular autologoen
erabilerarako (Luzuriaga et al., 2019a; Luzuriaga et al., 2020).
Leinu mesenkimaleko zelulez gain, DPSC-en desberdintzapenaren ezaugarri

interesgarriena gandor neural jatorrian datza. Jatorri honi esker, DPSC-ak neurona-
antzeko zeluletara desberdintzeko ahalmena dute. Azkeen urteetan erabiliak izan diren
neurona desberdintzapen medioak neurotrofina eta beste molekula txiki batzuez (NGF,
GDNF, BDNF, EGF, FGF, sonic hedgehog, forskolina, heparina, NT-3 eta azido retinoikoa
(RA)) osaturik daude. Baita ere garrantzitsua da ITSx, N2, B27 eta aminoazido ez-
ezinbestekoen erabilera (Arthur et al., 2008; Chang et al., 2014; Gervois et al., 2015;
Kanafi et al., 2014; Király et al., 2011; Luzuriaga et al., 2019b; Osathanon et al., 2014;
Xiao and Tsutsui, 2013; Zhang et al., 2017) (5. irudia).
23
DPSC-en desberdintzapen gaitasuna
Adipogenikoa Miogenikoa
Kondrogenikoa Neurogenikoa
Osteo/dentinogenikoa
5. irudia. DPSC-en desberdintzapen gaitasuna. (Aurrekoetxea et al., 2015).
DPSC-ek endodermo leinuko zelulak sortzeko ahalmena erakutsi dute (Atari et

al., 2012b). Leinu endodermikoko zelula pankreatikoetara desberdintzeko gaitasuna
erakutsi zuten glukagoia, somatostatina, intsulina eta polipeptido pankreatikoa
ekoizteko abilezia zuten zelulak lortuz. Desberdintzapen hau oberen lortu zutenak
CD117+ ziren zelulen subpopulazioa zen. Desberdintzapen prozesu onetan WNT eta
PI3K/AKT seinaleztapen bideak funtsezko rola zuela erakutsi zuen (Ishkitiev et al., 2013;
Yagi Mendoza et al., 2018). Onez gain, dexametasona, ITSx, HGF eta onkostatina M-z
osaturiko serum gabe edo serum bajuko (1 %-2 %) medioak erabiliz hepatozito-
antzerako zeluletara desberdintzea lortu zuten (Chen et al., 2016; Han et al., 2017;
Ishkitiev et al., 2012).
24
Sarrera
1.1.1.2. Hezur muineko zelula amak (BMSCs)

a. Ezaugarri nagusiak
Friedenstein eta bere lankideek aurkitu zituzten hezur muineko zelula ama
mesenkimalak 1970-ean, plastikoan itsasten ziren hezur muinetik eratorritako zelulen
isolamendu metodoari esker (Friedenstein et al., 1970). Zelula hauek plastikoa hasten
direnean, ugaritze ratio handiko kolonia konpaktu gisa fibroblasto itxurarekin. Hauek
kolonia osatzaile unitate fibroblastoak gisa izendatu ziren (ingelesez, colony forming unit
fibroblast, CFU-F) (Castro-Malaspina et al., 1980; Gothard et al., 2013).
CFU-F-ak, hezur muineko zelula mono-nuklearren (ingelesez, bone marrow

mononuclear cells, MNCs) maiztasun baxua erakutsi zuten, 1/10.000 eta 1/100.000
artean zirelarik (Castro-Malaspina et al., 1980). BMSC-en maiztasuna, hezur muinean
dauden zelula ama hematopoietikoena (ingelesez, hematopoietic stem cells, HSCs)
baino askoz baxuagoa da, hezur muineko MNC-en 1 % izanik (Civin et al., 1996).
Gainera, ziklo zelularraren ikerketek erakutsi dutenez, BMSC-en frakzio txiki

batek besterik ez dute ziklo zelularra aktibaturik (10 % at S + G2 + M) eta beste guztiak
G0/G1 fasean egonik (Conget and Minguell, 1999). Pazienteen aldakortasunaren
arabera, BMSC-en potentzial hedagarria laugarren pasetik hamabost pase igarotzeraino
irits daitezke (Digirolamo et al., 1999; Phinney et al., 1999). Naiz eta ziklo zelularra
aktibaturiko zelulen frakzioa txikia izan, ugaltze ratio handia dute ex vivo. Ugalketa
gaitasun honek aldaketak jasan ditzake zelulak lortzeko metodoen, BMSC-en
frekuentziaren eta emailearen adinaren arabera (Blazsek et al., 1999; Koç et al., 1999).
Duela gutxiko ikerketek BMSC-en in vitro hazkuntzak hobetu dituzte bio-erreaktoreak
erabiliz (Bhat et al., 2021; Santos et al., 2011). Naiz eta zelula somatikoek hazkuntza eta
desberdintzapen prozesuetan telomerasa aktibitatea galtzen duten zelulen heriotza
eraginez seneszentzi bidez, BMSC-ek telomerasaren aktibitatea mantentzen dute
(Pittenger et al., 1999). Hala ere, hazkuntza pase askoren ostean, apoptosis eta
seneszentzi seinaleak adierazten dituzte (Dhanasekaran et al., 2013).
BMSC-en funtzio nagusiak estroma mikro-ingurumenaren formakuntza eta

mantentze-lana dela iradoki da. Erregulazio seinale induktibo bidezko mikro-
ingurumenaren modulazioa ez da beste BMSC-entzako bakarrik, baizik eta beste
25
estromako zelula ez-mesenkimatiko eta zelula hematopoietiko aitzindarientzat ere bai

(Cheng et al., 2000). Teoria hau BMSC-ek ekoizturiko kolageno, laminina, fibronektina
eta proteoglikanoak bezalako matriz molekula ezberdinengatik indartuta dago
(Chichester et al., 1993; Connelly et al., 2008; Pittenger et al., 1999). Zelula-zelula
elkarreragin itsaskorra eta matrizeari elkarturiko kontra-errezeptore molekulak ere
adierazten dituzte.
Ikerketa batzuk, DPSC-ak bezala, BMSC-ak baskulaturaren inguruko guneetan

kokatzen direla iradoki dute, odol hodien kanpoko gainazala estalduz (Shi and Gronthos,
2003; Short et al., 2003; da Silva Meirelles et al., 2006). Aldiz, beste ikerketa batzuk
BMSC-ak hezur muin estromako zelula laguntzaileen (ingelesez, adventitial reticular
cells, ARCs) berdinak direla esan dute. Emaitza gisa, BMSC-ak estromako zelula
mesenkimal multipotente edo hezur muin estromako zelula ama bezala ere ezagutzen
dira (Gronthos et al., 2003; Horwitz et al., 2005).
b. BMSC-en azalera markatzaileak
BMSC-en ezaugarrietako bat CD14 (monozito eta makrofago markatzaileak),

CD31 (PCAM) eta CD34 zein CD45 markatzaile hematopoietikoen adierazpen negatiboa
da (Conget and Minguell, 1999; Jones et al., 2002; Pittenger et al., 1999). Bestalde, zelula
hauek adierazpen positiboa dute gihar leuneko α-aktina (α-sma), STRO-1, SH2, SH3 eta
SH4-entzako (Haynesworth et al., 1992; Simmons and Torok-Storb, 1991). Hauez gain,
CD54 (ICAM-1), CD102 (ICAM-2) eta CD166 (ALCAM-1) itsaspen molekulentzako ere
adierazpen positiboa dute (Chichester et al., 1993; Conget and Minguell, 1999; Prockop,
1997). Baita ere CD13 (ANPEP), CD29 (β1 integrina), CD73 (NTSE), CD90 (THY1) CD105
(endoglina) eta SSEA-4-entzako (enbrioien etapa-espezifiko antigenoa) (Boiret et al.,
2005; Delorme and Charbord, 2007; Gang et al., 2007; Jones et al., 2006). Azkenik,
garrantzitsua da aipatzea CD271-ren (afinitate-baxuko nerbio hazkuntza faktore
errezeptorea) adierazpena, hezur muineko subpopulazioen markatzaile bezala.
Subpopulazioen arteko markatzaile honen adierazpen ezberdintasuna BMSC-en
adierazpen maila altu eta hezur muineko beste zelula pupolazioen adierazpen baxuan
datza (Bühring et al., 2007; Cuthbert et al., 2015).
26
Sarrera
c. BMSC-en desberdintzapena
Hezur muineko MSC-ak leinu-anitzeko desberdintzapen gaitasuneko zelula ez-

hematopoietikoak dira. Ikerketa askok erakutsi dute kartilago, gihar kardiako, gihar
eskeletiko, hezur eta ehun adipotsua bezalako zelula mesenkimatikoetara
desberdintzeko zelula hauek duten gaitasuna (Arthur et al., 2009; Bianco et al., 2001;
Conget and Minguell, 1999; Matsuda et al., 2005; Prockop, 1997; Zheng et al., 2013).
Beraien jatorriko hozi-geruza mesenkima izanik ere, neurona-antzeko zelula
neuroektodermikoetara ere desberdindu daitezke (Krampera et al., 2007; Sanchez-
Ramos et al., 2000; Zhang et al., 2012). Hala ere, neurona-antzeko zelula hauetara
desberdintzeko gaitasuna, DPSC-ena baina txikiagoa da (Isobe et al., 2016; Pagella et al.,
2020).
BMSC-en desberdintzapen osteogenikoa dexametasona, L-azido askorbikoa eta

β-glizerol fosfatoaz (edo beste fosfato iturri izan daitekeen molekularen bat) osaturiko
medioetan oinarritzen da, DPSC-en antzera. Zelula hauetan ere molekula hauek RUNX2
genearen adierazpena areagotzen dute, osteo-desberdintzapen prozesuaren hasiera
izanik (Langenbach and Handschel, 2013).
Beste alde batetik, desberdintzapen adipogenikorako dexametasonaz gain,

indometazina eta IBMX-ez osaturiko medioak erabiltzen dira (Zheng et al., 2013).
Desberdintzapen kondrozitikorako aldiz, beharrezko molekulak dexametasona,

sodio pirubatoa, L-azido askorbikoa, prolina, ITS eta TGF-β1 dira (Solchaga et al., 2011).
Bi desberdintzapen hauentzako, adipogenikoa eta kondrogenikoa, BMSC-ek DPSC-ek
baina desberdintzapen gaitasun handiagoa erakutsi dute (Isobe et al., 2016).
Hauez gain, BMSC-ak ere zelula kardiako, gihar eskeletiko, lotailu eta estroma
hematopoietiko-laguntzailea bezalako zelula mesenkimaletara ere desberdin daitezke
(Guo et al., 2018; Matsuda et al., 2005; Tian et al., 2010; Wu et al., 2018) (6. irudia).
BMSC-en jatorria mesenkimala denetik, orain arte aipaturiko desberdintzapenak

“natural” kontsidera daitezke. Hala ere, zelula hauek jatorri ektodermikoko neurona-
antzeko (neurona markatzaileren bat adierazten dute zelulak) zeluletara desberdindu
27
daitezke. Desberdintzapen honetarako gehien erabilitako bi hazkuntza koktel daude.

Alde batetik oinarrizko fibroblasto hazkuntza faktorea (ingelesez, basic Fibroblast
Growth Factor, bFGF) erabiltzen duen medioa dago. Zelula zein ehun mota ezberdinetan
lau FGF errezeptore aurki ditzakegu adierazpen maila ezberdinekin (Eswarakumar et al.,
2005). Errezeptore honek Src, Crk, fosfolipasa C-ϒ (PLC-ϒ) eta SNT-1/FRS2 bezalako
seinale bideak aktibatzen ditu, hauetako batzuk desberdintzapen neuralean inplikatuak
egonik (Powers et al., 2000; Reuss and von Bohlen und Halbach, 2003). Ikerketa batzuk
ondorioztatu dutenez, SNT-1/FRS2 seinale bideak MAPK/ERK kaskada aktibatzen du,
nahitaezkoa faktore neurotrofikoen jariapenerako (Abe and Saito, 2000). Beste aldetik,
β-merkaptoetanolez (BME) osaturiko medioa dago zeinak 7 eguneko hazkuntzaren
ostean neuronentzako espezifikoa den enolasa (NSE), NeuN eta M-neurofilamentuaren
adierazpena bultzatzen duen (Khanabdali et al., 2016; Khang et al., 2012; Scintu et al.,
2006).
6. irudia. Hezur muineko zelula amen desberdintzapen gaitasuna. (Muruganandan et al., 2009).
28
Sarrera
2. Hezur ehun ingeniaritzarako aldamioak (Scaffold)
Scaffold hitza, ehun eta organoen erregeneraziorako ingurumen egokia ematen

duten hiru dimentsiotako (3D) bio-materialei dagokio. Material berrien sorreren
helburua, ingurumen naturalaren antzeko propietateak eta ezaugarri multi-funtzionalak
dituzten scaffold berrien garapena da (Dhandayuthapani et al., 2011) (7. irudia).
Hezur ehun ingeniaritzan, scaffoldek hiru ezaugarri bete behar dituzte hezur
injerto bezala erabiliak izateko: osteo-konduktibitatea, osteo-induktibitatea eta osteo-
integrazioa (Albrektsson and Johansson, 2001). Injertoan hezurra hazi baldin badaiteke
osteo-konduktibitate deitzen zaio, inplantearen azalera eta hezurraren arteko kontaktu
zuzenari berriz osteo-integrazioa. Ezaugarri hauek ezberdinak izan daitezke
materialaren arabera, inplante lekuaren arabera, etab. (Khan et al., 2005). Azkenik,
osteo-induktibitate gisa ezagutzen da hezur sorrera eragin dezaketen zeluletan
desberdintzeko ama zelula multipotenteei bultzatzeko gaitasunari (Roberts and
Rosenbaum, 2012).
Historikoki, bio-materialen lehen belaunaldiaren ezaugarri nagusia bio-

konpatibilitatea zen. Material hauen helburua ordezkatu behar zuten ehunaren antzeko
ezaugarri fisikoak edukitzea zen. Zeramikak (zirkonioa eta alumina), metalak (titanioa,
burdin herdoilgaitza eta aleazioak) eta polimeroak (kautxua, silikona, polipropilenoa eta
polimetilmetakrilatoa) osatzen zuten hezur ehun ingeniaritzan erabiltzeko bio-
materialen lehen belaunaldi hau. Hauetako scaffold batzuk erantzun immune ez-
espezifikoak eragiten zituzten, azkenean ehun konektibo fibrotikoz inguratua izan arte.
Honela, inguruko ehunetatik isolatuta geratzen ziren (Anderson, 2001).
Erantzun immune ez-espezifiko hauek saihestu nahian, bio-interaktibitatea izan

zen bigarren belaunaldiko helburua. Honetarako, lehen belaunaldiko materialen
azalerak hidroxiapatita (HA) edo β-trikaltzio fosfatoz estali ziren, mineralizazioa
baimenduz. Belaunaldi honetan bio-degradagarriak ziren scaffoldak erabili ziren lehen
aldiz. Scaffoldaren degradazio ratioa hezur sendaketa ratioarekin bateratuz, material
hauen helburua hezurra sortzen zuten zelulei euskarria ematea zen gorputzak materiala
xurgatzen zuen bitartean. Adibide ohikoenak polimero naturalak (azido hialuronikoa eta
kitosanoa) eta sintetikoak (poliglikolidoa eta polilaktida) dira (Navarro et al., 2008).
29
Gaur egunean gauden hirugarren belaunaldiko scaffoldak material bio-

sentikorrak dira. Bio-material hauek, gene espezifikoak aktibatzeko ahalmena dute,
zelulen ugaltze eta desberdintzapena sustatuz. Belaunaldi hau ehun ingeniaritzan
oinarritua dago, scaffold natural edo sintetikoak zelula amez eta hazkuntza faktoreez
estaliz, hezur birsorkuntza eta baskularizazioa bultzatzeko asmoz (Amini et al., 2012;
Hench and Polak, 2002; Rahman et al., 2018).
7. irudia. Hezur ehun ingeniaritza. Hezur scaffold-a eta zelula ama autologoak bioerreaktorean hazkuntza
faktoreekin haziak hezur autologoaren sorrera bultzatzen dute in vitro, hezur konponketa
aplikazioetarako in vivo.
Gaur egun, hezur ehun ingeniaritzarako scaffoldak polimero natural edo

sintetikoz eta material inorganikoz osatuta daude.
Gehien erabiltzen diren polimero sintetikoak azido poli-glikolikoa (PGA), azido

poli-laktikoa (PLA) eta beraien ko-polimeroak. Material hauen degradazio ratio kontrola
eta ezaugarri mekaniko ezin hobeek, zelulak erein ostean ehun ingeniaritzan erabiliak
izateko aukera ona eskaintzen dute (Dorati et al., 2017).
Bestalde, osagai biologiko naturalen artean proteinak (kolagenoa, fibrina gelak,

soja eta zeta) eta polisakaridoak (alginatoa, kitin/kitosanoa, almidoia eta azido
30
Sarrera
hialuronikoaren eratorriak) aurki ditzakegu. Aukera onak dira zelulen itsaspena

areagotzeko, hala ere, bio-degradazio eta ezaugarri mekanikoen kontrola murrizten
dute. Gainera, immune erantzuna sor dezakete (Dorati et al., 2017).
Azkenik, metal, trikaltzio fosfato (TCP), beira bio-aktibo, hidroxiapatita (HA),

wolastonita eta beraien arteko konbinazioak HA-TCP zeramika bifasikoa kasu, aurki
ditzakegu material inorganiko gisa. Material hauen ezaugarririk interesgarriena hezur
mineral fasearen antzekotasuna da (Kokubo and Takadama, 2006; Lakshmi and
Sasikumar, 2015; Stevens, 2008). Desabantaila nagusia berriz, material hauen
degradazio falta da, honi esker ezin dira xurgatuak izan ehun berrien sorrera eragotziz.
Azken ikerketetan ikusi denez, zelulen ugaltze eta desberdintzapenerako

scaffolden porositatea erabakigarria da. Ikerketa hauen arabera 100 eta 400 µm arteko
poro neurriak ezin hobeak dira hezur helduaren sorrerarako, baskularizazioa eta zelulen
infiltrazioa hobetuz lortua (Boyan et al., 2016a; Murphy et al., 2010). Beste ikerketa
batzuek berriz zelulen hazkunderako poro tamaina egokiena 800 µm direla iradoki dute
(Roosa et al., 2010). Bestalde, 100 µm baina txikiagoak diren poroak ehun fibrotiko eta
osteoide ez-mineralizatuaren sorrerarekin erlazionatu dituzte (Iviglia et al., 2019; Liu et
al., 2018). Aldi berean, mikro-poroek azalera area handiagoa eskaintzen dute, ioien
elkartruke eta zelula zein hezur itsaspen proteinak areagotuz (Abbasi et al., 2019; Diaz-
Rodriguez et al., 2018; Morejón et al., 2019).
Kontuan edukitzeko scaffolden beste ezaugarri garrantzitsu bat materialaren

forma da. Azalera ahurrek, azalera lau edo ganbilek baina ehun sorrera hobea erakutsi
dute. Azalera ahurretan, zelulen lerrokatzea hobea da aktina eta miosina fibren
dentsitate handiagoari esker, azalera ganbiletan berriz, ehunen hazkundea atzeratu
egiten da (Bianchi et al., 2014; Knychala et al., 2013).
2.1. Titanioa
Azken mende erdian, hortzen ordezkapenerako titaniozko inplanteak aukerarik

hoberen moduan ezarri dira, hauen erresistentzia, iraunkortasun eta osteo-integrazio
ahalmen altuarengatik (Albrektsson et al., 1981; Breine and Brånemark, 1980). Hala ere,
31
beharrezko masailezur faltagatik, bakterioen infekzioengatik (Periinplantitisa), inplante

azaleren mikro-porositatearengatik edo inguruko zelula ama mesenkimalen aktibazio
faltagatik inplante hauen efizientzia konprometitua izan da (Boyan et al., 2016a;
Graziano et al., 2008). Horregatik, scaffold berri, azalera topografia eta zelula ametan
oinarrituriko ikerketak, inplantologia klinikorako hobekuntza handiak ekar ditzakete
masailezur eta barailezurren birsortze terapietarako.
Nahiz eta hortz inplanteetarako aukerarik hoberena titanioa dela ikusi den arren,
azken hamarkadetan, inplante azalera ezberdinen diseinu eta fabrikazioak osteo-
integrazioa hobetzean duen garrantzia frogatu da (Gasik et al., 2015; Rani et al., 2012;
Rupp et al., 2018; Salou et al., 2015). Titanioaren konposizioaz gain, garrantzitsua da
azalera hauen topografia kontuan hartzea inplantearen ainguraketa iraunkorra lortzeko
(Annunziata and Guida, 2015; Jemat et al., 2015; Le Guéhennec et al., 2007; Naves et
al., 2015).
Titanio azalera gogorrek, inguruko hezur albeolarrarekiko duten kontaktu azalera

maximizatzeari esker, osteo-integrazio ahalmen handiagoa izatea frogatu dute titanio
leunekin alderatuz (Coelho et al., 2009). Inplante hauen hezur integrazio hobe hau,
titanio azaleren mikro-porositatearekin erlaziona daiteke, zeinak inguruko zelula ama
mesenkimalen desberdintzapen osteoblastikoa bultzatzen duen. Azkenik, inplantea
kokatu ostean, zelula mesenkimal hauek dira hezurra sendotu eta sendatzearen
arduradun (Boyan et al., 2016a; Graziano et al., 2008).
Lehen aipatu bezala, ikerketa ezberdinek frogatu duten bezala, poro tamaina
txikiek (<180 µm) zelulen desberdintzapena bultzatzen dute inplantearen sendaketaren
hasieran, aldi berean, tamaina handiko poroek (>300 µm) zelulen ugalketa eta hezur
sorrera bultzatzen dute (Coelho et al., 2015). Hala ere, porositateak materialen ezaugarri
mekanikoetan eragin zuzena du, beraz, ezinbestekoa da oreka egoki bat mantentzea
porositate eta gogortasunaren artean inplante motaren arabera. Hare gehiago, beste
ikerketa batzuk erakutsi dutenez, titanio porotsuek korrosioaren aurkako erresistentzia
txikiagoa dute gorputzeko fluidoen fluxu dinamikoaren ondorioz. Porositateak
gorputzeko fluidoen fluxua errazten du, degradazioa azkartuz (Chen et al., 2017).
32
Sarrera
Titanio porotsuen garapenean hobetu beharreko beste ezaugarri bat inplanteen

zurruntasuna txikitzea da. Titanio inplante zurrunetan ikusi denez, hezur sorrera eta
birmoldaketa txikitzen dute estresa babesteak dakarren inplikazio negatiboengatik.
Arazo hauek azkenean hezurraren birxurgapena eragiten dute, eta ondorioz
inplantearen galera (Ma et al., 2006; Świeczko-Żurek, 2009) (8. irudia).
Titanio sendozko muina

8. irudia. Titaniozko hortz
inplanteen azalera porotsua. (Pałka
and Pokrowiecki, 2018).
Titanio aleazioak hiru taldeetan sailka daitezke:
1- A fase egonkortzaileak: karbono (C), oxigeno (O), aluminio (Al) eta nitrogenoa
(N).
2- B fase egonkortzaileak:
a. Isomorfoak: tantalo (Ta), molibdeno (Mo), banadio (V) eta niobioa (Nb).
b. Euktoideak: silikona (Si), kromo (Cr), kobre (Cu), hidrogeno (H),
manganeso (Mn), nikel (Ni) eta burdina (Fe).
3- Gehikuntza neutroak: estainu (Sn) eta zirkonioa (Zr).
Kalteturiko hezur albeolarraren inguruko zelula mesenkimalen aktibazioa

ezinbestekoa da inplantearen integrazioa bultzatzeko, iraunkortasuna eta erresistentzia
hobetuz eta bakterioen eraginez sorturik infekzioak ekiditeko. Arrazoi honengatik,
33
titanio inplante eta zelula aloinjertu/autoinjertuen arteko konbinazioak abantaila

handiak eskaintzen ditu inplantologia klinikoan erabiliak izateko.
2.2. Dezelularizaturiko ehun adiposoa (DAT)
Gaur egun erabiltzen diren hortz inplante gehienak metal aleazio inerteak dira.
Inplante hauek bakarrik erabiliz edota dezelularizatutako hezur matrize eta plasmatik
eratorritako hazkuntza faktoreekin konbinatuz, ama zelula mesenkimalenosteo-
desberdintzapena bultzatzen dute, inplante azaleran hezurra sortuz (Anitua et al.,
2016b; Boyan et al., 2016a; Mayer et al., 2018; Zanicotti et al., 2018). Gaur egun, hortz
inplanteen arazorik nagusiena periinplantitisaren garapena da. Periinplantitisa,
murtxikatze naturalean inplanteek hezur ehunari transferitzen dion presio mekaniko
jarraiaren ondorioz sortzen da. Kasu okerrenetan, periinplantitisak inplantearen galera
eragiten du (Bertolini et al., 2019). Hortz naturaletan, arazo hau lotailu periodontalari
(PDL) esker konpontzen da, inerbazio eta baskularizazio altuko ehun konektiboa da,
kolageno sorta indartsuez osaturik dagoena. Kolageno fibra sorta hauek hortz sustrai
zementu eta hezur albeolarrari ainguraturik daude kaltzifikazio arineko ertzei esker.
Fibra hauei Sharpey fibra zulatzaileak bezala ezagutzen zaie (Aaron, 2012). PDL-aren
funtzio nagusia mastekatzean sortzen den indarra xurgatzea da kuxin bezala jokatuz,
honela hezur albeolarra babestuz
Dezelularizatutako ehun adiposoak (ingelesez, Decellularized Adipose Tissue,

DAT) bio-material itxaropentsua dela ematen du malgutasun, irisgarritasun eta
ezaugarri bio-aktiboak bezalako ezaugarriengatik (Yang et al., 2020). In vivo entseiuetan
dagoeneko erakutsi dute bio-bateragarritasuna (Wang et al., 2013). DAT-aren ezaugarri
interesgarrienetako bat, material honen leuntasuna da. Honi esker, ehun konektibo
interfasea lortu daiteke hortz inplante sustraiaren eta hezur albeolarraren artean. DAT-
a ehun adiposo zuritik lortzen da, hau, baskularizazio altuko ehuna da. Zelulen atxikipen
eta integrazioari laguntzen dio oinarrizko mintz proteinen kontzentrazio altuari esker,
hauen aretan aipagarrienak kolagenoa (I, III eta IV mota), perlekanoa (proteoglikano
sulfatatua) eta laminina izango lirateke (Yang et al., 2020). Dezelularizazio prozesua ere
hobetua izan da (Madarieta Pardo et al., 2017). Baita ere garrantzitsua da aipatzea DAT-
34
Sarrera
a modu ezberdinetan prozesatua izan daitekeela, aplikazioaren arabera. Hezur ehun

birsorkuntzaren kasuan, formulazio itxaropentsuena apar sendo forma da. Honen
porositate eta pisu ratioarekiko bolumen handiak, mantenugai, seinale eta zelulen
mobilitatea baimentzen du materialaren matrizean barren (8. irudia).
9. irudia. Irudi makroskopiko (A, B) eta ekortzeko mikroskopio elektronikoko irudiak (SEM) (C, D),
txerrien ehun adiposo ez manipulatua (A, C) eta dezelularizaturiko matrize extrazelularra (ECM) (B, D).
Eskala barra: 50 µm. (Choi et al., 2012).
3. Hazkuntza faktoreak
Azken hamarkadetan, hezur proteina morfogenikoak (ingelesez, bone morphogeniz

proteins, BMPs) eta esmalte matrizearen deribatuak (ingelesez, enamel matrix derivate,
EMD) bezalako molekulak erabili izan dira zauritu edo galduriko ehunen birsorkuntza
bultzatzeko (Dumic-Cule et al., 2018; Miron et al., 2016; Rao et al., 2013). Hala ere, azken
urteetan, plaketetatik eratorritako produktuek tresna itxaropentsua bihurtu dira zelulen
hazkuntza eta desberdintzapena areagotuz ehun ingeniaritzan.
35
3.1. Plasmatik eratorritako produktuak
Kalteturiko gunearen sendaketa lokala bultzatzeko asmoz sortu zen bildutako

plasma soluziotik eratorritako plaketa eta hazkuntza faktoreen kontzentratuaren
kontzeptua (Anfossi et al., 1989; Fijnheer et al., 1990). 1990. hamarkadaren bukaeran
jarri zitzaion plaketetan aberatsa den plasma (ingelesez, platelet rich plasma, PRP) izena
(Jameson, 2007; Marx et al., 1998; Whitman et al., 1997). PRP-a plaketez osaturik dago,
hauek aktibatzean hazkuntza faktoreak askatzen dituzte, mindutako gunean zelulen
hazkunde, atxikipen eta migrazioa areagotuz (Jameson, 2007; Marx, 2004). PRP-aren
ostean bigarren plasmatik eratorritako produktu bat formulatu zen antikoagulatzaileak
erabiliz, honi plaketetan aberatsa den hazkuntza faktore (ingelesez, platelet-rich growth
factor, PRGF) izena jarri zitzaion (Anitua, 1999). Gainera, bi produktu hauen arazorik
handiena (manipulatzeko zailtasuna) saiheste arren, hirugarren belaunaldiko plasmatik
eratorritako produktua sortu zuten, plaketetan aberatsa den fibrina (ingelesez, Platelet
rich fibrin, PRF) (Anitua et al., 2016b; Anitua et al., 2016a).
Aktibaturiko plaketek askatzen dituzten hazkuntza faktoreen artean honako hauek

sar ditzakegu: β1 hazkuntza faktore eraldatzailea (ingelesez, transforming growth factor
β1, TGF-β1), plaketetatik eratorritako hazkuntza faktorea (ingelesez, platelet derived
growth factor, PDGF), baskulatura endotelial hazkuntza faktorea (ingelesez, vascular
endothelial growth factor, VEGF), fibroblasto hazkuntza faktorea (ingelesez, fibroblast
growth factor, FGF), hazkuntza faktore epidermikoa (ingelesez, epidermal growth factor,
EGF) eta IL-1β, IL-4 eta IL-6 moduko interleukinak (IL) (Dohan et al., 2006).
Nahiz eta PRP eta PRGF-aren prestaketa oso antzekoa den arren, PRGF-ak plasma
proteina eta koagulazio faktore gehiago ditu, efektu handiagoa eraginez PRP-arekin
alderatuz (Anitua, 1999).
Plasmatik eratorritako bi produktuek, PRGF eta PRF, dituzten hazkuntza faktore

nahasketak inguruko zelula mesenkimalen ugalketa eta desberdintzapena
osteoblastikoa bultzatzen dute. Produktu hauen ezaugarri hoberenetako bat terapia
pertsonalizatu autologoetan erabili ahal izatea da (Anitua et al., 2013). Hauen erabilerak
dakartzan abantailak frogatuak izan dira eta beraien erabilera asko zabaldu da
36
Sarrera
esperimentazioan bezain ehun birsortze terapia klinikoan, batez ere odontologiako

inplante terapietan (Anitua et al., 2016b; Masuki et al., 2016) (10. irudia).
10. irudia. PRGF (esker) eta PRF-rean (eskuin) irudiak.
PRGF-a plaketetan aberatsa den plasma frakzioz osaturik dago. Pazientearen

odola zentrifugatu ostean, plasma frakzio hori kaltzio kloruro bidez aktibatzean lortzen
da. Kaltzio tratamenduak plaketen degranulazioa abiarazten du, honen ondorioz,
polimerizaturiko fibrina koaguloa eta hazkuntza faktoreen nahasketa konplexua lortzen
da (Anitua et al., 2009; Jovani-Sancho et al., 2016; Paknejad et al., 2012). Ondorengo
zentrifugazioak fibrina koagulua hazkuntza faktoreetan aberatsa den frakzio
disolbagarritik apartatuko du (Anitua et al., 2012).
PRF-a lortzeko, odola anti-koagulatzaile gabe ateratzen denez, zentrifugazio

azkar bat beharrezkoa da odola atera ostean. Odol frakzioak bereiztu ondoren, leukozito
eta plaketak dituen koagulua lautu egin daiteke mintz bat lortu arte, produktu honek
duen manipulazio errazari esker. Ezaugarri interesgarrienetako bat hazkuntza faktoreen
askapen progresiboa da denboran zehar plaketek duten degranulazioaren eraginez.
Ebakuntzaren ondoren, ehunaren sendaketa hobetzeko, zelulen hazkuntza eta
kimiotaxia bultzatzen dute hazkuntza faktore hauek. Fibrina koagulua erresistente,
gogor, malgu eta manipulatzek erraza da. Ezaugarri hauek moldagarritasun handia
ematen diote azalera anatomiko ezberdinetan erabiliak izateko (Khurana et al., 2017;
Kumar et al., 2016).
37
Gaur egun, hazkuntza faktoreetan aberatsa den plasma (PRGF) eta plaketetan
aberatsa den fibrinaren (PRF) erabilera klinikoa zabaldua izan da hortz erauzketa osteko
titanio inplanteen inguruko hezurra sendatzeko. Produktu hauei plasmatik eratorritako
terapia medikorako produktu aurreratu (ingelesez, plasma-derived advanced medical
therapy products, AMTP) bezala ezagutzen zaie (Giannini et al., 2015; Kobayashi et al.,
2016; Nishiyama et al., 2016).
38
Metodologia
Metodologia
gBMSC-en isolamendu eta hazkuntza
gBMSC-ak Zuritxeko unibertsitateko (Zürich, Suitza) Zelula eta Ehun Ingeniaritza

Laborategitik (Ehrbarlab) lortu ziren ondorengo prozedura jarraituz: gBMSC-ak, gizaki
emaile osasuntsuetan (45 urteko bataz besteko adina) eginiko hezur-muin aspiratuetatik
lortu ziren, prozedura kirurgiko ortopedikoetan. Aspiratuak, tokiko batzorde etikoak
ezarritako baimen informatuarekin lortu ziren (University Hospital Basel; Prof. Kummer;
approval date 26/03/2007 Ref. Number 78/07). Zelula nukleatuen isolamendurako,
aspiratuan lorturiko globulu gorriak lisatuak izan ziren 0.15 M NH4Cl (Sigma, Suitza), 1
mM KHCO3 (Sigma, Suitza) eta 0.1 mM Na2EDTA-rekin (Fluka, Suitza) osaturiko bufferraz.
gBMSC-ak, % 10 BSF (ingelesez, fetal bovine serum) (Gibco, NY, AEB), % 1 penizilina-
estreptomizina (Gibco, NY, AEB) eta 5 ng/ml fibroblasto hazkuntza faktore 2-az (FGF2,
PeproTech, NJ, AEB) osaturiko αMEM (ingelesez, minimal essential medium) (Gibco, NY,
AEB) medioan hazi ziren 37 °C-tan % 5-eko CO2-arekin. 3 eta 8 bitarteko zelula-paseak
erabili ziren esperimentuetarako.
gDPSC-en isolamendu eta hazkuntza
Giza hortz mamiko zelula amak (gDPSC), hortz klinikan paziente gazte
osasuntsuetatik (18-tik 30 urte bitartekoak) erauzitako hirugarren molarretatik isolatu
ziren. Pazienteek baimen informatua sinatu zuten aldez aurretik onartutako
M10_2016_088 protokoloa jarraituz (Euskal Herriko Unibertsitateko etika batzordea).
Hortz mamiaren erauzketa molarren apurketarekin egin zen. Lorturiko hortz

mamiak, HBSS (ingelesez, Hank´s balanced solution) (Gibco, NY, AEB) medioan
disolbaturiko 3 mg/ml kolagenasa I (Gibco, NY, AEB) eta 4 mg/ml dispasa-z (Sigma, MO,
AEB) osaturiko digestio entzimakoaz tratatu ziren ordubetez 37 °C-tan % 5-eko CO2-
arekin. Digestio entzimatiko soluzioa neutralizatzeko, % 10-eko BSF-z (HyClone, UT, AEB)
osaturiko DMEM-a (ingelesez, Dulbecco´s modified eagle medium) (Lonza, Suitza) erabili
zen. Honen ostean, zelulak 1500 rpm-etan zentrifugatu ziren 5 minutuz. Lorturiko
zelulak mekanikoki bereizi ziren 18G-ko orratz batekin (BD Microlance, Fisher Scientific,
UK). Zelulak bereizi ostean, % 10-eko BSF, % 1 penizilina-estreptomizina (Gibco, NY, AEB)
41
eta % 1 L-Glutamina-z (Sigma, MO, AEB) osaturiko DMEM medioan erein ziren 37 °C-tan
% 5-eko CO2-arekin. 5 80-ko konfluentzia lortu ostean zelulak 75 zm2-ko flasketara
(Sarstedt, Nümbrecht, Alemania) pasa ziren. Esperimentuetarako 4 eta 10 pase
bitarteko zelulak erabili ziren.
Desberdintzapen osteogeniko medioa
Titanio eta pDAT-zko apar solidoetan ereindako gDPSC-en esperimentuetarako

erabili zen medio osteogenikoa, DMEM (% 10 BSF, % 1 penizilina-estreptomizina eta %
1 L-Glutamina), 50 µM azido askorbiko (Sigma, MO, AEB), 20mM β-glizerolfosfato
(Sigma, MO, AEB) eta 10 nM dexametasona-z (Sigma, MO, AEB) osaturik zegoen. gDPSC
eta gBMSC-en arteko ikerketa konparatiboetarako berriz DMEM (% 10 BSF, % 1
penizilina-estreptomizina eta % 1 L-Glutamina), 50 µM azido askorbiko (Sigma, MO,
AEB), 10mM β-glizerolfosfato (Sigma, MO, AEB) eta 100 nM dexametasona-z (Sigma,
MO, AEB) osatua. Esperimentu konparatibo hauetarako, kontrol zein desberdintzapen
medioak 5 ng/ml EGF (AF-100-15-500UG, PeproTech, NJ, AEB) ere bazuen.
Titanio diskoen fabrikazioa
2 mm-ko lodiera duten Ti6AL4V diskoak, 5.5 mm-ko diametroa duen barra bat
moztuz lortu ziren Avinent Implant System SLU (Bartzelona, Espainia) enpresatik. BASTM
titanio azaleraren fabrikaziorako, titanio diskoaren aurpegi bat korindoi zuriz (Al2O3)
F60 eginiko “shot blastin” teknika erabili zen, 212-300 µm-ko tamainako partikulak
proiektatuz. Ondoren, diskoak bainu ultrasoniko batean garbitu ziren 10 minutuz eta ur
distilatuz garbitu ziren. Garbiketen ostean, anodizatuak izan ziren DC energia iturriko
anodoari lotuz eta kaltzio eta fosforoa erabiliz ur soluzioko elektrolito gisa. 0.75
mA/mm2-eko korronte dentsitatea aplikatu zen eta potentzialari libreki handitzen utzi
zitzaion 130 V-raino heldu arte. Azkenik, bainu ultrasonikoan ur destilatuzko 10
minutuko garbiketekin bukatu zen fabrikazio prozesua. Ti6Al4V titaniozko diskoek ez
zuten inolako leuntze edo tratamendurik jasan.
42
Metodologia
pDAT-ren dezelularizaio eta apar solido prozesamendua
Txerrietatik eratorritako ehun adiposoa tokiko janari enpresa batetik (Jaucha SL,
Nafarroa, Espainia) lortu zen. Ehuna gela tenperaturan desizoztu, garbitu eta irabiagailu
batez krematua izan zen. Ondoren, ehuna izotzetan homogeneizatu zen bi hagaxka
ezberdinezko Plyton-a (PT3100) erabiliz 1200 rpm-etan 5 minutuz. Lipidoen fase
separazioa lortzeko, homogeneizaturiko ehuna 900 g-etan zentrifugatu zen ur ultra
purua erabiliz 5 minutuz. Lipidoak eskuz baztertuak izan ziren eta proteinak
kontserbatuak. Proteina pelletak gauan zehar isopropanolez (Merk Life Science,
Espainia) tratatuak izan ziren astintzaile orbital batez gela tenperaturan. PBS-ez garbitu
ondoren, % 1 Triton X-100 eta % 0.1 amonio hidroxido-z (Merk Life Science, Espainia)
tratatu zen 36 orduz gela tenperaturan astintzaile orbitalean. PBS-ezko garbiketen
ostean, liofilizatua izan zen erabat lehortu arte. Lorturiko ehuna fresatu egin zen
nahasgailu errota (Retsch MM400) erabiliz prozesatuak izateko grano fineko hautsa
lortu arte. Lorturiko hautsa nitrogeno likidoz izoztu zen eta 4 °C-tan gorde zen hutseko
lehorgailuan.
Apar solidoak pDAT izozte-lehortze prozesuaren bidez prestatu ziren. % 0.5

pDAT-ri 0.5 M azido azetiko gehitu zitzaion, lorturiko soluzioa irabiagailu magnetiko
batez homogeneizatu zen 48 orduz gela tenperaturan. 20 mm-ko diametro eta 3 mm-ko
lodiera duen tefloizko moldeak erabili ziren Ekorkuntz Mikroskopio Elektronikorako
(SEM), 1 ml soluzio erabiliz. In vitro zelula kultiboentzako berriz, apar sendoak, 8
kristalezko hobitxodun Millicell EZ-portan (Merk Millipore) prestatu ziren 120 µl soluzio
erabiliz. Lorturiko portak mikroskopio optiko eta fluoreszenteentzako bateragarriak
ziren. Laginak -20 °C-tan izoztu eta izoztu-lehortu ziren (0.63 mbar eta -10 °C) apar
sendoak lortzeko. Zelula hazkundeetan erabiliak izateko etileno oxidoz (Esterilizacion SL,
Bartzelona, Espainia) esterilizatu ziren.
PRGF eta PRF-aren prestakuntza
PRGF-a prestatzeko, giza emaile gazte osasuntsuetatik lortu zen odola % 3.8
sodio zitrato antikoagulatzailea zuten 5 ml-ko odola biltzeko hodiak (BD Vacutainer,
Plymouth, UK) erabiliz. 8 minutuz 580 g-etara zentrifugatu ondoren, plaketetan aberatsa
den frakzioa 15 ml-lo falkon hodietara pasa zen. Plaketak, % 10 kaltzio kloruroz (Braun
43
medical, Melsungen, Alemania) aktibatuak izan ziren ordu batez 37 °C-etan. Inkubazio
honen ostean, plasma 3000 g-etan zentrifugatu zen 15 minutuz 4 °C-tan eta filtratua izan
zen 0.2 µm-ko poro tamainako iragazkiak erabiliz (Sarstedt, Nümbrecht, Alemania).
Azkenik, plasma alikuotatu eta izoztuta gorde zen -20 °C-tan erabili arte. PRGF-a medio
aldaketa bakoitzarekin gehitu zen (10. irudia).
PRF-aren prestaketarako berriz, odola antikoagulatzaile gabeko hodietan (BD

Vacutainer, Plymouth, UK) bildu zen. Laginak momentuan zentrifugatu ziren 580 g-etan
8 minutuz, odolaren koagulazio goiztiarra ekiditeko. Odol eta fibrinaren koagulazioaren
ondoren, plaketak dituen fibrina koagulua hematokrito frakziotik bereizi zen bisturi eta
pintzak erabiliz. Azkenik bi beiren artean konprimatu zen pisua erabiliz ordubetez gela
tenperaturan. Fibrinazko koaguluak zm2 bateko zati txikiagotan moztu ziren (10. irudia).
Antikoagulatzailea CaCl2
bidezko
Odol plaketa
zentrifugazioa aktibazioa
PRGF
PRF
Plasma
Odol Kapa leukozitarioa
erauzketa Eritrozitoak Fibrina
koaguluaren
Antikoagulatzailerik formazioa Konpresio
gabe tresna
10. irudia. PRGF eta PRF-aren prestakuntza ilustrazioa. (Autoreak sortua).
gDPSC eta gBMSC-en hazkuntza titaniozko dizkoetan
Zelulek % 80-ko konfluentzia lortzean, % 0.05 Tripsina-EDTA erabiliz desitsatsi eta

bildu ostean zentrifugatu eta kontatuak izan ziren. Esperimentuaren arabera zelula
dentsitate ezberdinak erein ziren Ti6Al4V eta BASTM titanio diskoetan. Zelulen itsaspena
44
Metodologia
areagotzeko, 15.000 zelula 70 µl-ko tantetan erein ziren diskoen gainean eta 3 orduz 37
°C-etan inkubatu ziren. Inkubazio honen ostean 700 µl DMEM medio gehitu ziren 24
putzuko plakentzako eta 4 ml 6 putzuko plakentzako.
gDPSC-en hazkuntza txerritik eratorritako ehun adiposo dezelularizatuan (pDAT)
Zelulek % 80-ko konfluentzia lortzean, % 0.05 Tripsina-EDTA erabiliz desitsatsi eta

bildu ostean zentrifugatu eta kontatuak izan ziren. pDAT-a (Tecnalia, Donostia, Espainia)
24 putzuko plaketan (Sarstedt, Nümbrecht, Alemania) eta 8 putzuko Ibidi plaketan (Ibidi,
Munich, Alemania) jarri zen. DMEM medioaz pDAT-a hidratatu ondoren, gDPSC-ak
10.000-20.000 zelula/putzu-ko dentsitatean erein ziren (esperimentuaren arabera).
Hazkuntza medioa 2-3 egunero aldatu zen.
Kaltzeina/ propidio ioduro esperimentua
4 eguneko hazkundearen ostean, zelulak PBS-z garbitu ziren. Garbiketak egin eta
gero, zelulak 3 µM kaltzeina-AM (Molecular probes, OR, AEB) eta 2.5 µM propidio
ioduro-arekin (Sigma, MO, AEB) inkubatu ziren 30 minutuz 37 °C-tan. Azkenik, zelulei 3
PBS garbiketa egin zitzaizkien eta argazkiak Axioskop mikroskopio fluoreszentea (Zeiss,
Overkochen, Alemania) eta Nikon DS-Qi1 kamera erabiliz (Nikon, Tokio, Japonia) atera
ziren.
Immunozitokimika
Zelulen hazkundearen ondoren, zelulak PBS-z garbitu eta % 4 paraformaldehidoz

(PFA) fijatu ziren gela tenperaturan 10 minutuz. Honen ostean, zelulak 10 minutuz
inkubatu ziren % 10 ahuntz seruma (Invitrogen, CA, AEB) erabiliz gela tenperaturan.
Blokeo pausuari jarraituz, gau osoko inkubazioa egin zen 4 °C-tan % 0.1 Triton X-100/ %
1 BSA/ PBS erabiliz ondorengo antigorputzekin: BGLAP (ab93876, Rabbit polyclonal,
Abcam, Cambridge, UK), Caspasa-3 (ab32351, Rabbit monoclonal, Abcam, Cambridge,
UK), Ki67 (ab15580, Rabbit polyclonal, Abcam, Cambridge, UK), Osterix (ab22552, Rabbit
polyclonal, Abcam, Cambridge, UK) eta SPARC (ab14174, Rabbit polyclonal, Abcam,
45
Cambridge, UK). Alexa 488 conjugated rabbit IgG (A11008, Abcam, Cambridge, UK)
erabili zen antigorputz sekundario gisa antigorputz primarioak lokalizatzeko %1 BSA/
PBS erabiliz ordubetez gela tenperaturan. Zelulen nukleoak 4’,6-diamino-2-fenilindol-ez
(DAPI, Invitrogen, CA, AEB) tindatu ziren. Irudiak, Axioskop mikroskopio fluoreszentea
(Zeiss, Overkochen, Alemania) eta Nikon DS-Qi1 kamera erabiliz (Nikon, Tokio, Japonia)
eta Leica DM6000 B mikorskopioa (Leica, Wetzlar, Alemania), Leica DFC420 C kamera
eta 3.3.3.16958 Leica application suite X (Leica, Wetzlar, Alemania) programaren bidez
atera ziren.
Fluxu zitometria
gDPSC eta gBMSC-en fenotipoa fluxu zitometriaz analizatu zen. Antigorputz

bakoitzarentzat 500.000 zelula desitsatsi ziren eta % 0.15 behi serum albumina (BSA,
Sigma, MO, AEB) duen PBS-z inkubatu ziren 40 minutuz izotzetan ondorengo
antigorputzekin: 1:50 CD45-APC (304011, Biolegend, CA, AEB), 1:50 CD73-APC (17-0739-
41, eBioscience, MA, AEB), 1:50 CD90-FITC (328107, Biolegend, CA, AEB) eta 1:50 CD105-
PE (12-1057, eBioscience, MA, AEB). % 0.15 BSA-dun PBS-z garbitu eta gero 500 µl PBS-
tan bir-suspenditu ziren. Analisia, Gallios fluxu zitrometoa (Beckman Coulter, CA, AEB)
erabiliz egin zen Kaluza 1.1 softwarearekin (Beckman Coulter, CA, AEB).
Ekorkuntz mikroskopio elektronikoa
Bi titanio azaleretan hazitako zelulak % 2 glutaraldehidoz (Sigma, MO, AEB) fijatu

ziren 0.1 M Sorensen fosfato bufferra (SPB, Thermo Fisher Scientific, MA, AEB) erabiliz
ordubetez 4 °C-tan. Pauso honen ondoren, laginak 3 aldiz garbitu ziren % 4-8 sakarosa
zuen 0.1 M SPB bufferrarekin, eta gero beste 3 garbiketa 0.1 M SPB-rekin. Zelulak
lehortzeko 15 minutuko inkubaketak egin ziren etanolean (% 30, % 50, % 70, % 90 eta %
100). Behin lehortuta, hexametildisilazanoz (Sigma, MO, AEB) garbitu ziren. Airean
lehortu eta gero, 15 nm lodierako urre hautsez estali ziren laginak. Irudiak ekortzeko
mikroskopio elektroniko (SEM, S4800, Hitachi High Technologies, Tokio, Japonia) bidez
atera ziren. Zelularik gabeko diskoei ere mikroskopio berberaz atera zitzaizkien
argazkiak.
46
Metodologia
Transmisiozko mikroskopio elektronikoa (TEM)
Laginak %2 glutaraldehidotan 15 minutuz fijatu ondoren Epon Polarbed

erretxinean (Electron Microscopy Science, Hatfield, PA, AEB) txertatu ziren. 70 nm-tako
sekzio ultra finak 150 kobrezko sarean (150 Square Mesh xopper 3,05 mm, AGAR
Scientific, UK) jarri ziren. Post tindaketa ur destilatutan disolbaturiko % 2 uranil azetatoa
(AGAR Scientific, UK) eta % 0.2 zitratoarekin (AGR1210, AGAR Scientific, UK) egin zen.
Irudiak Philips EM208S transmisiozko mikroskopio elektronikoarekin atera ziren Jeol
JEM 1400 Plus kamerari esker.
RNA erauzketa eta erretrotranskripzioa
Zelula peletak -80 °C-tan gorde ziren erabiliak izan arte. RNA, RNeasy mini kit-a
(Qiagen, Hilden Alemania) erabiliz erauzi zen. RNA-ren kontzentrazio eta purutasuna
260/ 280 nm-ko absorbantziaz neurtu zen Nanodrop Synergy HT-ren bidez (Biotek, VT,
AEB). cDNA-ren sintesia erretrotranskripzioz lortu zen 1000 ng-ko hasierako RNA-tik
iScript cDNA kit-a erabiliz (Biorad, CA, AEB). Retrotranskripzio zikloak 25 °C-tako 5
minutuko pausoarekin hasi zen, honi jarraituz 46 °C-ko 20 minutu zikloa eta amaitzeko
minutu bateko 95 °C-ko zikloarekin. Behin erretrotranskripzioa amaiturik 4 °C-tan
mantendu ziren -20 °C-tan izoztu arte.
RNA sekuentziazioa
gDPSC eta gBMSC-ak plastiko, Ti6Al4V eta BAS titanio azaleretan medio kontrol
edo osteoblastikoarekin hazi ziren 14 egunez. 24 disko erabili ziren kondizio bakoitzeko
eta tripsinarekin zelulak desitsatsi ostean, RNA Quiagen RNA erauzketa kitarekin lortu
zen. gDPSC eta gBMSC-etatik erauzitako RNA Zuritxeko Genomika zentroan sekuentziatu
zen Illumina sekuentziagailuaz (Illumina, CA, AEB), 25.000 RNA irakurketa lortuz
baldintza bakoitzeko. Gene hauen adierazpena presentzia/gabezia (ON/OFF) kriterioa
jarraituz analizatu zen baldintza ezberdinen konparaketetan eta 10 irakurketa
gordinetan jarri zen muga gene baten adierazpena positibotzat (ON) hartzeko.
Aktibaturiko gene bideak “Pathway Enrichment Analysis” erabiliz analizatu zen, “The
47
Connectivity Map” (CMAP) eta “Gene Ontology enrichment Biological Process” (GOBP)
datu baseak erabiliz CIC bioGUNE-n (CIC bioGUNE, Derio, Espainia).
Denbora-errealeko PCR kuantitatiboa (qPCR)
Power SYBR Green PCR Master Mix-a (Applied biosystems, CA, AEB) erabili zen
qPCR-a egiteko. Anplifikatzeko programaren zikloak 10 minutu 95 °C-tan eta 95 °C 20
segundo eta 59 °C-ko minutu bateko 40 ziklorekin egin zen. Erabili ziren “etxezaintza”
geneak β-aktina 5´-GTTGTCGACGACGAGCG-3´ eta 5´-GCACAGAGCCTCGCCTT-3´ eta
Gapdh 5´ CTTTTGCGTCGCCAG -3´ eta 5´- TTGATGGCAACAATATCCAC -3´ izan ziren.
Azterturiko geneak hauek izan ziren: kolageno I (COL I) 5´ -GGCCCCCTGGTATGACTGGCT-
3´ eta 5´-CGCCACGGGGACCACGAATC-3´, osteonektina (SPARC) 5´-
GAAAGAAGATCCAGGCCCTC-3´ eta 5´-CTTCAGACTGCCCGGAGA-3´, osteokaltzina
(BGLAP) 5´-CGCCTGGGTCTCTTCACTAC-3´ eta 5´-CTCACACTCCTCGCCCTATT-3´, dentin
sialofosfoproteina (DSPP) 5´-TGCCCAAATGCAAAAATATG-3´ eta 5´-
GTGGGCCACTTTCAGTCTTC-3´, osterix (OSX) 5´-TGAGGAGGAAGTTCACTATG-3´ eta 5´-
CATTAGTGCTTGTAAAGGGG-3´eta runx2 (RUNX2) 5´-CACTCACTACCACACCTACC-3´ eta
5´-TTCCATCAGCGTCAACAC-3´. Ikerturiko geneen adierazpena etxezaintza geneen
adierazpenarekin normalizatuak izan ziren.
Fosfatasa alkalino tindaketa (ALP)
Zelulak minutu batez % 4 PFA-az fijatu ondoren 3 aldiz garbitu ziren % 0.05 Tween
20-PBS-z. ALP tindaketarako, 5-bromo-4-kloro-3-indolil fosfato/ tetrazolio nitro urdina
(NBT/BCIP, Sigma, MO, AEB) erabili zen eta tindaketa 3 minuturo begiratu zen. Tindaketa
amaitu ondoren, PBS-zko 5 minutuko 3 garbiketa egin ziren. Irudiak, Zeiss Stemi 2000-C
mikroskopio estereoskopikoarekin (Zeiss, Alemania) atera ziren Canon PowerShot A80
kamera (Canon, Tokio, Japonia) erabiliz. ALP aktibitate entzimatikoa kuantifikatzeko,
zelulak tripsina-EDTA-rekin desitsatsi ziren. Absorbantzia 420 nm-tan neurtu zen
Synergy HT-ren bidez (BioTek, VT, AEB) Gen5 1.11 programa erabilita.
48
Metodologia
Alizarin gorri tindaketa (ARS)
gDPSC eta gBMSC-en potentzial osteogenikoa neurtzeko Alizarin gorria erabili

zen zelulaz kanpoko kaltzio deposituak tindatzeko. 21 egunetako hazkuntzaren ondoren,
zelulak fijatuak izan ziren % 4 PFA-z 10 minutuz. Ur distilatuz garbitu ostean, pH 4.2-dun
% 2 ARS-arekin (Acros organics, Sigma, MO, AEB) tindatu ziren laginak ilunpean 45
minutuz gela tenperaturan. Ur distilatuz 3 aldiz 5 minutuko garbiketak egin ziren
soberako ARS-a kentzeko. Irudiak Zeiss Stemi 2000-C mikroskopio estereoskopiko (Zeiss,
Germany) eta Canon PowerShot A80 kamera (Canon, Tokyo, Japan) erabiliz atera ziren.
Analisi estatistikoa
Analisi estatistikoa IBM-ren SPSS software estatistikoa (v.26.0) erabiliz gauzatu

zen, baldintza bakoitzaren media eta errore estandarra kalkulatuz. Esperimentu
ezberdinetako balditzen datuak Mann Whitney testa edo ANOVA bidez analizatu ziren,
Bonferroni edo Games-Howell testekin jarraituz, bariantzen homogeneitatearen
arabera. Konfidantza tartea % 95 (p < 0.05), % 99 (p < 0.01) eta % 99.9-n (p < 0.001)
ezarri zen.
49
Hipotesia
Hipotesia
Azkeneko hamarkadetan, hezur ehun ingeniaritza eta hortz inplantologian

erabiltzeko hortz inplante eta scaffold-ek asko hobetu dute. Material berriak, azalera
topografia eta laztasunaren aldaketek, zelula ama mesenkimalen osteoblasto
desberdintzapenean eragin zuzena dutela erakutsi dute. Scaffold berri guztiek hauen,
porositate, laztasun eta formaren hobekuntzak kontuan izanik ere, erabilera klinikorako
aukerarik hoberena zein den ez dago argi. Ugaritze eta desberdintzapen gaitasun
handiari esker, MSC-ek hezur ingeniaritzaren etorkizuna direla dirudite; hala ere, hezur
birsortze terapietarako MSC-rik hoberena aukeratzeko eztabaida oraindik abian dago.
Azkenik, ehun ingeniaritzaren erronka nagusienetako bat zabaldua dagoen animali
iturriko serumen erabilera da, behi serum fetala (BSF) bezala, zeinak ordezkatuak izan
beharra diren immune erantzuna desaktibatzeko zelulak injertatutako pazienteetan.
Periinplantitisaren eragin dezakeen inplante galera ekiditeko, lotailu

periodontala bezalako ehun garrantzitsua ordezkatzeko asmoz, gure hipotesiaren
arabera titanio biomimetiko azalera BASTM eta dezelularizatutako ehun adiposoak (DAT),
hezur ingeniaritzarako zelula amen desberdintzapen osteoblastiko bultzatzeko material
eraginkorragoak izan daitezke. Gainera, erauzketa erraz, ugaritze altu eta osteo-
desberdintzeko ahalmena duten hortz mamiko zelula amak (DPSC) zelula autologoez
eginiko birsortze terapietarako aukera ona izan daitezke. Amaitzeko, plasmatik
eratorritako hazkuntza faktoreetan aberatsa den plasma (PRGF) eta plaketetan aberatsa
den fibrina (PRF) BSF-aren ordezkari onak izan daitezke in vitro zelula hazkundeetarako.
Plasmatik eratorritako produktu hauek paziente berberetik lortu daitezkeenez, immune
erantzun ez desiragarriak ekidingo lituzkete birsortze zelula terapietan.
53
Helburu nagusiak
Helburu nagusiak
Lan honen helburu nagusia, DPSC-en desberdintzapen osteoblastiko gaitasunak

bio-materialekin duen elkarreragina aztertzea da hezur ehun ingeniaritzarako. Helburu
hau lortzeko, Ti6AL4V zein BASTM titanio azalerak eta dezelularizatutako txerri ehun
adiposo-aren (pDAT) efektua ebaluatu dugu plasmatik eratorritako produktu eta
desberdintzapen osteoblastiko medioarekin konbinatua.
Helburu zehatzak
1. gDPSC-en bideragarritasun eta ugalketaren ebaluazioa Ti6AL4V eta BAS titanio

azaleretan haziak.
2. PRGF eta PRF produktu plasmatikoek gDPSC-en ugaritze eta desberdintzapen
osteoblastikoan duten eraginaren azterketa.
3. Plasmatik eratorritako produktuak, Ti6AL4V eta BAS titanioetan
desberdintzapen medioaren presentzian edo gabezian hazitako gDPSC-en
konbinazioak ugalketa eta desberdintzapen osteoblastikoan duten efektuen
ikerketa.
4. gDPSC eta gBMSC-en arteko ugalketa eta desberdintzapen osteoblastiko
gaitasunaren konparaketa Ti6AL4V eta BAS titanio azaleretan hazita
desberdintzapen medioaren presentzian edo gabezian.
5. gDPSC-en itsaspen eta bideragarritasunaren ebaluazioa dezelularizatutako ehun
adiposoan (DAT) haztean.
6. DAT scaffold-aren efektuen azterketa gDPSC-en desberdintzapen
osteoblastikoan osteo-desberdintzapen medioarekin konbinatuta.
57
Emaitzak
Emaitzak
gDPSC-en isolamendu, hazkuntza eta karakterizazioa fluxu zitometria bidez
Giza hortz muineko zelula amak (gDPSC) hirugarren haginetatik isolatu ziren eta
behi serum fetal (% 10), penizilina/estreptomizina (% 1) eta L-Glutamina-z (% 1)
osaturiko DMEM medioan hazi ziren. 2-3 aste eta gero, zelulek kolonia atxikitu anitzak
eratu zituzten, sub-konfluentzia lortuz. gDPSC-ek fibroblasto itxurako morfologia
erakusten dute hazkuntza kultiboetan; zelulek ezaugarri mantentzen dute ugaltze maila
altuarekin batera pase askotan (12. irudia).
A B
D E
12. irudia. gDPSC-en in vitro hazkuntza. gDPSC hazkuntzen fase kontraste mikroskopia irudiak egoera
sub-konfluente (A, D) eta konfluentean (B, E) handipen txiki eta handiarekon. (Irastorza et al., 2019)-tik
moldatua.
gDPSC-en markatzaile zelularren ebaluaketarako, fluxu zitometriaz analizatu

ziren zelula markatzaileak ondorengo CD-en (cluster of differentiation) antigenoen
aurkako antigorputzak erabiliz: CD45, CD73, CD90 eta CD105. gDPSC-ak negatiboak ziren
CD45 markatzaile hematopoietikoarentzako. Bestalde, positiboak ziren zelula ama
mesenkimalen markatzaile diren CD73 (% 100), CD90 (% 100) eta CD105-entzako (%
100). Emaitza hauekin, hortz mamiko zelula amen zelula ama mesenkimal fenotipoa
ondoriozta dezakegu (Gronthos et al., 2003) (13. irudia).
61
CD 45 A B CD 73
3.0% 100.0%
CD 90 D E CD 105
100.0% 99.9%
13. irudia. Fluxu zitometria bidezko gDPSCen ama zelula markatzaileak. Fluxu zitometriak erakutsi
duenez gDPSC-ak negatiboak ziren CD45 markatzaile hematopoietikoarentzat (A) eta positiboak CD73,
CD90 eta CD105 (B, D eta E) zelula ama mesenkimal markatzaileentzat. (Irastorza et al., 2019)-etik
moldatua.
Ekortze mikroskopio elektronikozko (SEM) Ti6AL4V eta BASTM titanio azaleren mikro-
topografia analisia
Zelulak gabeko titanio azaleren SEM irudiak (Ti6AL4V) zirrikitu paralelo kontzentrikoak
erakutsiz (14. irudia A, B), bestalde, titanio azalera latza (BASTM) hobi eta uniformeki
sakabanaturiko mikro-poro txikiak (< 10 µm) erakutsiz azalera guztian zehar (14. irudia
D, E).
62
Emaitzak
A B
Ti6AL4V
D E
BAS®
14. irudia. Ti6AL4V eta BAS titanio azaleren SEM irudiak. Ti6AL4V (A, B) eta BAS (D, E) titanio azaleren
ekortze mikroskopio elektronikoaren irudiak handipen txiki eta handiarekin. (Irastorza et al., 2019)-tik
moldatua.
gDPSC-en zelula atxikimendu, migrazio eta bideragarritasuna Ti6AL4V eta BAS TM

titanio azaleretan haztean
gDPSC-ak Ti6AL4V eta BASTM titanio azaleretan erein ziren 20,00 zelula/diskoko
dentsitatean 4 egunez. Zelulak sendoki atxikitu eta zabaldu ziren Ti6AL4V titanio
leunaren azaleran zehar. Zelulak, diskoaren zirrikitu kontzentrikoak jarraituz orientaturik
hazi ziren eta lamelipodio gisako zelula luzaketak erakutsi zituzten (15. irudia A).
Bestalde, BAS titanio azaleran hazitako gDPSC-ak beraien morfologia moldatu behar izan
zuten azalera porotsuan barneratzeko (15. irudia B). bi titanio azaleretan, zelulen
atxikimendua hazkuntza denbora guztian zehar mantendu zen.
Zelulen bideragarritasun eta heriotza entsegua egiteko, titanio azaleretan

hazitako gDPSC-ak kaltzeina-AM (fluoreszentzia berdea) eta propidio ioduroarekin
(fluoreszentzia gorria) kultibatu ziren. Fluoreszentzia irudiek erakutsi zutenez, gDPSC-ak
% 100 zeuden kaltzeinarekin tindatuak bi titanio diskoetan, hauen gainean hazitako
gDPSC-en bideragarritasun handia erakutsiz (15. irudia D, E). Hare gehiago, gDPSC-ek ez
63
zuten PI fluoreszentzia gorririk erakutsi, hazkuntza hauetan zelula heriotza ez zegoela

erakutsiz.
Azkenik, zelulen nukleoak fluoreszentzia urdinez (DAPI) tindatuak izan diren

irudietan ikusten denez, Ti6AL4V titanio azaleran zelulak zirrikituak jarraituz espiral
forman orientatzen zirela ikusi zen (15. irudia F), BAS titanioan aldiz, zelulek ez zuten
inolako orientazio lehentasunik erakutsi (15. irudia G).
A D F
Ti6AL4V
B E G
BAS®
15. irudia. Titanio azaleretan hazitako gDPSC-en bideragarritasun, orientazio, mobilitate eta SEM
irudiak. Ekortze mikroskopio elektronikoaren gDPSC-ak ereindako bi titanio azaleren irudiak (A, B). 4
egunez bi titanio azaleretan hazitako gDPSC-en fluoreszentzia irudiak bizirik dauden zelula (berde) eta
hildakoak (gorri) erakutsiz (D, E). Eskala barra: 100 µm. Nukleoak DAPI-z urdinez tindaturiko gDPSC-ak,
titanio disko osoko mosaiko fluoreszentzia irudietan. Ti6AL4V (F) eta BAS (G). Eskala barra: 2 mm.
(Irastorza et al., 2019)-tik moldatua.
Ti6AL4V eta BASTM titanio azaleretan hazitako gDPSC-en ugaritzearen azterketa PRGF-
arekin konbinatzean.
Ugaritzen hari diren zelulen kuantifikazio fotometriko/fluorimetrikoa ezin zen

egin titanio diskoen opakotasunarengatik. Honengatik, bideragarriak ziren zelulen
kopurua (interfase edo mitosian) nukleoen tindatzaile fluoreszente den DAPI-z
tindaturiko nukleoen kontaketaren bidez egin zen. Irudiek erakutsi zutenez, nukleoen
morfologia normala zen interfasean aurkitzen ziren zeluletan eta kromosoma
kondentsatuak ikus zitezkeen zelula mitotikoetan. Espero bezala, gDPSC gehienak
interfasean aurkitzen ziren, hala ere zelula batzuk mitosiaren etapa ezberdinetan
64
Emaitzak
zeuden, gehienak metasafe eta anafasean. Emaitza hauek, gDPSC-en ugaltze normala
erakusti zuten. Hala eta guztiz ere, gDPSC-ak PRGF solublearekin haztean, ugalketa
esanguratsuki areagotua zuten (% 20-tik % 50-raino; p < 0.05) 4 egunek hazkundearen
ostean kontrolekin alderatuta (16. Irudia G). Emaitza hauek erakusten dutenez, gDPSC-
ak plasmatik eratorritako osagarriekin titanio azaleretan haztean, zelula ugalketa
areagotuta dute. Emaitzan berresteko, Ki67 immunofluoreszentzi entsegua egin zen.
Ki67-arekin tindaturiko gDPSC-ak, bi titanio azaleretan PRGF-arekin haziak, kontatuak
izan ziren, berriz ere, ugaltzen hari diren zelula kopurua areagotua dagoela erakutsiz (16.
irudia A-F).
Kontrola PRGF ®
A B
Ti6AL4V
Ki67/ DAPI
D E
BAS®
F Ki67 kontaketa G DAPI kontaketa

2 * * 2 * *
Zelula kopurua
Zelula kopurua
1,5 1,5
1 1
0,5 0,5
0 0
Control Ti/PRGF Ti Control BAS/PRGF BAS Control Ti/PRGF Ti Control BAS/PRGF BAS
65
16. irudia. Titanio azaleren gainean PRGF-arekon hazitako gDPSC-en ugalketa entsegua. Ki67 ugalketa
markatzaile (berde) eta DAPI-z nukleoak markaturiko (urdin) gDPSC-en immunofluoreszentzi irudiak
baldintza kontroletan Ti6AL4V (A) eta BAS (D) titanio diskoetan, eta % 20 PRGF-rekin haziak Ti6AL4V (B)
eta BAS (E) diskoetan 4 egunez. PRGF tratamenduak Ki67+ zelulen kopurua handitu zuen. Barra eskala: 50
µm. Titanio azaleren gainean kontrol eta PRGF baldintzetan mitosian dauden zelulen (Ki67+) arteko
konparaketa (F) eta nukleo kopuru totalen konparaketa (DAPI; G). estatistikoki esanguratsua p < 0.05
denean. (Irastorza et al., 2019)-tik moldatua.
Ti6AL4V eta BASTM titanio azaleretan hazitako gDPSC-en fosfatasa alkalinoaren

aktibitatea
ALP aktibitate mailaren azterketa ohikoa da ama zelulen desberdintzapen

osteoblastiko goiztiarraren markatzaile bezala. Fosfatasa alkalino entzima beharrezkoa
da matrize extrazelularraren mineralizaziorako (Orimo, 2010). Desberdintzapen
osteoblastikoa bultzatzeko, Ti6AL4V eta BAS titanio diskoetan ereindako gDPSC-ak 7
egunez hazi ziren erabilpen zabaleko desberdintzapen osteoblastikoa bultzatzen duen
medioarekin. Hazkuntza medio hau dexametasona, azido askorbiko eta β-glizerol
fosfatoaz osatua dago (Winning et al., 2019). Gainera, plasmatik eratorritako bi
produktu ere, PRGF eta PRF, gehitu ziren medio hauetara. ALP aktibitate mailak
nabarmen handitu ziren titanio azaleretan osteo-desberdintzapen medioarekin hazitako
gDPSC-etan. Dena dela, naiz eta desberdintzapen medioarekin egon, PRGF-arekin hazi
ziren gDPSC-ek ez zuten fosfatasa alkalino aktibitatea handitu (17. irudia A, B). Emaitza
hauek PRGF-arekin hazitako DPSC-en ugaltze maila handituarekin bat datoz (16. irudia).
Bestalde, titanio leunaren gainean PRF-rekin hazitako gDPSC-ek kontrolekin alderatuta,
ALP aktibitatea areagotuta zuten. Gainera, desberdintzapen tratamendurik gabe ere,
BAS titanioan PRGF-rekin hazitako gDPSC-ek ALP aktibitatea handituta zuten kontrolekin
konparatuz. Lehen ikusi dugun PRGF-ak bultzaturiko zelula dentsitate handiaren ondorio
izan daiteke emaitza hau (16. irudia).
66
Emaitzak
A Kontrola PRGF PRF

Kontrola
Ti6AL4V
Desberdintzapena
Kontrola
BAS
Desberdintzapena
®
10
B 9
8
7
ALP absorbantzia
normalizatua
6
5
4
*
3
2
1
0
CL GL PL CDL GDL PDL CR GR PR CDR GDR PDR
Kontrola Desberdintzapena Kontrola Desberdintzapena
Ti6AL4V BAS
67
17. irudia. Bi titanio azaleretan, desberdintzapen osteoblastiko medioaren presentzia edo absentzian
eta plasmatik eratorritako produktuekin (PRGF eta PRF) hazitako gDPSC-en fosfatasa alkalino entsegua.
14 egunez Ti6AL4V eta BAS titanio diskoetan, desberdintzapen osteoblastikoaren presentzian edo
gabezian hazitako gDPSC-en fosfatasa alkalino tindaketa irudiak (A). ALP aktibitatearen kuantifikazio
normalizatua erakusten duen grafiak (B). akronimoen esanahia: C (kontrola), G (PRGF), P (PRF), D
(desberdintzapen medioa), L (Ti6AL4V titanioa) era R (BAS titanioa). Estatistikoki esanguratsua (*) p< 0.05
denean. Eskala barra: 1 mm. (Irastorza et al., 2019)-tik moldatua.
Ti6AL4V eta BASTM titanio azaleretan hazitako gDPSC-en desberditzapen osteogeniko

terminalaren Alizarin gorri tindaketa
Zelula amen desberdintzapen osteogenikoaren froga nagusia hezur matrize

nodulu kaltzifikatuen sorrera da. Tindaketa hau alizarin gorriaren bidez egin zen, zeinak
kaltzifikaturiko hezur nodulu extrazelularrak gorriz tindatzen dituen. gDPSC-ak
plastikoan, Ti6AL4V eta BAS titanio azaleretan erein eta desberdintzapen
osteogenikoaren presentzian edo gabezian hazi ziren 14 egunez alizarin gorri
tindaketaren aurretik. Mikroskopio estereoskopikoarekin ateratako irudiek erakusten
dutenez, ez zegoen alizarin gorri tindaketarik plastikoan kontrol medioarekin hazitako
gDPSC-etan. Bestalde, bi titanio azaleretan hazitako gDPSC-ek alizarin gorri tindaketa
lekuak erakutsi zituzten, kaltzifikaturiko hezur matrize gordailuei dagokiona. Hezur
matrize gordailu hauek maila makroskopikoan identifika daitezke kontrol kondizioetan,
BAS titanio azaleran kontsistenteagoa izanik (18. irudia D-K). Horregatik, alizarin gorri
tindaketak erakutsi duen bezala, gDPSC-en desberdintzapen osteoblastikoa bultzatzeko
titanio azaleren eragina nahikoa dela erakutsi dute. Kontrolekin alderatuta,
desberdintzapen osteoblastiko medioaren eraginak, tindaturiko matrize depositu
gordailuetan ez zuela handipen osagarririk sortu ikusi zen gDPSC-ak titanio gainean
haztean. Desberdintzapen osteoblastikoarekin hazitako gDPSC-en kaltzio deposituak
intentsitate handiagoarekin tindatuta zeudela ematen zuen, batez ere BAS titanioan (18.
irudia J, K). Desberdintzapen osteoblastikoaren efektuen frogarik handiena, plastiko
gainean hazitako gDPSC-etan aurkitu zen. Baldintza honetan, dexametasona, azido
askorbiko eta β-glizerol fosfatoz osaturiko desberdintzapen koktelak hezur matrize
68
Emaitzak
mineralizatu gordailuen handipena erakutsi zuten kontrolekin konparatuta (18. irudia A,

B).
Kontrola Desberdintzapena
A B
D E
Ti6AL4V
F G
H I
BAS®
J K
69
18. irudia. Ti6AL4V eta BAS titanio azaleretan hazitako gDPSC-en alizarin gorri tindaketa. 14 egunez,
baldintza kontroletan alizarin gorriz tindatutako hezur matrize gordailuak plastikoan (A), Ti6AL4V (D, F)
eta BAS-ean (I, F) haziak, desberdintzapen osteoblastikoarekin trataturiko plastiko (B), Ti6AL4V (E, G) eta
BAS-etan (J, K) hazitako gDPSC-ekin konparatuta. Eskala barra (A, B): 100 µm; (D, E, H eta I): 2 mm; (F, G,
J eta K): 0.5 mm. (Irastorza et al., 2019)-tik moldatua.
PRGF eta PRF osagarrien efektua desberdintzapen osteoblastikoarekin BAS TM titanio

azaleran hazitako gDPSC-engan
Bi titanio azaleretan hezur-sortzaileak diren zeluletara desberdintzeko gDPSC-en

gaitasuna ikusi ostean, PRGF eta PRF-ak gDPSC-en desberdintzapenean duen efektua
aztertu genuen. Efektu hau aztertzeko, BAS titanio azalera gainean desberdintzapen eta
kontrol medioekin hazitako gDPSC-ei PRGF eta PRF gehitu zitzaien 21 egunez. gDPSC-ek
sorturiko hezur matrize gordailuak baldintza guztietan aurkitu ziren PRGF eta PRF-arekin
edo hauen gabezian haziak egonik ere. Hala ere, tindaturiko nodulu mineralizatuen
gutxiagotzea nabarmena zen PRGF-arekin hazitako hDPSC-en bi baldintzetan (19. irudia
A). bestalde, naiz eta ez erakutsi mineralizatutako noduluen kantitate handiagorik, PRF-
rekin hazitako gDPSC-ek intentsitate handiagoko hezur matrize deposituak sortu
zituzten. Emaitza hau kuantifikazio fotometrikoaren bidez egiaztatu zen alizarin gorri
prezipitatuen disolbaketari esker (19. irudia B).
A Kontrola PRGF PRF

Kontrola
Desberdintzapena
70
Emaitzak
2,5
ARS absorbantzia normalizatua
*
2
1,5
*
0,5
0
CR GR PR CDR GDR PDR
19. irudia. PRGF eta PRF-arekin BAS titanio azalera gainean hazitako gDPSC-en alizarin gorri tindaketa
eta kuantifikazio fotometrikoa. Desberdintzapen eta control medioak eta PRGF eta PRF-rekin BAS titanio
azalera gainean hazitako gDPSC-en alizarin gorri tindaketa 21 egunen ostean (A). Alizarin gorriaren
kuantifikazio fotometriko normalizatua (B). Akronimoen esanahia: C (kontrola), G (PRGF), P (PRF) eta D
(desberdintzapen medioa). Estatistikoki esanguratsua (*) p< 0.05 denean. Eskala barra: 250 µm. (Irastorza
et al., 2019)-tik moldatua.
Ti6AL4V eta BASTM titanio azaleretan PRGF eta PRF-rekin edo hauen gabezian hazitako
gDPSC-en desberdintzapen markatzaileen azterketa RT-QPCR-bidez
Alizarina gorriz eginiko hezur matrize deposituen tindaketak, gDPSC-en

desberdintzapen osteoblastikoa erakutsi zuen PRGF eta PRF-arekin haztean. Hala ere,
plasmatik eratorritako produktuek gDPSC-en desberdintzapen osteoblastikoaren
seinalizazio bideei nola eragiten zien ez zegoen garbi. Galdera honi argia bota nahian,
desberdintzapen osteoblastikoaren etapa ezberdinetan inplikatuta dauden gene
markatzaileak aukeratu ziren. Gene markatzaile multzo hau Kolageno I (hezur matrize
extrazelularraren konposatu organiko nagusia), RUNX2 (osteoblasto heldugabe
71
markatzailea), SPARC (osteonektina, tarteko osteoblasto jariatzaile markatzailea) eta

OSTERIX/SP7-z (osteoblasto heldu markatzailea) osaturik zegoen.
RT-QPCR-aren emaitzek erakutsi zutenez, nahiz eta gDPSC-ak desberdintzapen

osteoblastiko mediorik bage hazi, Kolageno I, RUNX2, SAPRC eta OSTERIX adierazten
zituzten bi titanio azaleretan haztean (20. irudia). Gainera, PRGF edo PRF-arekin hazitako
gDPSC-ek, baldintza gehienetan markatzaile hauen adierazpenak handituak zituzten.
Kontrol eta plasmatik eratorritako produktuak zituzten medioen arteko Kolageno I-en
adierazpen konparaketak, nolabaiteko aldakortasuna erakutsi zuen. Hala eta guztiz ere,
PRGF eta PRF-rekin hazitako gDPSC-ek RUNX2 eta SPARC markatzaileen adierazpen
handipen sendoa erakutsi zuten. Bi markatzaile hauen artean, SPARC aipatu behar
genuke bereziki, honen adierazpen maila PRGF eta PRF baldintzetan 6-11 aldiz handituta
zegoen kontrolekin alderatuz, desberdintzapen osteoblastikoaren presentzi edo
gabeziko baldintzetan (20. Irudia). gDPSC-ek RUNX2 eta SPARC markatzaile pre-
osteoblastikoen adierazpena handituta zuten arren PRGF eta PRF-ren desberdintzapen
osteoblastikoren efektu bultzatzaileari esker, ezberdintasun interesgarriak aurkitu ziren
bi plasmatik eratorritako produktu hauen artean. RUNX2 eta SPARC-en adierazpen
handipenak pentsatuarazi zigutenaren kontra, OSTERIX osteoblasto helduen
markatzailea PRF baldintzetan bakarrik zegoen handituta. Garrantzitsua da, kontrol
baldintzetan Kolageno I, RUNX2 eta SPARC-en adierazpena aurkitu daitekeela esatea,
naturalki egoera osteoblastiko pre-desberdintzatuan daudelarik. Nabarmena zen
OSTERIX gene adierazpenaren handipen esanguratsua (10-30 aldiz) PRF-a zuten
baldintzetan, desberdintzapen osteoblastikoa eduki edo ez eduki arren (20. irudia E).
Dena dela, garrantzitsua da aipatzea PRGF-rekin hazitako balditzek ez zutela markatzaile
honen adierazpena handitu, baizik eta kontrol baldintzetako adierazpen maila baino
txikiagoak zituztela.
72
Emaitzak
Kolageno I RunX2
A B
* *
3,5
mRNA Fold Change
mRNA Fold Change

3,5
3 3
2,5 2,5
2 2
1,5 1,5
1 1
0,5 0,5
0 0
D SPARC Osterix
** E
16 ** 35
*
mRNA Fold Change
mRNA Fold Change

14 30
12 25
10
20
8
6 15
4 10 **
2 5
0 0
20. irudia. Ti6AL4V eta BASTM titanio azaleretan, PRGF eta PRF-arekin edo haue gabezian hazitako
gDPSC-en desberdintzapen osteoblastikoaren gene adierazpenen QPCR-a. 14 eguneko hazkuntza eta
gero eginiko Kolageno I, RUNX2, SPARC eta OSTERIX-en mRNA adierazpen normalizatua. Estatistikoki
esanguratsua (*p< 0.05) eta (**p< 0.01) denean. Akronimoen esanahia: C (kontrola), D (desberdintzapen
medioa), L (Ti6AL4V), R (BAS), G (PRGF) eta P (PRF). (Irastorza et al., 2019)-tik moldatua.
gDPSC eta gBMSC-en Kaspasa 3 bidezko zelula heriotz konparaketaren azterketa

Ti6AL4V eta BASTM titanio azaleretan haziak 24 eta 48 orduz
BMSC-ak ongi ikerturiko desberdintzapen osteoblastiko gaitasuna duten MSC-ak

dira. Gaur egun, hezur birsortze terapietan erabiltzeko zelula ama aukerarik aproposena
ez dago oraindik garbi. Honengatik, bi zelula mota hauen arteko bideragarritasun,
ugaltze eta desberdintzapen osteoblastikoaren arteko ikerketa konparatiboa gauzatu
genuen. Kaspasa 3, apoptosiari esker gertatzen den zelula heriotza markatzailea da.
gDPSC eta gBMSC-engan titanio azaleren eragin ditzaketen heriotza zelular
ezberdintasunak aztertzeko, 24 eta 48 orduz hazi genituen bi zelula mota hauek titanio
73
azaleren gainean. Denbora hau igaro ondoren, immunofluoreszentzi entseguak egin

ziren zelula apoptotikoak antzemateko (Kaspasa 3+). Emaitzek erakutsi zutenez, bi
titanio azalerek ez zuten inolako eragin zitotoxikorik izan gDPSC eta gBMSC-engan 24
eta 48 ordu igaro ostean. Zelula apoptotiko bat edo bi bakarrik aurkitu ziren titanio disko
osoan bi zelula motetan, zelula heriotza tasa % 0.1 baina txikiagoa izanik. Zelulek
nukleoak DAPI- tindatu ziren fluoreszentzia urdinez (21. irudia).
24H Kristala Ti6AL4V BAS

BMSC
DPSC
48H
BMSC
DPSC
21. irudia. 24 eta 48 orduz kristal, Ti6AL4V eta BAS titanio azaleren gainean hazitako gDPSC eta gBMSC-
en Kaspasa 3 heriotza zelular markatzailearen immunofluoreszentzia irudiak. Kristal, Ti6AL4V eta BAS
titanio azaleretan hazitako gDPSC eta gBMSC-en Kaspasa 3 heriotza zelular markatzaile (berde) eta DAPI
tindatzaile nuklearraren (urdin) immunofluoreszentzi irudiak 24 eta 48 orduren ostean. Bi titanio azalerek
eragin zitotoxikorik ez zutela erakutsi zuten irudiek, bi zelula motetan Kaspasa 3 positibo diren zelula
bakarrak aurkituz titanio disko osoan. Eskala barra: 100 µm.
74
Emaitzak
Ti6AL4C eta BASTM titanio azaleretan 24 eta 48 orduz hazitako gDPSC eta gBMSC-en
arteko ugalketa konparazio ikerketa
Kristal, Ti6AL4V eta BAS titanio diskoen gainean 24 eta 48 orduz hazitako gDPSC
eta gBMSC-en arteko ugaltze ezberdintasunak ikertzeko, immunofluoreszentzi ikerketa
egin zen zelula ugalketaren markatzaile den Ki67 (berde) eta DAPI nukleo markatzailea
(urdin) antzemateko. Titanio diskoen opakotasunaren ondorioz, zelula kopuru totala
(DAPI+) eta zelula proliferatzaile kopuru totala (Ki67+), eskuz kontatuz lortu ziren.
Espero bezala, bi zelula moten gehiengoak interfasean ageri ziren, hala ere,
ezberdintasun interesgarriak aurkitu ziren kristal gainean hazitako gDPSC eta gBMSC-en
artean, eta baita titanio azaleren gainean hazitakoen artean ere (22. irudia A). Ki67/DAPI
normalizatuaren grafiketan ikus zitzkenez, 24 orduren ondoren ezberdintasun
esanguratsuak daude gDPSC eta gBMSC-en ugalketa proportzioen artean kristal
gainean, gDPSC-ek izanik ugaltze mailarik handiena. Proportzio hau ere handiagoa zen
gDPSC-etan Ti6AL4V eta BAS titanio diskoetan haztean ere, zertxobait handiagoa izanik
Ti6AL4V titanioan bi zelula motetan BAS titanioan baino. 48 orduko hazkundearen
ostean, gDPSC eta gBMSC-en ugalketa maila berdindu egin zela ikusi zen kristalean eta
ez zen ezberdintasun estatistikorik aurkitu. Dena dela, Ti6AL4V titanioan, gDPSC-ek
gBMSC-ak baina ugalketa maila handipen esanguratsua zutela frogatu zuten. Azkenik,
BAS titanio azalerak ere emaitza interesgarriak erakutsi zituen, gDPSC-en ugalketa maila
gBMSC-ena baino handiagoa izanik estatistikoki. Gainera, hDPSC-en ugalketa maila
kontrol baldintzarenarekin parekatzea lortu zuten. Bestalde, gBMSC-ek BAS titanioaren
gainean, 24 ordutan baino ugaltze maila txikiagoa erakutsi zuten, esperimentu osoko
mailarik txikiena erakutsiz (22. irudia B).
75
A Kristala Ti6AL4V BAS

BMSC
24H
DPSC
BMSC
48H
DPSC
B Ki67/DAPI Ki67/DAPI
* 24H 48H *
2,5 1,4
Ki67/DAPI normalizatua
Ki67/DAPI normalizatua
1,2
2 *
1
1,5 0,8
1 0,6
0,4
0,5
0,2
0 0
Coverslips Ti6AL4V BAS Coverslips Ti6AL4V BAS
BMSC DPSC
76
Emaitzak
22. irudia. Kristal, Ti6AL4V eta BAS titanio azaleretan 24 eta 48 orduz hazitako gDPSC eta gBMSC-en
arteko ugaritze ikerketa. Immunofluoreszentzia mikroskopio bidez ateratako gDPSC eta gBMSC-en Ki67
ugalketa markatzaile (berde) eta DAPI nukleo markatzaileen (urdin) irudiak 24 eta 48 orduren ostean (A).
azalera ezberdinetan hazitako bi zelula moten ugalketa ratioaren grafika (B). Eskala barra: 100 µm.
Estatistikoki esanguratsua (*p< 0.05) denean.
Ti6AL4V eta BASTM titanio azaleren gainean desberdintzapen osteoblastiko medioaren

presentzian edo gabezian hazitako gDPSC eta gBMSC-en SPARC eta Osterix
desberdintzapen osteoblastiko markatzaileen immunofluorezentzia entsegua
Desberdintzapen osteoblastiko markatzaileen adierazpena ikertzeko, gDPSC eta

gBSC-ak bi titanio azaleren gainean erein ziren eta desberdintzapen medioaren
presentzian edo gabezian hazi ziren 14 egunez. Fijaketaren ondoren,
immunofluoreszentzi entsegua egin zen Osteonektina (SPARC) eta Osterix detektatzeko.
Bi zelula moten nukleoak DAPI-z tindatu ziren. 14 egun ondoren ikusi genuen bezala, bi
zelula motek SPARC adierazten zuten hazkuntza medio guztietan (23. irudia). SPARC-ek
zitosolean lokalizaturik zegoela ematen zuen, nukleoen inguruan kongretatua. Gainera,
Ti6AL4V titanioan desberdintzapen medioarekin hazitako gBMSC-ak bakarrik erakutsi
zuten nolabaiteko SPARC adierazpen handipena. Dena dela, Osterix-en adierazpena
handiagoa zen gBMSC-etan gDPSC-ekin alderatuz baldintza guztietan (24. irudia). SPARC
ez bezala, Osterix (transkripzo faktorea) nukleoan lokalizaturik zegoen. Nahiz eta Osterix
gBMSC-etan gehiago adierazita egon, zelula hauek ez zuten ezberdintasun handirik
erakutsi kontrol eta tratamendu osteoblastikoren artean, gDPSC-ek berriz,
desberdintzapen osteoblastiko medioarekin hazi ondoren Osterix-en adierazpena
handitu zuten.
77
Ti6AL4V
BMSC
BAS
Ti6AL4V
DPSC
BAS
23. irudia. Ti6AL4V eta BASTM titanio azaleren gainean desberdintzapen osteoblastiko medioaren
presentzian edo gabezian hazitako gDPSC eta gBMSC-en SPARC desberdintzapen osteoblastiko
markatzailearen immunofluorezentzia irudiak. Bi titanio azaleretan hazi ziren gDPSC eta gBMSC-ak
desberdintzapen osteoblastiko medioaren presentzian eta gabezian 14 egunez. Fijaketaren ondoren,
SAPRC desberdintzapen osteoblastikoaren markatzailea (berde) eta DAPI-z zelulen nukleoak (urdin)
tindatu ziren. Eskala barra: 100 µm.
78
Emaitzak
Ti6AL4V
BMSC
BAS
Ti6AL4V
DPSC
BAS
24. irudia. Ti6AL4V eta BASTM titanio azaleren gainean desberdintzapen osteoblastiko medioaren
presentzian edo gabezian hazitako gDPSC eta gBMSC-en Osterix desberdintzapen osteoblastiko
markatzailearen immunofluorezentzia irudiak. Bi titanio azaleretan hazi ziren gDPSC eta gBMSC-ak
desberdintzapen osteoblastiko medioaren presentzian eta gabezian 14 egunez. Fijaketaren ondoren,
Osterix desberdintzapen osteoblastikoaren markatzailea (berde) eta DAPI-z zelulen nukleoak (urdin)
tindatu ziren. Eskala barra: 100 µm.
79
Ti6AL4V eta BASTM titanio azaleretan hazitako gDPSC eta gBMSC-en mineralizaturiko
hezur matrize gordailuen konparaketa Alizarina gorriaren bidez
Kaltzifikaturiko hezur matrize nodulu extrazelularrak, erabat desberdintzatutako

zelula osteoblastikoen berrespena dira. Gordailu hauek Alizarina gorriari esker tindatu
ziren, laranja(gorri kolorea lortuz. gDPSC eta gBMSC-ak plastiko, Ti6AL4V eta BAS
titanioetan hazi ziren 21 egunez desberdintzapen osteoblastiko medioaren presentzian
edo gabezian. Orokorrean, gDPSC-ek gBMSC-ak baina mineralizazio handiagoa erakutsi
zuten baldintza guztietan, baina ez zen nahikoa izan estatistikoki esanguratsua izateko.
Hala ere, mineralizazio handipenik aipagarriena desberdintzapen osteoblastiko
medioarekin bi titanio azaleren gainean hazitako hDPSC-ek erakutsi zuten (25. irudia),
baina errepikatua izan behar da ondorio sendoak lortzeko. Hare gehiago, bi titanio
azaleretan hazitako hDPSC hauek izan ziren kontrolekiko mineralizazio handipena
erakutsi zuten baldintza bakarrak. Emaitza hauek, titanio azalerek gDPSC-en
desberdintzapen osteoblastikoan zuten eragin areagotzailea erakutsi zuten. Alizarina
gorriz nodulu kaltzifikatuak tindatu ostean, azido azetikoz disolbatu ziren plaka irakurle
batez neurtua izateko.
Normalized Alizarin red absorbance
3,5
2,5 BMSC
2 DPSC
1,5
0,5
80
Emaitzak
25. irudia. Ti6AL4V eta BASTM titanio azaleretan hazitako gDPSC eta gBMSC-en mineralizaturiko hezur
matrize gordailuen Alizarina gorriaren absorbantzia grafikoa. 21 egunez hazi ondoren, hezur matrize
extrazelular gordailuak Alizarin gorriz tindatu ziren, honen ostean, Alizarina azido azetikoan disolbatu zen
eta plaka irakurle batez neurtu zen absorbantzia.
Plastiko, Ti6AL4V eta BASTM titanio azaleretan desberdintzapen osteoblastiko

medioaren presentzian edo gabezian hazitako gDPSC eta gBMSC-en RNA
sekuentziazioa
Desberdintzapen osteoblastiko prozesuan parte artzen duten gene ezberdinen

eta gene bideen erregulazio positibo edo negatiboa aztertzeko, gDPSC-ak eta gBMSC-ak
plastiko, Ti6AL4V eta BAS titanio diskoetan hazi ziren 14 egunez desberdintzapen
osteoblastiko medioaren presentzian edo gabezian. Hazkuntzaren ondoren, zelulak
desitsatsi eta RNA atera genuen Qiagen-en RNA estrakzio kit-a erabiliz eta Illumina-z
sekuentziatu genuen Zürich Unibertsitateko Genomika Zentroan, lagin bakoitzeko
25.000 RNA irakurketa lortuz. Lorturiko datuak “Pathway Enrichment Analysis” bidez,
“The Connectivity Map” (CMAP) eta “Biological Process Gene Ontology” (GOBP) datu
baseak erabiliz analizatu zen CIC bioBuneko Genoma Analisi Plataforman.
Ezberdin adierazitako geneen ikerketa konparatiboan zentratu ginen,

presentzia/ gabezia (ON/OFF) kriterioa jarraituz baldintza esperimental ezberdinen
artean. 10 irakurketa gordinetan ezarri genuen gene baten adierazpen positibo (ON)
muga. Baldintza ezberdinen konparaketetan atera ziren ezberdin adierazitako geneen
kantitateak (2. taula).
Comparative conditions Genes

DPSC-C-FLASK VS BMSC-C-FLASK 69
DPSC-C-FLASK VS DPSC-C-TI 7
BMSC-C-FLASK VS BMSC-C-TI 16
BMSC-C-TI VS BMSC-C-BAS 23
DPSC-C-FLASK VS DPSC-T-FLASK 34
BMSC-C-FLASK VS BMSC-T-FLASK 43
DPSC-C-FLASK VS DPSC-T-TI 17
DPSC-T-TI VS DPSC-T-BAS 1
BMSC-C-FLASK VS BMSC-T-TI 64
BMSC-T-TI VS BMSC-T-BAS 35
81
2. taula. Baldintza batean adierazita eta bestean adierazi gabe dauden geneen kantitateak erakusten
dituen taula. Adierazitako geneen kantitate patroi ezberdinak aurkitu ziren baldintza ezberdinak
alderatzean. Laburdurak: DPSC: hortz mamiko zelula amak; BMSC: hezur muineko zelula amak; C: kontrol
medioa; T: desberdintzapen osteoblastiko medioa; Flask: plastiko azalera; TI: Ti6AL4V titanioa eta BAS:
“Biomimetic Advanced Surface” titanioa.
Baldintza ezberdinen arteko geneen ON/OFF analisi konparaketak emaitza

interesgarriak erakutsi zituen. Plastiko gainean kontrol medoarekin hazitako gBMSC-ek
HOX gene anitz adierazi zituzten gDPSC-ekin konparatuta (3. taula). Gainera,
desberdintzapen osteoblastikoan bereziki inplikatuta dauden SPARC, OSTERIX/SP7 eta
ZBTB16 geneen adierazpena handituta aurkitu zen bi zelula motetan desberdintzapen
osteoblastiko medioarekin eta/edo titanio gainean haztean (3. taula). Garrantzitsua da
ZBTB16-ren kasua aipatzea, hau izan delako desberdintzapen osteoblastiko pean
(tratamendu farmakologikoa eta/edo titanioa) hazitako bi zelula motetan (gDPSC eta
gBMSC) adierazi den genea, osteogenesi prozesuan eduki dezakeen rol garrantzitsua
iradokiz. Azkenik, neurotrofina errezeptore eta gDPSC-en “amatasun” markatzaile den
NTRK3 eta erlazionaturiko GFRA2 geneak kontrol baldintzetan adierazita zeuden, baina
adierazpen hau itzali egin zen titanioan desberdintzapen osteoblastiko medioarekin
haztean (3. taula).
Identifier Gene- Description DPSC-C- BMSC-C-

name FLASK FLASK
DPSC-C- ENSG00000037965 HOXC8 homeobox C8 0 76
FLASK VS
BMSC-C-
FLASK
ENSG00000106511 MEOX2 mesenchyme 0 185
homeobox 2
ENSG00000170370 EMX2 empty spiracles 0 19
homeobox 2
ENSG00000175879 HOXD8 homeobox D8 0 21
82
Emaitzak

DPSC-C- DPSC-C-
Flask Ti
DPSC-C- ENSG00000170374 SP7 Sp7 transcription factor 0 71
FLASK VS
DPSC-C-
TI
DPSC-C- DPSC-T-
Flask Flask
DPSC-T-
FLASK
tyrosine kinase 3
ENSG00000168546 GFRA2 GDNF family receptor 107 0
alpha 2
BMSC-C- BMSC-T-
Flask Flask
BMSC-C- ENSG00000109906 ZBTB16 zinc finger and BTB 0 673
BMSC-T-
FLASK
DPSC-C- DPSC-T-
Flask Ti
DPSC-T-
TI
tyrosine kinase 3
ENSG00000170374 SP7 Sp7 transcription factor 0 51
BMSC-C- BMSC-T-
Flask Ti
BMSC-C- ENSG00000107742 SPOCK2 SPARC (osteonectin), 0 10
FLASK VS cwcv and kazal like
BMSC-T- domains proteoglycan
TI 2
ENSG00000152583 SPARCL1 SPARC like 1 0 45
3. taula. Baldintza ezberdinen arteko konparaketen gene adierazpen ezberdintasunak. Laburdurak:

DPSC: hortz mamiko zelula amak; BMSC: hezur muineko zelula amak; C: kontrol medioa; T:
desberdintzapen osteoblastiko medioa; Flask: plastiko azalera; TI: Ti6AL4V titanioa eta BAS: “Biomimetic
Advanced Surface” titanioa.
83
Gene adierazpen indibidualen konparaketez gain, gene bideen aberaste analisia

egin genuen “The Connectivity Map” (CMAP) eta “Gene Ontology enrichment” (GO)
datu baseak erabiliz. Alde batetik, CMAP-ek transkripzio adierazpen datuak erabiltzen
ditu zelula fisiologia, gaixotasun eta terapiekin erlazionatzeko. Beste alde batetik, GO-k
ontologia erabiltzen du gene eta beraien produktuen esanahi biologikoa lortzeko.
Analisiak hiru kategoriatan banatuta daude: osagai zelularra (CC), prozesu biologikoak
(BP) eta funtzio molekularra (MF). Ikerketa honetan, GOBP erabili dugu gene bidean
analizatzeko (4 eta 5. taulak). CMAP zein GOBP-z eginiko analisiek baldintza
esperimental ezberdinen artean aldatuta egon daitezkeen gene bide eta prozesuak
erakusten dizkigute, erlazionaturiko probabilitate balioa (p) eta gene bideen gene
kopuru totaletik (Size) ezberdin adierazitako geneak (Count) erakutsiz gene bide
bakoitzean. Gene bide bakoitzean ezberdin adierazitako geneen kopuru minimoa 2-an
ezarri genuen eta esanguratasun estatistikoa (p< 0.05-ean).
CMAP ID Size Count pvalueadj Genes Description

DPSC-C- ALCALAY_AML_NP 133 8 6.98724e-09 COCH, HOXA1, Genes up-regulated
FLASK MC_UP HOXA10, HOXA5, in acute myeloid
VS HOXA7, HOXB3, leukemia (AML)
BMSC- HOXB6, HOXB7
C-FLASK
VERHAAK_AML_NP 173 7 1.16885e-06 EREG, HOXA10, Genes up-regulated
M1_MUT_VS_WT_ HOXA5, HOXA7, in acute myeloid
UP HOXB3, HOXB6, leukemia (AML)
TNFSF10
TAKEDA_NUP8_HO 125 6 3.89713e-06 EREG, HOXA3, Hematopoietic
XA9_16D_UP HOXA5, HOXA7, disorder
HOXB3, TNFSF10
BOQUEST_CD31PL 552 8 0.000117134 BST2, CHI3L1,
US_VS_CD31MINU COCH, CSF2RB,
S_UP DOK5, HOXB7,
STEAP4, TNFSF10
TAKEDA_NUP8_HO 143 5 0.000184436 BST2, HOXA3, effects of NUP98-
XA9_3D_UP HOXA5, HOXA7, HOXA9 on gene
HOXB3 transcription at 3
days after
transduction UP
XA9_6H_UP HOXB3, HOXC6 HOXA9 on gene
transcription at 6
84
Emaitzak
hours after
transduction UP
transcription at 8
days after
transduction UP
transcription at 10
days after
transduction UP
DPSC-C- BASSO_GERMINAL 93 3 0.0191607 BATF, BCL2A1, Gene up-regulated
FLASK _CENTER_CD40_UP HLA-DQB1 by CD40 signaling
VS in Ramos cells
DPSC-T-
FLASK
CMV_HCMV_TIME 25 2 0.0377068 RSAD2, TNFSF10 Genes up-regulated
COURSE_12HRS_U after infection with
P HCMV at 12 h
VERHAAK_AML_NP 173 3 0.040305 BCL2A1, Genes up-regulated
M1_MUT_VS_WT_ SERPINA1, in acute myeloid
UP TNFSF10 leukemia (AML)
CARIES_PULP_UP 200 3 0.0462674 BCL2A1, HLA- Immune/cytokine
DQB1, SERPINA1 response
4. taula. Gene bideen aberastasun analisia “The Connectivity Map”-ez (CMAP) egina. Plastiko eta titanio
azaleren gainean desberdintzapen osteoblastiko medioaren presentzian edo gabezia hazitako gDPSC eta
gBMSC-en gene bideen aberaspen analisi konparatiboa. Taulan agertzen ez diren konparaketak ez zuten
ezarritako n= 2 eta p< 0.05 eskakizuna bete. Laburdurak: DPSC: hortz mamiko zelula amak; BMSC: hezur
muineko zelula amak; C: kontrol medioa; T: desberdintzapen osteoblastiko medioa; Flask: plastiko azalera;
TI: Ti6AL4V titanioa eta BAS: “Biomimetic Advanced Surface” titanioa.
GOBP ID Size Count pvalueadj Genes Description

DPSC-C- GO:0009952 104 12 1,32926E-12 HOXA1, HOXA5, HOXA7, anterior/posterior
FLASK VS HOXA10, HOXB3, pattern
BMSC-C- HOXB6, HOXB7, HOXC6, specification
FLASK HOXC8, HOXC9,
HOXC10, HOXC11
GO:0048704 80 7 8,00122E-06 HOXA1, HOXA5, HOXA7, embryonic
HOXB3, HOXB6, HOXB7, skeletal system
HOXC9 morphogenesis
GO:0009792 607 13 9,5092E-05 HOXA1, HOXA5, HOXA7, embryo
HOXB3, HOXB6, HOXB7, development
HOXC6, HOXC9,
85
HOXC11, MEOX2, PITX2, ending in birth or

TBX18, HEY2 egg hatching
GO:0001568 531 10 0,00607727 CHI3L1, EREG, HOXA1, blood vessel
2 HOXA3, HOXA5, HOXA7, development
HOXB3, MEOX2, PITX2,
HEY2
GO:0065007 7094 38 0,00910242 BST2, CHI3L1, CSF2RB, biological
5 CSTA, EREG, HAS1, regulation
HOXA1, HOXA3, HOXA7,
HOXA9, HOXA10,
HOXC10, HOXC11,
HOXD8, LSP1, MEOX2,
OPCML, PITX2, SIM1,
ZIC1, TNFSF10, WISP3,
TBX18, RASSF9, ABCC9,
CNKSR2, DOK5, SUCNR1,
HHIP, EBF2, NDNF,
FOXP2
GO:0032774 3408 26 0,01596934 EREG, HOXA1, HOXA3, RNA biosynthetic
HOXA5, HOXA7, HOXA9, process
HOXA10, HOXB3,
HOXC10, HOXC11,
HOXD8, MEOX2, PITX2,
SIM1, ZIC1, TBX18,
HEY2, EBF2, SPX, FOXP2
GO:0072358 414 8 0,01691315 CHI3L1, EREG, HOXA1, cardiovascular
5 HOXA3, HOXA5, HOXA7, system
HOXB3, MEOX2 development
GO:0009954 30 3 0,02275033 HOXA10, HOXC10, proximal/distal
7 HOXC11 pattern formation
DPSC-C- GO:0042755 26 2 0,02335918 LEP, TACR1 eating behavior
FLASK VS 4
DPSC-C-
TI
GO:0046887 93 2 0,03149338 LEP, TACR1 positive regulation
5 of hormone
secretion
GO:0050880 127 2 0,03149338 LEP, TACR1 regulation of
5 blood vessel size
GO:0002520 737 3 0,04081726 LEP, RSAD2, SP7 immune system
7 development
GO:0050867 258 2 0,04102342 HLA-DQB1, TACR1 positive regulation
of cell activation
GO:0009914 281 2 0,04869166 LEP, TACR1 hormone
6 transport
BMSC-C- GO:0010719 22 2 0,02250505 LDLRAD4, TBX5 negative
FLASK VS 5 regulation of
86
Emaitzak
BMSC-C epithelial to
TI mesenchymal
transition
BMSC-C- GO:0035912 5 2 0,04224312 HEY2, DLL4 dorsal aorta
FLASK VS 7 morphgenesis
BMSC-T-
FLASK
DPSC-C- GO:0060218 13 2 0,02773949 BATF, SP7 hematopoietic
FLASK VS 1 stem cell
DPSC-T- differentiation
TI
5. taula. Gene bideen aberastasun analisia “Gene Ontology Biological Process”-ez (GOBP) egina. Plastiko
eta titanio azaleren gainean desberdintzapen osteoblastiko medioaren presentzian edo gabezia hazitako
gDPSC eta gBMSC-en gene bideen aberaspen analisi konparatiboa. Taulan agertzen ez diren konparaketak
ez zuten ezarritako n= 2 eta p< 0.05 eskakizuna bete. Laburdurak: DPSC: hortz mamiko zelula amak; BMSC:
hezur muineko zelula amak; C: kontrol medioa; T: desberdintzapen osteoblastiko medioa; Flask: plastiko
azalera; TI: Ti6AL4V titanioa eta BAS: “Biomimetic Advanced Surface” titanioa.
Dezelulaturiko txerri ehun adiposoa (pDAT) apar solido bezala prozesatuaren SEM
irudiak
Txerrien ehun adiposoa erauzi ondoren, dezelularizazioa isopropanol eta Tritoi

X-100 erabiliz gauzatu zen, garbigarri ez ionikoa. Dezelularizazio prozesua amaitzean,
scaffold biologiko moduan in vitro zelulek hazkuntzetan erabilia izateko, apar solidoa
izozte-lehortze metodoaren bidez eratu zen (26. irudia A, B). SEM irudiek
interkonektibitate handiko egitura porotsua frogatu zuten. 50 eta 100 µm-en arteko
poroek tamaina zutelarik (26. irudia C, D).
A B
C D
87
26. irudia. In vitro erabilerarako dezelularizaturiko txerri ehun adiposoaren egitura porotsua SEM
irudietan. In vitro zelulekin konbinatuta erabiltzeko dezelularizaturiko txerri ehun adiposoaren irudi
makroskopikoa (A, B). pDAT-ren SEM irudian 50-100 µm arteko poro tamainak erakutsiz (C, D).
Plastiko eta pDAT-n ereindako gDPSC-en bideragarritasunaren azterketa Kaltzeina-

AM/ propidio ioduroaren bidez
pDAT-ren eragin zitotoxikoa baztertzeko, 15.000 gDPSC zelula erein ziren bai
hobitxo hutsetan (plastikoa) eta baita pDAT apar solidoetan 4 egunez. Zelulen
bideragarritasun entsegua gDPSC-ak, Kaltzeina-AM (fuoreszentzia berdea) zelula bizien
tindatzailearekin eta propidio ioduro (fluoreszentzi gorria) hildako zelulen
tindatzailearekin haziz burutu zen. Fluoreszentzi mikroskopioarekin ateratako irudiek,
gDPSC-ak pDAT-an haztean ia % 100-eko bideragarritasuna zutela frogatu zuten, zelula
guztiak fluoreszentzi berdez tindaturik aurkituz. Zelula isolatuak bakarrik aurkitu ziren
gorriz tindaturik, pDAT-ren zitotoxizitate eza erakutsiz (28. irudia). Bi azalera hauen
arteko alderik handiena, plastikoan aurkituriko zelula kopuru handia izan zen (27. irudia
A, B). Aurkitutako gDPSC zelula kopuru desberdintasun hau, plastikoan duten mono-
geruza hazkuntzarengatik izan daiteke, pDAT-an duten 3 dimentsiotako hazkuntzarekin
alderatuz.
Plastiko pDAT
A a D
B E
88
Emaitzak
27. irudia. Plastiko eta pDAT apar solidoetan hazitako gDPSC-en Kaltzeina_AM/ propidio ioduro irudiak.
gDPSC-ak 15.000 zelula/ hobitxo dentsitatean hazi ziren 4 egunez eta Kaltzeina-AM (berde) zelula bizi
markatzaile eta propidio ioduro (gorri) zelula hilen markatzaileekin tindatu ziren. Plastiko gainean hazitako
zelulek (A, B), pDAT-an hazitakoek (D, E) baina kopuru handiagoa erakutsi zuten, mono-geruza hazkundea
dela eta. Eskala barra (A, D): 100 µm; (B, E): 50 µm.
pDAT-an hazitako gDPSC-en zelula osteoblastiko markatzaileen immunofluoreszentzia
pDAT apar solidoak 8 hobitxoko Minicell EZ-portetan integratu ziren in vitro

erabilerarako zelula hazkundeetan. gDPSC-ak 15.000 zelula/ hobitxo dentsitatean erein
ziren eta 14 egunez hazi ziren medio kontrol (DMEM) eta desberdintzapen osteoblastiko
medioarekin. DAPI nukleo markatzaileak, pDAT egitura porotsuan plastikoan baino
zelula gutxiago zeudela frogatu zuen, non zelulak mono-geruza atxikituetan hazi ziren
(28. Irudia A). 14 eguneko hazkundearen ostean, immunofluoreszentzi entsegua burutu
zen desberdintzapen osteoblastiko markatzaile diren Osteokaltzina (BGLAP) eta
Osteonektina-ren (SPARC) adierazpena detektatzeko. Plastikoan hazitako gDPSC-ek bi
desberdintzapen osteoblastiko markatzaile hauen adierazi zituzten. pDAT-an ereindako
gDPSC-ek BGLAP eta SPARC-en intentsitate erlatiboa esanguratsuki handitua zuten bi
medioekin hazita plastikoarekin alderatuz (28. irudia B; 29. irudia D).
500
B
BGLAP 400
***
300
A Kontrola Desberdintzapena
200
Plastiko
100
0
a
DMEM DMEM
control pDAT
D
500
***
400
pDAT
300
200
100
0
Osteo Osteo
Control pDAT
89
28. irudia. Plastiko eta pDAT-an desberdintzapen osteoblastikoaren presentzian edo gabezian hazitako
gDPSC-en Osteokaltzina (BGLAP) immunofluoreszentzia irudiak eta intentsitate kuantifikazioa. Plastiko
eta pDAT-a duten EZ-portetan 2 astez kontrol eta desberdintzapen medioekin hazitako gDPSC-en
immunofluoreszentzia irudiak (A). ImageJ-rekin eginiko BGLAP-aren IF markaketaren kuantifikazio
erlatiboa baldintza ezberdinetako zelula kopuruekiko (B, D). Eskala barra: 50 µm. Estatistikoki
esanguratsua (***p ≤ 0.001) denean.
300
SPARC 250
200
A Kontrola Derberdintzapena
150
Plastikoa
100
50
0
DMEM DMEM
D Control pDAT
350
***
300
pDAT
250
200
150
100
50
0
Osteo Osteo
Control pDAT
gDPSC-en Osteonektina (SPARC) immunofluoreszentzia irudiak eta intentsitate kuantifikazioa. Plastiko
eta pDAT-a duten EZ-portetan 2 astez kontrol eta desberdintzapen medioekin hazitako gDPSC-en
immunofluoreszentzia irudiak (A). ImageJ-rekin eginiko SPARC-en IF markaketaren kuantifikazio erlatiboa
baldintza ezberdinetako zelula kopuruekiko (B, D). Eskala barra: 50 µm. Estatistikoki esanguratsua (***p
≤ 0.001) denean.
90
Emaitzak
Plastiko eta pDAT-an desberdintzapen osteoblastiko medioaren presentzian edo

gabezian hazitako gDPSC-en ALP tindaketa eta kuantifikazioa
gDPSC-ak plastiko eta pDAT-an hazi ziren 14 egunez kontrol eta desberdintzapen
osteoblastiko medioekin. Ondoren, mineralizatzen duten hezur zelulen ezaugarri den
fosfatasa alkalino entzima tindatu zen. Irudiek erakutsi zutenez, gDPSC-ek ALP
aktibitatea zuten bi azaleretan (30. irudia A). ALP kuantifikazioak, bi azaleretan
desberdintzapen medioarekin hazitako zelulen markaketa handipen esanguratsua
frogatu zuten (30. irudia B, D).
Kontrola Desberdintzapena B **
A 300

250
200
150
Plastiko
100
50
0
Plastiko
D 1000 **
800
600
pDAT
400
200
0
Osteo
DMEM
pDAT
gDPSC-en ALP aktibitate kuantifikazioa. gDPSC-ak 14 egunez hazi ziren plastiko eta pDAT-a zuten EZ-
portetan kontrol eta desberdintzapen osteoblastiko medioarekin. ALP aktibitatea prezipitatu
more/beltzen detekzioz gauzatu zen (A). ALP-ren kuantifikazioa, absorbantzia erlatiboaren ImageJ-rekin
neurtuz gauzatu zen. Estatistikoki esanguratsua (**p ≤ 0.01) demean.
91
Plastiko eta pDAT-an desberdintzapen osteoblastiko medioaren presentzian edo

gabezian hazitako gDPSC-en Alizarin gorri tindaketa eta kuantifikazioa
Alizarin gorria, mineralizaturiko hezur matrize gordailuak kolore laranja/gorriz

tindatzen dituen kaltzio-lotzaile tindakaria da. gDPSC-ak 4 astez hazi ziren plastiko eta
pDAT-an kontrol eta desberdintzapen osteoblastiko medioekin. Honen ostean,
plastikozko hobitxoak zelula konfluentzia handiarekin bukatu zuten, Alizarin gorri
positibo ziren zelula sakabanatuak erakutsiz (31. irudia A). Hala ere, Alizarin gorri
prezipitatu dentsitaterik handienak pDAT-an ereindako gDPSC-etan aurkitu zen (31.
Irudia A). neurketa semi-kuantitatiboek, bi azaleretan desberdintzapen
osteoblastikoaren eraginez, tindaketa intentsitate handiagoa frogatu zen (31. irudia B).
hare gehiago, eremu argiko mikroskopio irudiak DAPI immunofluoreszentzia irudiekin
konbinatuz, zelulen lokalizazio erlatiboa behatu zen hezur matrize gordailuekiko. gDPSC-
ak area mineralizatuen ertzetan dentsitate handiagoan kokatuta zeudela eman zuen.
Gainera, nodulu kaltzifikatuekin kontaktu estuan aurkitu ziren gDPSC-ak itxura oneko
nukleoak zituzten (31. irudia A).
92
Emaitzak
A DAPI Alizarina Merged
Plastikoa
Desberdintzapena
Plastikoa
Desberdintzapena
B 300 200 *
250
150
200
150 100
100
50
50
0 0
DMEM Osteo DMEM Osteo
Plastikoa pDAT
gDPSC-en Alizarin gorri-DAPI tindaketa bikoitza eta kuantifikazioa. gDPSC-ak hobitxo hutsetan
(plastikoa) eta pDAT apar solidoetan hazi ziren kontrol eta desberdintzapen osteoblastiko medioarekin 4
astez Alizarin gorri tindaketa egin baino lehen. Zelulen nukleoak DAPI-z tindatu ziren. Eremu argiko eta
immunofluoreszentzia irudiak batu ziren gDPSC-en lokalizazioa aztertzeko mineralizaturiko hezur matrize
noduluen inguruan (A). Alizarin gorriaren kuantifikazio erlatiboa neurtu zen (B). Eskala barra: 50 µm.
Estatistikoki esanguratsua (*p ≤ 0.05) denean.
93
gDPSC-ek pDAT-an haztean sortutako Sharpey-itxurako kolageno fibra sorta luzeen

TEM irudiak
gDPAC-ak pDAT apar solidoetan haztean sorturiko hezur-itxurako ECM ultra-

egitura aztertzeko asmoz, TEM irudiak atera ziren. Baldintza kontroletan, area handietan
sakabanaturiko kolageno fibra txikiak ikusi ziren, baita ehun adiposo dezelularizazioan
erabat ezabatu gabeko lipido tanta sakabanatuak ere. gDPSC-ak pDAT-an
desberdintzapen osteoblastikoarekin haztean, trantsizio zorrotzak ikusi ziren kolageno
mehe area eta mineralizaturiko kolageno lodi areen artean (32. irudia; marratxo horiak).
Kolageno sorta lodi hauek, elektroi dentsitate handiagoa zuten eta pDAT apar solidoari
loturik zeuden, zein kolageno meheago eta ez kaltzifikatuez osaturik dagoen. Apar solido
barneko kolageno elektrodentsoen areatan, mintz-barneko osifikazio lekuak aurkitu
ziren (33. irudia A, B; geziek seinalatua). Mineralizaturiko hezur matrizea ere aurkitu zen
area elektro-dentsoetan kolageno fibrei Sharpey-gisako fibrez lotua (33. irudia B;
izartxoak). Kolageno elektro-dentso area eta mintz-barneko osifikazio leku hauek ez
ziren ikusiak izan zelularik erein gabeko apar solidoetan (datuak ez dira erakusten),
gDPSC-ek eragindako egitura hauen de novo sorrera frogatuz.
94
Emaitzak
pDAT Control pDAT Differentiation

A B
D E
F G
32. irudia. pDAT- hazitako gDPSC-en ultra-egiturara ezaugarriak TEM irudien bidez. gDPSC-ak 4 astez
hazi ziren kontrol (ezker zutabea) eta desberdintzapen osteoblastiko medioekin (eskuin zutabea). gDPSC-
ek sorturiko kolageno fibra lodiago eta kaltzifikatuen hezur ECM-a eta pDAT apar solido matrizeko
kolageno fibra meheen arteko trantsizio area aztertu zen (marratxo horia). Kolageno fibra elektro-dentso
kantitate gehiago ikusi zen desberdintzapen osteoblastiko baldintzetan (beheko handipen altuko irudiak).
Eskala barra: 1 µm (A, D eta E); 500 nm (B); 200 nm (F eta G).
95
B
* *
*
*
* *
33. irudia. pDAT apar solidoetan hazitako gDPSC-ek sortutako mintz-barneko osifikazio gune eta
Sharpey-gisako fibrak TEM irudien bidez. pDAT apar solidoetan hazitako gDPSC-en kaltzifikaturiko
kolageno sorta lodi arearen eta kolageno area ez kaltzifikatuaren arteko trantsizioa (marratxo horia).
Mintz-barneko osifikazio guneak aurkitu ziren kolageno lodia zuten egitura elektro-dentsoetan. Gezi
puntek seinalaturiko guneen handipenak eskuin panelean (A). Sharpey-moduko fibra zulatzaileen
presentzia mintz barneko osifikazio guneen ertzetan (eskuin paneleko izartxoak), kolageno matrizeari
ainguratzea erakutsiz. Gezi puntek seinalaturiko guneen handipenak eskuin panelean (B). Eskala barra: 2
µm (goiko ezkerreko irudia); 1 µm (beheko ezkerreko irudia); 500 nm (goiko eskuineko irudiak); 200 nm
(beheko eskuineko irudiak).
96
Eztabaida
Eztabaida
Ikerketa honen helburuetako bat, in vitro hezur birsorkuntzarako gDPSC-ak

plasma autologo osagaiekin eta hortz inplanteen titanio biomimetikoekin
konbinatzearen ebaluaketa egitea zen. Esparru honetan, ikerketa hau gDPSC-ak Ti6AL4V
estandarrean eta BASTM (Avinent implant system) titanio biomimetiko azaleretan,
plasmatik eratorritako PRGF eta PRF-rekin hazteak eragin zitzakeen desberdintzapen
osteoblastiko prozesu eta jariaturiko hezur matrize deposizioen handipena aztertzera
bideratuta zegoen. Gronthos et al.-ek gDPSC-ak lehen aldiz isolatu ostean (Gronthos et
al., 2000), laborategi ezberdin askok baieztatu dute gandor neuraletik eratorritako zelula
ama hauen hozi geruza ezberdinetako zelula leinu ezberdinetara desberdintzeko
gaitasuna (Nuti et al., 2016). Desberdintzapen gaitasun honen barruan sartuko litzateke
hezur sortzaile diren zelula osteoblastikoetara desberdintzeko abilezia, hauek izanik
inplantologia alorrerako zelula interesgarrienak (Giuliani et al., 2013; Tatullo, 2017).
Zelula ama mesenkimalek, hezur matrize jariatzaile diren osteoblasto eta

osteozitoetara desberdintzeko prozesua gutxienez hiru pausoz osatua dago. Prozesu
honetako pauso bakoitza gene markatzaile adierazpenez karakterizatua dago. Lehen
pausoan, zelula ama mesenkimalek zelula osteo-kondroprogenitoreetara
desberdintzeko konpromezua hartzen dute, RUNX2 transkripzio faktorearen
adierazpena handituz. Gene honen adierazpenak, zelula ama mesenkimalak hezur
leinuko zelula orteoprogenitoreetara desberdintzera bultzatzen ditu. Bigarren pausoan,
MSC-ak osteoblasto jariatzaileetan eraldatzen dira eta BGLAP (osteokaltzina) eta SPARC
(osteonektina) bezalako kaltzio lotzaile proteinen produkzioa eta jariaketa hasten dute.
Bi proteina hauek Kolageno extra-zelularrarekin elkartzean, hezur matrize extra-
zelularreko zati organikoa (osteoidea) sortzen dute. Honen ostean, hidroxiapatita
minerala jariatzen hasten dira hezur matrize heldugabean, hau mineralizatuz. Kristalen
nukleazioz ematen den mineralizazio prozesua, fosfatasa alkalinoari esker gertatzen den
Ca2+ eta PO4- ioien katalisi erreakzioarengatik egiten da. Momentu honetan, MSC-ek,
OSTERIX transkripzio faktorea bezalako erabat desberdindutako osteoblasto
markatzaileak adierazten dituzte. Transkripzio faktore honen adierazpena osteozito
helduetan mantentzen da, kaltzifikaturiko hezur matrize helduak osteoblastoak inguratu
ostean. Osteozito heldu hauek, lehen pausoetako SPARC eta Kolageno I-en adierazpena,
99
maila baxuagoan, mantentzen dute, denboran zeharreko hezur matrizearen

birmoldaketarako (34. irudia).
Azken hamarkadan, erabilera klinikorako titanio materialen bio-

bateragarritasunak hobekuntza garrantzitsuak jasan ditu, titaniozko hortz inplanteen
konposizio eta azaleran eginiko aldaketei esker. Aldaketa hauek, titanio inplantearen
inguruko MSC-en desberdintzapena eta hezur sorrera bultzatzeko helburuarekin egin
ziren. Aldez aurreko ikerketek erakutsi zuten zelula ama mesenkimalen itsaste, ugaltze
eta osteoblasto desberdintzapenerako gaitasuna titanio azaleren gainean haztean,
desberdintzapen osteoblastiko medioarekin hazi gabe ere (Olivares-Navarrete et al.,
2010). Ikerketa honen emaitzek lehen eginiko ikerketekin bat egiten dute, zelula ama
mesenkimalek, gure kasuan giza emaile osasuntsuetatik eratorritako gDPSC-ak,
ereindako azaleraren arabera beraien jokabidea aldatu zitekeela erakutsiz. gDPSC-ak
titanio azalerara itsasteak nahikoa izan zen zelula hauek bere kabuz desberdintzapen
osteoblastikoa gauzatzeko, Alizarin gorri bidez tindatu zitezkeen hezur matrize
mineralizatuak sortuz. Emaitza hauek, gDPSC-ak plastiko estandarrean haztean
gertatzen denaren aurkakoak dira, non β-glizerolfosfato, azido askorbiko eta
dexametasonaren beharra duten desberdintzapen osteoblastikoa gauzatzeko
(Langenbach and Handschel, 2013). Titanio azaleren abantaila nagusiena, zelula ama
mesenkimalen desberdintzapen osteoblastiko indukzio gaitasun hau da. Bestalde,
titanio azaleren makro eta mikro zimurtasunak zelulen itsaspen, ugaltze eta
desberdintzapen osteoblastikoan rol garrantzitsua zuela frogatua zuten (Boyan et al.,
2016b; Coelho et al., 2009). gDPSC-ek, desberdintzapen osteoblastikoa, hezur proteina
morfogenetiko, hezur proteina eta baskulatura endotelialaren hazkuntza faktoreen
produkzio sendoa erakutsi zuten titanio azalera porotsuan haztean (Perrotti et al.,
2013). Duela gutxiko ikerketek iradoki dutenez, osteo-indukzioa areagotuta dago
kimikoki aldaturiko mikro zimurtasun dun titanio azaleretan, hortz klinika
aplikazioetarako abantaila garrantzitsua erakutsiz (Boyan et al., 2016b; DE Colli et al.,
2018). Ikerketa honetan, OSTERIX-en adierazpen mailan aldaketa txiki baina
esanguratsua aurkitu zen medio kontrolarekin Ti6AL4V (lehun) eta BAS (gogor) titanio
azaleretan ereindako gDPSC-en konparaketan. Hala ere, gDPSC-en desberdintzapen
osteoblastikoa asko areagoturik zegoen BAS titanio azaleraren gainean plaketetan
100
Eztabaida
aberatsa de fibrinarekin (PRF) hazitako baldintzetan, desberdintzapen ostreoblastiko

medioaren presentzian edo gabezian hazita ere. Baldintza honetan, OSTERIX-en mRNA
adierazpen maila asko areagoturik aurkitu zen.
gDPSC-en in vitro hedapen eta mantentzea ere ikertua izan zen Ti6AL4V (lehun)
eta BAS (gogor) titanio azaleretan. Bi azalerek, zelulen bideragarritasuna mantendu
zuten, zelulen ugaltze ona baimenduz. Hau, Ki67-rako positibo ziren zelulak detektatuz
egiaztatu zen baldintza basaletan. Ti6AL4V titanio azaleran hazitako gDPSC-ek
mobilitate handiagoa erakutsi zuten BAS titanio azaleraren gainean hazitakoekin
alderatuta, azalera lauaren ondorioz. Nahiz eta plasmatik eratorritako bi produktuek
gDPSC-en ugalketa ona baimendu zuten, PRF-ak ez bezala, % 20-ko PRGF-z osaturiko
medioak esanguratsuki handitu zuen zelulen hazkuntza. Emaitzen ezberdintasun hau, bi
produktu hauen erabilera metodo ezberdinengatik eragina izan zitekeen. PRF mintzak
plaken hobitxoetan mantendu ziren esperimentuak iraun zuen denbora osoan zehar,
molekulak pixkanaka askatuz. Honen aurka, disolbagarria den PRGF-a, medio aldaketa
bakoitzarekin % 20-ko kontzentrazioan berritu zen 2-3 egunero. Posiblea da, hazkunde
medioari PRGF-a gehitzean eragindako hazkuntza faktoreen kontzentrazio handiak
gDPSC-en ugalketa areagotu zuela esatea, eta aldi berean honek, osteoblasto
helduetara desberdintzeko prozesuan eragin negatiboa zuela esatea. Bi prozesu hauek
(zelula ugalketa vs desberdintzapena) prozesu antagonikoak direlako. PRGF-arekin
hazitako gDPSC-ek, RUNX2 eta SPARC bezalako osteoblasto konpromezu markatzaileen
adierazpen mailak handituak zituzten. Baina nolabait, GDPSC-ek huts egin zuten
osteoblastu zelula helduetara desberdintzean, OSTERIX transkripzio faktorearen
adierazpen maila baxuak eta Alizarina gorriz tindatutako jariaturiko hezur matrize
mineralizatuaren detekzioak erakutsi zuen bezala. Bestalde, PRF-z osaturiko
medioarekin hazitako gDPSC-ak, fibrina mintz honek pixkanaka askaturiko hazkuntza
faktore hauei esker, osteoblasto helduen desberdintzapena areagotu zuten.
Garrantzitsua da aipatzea, gDPSC-al BAS titanio azaleraren gainean PRF-rekin haztean
izan zela in vitro desberdintzapen osteoblastikorako baldintzarik eraginkorrena. Hau
izan zen BAS titanio gogor azalerak Ti6AL4V titanioarekin alderatuta aukera hobea zela
erakutsi zuen unea.
101
Metodologia hau hortz klinikara itzuli ahal izateko, in vivo ikerketa gehiago
beharrezkoak dira. Nahiz eta ez izan giza gorputz helduan zelula ama mesenkimal iturri
ugariena, inplantologia eta ebakuntza kraniomaxilofazial arloetarako, gDPSC-ak oso
zelula interesgarriak dira. Istripuren batean hortzak galdu dituzten pazienteen kasuan,
hau bereziki interesgarria da. Galdutako hortz piezatik lorturiko gDPSC autologoen
erabilerak onura handiak ekar ditzake kalteturiko hezur gunearen birsorpena
laguntzean. Kasua edozein izanik ere, BAS bezalako mikro-porodun titanio azalera
biomimetikoan haztean, gDPSC-ek eraginkortasunez erantzuten dute desberdintzapen
osteoblastiko protokoloei, bereziki plaketetan aberatsa den fibrina mintzarekin
konbinatzean.
TITANIO AZALERA PRGF (disolbagarria; 20%)

(Ti6Al4V, BAS) PRF (ez-disolbagarria)
Ez konprometitua Pre-konprometitua Konprometitua
Kolageno I Runx2 Runx2

(altu) OsteoN
OsteoN Kolageno I
Kolageno I (altu)
Osterix
DESBERDINTZAPEN PRF (ez-disolbagarria)

TRATAMENDUA
(DEXA, BGP, ASC)
34. irudia. gDPSC-en desberdintzapen osteoblastiko prozesuan plasmatik eratorritako produktuen

eraginen laburpena. Desberdintzapen erreaktibo farmakologikoek, hazkuntza substratuek (Ti6AL4V eta
BAS) eta plasmatik eratorritako produktuekin (PRGF eta PRF) hazteak desberdintzapen osteoblastiko
prozesuan duten eraginen laburpen eredu teorikoa. Zelula ama mesenkimalak egoera ez-desberdinduan
hazten dira in vitro. Osteoblasto desberdintzapen konpromezua hartzera induzitu daitezke, non lehen
102
Eztabaida
pausoan zelulek RUNX2 transkripzio faktorearen adierazpena areagotzen duten, eta poliki-poliki geroz eta
Kolageno I eta SPARC gehiago. Desberdintzapen osteoblastikoaren azken etapan, zelulek matrize extra-
zelularra mineralizatzeko gaitasuna lortzen dute, hezur ehun heldua sortuz. Zelula/molekula mailan,
OSTERIX transkripzio faktorearen adierazpena du ezaugarritzat, osteoblasto/osteozito helduen gene
markatzailea. Erreaktibo farmakologiko, plasmatik eratorritako PRGF eta PRF, eta titanio azalerek gDPSC-
en osteoblasto desberdintzapen konpromezuan eragina dutela ikusi da. Hau, RUNX2 eta SPARC eta
fosfatasa alkalinoaren adierazpenaren detekzioz egiaztatu da baldintza guzti hauetan. Hala ere, PRGF
disolbagarriarekin hazitako gDPSC-ekez zuten osteoblasto heldu etapara eltzea lortu, seguraski
ugaltze/desberdintze prozesu antagonikoen eraginez. Honen aurka, PRF mintzekin hazitako gDPSC-ek
desberdintzapen osteoblastiko markatzaileen adierazpen handienak izan zituzten, bereziki BAS titanio
azalera biomimetikoa eta desberdintzapen osteoblastiko medioarekin konbinatzean.
Azalduriko ikerketa honek, zelulen bideragarritasun, ugalketa eta

desberdintzapen osteoblastiko gaitasun onak erakutsi zituzten titanio azaleren gainean
haztean. Zelula ama mesenkimalek, hezur ehun ingeniaritzan erabiltzeko aukera onena
zirela erakutsi zuten beraien itsaspen, ugaltze eta zelula ezberdinetara desberdintzeko
gaitasunari esker biomaterial ezberdinen gainean haztean. Dena dela, giza gorputz
helduak aurkituriko zelula ama mesenkimal iturri ezberdinengatik, ehun ingeniaritzan
erabiltzeko zelularik onena zein den oraindik ez dago garbi. Hezur eta hortz birsorpen
terapia eraginkorrak garatzeko, giza gorputz helduko zelula amak alderatu beharra
daude aukerarik onena zein den jakiteko. Galdera honi erantzuna eman nahian,
konparaketa ikerketa egin genuen gDPSC eta gBMSC-en artean, MSC mota
esperantzagarri bat zeinak hezur desberdintzapen gaitasun naturala duen.
Konparaketa ikerketa honen helburua, gDPSC eta gBMSC-en zelulen arteko

bideragarritasun, ugalketa eta desberdintzapen osteoblastikoa aztertzea izan zen
Ti6AL4V eta BASTM gainean haztean desberdintzapen osteoblastiko medioaren
presentzian edo gabezian. Emaitzen ebaluaketarako garrantzitsua da kontuan hartzea
gDPSC eta gBMSC-en emaileen adina, non gDPSC emaileen adina 16-30 urte bitartean
zegoen eta gBMSC emaileen adina 45 urtetan.
Ti6AL4V eta BAS titanio azaleren gainean hazitako gDPSC eta gBMSC-ek ez zuten
zito-toxizitaterik erakutsi. Bi zelula mota hauek, ia % 100-eko bideragarritasuna adierazi
zuten titanio azaleren gainean haztean, non isolaturiko zelularen bat bakarrik aurkitu
103
zen ioduro propidioarekin tindatua. Hala eta guztiz ere, zelula ugalketa esperimentuak
gDPSC eta gBMSC-en arteko ezberdintasunak erakutsi zituen. 24 eta 48 orduz titanio
gainean hazi ostean gDPSC-ek, gBMC-ek baino ugalketa maila handiagoa erakutsi zuten.
Kristal gainean haztean, aldaketa hau 24 orduren ostean bakarrik ikusi zen, bi zelulen
artean 48 orduren ondoren ugalketa maila antzekoa ikusiz. Emaitza hauek lehenago
eginiko artikuluekin bat egiten dute, non emaitza berberak izan zituzten zelulak bio-
material ezberdinen gainean haztean (Amid et al., 2021; Ponnaiyan and Jegadeesan,
2014).
gDPSC eta gBMSC-ek jariaturiko mineral gordailuen sorrera ere ezberdina izan
zen kristal, Ti6AL4V eta BAS-ean. Alizarin gorri tindaketaren kuantifikazioak erakutsi
zuenez, gDPSC-ek hezur mineral produkzio handiagoa eduki zuten gBMSC-ekin
alderatuz- gainera, Ti6AL4V eta BAS titanio azaleren gainean desberdintzapen
osteoblastikoarekin hazitako gDPSC-ek erakutsi zuten baldintza guztien artean hezur
mineral sorrera handiena. Erlazionaturiko ikerketetan ikusi zuten bezala, gDPSC-ek
gBMSC-ek baino mineralizazio handiagoa eduki zuten bi titanio azaleretan haztean
(Davies et al., 2015; Mohanram et al., 2020).
Honez gain, RNA sekuentziazioa, geneen adierazpen/ adierazpen eza kriterioa

jarraituz analizatu zen. Helburu hau lortzeko, binakako analisi konparatiboak gauzatu
ziren baldintza guztien artean, baldintza batean adierazita eta bestean adierazi gabe
zeuden geneak begiratuz. Presentzia/ gabezia (ON/OFF) konparaketa aukeratu genuen
gene set espezifikoak detektatzeko. Hauen adierazpena aktibatua egongo litzateke
desberdintzapen osteogeniko baldintzetan, eta honela gDPSC eta gBMSC-en
desberdintzapen osteoblastikoan inplikatuta dauden gene berri eta seinalizazio bideak
identifikatu ahal izango genituen.
gDPSC eta gBMSC-ak plastikoan medio kontrolarekin haztean erakutsi zuten

gene adierazpen ezberdintasun handiena gBMSC-ek adierazitako HOX gene familia izan
zen. HOX geneak, zelula ama mesenkimalen ugalketaren arduradun dira, baita
eskualdeetako zehaztapenak eta erlazionaturiko ehunen espezifikotasunarenak ere
(Ackema and Charité, 2008). Aurreko ikerketek HOX-en adierazpen patroi
104
Eztabaida
ezberdintasunak frogatu zituzten gandor neuraleko zeluletan eta barailezur helduan,

aldi berean, mesodermotik eratorritako hezurrek eta mesenkimak HOX-en adierazpen
positiboa zuten (Dong et al., 2014; Lee et al., 2015b; Wehrhan et al., 2011). Gene familia
hau, MSC-en leku-espezifikotasunarekin erlazionaturik egon daitekeela iradoki da,
kokaleku anatomikoaren arabera (Wang et al., 2009). HOX geneen adierazpen
ezberdintasunak, jatorri enbrionario ezberdina duten zelula injerto autologoetan ikusi
den zelulen jokabide ezberdintasunak azal ditzake (Leucht et al., 2008). Ikerketa honetan
lorturiko emaitzak bateragarriak dira lehen eginiko ikerketekin, zeinak barailezurrean
HOX geneen adierazpen jaitsiera ikusi zuten hezur luzeekin alderatuz (Lee et al., 2015b;
Leucht et al., 2008).
Desberdintzapen osteoblastikoarekin erlazionaturiko genetan arreta berezia

jarriz, desberdintzapen osteoblastikoaren markatzaile den OSTERIX/SP7-aren
adierazpena gDPSC-etan induzituta zegoela ikusi zen titanio azaleretan desberdintzapen
osteoblastiko medioaren presentzian edo gabezian hazi ondoren. gBMSC-etan
adierazpen ezberdintasun hau ezin izan zen aurkitu, zelula hauek duten adierazpen
basala dela eta. Emaitza hauek lehen eginiko ikerketen emaitzekin bateragarriak dira,
non OSTERIX/SP7-ren adierazpena, bai titanio azalerengatik, bai desberdintzapen
medioarengatik areagotuta zegoela ikusi zen. Honez gain, SPARC-ekin erlazionaturiko bi
genek, SPOCK2 eta SPARCL1, adierazpena isilarazita zutela erakutsi zuten gBMSC-etan
baldintza kontroletan eta adierazpen positiboa zelula hauek Ti6AL4V titanio azaleran
desberdintzapen osteoblastiko medioarekin haztean. Azkenik, aipatu beharreko azken
desberdintzapen osteogenikoarekin erlazionaturiko genea ZBTB16 da. ZBTB16,
proteina-proteina elkarreragin domeinua eta DNA-ri lotzeko bederatzi Kruppel-antzeko
zink hatzak dituen zink hatz-dun transkripzio faktorea da. OSTERIX/SP7, ZBTB16
genearen promotoreari lotzen zaio honen transkripzioa hasteko (35. irudia). Ikerketa
honetan, medio kontrolarekin haztean gDPSC eta gBMSC-ek gene hau ez zutela
adierazten ikusi genuen, baina bi zelula hauek desberdintzapen osteoblastiko
medioarekin haztean ZBTB16-ren adi erazpena nabarmenki handitu zuten. Lehen
eginiko ikerketa batzuen emaitzetan gauza berbera ikusi zuten, non ZBTB16 genea
dexametasonaren eraginez adierazten zela frogatu zuten. Honengatik, ZBTB16 zelulak
desberdintzapen osteoblastiko medioarekin haztean bakarrik adierazi zen (Felthaus et
105
al., 2014a; Felthaus et al., 2014b; Onizuka et al., 2016). Orokorrean, gDPSC eta gBMSC-
ak kultibo baldintza ezberdinetan haztean egin den RNA sekuentziazio honek ZBTB16-ek
osteogenesiaren erregulazioan rol garrantzitsua izan dezakeela iradoki dute.
Osx
Sp1
ZBTB16
Sp1
35. irudia. Osterix, ZBTB16-ren promotoreko Sp1 sekuentziari lotzen zaio.
Ezberdin adierazitako beste gene interesgarrien artean , NTRK3 eta GFRA2

geneen adierazpena zuten kontrol medioarekin plastiko gainean ereindako gDPSC-ek,
eta adierazpen hau desagertu egin zen desberdintzapen medioaren eta/edo titanioen
eraginez. Neurotrofinen errezeptore geneak, eta partikularki NTRK3, gDPSC-en
“amatasun” markatzaile izan zitezkeela iradoki zenez, emaitza hauek ere lehenago
eginiko ikerketekin bat egingo lukete (Luzuriaga et al., 2019b).
Azkenik, garrantzitsua da aipatzea geneen adierazpen ezberdintasun eza

Ti6AL4V eta BAS titanio azaleren gainean hazitako gDPSC-etan. Adierazpen ezberdina
zuten geneak gutxi ziren eta gainera patroi inkoherentea jarraitzen zuten. Emaitza
honek, bi titanio azalera hauek duten gene adierazpen indukzio berbera frogatuko
lukete. Horregatik ondorioztatu dugu, titanio azaleren gainean hazitako zelulen arteko
gene adierazpen patroi ezberdintasunak edozein direla ere, gene adierazpen maila
aldaketa arinak bilatu beharko ditugu, osteogenesiarekin erlazionaturiko gene maisuak
bilatu beharrean.
Gene interesgarrien adierazpen ezberdintasunak analizatu ostean, seinalizazio

bideen aberastasun analisira jo genuen, hazkuntza baldintza ezberdinetan hazitako
gDPSC eta gBMSC-etan afektaturiko gene kluster eta seinalizazio bideak identifikatzeko.
Honetarako, konektibitate mapak (CMAP) eta prozesu biologikoen gene ontologiaren
(GOBP) bidez aztertu ziren konparaketa esperimental bakoitzean afektaturiko
106
Eztabaida
seinalizazio bideak identifikatzeko. Afektaturiko seinalizazio bideak aukeratzeko,

gutxienez ezberdin adierazitako bi gene eta esanguratsua p< 0.05 kriterioa jarraitu
genuen
Datu base hauek erakutsi zuten ze prozesu biologiko eta gaixotasunekin

erlazionaturik zeuden aktibaturiko gene taldeak. CMAP-ek eman zizkigun datuen
arabera, gDPSC eta gBMSC-en artean ezberdintasunik handiena HOX geneetan zegoen,
gene hauek leuzemia mieloide akutu eta desorden hematopoietikoa bezalako prozesu
ezberdinekin erlazionaturik daude. Bestalde, GOBP-ak gene ezberdinen adierazpena,
aurreko/ atzeko patroi espezifikotasuna, odol hodien garapena, sistema
kardiobaskularraren garapena, odol hodien tamainaren erregulazioa, hormonen
garraioa eta zelula ama hematopoietikoen desberdintzapen prozesuekin erlazionatu
zituen. Aurreko/ atzeko patroi espezifikotasunarekin erlazionaturik dauden seinalizazio
bideen ezberdintasun esanguratsuak eta ama zelula hematopoietikoen
desberdintzapena garbi erlazionaturik egon daiteke gDPSC eta gBMSC-en jatorri
enbrionario eta funtzio fisiologikoari.
Aurreko ikerketetan ikusi bezala, nahiz eta desberdintzapen osteoblastikoarekin

erlazionaturiko geneen adierazpen handiagoa izan gBMSC-ek, hezur mineralaren
sorrera beti handiagoa da gDPSC-etan (Davies et al., 2015; Mohanram et al., 2020).
Emaitza hauek berretsita daude gure ikerketan lorturiko emaitzengatik Alizarin gorri
bidezko hezur mineralaren detekzioz. Are gehiago, zelulen ugalketa maila ere handiagoa
da gDPSC-etan gBMSC-etan baino. Bi zelula mota hauek isolatzeko metodologia
ezberdina dela aipatzea ere garrantzitsua da. gDPSC-ak lortzeko prozedura errazagoa da
eta ez ain erasokorra gBMSC-ak lortzeko metodologiarekin alderatuz. Informazio guzti
honekin, hezur eta hortz ehun ingeniaritzan erabiltzeko, gDPSC-ak gBMSC-ak baino
zelula ama mesenkimal iturri hobea direla iradoki dugu (Amid et al., 2021; Mohanram
et al., 2020).
Lehen aipatu bezala, hortz inplanteak asko hobetu dira azken urteetan
inplanteen biziraupen maila areagotuz. Biziraupen hau % 95 inguruan egongo litzateke
inplantea jarri eta 10 urte igaro ondoren (Moraschini et al., 2015) eta % 88-an 20 urte
107
igaro ondoren (Chrcanovic et al., 2018). Hala ere, bizi-itxaropenaren handipenarekin eta
herrialde garatuen biztanleriaren zahartzearengatik, denbora luzeko iraupena duten
hortz inplanteen eskaria mantendu egingo dela ematen du etorkizunean.
Azken hamarkadetan zehar, hortz inplanteen osteo-integrazioak hobekuntza

emaitza handiak eduki ditu, hala ere, oraindik erronka garrantzitsuak mantentzen dira.
Aho inplantologiaren arazo handienetako bat, Hezur Marjinalaren Galera (MLS) da, zein
inplanteen galerarekin zuzenki erlazionaturik dagoen, murtxikatze funtzioak PDL-aren
gabezian hezur albeolarrari jasanarazten dion estres mekanikoarekin erlazionaturik.
Murtxikatze zama guztia hezur ehun albeolarrari transferitzen zaio, hortz inplanteak
bertan zuzenki ainguratuta daudelako, eta honek hezurraren birxurgapena eragin
dezake. Ikerketa asko daude MLB altua periinplantitisa jasan eta inplantearen
galerarekin erlazionatzen dutenak (Chrcanovic et al., 2018; Coli and Jemt, 2021; Galindo-
Moreno et al., 2015). Periinplantitisa eta MLB-a murrizteko estrategiarik eraginkorrena
PDL-aren berreraikuntza da, zeinek kuxin natural funtzioa betetzen duen hezur albeolar
eta hortzaren artean, indar mekanikoak xurgatuz. Hala ere, PDL-aren birsorkuntza eta
ingeniaritza aparteko erronka izango litzateke (Lee et al., 2020). PDL-a ordezkatzeko
edozein material gogorki lotu beharko litzateke bai hezur albeolarrera bai hortz
inplantera, eta aldi berean, baskularizazio handiko banda mantendu beharko luke hauen
artean. Praktikan, arazo hau, bio-materialetan zelula ama osteogeniko eta
baskulogenikoak ereinez bakarrik konponduko litzateke.
Zelula amen terapia bidez birsortutako PDL-aren testuinguruan, paziente

berberetik eratorritako zelula amak (txertaketa autologoa) bio-materialean ereitea
izango litzateke agertokirik onena, honela manipulazio egokiaren ondoren, errefuxa
immunologikoa ekidinez. Aurreko ikerketetan esan bezala, hortz inplantologian erabili
ahal izateko zelula amarik interesgarrienetako bat gDPSC-ak dira. Zelula haue ondo
egokituta daude kriokontserbazio eta transplante autologoetarako (Ibarretxe et al.,
2012b; Raik et al., 2020). gDPSC-en beste ezaugarri garrantzitsu bat, zelula mesenkimal
eta zelula ez mesenkimaletara desberdintzeko dute gaitasuna da animali iturriko seruma
bezalako konposatu xenogenikorik erabili beharrik gabe. Dagoeneko aztertua izan da
gDPSC-ek serumik gabeko medioekin haztean duten desberdintzapen gaitasuna, zelula
108
Eztabaida
baskulogeniko eta osteogenikoak lortuz. Gure taldeak orain dela gutxi argitaratu eta
patentatu zuen zelula baskulogenikoak lortzeko (endotelia eta perizitoak) animali
serumik gabeko metodologia (Luzuriaga et al., 2020; Pineda Martí et al., 2020). Metodo
hau bio-materialetan ereindako gDPSC-ei aplika daiteke pDAT-a bezalako scaffold-ak
baskularizatzeko eta honela zelula terapietan erabili ahal izateko.
Ikerketa honetan, patentaturiko dezelularizazio protokoloa (Madarieta Pardo et

al., 2017) jarraiturik lortutako pDAT apar solidoak gDPSC-ekin konbinatu genituen. Ehun
adiposoa, aktibitate biologikoa duten mintz itsaspen proteina iturri eskuragarria da
(Yang et al., 2020). Hezur birsorkuntzaren testuinguruan, zelula osteoblastikoak eta
mineralizaturiko hezur matrize ehuna lortzeko, pDAT-an ereindako gDPSC-en
desberdintzapena frogatzea oso garrantzitsua zen. Ikerketa honetan, gDPSC-ak pDAT-an
haztean duten desberdintzapen osteoblastiko gaitasuna aztertu zen. PDL-aren
ingeniaritza testuinguruan, konpondu beharreko arazo garrantzitsu bat bat, pDAT apar
solidoen hazkuntza sistemaren optimizazioa izango litzateke, material hau aldez aurretik
zelula baskular eta osteoblastoetara desberdindutako gDPSC-ekin konbinatuz, zeinak
galduriko PDL-aren egitura eta funtzioa imitatuko lukeen.
Ikerketa honetan lorturiko emaitzek, PDL eta hortz hezur birsorkuntzarako pDAT
apar solidoak bio-material garrantzitsua izan daitekeela frogatu du. pDAT-aren
formulazio honek, gDPSC-ek jariaturiko hezur matrizea esanguratsuki handitu zuen,
fosfatasa alkalino eta Alizarin gorriaren ebaluaketak erakusti zuen bezala. Material
honetan ereindako gDPSC-ek ez zuten bideragarritasun galerarik erakutsi baldintza
esperimentaletan. gDPSC-ak dentsitate baxuetan erein ziren (15.000 zelula/hobitxo;
21.428 zelula/ zm2) eta baita pDAT scaffoldaren bolumen baxuak (120 µl/ hobitxo)
denbora luzeko ikerketetarako. Zelula dentsitate handiagoen erabilerak seguraski,
baskulatura bidezko mantenugai eta oxigeno horniketa beharko luke (Nakamura et al.,
2019). In vivo esperimentu gehiago beharrezkoak izango dira material honen potentziala
ikertzeko hezur ehun eta PDL lesioen sendakuntzan.
Azkenik, pDAT-an ereindako gDPSC-ek kaltzifikaturiko kolageno fibra sorta lodiak eta
mintz barneko osifikazio lekuak sortu zituzten. Kaltzifikaturiko gune hauek pDAT-ri
109
itsatsirik daude Sharpey fibren bidez. Emaitza guzti hauek erakutsi dutenez gDPSC-ak,
edo beste ama zelula mesenkimalen bat, pDAT-rekin konbinatzean desberdintzapen
osteoblastikoa induzitzeaz gain, injertoa inguruko ehun gogorrari itsasten laguntzen du.
Hezur sendaketaren kasuan itsaspen honek interes berezia du, non scaffold-a eta hezur
ehunaren arteko itsaspen fisikoa beharrezkoa den. In vivo transplantazio esperimentuak
beharko diraaurkiketa hauek baieztatzeko, non zelula amen garraiobide izateaz aparte,
scaffold-ak ECM bio-induktore gisa jokatuko luke, hezur ehun gogorrarekin itsaspen
kaltzifikatua areagotuz eta baita hezur ehun ostalariko ama zelula mesenkimalen
errekrutatze eta aktibazioa eraginez.
110
Ondorioak
Ondorioak
Azken hamarkadetan, zelula ama mesenkimal ezberdinek hezur ehun

ingeniaritzan erabiliak izateko potentziala frogatu dute. Beraien ugalketa ratio handia
eta multi-leinu desberdintzapen gaitasunengatik, zelula hauek hautagai aproposak dira
birsortze terapietarako. Gainera, inplante eta scaffold-en fabrikazio hobekuntzek,
porositate, laztasun eta iraunkortasunak hobetu dituzte. Aldaketa hauek, zelula amen
ugalketa eta desberdintzapenerako bio-bateragarri-tasunaren hobekuntzetarako
bideratuta daude. Azkenik, plasmatik eratorritako hazkuntza faktoreak irtenbide ezin
hobea dela erakutsi du terapia autologoetan erabiliak izateko zelula amen in vitro
hazkuntza eta desberdintzapenerako. Honela, erantzun immune ez desiragarriak
deuseztatuz animali jatorriko serumak ekidinez.
Jarraian datozen ondorioak atera dira lan honen emaitzetatik:
1. gDPSC-en bideragarritasuna eta ugalketa ez dira kaltetu Ti6AL4V eta BAS titanio
azaleretan haztean.
2. Bi titanio azalerek eragin osteo-induktiboa erakutsi dute gDPSC-engan
desberdintzapen osteoblastiko medioaren beharrik gabe.
3. Plasmatik eratorritako PRGF-ak gDPSC-en in vitro ugalketa areagotu du, aldi
berean PRF-ak desberdintzapen osteoblastikoa eta kaltzifikaturiko hezur matrize
produkzioa maximizatu du.
4. BAS titanio azalera plasmatik eratorritako PRF-arekin konbinaturik, gDPSC-en
zelula hezur-sortzaileetarako desberdintzapen osteoblastikoa bultzatu du.
Emaitza hauek, klinika praktika ohikoetan zabalduriko plasmatik eratorritako
fibrina koaguluaren erabilerari laguntza esperimentala eman diote, mikro-
porodun titanio inplante azaleren aldameneko hezur produkzioa bultzatzeko.
5. Ti6AL4V eta BAS titanio azaleretan hazitako gDPSC eta gBMSC-en ikerketa
konparatiboak, gDPSC-ek ugalketa eta mineralizazio handiagoa dutela erakutsi
dute gBMSC-ekin alderatuta, baina esanahi estatistikoaren faltaren ondorioz,
datu esperimental gehiagoren beharra erakutsi dute ondorio sendoak
ateratzeko. Isolamendu errazago eta inbasibotasun txikiagoa, ugaltze ratio altu
113
eta hezur mineralen deposizioek erakutsi dutenez, gDPSC-ak gBMSC-ak baino

aukera hobeagoa direla erakutsi dute hezur birsortze terapietarako.
6. Dezelularizatutako txerri ehun adiposoa-k (pDAT) gDPSC-en itsaspen eta
bateragarri-tasunean lagundu du.
7. pDAT-k gDPSC-en desberdintzapen osteoblastikoa lagundu du kaltzifikaturiko
hezur matrize produkzioarekin, mintz barneko osifikazioa eta Sharpey fibra-
antzeko atxikimendu egituren formakuntzaren bidez.
8. Ehun adiposo material gordina material iturri erlatiboki ugaria eta eskuragarria
dela kontuan izanik, eta DAT zein gDPSC-ak giza emaileetatik isolatuak izan
daitezkeenez, aukera paregabea ematen du terapia kliniko pertsonalizatuetan
konbinaturik erabili ahal izateko hezur kaltetuen sendaketa eta hortz
inplantologiarentzako.
114
I Eranskina
patenteak
I Eranskina (patenteak)
(12) INTERNATIONAL APPLICATION PUBLISHED UNDER TUE PATENT COOPERATION TREATY (PCT)
(19) World Intellectual

Property
(10) International Pu blication
Organization
09 January 2020 (09.01.2020) WIPOI PCT
International Bureau Number

(43) International Publication WO 2020/007878 Al
Date
(51) International Patent Classification:
A61K35/28 (2015.01) C12N 5/0775 (2010.01)
(21) International Application Number:
PCT/EP2019/067769
(22) International Filing Date:
02 July 2019 (02.07.2019)
(25) Filing Language: English
(26) Publication Language: English
(30) Priority Data:
18382492.9 03 July 2018 (03.07.2018)
(71) Applicants: UNIVERSIDAD DEL PAís VASCO - EUSKAL HERRIKO UNIBERTSITATEA [ES/ESI•, OTRI,
Edificio Rectorado, C.Barrio Sarriena s/n, 48940 LEIOA (ES). ACIIUCARRO BASQUE CENTER FOR NEU-
ROSCIENCE FUNDAZIOA [ES/ESI•, Science Park of the
UPV/EHU, Sede Building, 3rd floor, Barrio Sarriena, s/n, 48940 LEIOA (ES).
(72) Inventors: PINEDA MARTÍ, José Ramón; ACHUCAR-
RO BASQUE CENTER FOR NEUROSCIENCE FUN-
DAZIOA, Science Park of the UPV/EHU, Sede Building, 3rd floor, Barrio Sarriena, sin, 48940 LEIOA (ES).
LUZURIAGA GONZÁLEZ, Jon; Dep. Bio. cel. Facultad de Medicina y Enfermería, UPV/EHU, 48940 LEIOA
(ES). UNDA RODRÍGUEZ, Fernando; Dep. Bio. cel. Facultad de Medicina y Enfermeffa, UPV/EHU, 48940
LEIOA (ES). PASTOR ALONSO, Oier•, ACHUCARRO BASQUE CENTER FOR NEUROSCIENCE FUN-
DAZIOA, Science Park of the UPV/EHU, Sede Building, 3rd floor, San-iena, sin, 48940 LEIOA (ES).
ENCINAS PÉREZ, Juan Manuel; ACHUCARRO BASQUE
CENTER FOR NEUROSCIENCE FUNDAZIOA, Science Park ofthe UPV/EHU, Scdc Building, 3rd floor, Bam
Sarfiena, 48940 LEIOA (ES). 'BARRETXE BILBAO, Gaskon; Dcp. Bio. Ccl. Facultad dc Medicina y
Ellfcrmcría,
UPV/EHU, 48940 LEIOA (ES). IRASTORZA EPELDE, Igor; Dcp. Bio. Ccl. Facultad dc Medicina y
Enfcrmcría, UPV/EHU, 48940 LEIOA CES).
(74) Agent: ZBM PATENTS - ZEA, BARLOCCI & MARKVARDSEN; Rambla Catalunya 123, 08008 Barcelona
CES).
(81) Designated States (unless otherwise indica/ed, ./ôr evey:v kind ofna/Ìona/ pro/ec/Ìon available): AE,
AG, AL, AM AO, AT, AU, AZ, BA, BB, BG, Bil, BN, BR, BW, BY, BZ,
CA, Cll, CL, CN, CO, CR, CU, CZ, DE, D], DR, DM, DO,
117
HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KM, RN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, W, LY, MA, MD, ME,
MG, MK, MN, MW, NIX, MY, MZ, NA, NG, M, NO, NZ, 0M, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW,
SA, SC, SD, SE, SG, SK, SL, SM, ST, SV, sy, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM,
ZW.
(84) Designated States (unless otherwise indica/ed, for evuy kind of regional pro/ec/Žon available): ARIPO
(B W, GM,
UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, TM), European (AL, AT, BE, BG, CM, cy, CZ, DE, DR,
EE, ES, Fl, FR, GB, GR, HR, HU, IE, IS, IT, LT, W, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, Sl, SK, SM,
TR), OAPI (BF, BJ, CF, CG, Cl, CM, GA, GN, GQ, GW, KM, ML, MR, NE, SN, TD, TG).
Declarations under Rule 4.17:

as to applicant's entitlement to apply for and he granted a patent (Rule 4.1 7(ii))
Published:
with international search report (Art. 21 (3)) with sequence listing part of
description (Rule 5.2(a))
(54) Title: CELLULAR AGGREGATES FOR USE IN VASCULARISATION THERAPY

(57) Abstract: Thc prcscnl invcnlion provides a scrum-frcc cndothclial cell diffcrcnlialion cullurc medium
comprising (a) a basal cullurc medium and (b) an cndothclial cell diffcrcnlialion combination of EGF-FGFand
VEGF prolcin, whcrcin lhc amount of EGF is highcr than lhc amount of FGF prolcin. Thc prcscnl invcnlion
furlhcr provides a process for lhc preparation of cellular aggrcgalc suspensions comprising differentiated
endothelial cells from dental stem cells using the serum-free medium, as well as the use of the rcsulling
suspension in therapy.
II Eranskina
artikukuak
II Ernaskina (artikuluak)
REVIEW
published:16 October 2015
doi:10.3389/fphys.2015.0028 9
Dental pulp stem cells as a

Edited by:
Thimios Mitsiadis,
multifaceted tool for bioengineering
University of Zurich, Switzerland and the regeneration of
Reviewed by:
Gianpaolo Papaccio, craniomaxillofacial tissues
Second University of Naples, Italy
Zhi Chen,
Maitane Aurrekoetxea †, Patricia Garcia-Gallastegui †, Igor Irastorza, Jon
Wuhan University, China
Luzuriaga, Verónica Uribe-Etxebarria, Fernando Unda* and Gaskon
*Correspondence:
Fernando Unda fernando.unda@ehu.eus; Ibarretxe*
Gaskon Ibarretxe
Department of Cell Biology and Histology, Faculty of Medicine and Dentistry, University of the
gaskon.ibarretxe@ehu.eus
Basque Country, Leioa, Spain
†
These authors have contributed equally to
this work.
Dental pulp stem cells, or DPSC, are neural crest-derived cells with
Specialty section: an outstanding capacity to differentiate along multiple cell lineages of
Craniofacial Biology, a
interest for cell therapy. In particular, highly efficient
section of the journal osteo/dentinogenic differentiation of DPSC can be achieved using
Frontiers in Physiology
simple in vitro protocols, making these cells a very attractive and
Received: 31 July 2015
Accepted: 01 October 2015
promising tool for the future treatment of dental and periodontal
Published: 16 October 2015 diseases. Among craniomaxillofacial organs, the tooth and salivary
Citation: gland are two such cases in which complete regeneration by tissue
Aurrekoetxea M, Garcia-Gallastegui P, engineering using DPSC appears to be possible, as research over the
Irastorza I, Luzuriaga J,
Uribe-Etxebarria V, Unda F and last decade has made substantial progress in experimental models of
Ibarretxe G (2015) Dental pulp stem cells partial or total regeneration of both organs, by cell recombination
as a multifaceted tool for bioengineering
and the regeneration of craniomaxillofacial technology. Moreover, DPSC seem to be a particularly good choice
tissues. Front. Physiol. 6:289. doi: for the regeneration of nerve tissues, including injured or transected
10.3389/fphys.2015.00289
cranial nerves. In this context, the oral cavity appears to be an
excellent testing ground for new regenerative therapies using DPSC.
However, many issues and challenges need yet to be addressed
before these cells can be employed in clinical therapy. In this review,
we point out some important aspects on the biology of DPSC with
regard to their use for the reconstruction of different
craniomaxillofacial tissues and organs, with special emphasis on
cranial bones, nerves, teeth, and salivary glands. We suggest new
ideas and strategies to fully exploit the capacities of DPSC for
bioengineering of the aforementioned tissues.
Keywords: DPSC, differentiation, tooth, bone, salivary gland, nerve, cell therapy
121
ORIGINALRESEARC H
published:30 March 2016
doi:10.3389/fcell.2016.0002 5
Wnt/β-Catenin Regulates the Activity of

Edited by:
Epiprofin/Sp6, SHH, FGF, and BMP to Coordinate
Cesare Indiveri, the Stages of Odontogenesis
University of Calabria, Italy
Maitane Aurrekoetxea1, Igor Irastorza1, Patricia García-Gallastegui1,
Reviewed by: Lucia Jiménez-Rojo2, Takashi Nakamura3, Yoshihiko Yamada4, Gaskon
Agnes Bloch-Zupan, Ibarretxe1 and Fernando J. Unda1*
University of Strasbourg, France
1
Andreas Eisenreich, Department of Cell Biology and Histology, Faculty of Medicine and Dentistry, University of the Basque
Charité - University Medicine Berlin, Country UPV/EHU, Leioa, Spain, 2 Center of Dental Medicine, Institute of Oral Biology, University of
Germany Zurich, Zurich, Switzerland, 3 Division of
*Correspondence: Molecular Pharmacology and Cell Biophysics, Department of Oral Biology, Graduate School of
Fernando J. Unda Dentistry, Tohoku University,
fernandoundarodriguez@gmail.com Sendai, Japan, 4 Laboratory of Cell and Developmental Biology, National Institute of Dental and
Craniofacial Research,
Specialty section: National Institutes of Health, Bethesda, MD, USA
Cellular Biochemistry, a
section of the journal Background: We used an in vitro tooth development model to investigate
Frontiers in Cell and Developmental
Biology
the effects of overactivation of the Wnt/β-catenin pathway during
Received: 31 December 2015
odontogenesis by bromoindirubin oxime reagent (BIO), a specific
Accepted: 14 March 2016 inhibitor of GSK-3 activity.
Published: 30 March 2016
Results: Overactivating the Wnt/β-catenin pathway at tooth initiation
Citation:
Aurrekoetxea M, Irastorza I, upregulated and ectopically expressed the epithelial markers Sonic
García-Gallastegui P, Jiménez-Rojo L, Hedgehog (Shh), Epiprofin (Epfn), and Fibroblast growth factor8 (Fgf8),
Nakamura T, Yamada Y, Ibarretxe G and
Unda FJ (2016) Wnt/β-Catenin which are involved in the delimitation of odontogenic fields in the oral
Regulates the Activity of ectoderm.This result indicated an ectopic extension of the odontogenic
Epiprofin/Sp6, SHH, FGF, and BMP to
Coordinate the Stages of potential. During tooth morphogenesis, Fibroblast growth factor4 (Fgf4),
Odontogenesis. Front. Cell Dev. Fibroblast growth factor10 (Fgf10), Muscle segment homeobox 1 (Msx-
Biol. 4:25. doi:
10.3389/fcell.2016.00025 1), Bone Morphogenetic protein 4 (Bmp4), and Dickkopf WNT signaling
pathway inhibitor 1 (Dkk1) were overexpressed in first molars cultured
with BIO. Conversely, the expression levels of Wingless integration site
10b (Wnt-10b) and Shh were reduced. Additionally, the odontoblast
differentiation markers Nestin and Epfn showed ectopic overexpression
in the dental mesenchyme of BIO-treated molars. Moreover, alkaline
phosphatase activity increased in the dental mesenchyme, again
suggesting aberrant, ectopic mesenchymal cell differentiation. Finally,
Bmp4 downregulated Epfn expression during dental morphogenesis.
Conclusions: We suggest the presence of a positive feedback loop
wherein Epfn and β-catenin activate each other.The balance of the
expression of these two molecules is essential for proper tooth
development. We propose a possible link between Wnt, Bmp, and Epfn
that would critically determine the correct patterning of dental cusps and
the differentiation of odontoblasts and ameloblasts.
Keywords: Wnt/β-catenin, tooth development, GSK-3, BIO-culture, Epiprofin/Sp6, odontogenesis
123
Cellular Physiology Cell Physiol Biochem 2019;52:1361-1380

DOI:DOI: 10.33594/00000009 © 2019 The Aut Cell hor(s). Published by © 2019 The
and Biochemistry 10.33594/000000096 6 Physiol Bioc Author(s)
Published online: 11 May
1361 hem Press GmbH&Co. KGPublished
2019Published online: 11 May by Cell Physiol Biochem
2019
Original Paper Luzuriaga et al.: BDNF and NT3 Reprogram Huma Press GmbH&Co. KG, Duesseldorf
Accepted: 6 May 2019 n Dental Pulp Stem Cells to
Neuralwww.cellphysiolbiochem.com
Crest Progenitors
This article is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International
License (CC BY-NC-ND). Usage and distribution for commercial purposes as well as any distribution of modified
material requires written permission.
BDNF and NT3 Reprogram Human Ectomesenchymal Dental Pulp

Stem Cells to Neurogenic and Gliogenic Neural Crest Progenitors
Cultured in Serum-Free Medium
Jon Luzuriagaa Jose Ramon Pinedaa,b Igor Irastorzaa
Veronica Uribe-Etxebarriaa Patricia García-Gallasteguia
Juan Manuel Encinasb,d Pablo Chameroc Fernando Undaa
Gaskon Ibarretxea
a
Department of Cell Biology and Histology, Faculty of Medicine and Nursing, University of the Basque Country,
UPV/EHU, Leioa, Spain, bAchucarro Basque Center for Neuroscience, UPV/EHU Scientific Park,
Leioa, Spain, cLaboratoire de Physiologie de la Reproduction et des Comportements UMR 0085 INRA/
CNRS/IFCE/Université de Tours, Nouzilly, France, dIkerbasque, The Basque Foundation for Science, Bilbao,
Spain
Key Words: Serum-free culture media • Calcium imaging • Cell differentiation • Dental Pulp Stem
Cells • Brain Derived Neurotrophic Factor
Abstract
Background/Aims: Human Dental Pulp Stem Cells (hDPSCs) are one of the most promising
types of cells to regenerate nerve tissues. Standard DMEM+10% fetal bovine serum (FBS) culture
medium allows a fast expansion of hDPSC as a surface-adherent cell monolayer. However, the
use of FBS also compromises the clinical use of these protocols, and its longterm presence favors
hDPSCs differentiation toward mesenchymal cell-derived lineages, at the expense of a reduced
capability to generate neural cells. The objective of this work was to characterize the role of
neurotrophin signaling on hDPSCs using a serum-free culture protocol, and to assess the
neurogenic and gliogenic capacity of hDPSCs for future nerve tissue bioengineering and
regeneration. Methods: We compared the different expression of neurotrophin receptors by RT-
PCR, Q-PCR, and IF of hDPSCs cultured with different growth media in the presence or absence
of serum. Moreover, we assessed the response of hDPSCs to stimulation of neurotransmitter
receptors by live cell calcium imaging under these different media. Finally, we compared the
osteogenic potential of hDPSCs by Alizarin red staining, and the differentiation to
gliogenic/neurogenic fates by immunostaining for Schwann lineage
Gaskon Ibarretxe Cell Biology & Histology Department, Faculty of Medicine and Nursing, University of the Basque Country, UPV/ and
Jose R. Pineda EHU; Achucarro Basque Center for Neuroscience Fundazioa, Barrio Sarriena s/n; Sede Building 3rd floor, Leioa,
Bizkaia, 48940 (Spain) Tel. (+34) 946013218, E-Mail gaskon.ibarretxe@ehu.eus; jr.pineda@achucarro.org
125
European Cells and Materials Vol. 38 2019 (pages 201-214) I Irastorza et al.
hDPSCs with PRF and PRGF on biomimetic titanium DOI: 10.22203/eCM.v038a14 ISSN 1473-2262
ADHESION, INTEGRATION AND OSTEOGENESIS OF HUMAN

DENTAL PULP STEM CELLS ON BIOMIMETIC IMPLANT SURFACES
COMBINED WITH PLASMA DERIVED PRODUCTS
I. Irastorza1, J. Luzuriaga1, R. Martinez-Conde2, G. Ibarretxe1 and F. Unda1*
Department of Cell Biology and Histology. Faculty of Medicine and Nursing, University
1
of the Basque Country, UPV/EHU, Leioa, 48940, Bizkaia, Spain.

2Department of Stomatology II. Faculty of Medicine and Nursing, University of the Basque Country,
UPV/EHU, Leioa, 48940, Bizkaia, Spain.

Abstract
Dental implants are the usual therapy of choice in the dental clinic to replace a loss of natural teeth. Over
recent decades there has been an important progress in the design and manufacturing of titanium implant
surfaces with the goal of improving their osteointegration. In the present work, the aim was to evaluate the
usefulness of hDPSCs (human dental pulp stem cells), in combination with autologous plasma components,
for in vitro bone generation on biomimetic titanium dental implant materials. In this context, the combination
of hDPSCs stimulated by PRGF or PRF and cultured on standard Ti6A14V and biomimetic BAS™ (Avinent
Implant System) titanium surfaces were studied in order to evaluate possible enhancements in the
osteoblastic differentiation process out of human mesenchymal cells, as well as bone matrix secretion on the
implant surface. The results obtained in this in vitro model of osteogenesis suggested a combination of
biomimetic rough titanium surfaces, such as BAS™, with autologous plasma-derived fibrin-clot membranes
such as PRF and/or insoluble PRGF formulations, but not with an addition of water-soluble supplements of
plasma-derived growth factors, to maximise osteoblastic cell differentiation, bone generation, anchorage and
osteointegration of titanium-made dental implants.
Keywords: Dental pulp stem cells, titanium implants, osteoblast differentiation, platelet rich in growth
factors, platelet rich fibrin, biomimetic advanced surface.
*Address for correspondence: Fernando Unda, Cell Biology and Histology Department. Faculty of Medicine
and Nursing, University of the Basque Country, UPV/EHU, Leioa, 48940, Bizkaia, Spain. Telephone number:
+34 946012857 Email: fernandoundarodriguez@gmail.com
Copyright policy: This article is distributed in accordance with Creative Commons Attribution Licence
(http://creativecommons.org/licenses/by-sa/4.0/).
127
biomedicines
Article
Vasculogenesis from Human Dental Pulp Stem Cells

Grown in Matrigel with Fully Defined Serum-Free Culture
Media
Jon Luzuriaga 1 , Jon Irurzun 1, Igor Irastorza 1, Fernando Unda 1, Gaskon Ibarretxe 1,*,† and
Jose R. Pineda 1,2,*,†
1 Cell Biology and Histology Department, University of the Basque Country (UPV/EHU), 48940 Leioa, Spain;
jon.luzuriaga@ehu.eus (J.L.); jirurzun002@ikasle.ehu.eus (J.I.); igor.irastorza@ehu.eus (I.I.);
2 Achucarro Basque Center for Neuroscience, University of the Basque Country (UPV/EHU), 48940 Leioa, Spain
* Correspondence: gaskon.ibarretxe@ehu.eus (G.I.); joseramon.pinedam@ehu.eus or
jr.pineda@achucarro.org (J.R.P.); Tel.: +34-946-013-218 (G.I.); +34-946-012-426 (J.R.P.) † These
authors contributed equally to this work.
Received: 20 October 2020; Accepted: 5 November 2020; Published: 9 November 2020
Abstract: The generation of vasculature is one of the most important challenges in tissue
engineering and regeneration. Human dental pulp stem cells (hDPSCs) are some of the most
promising stem cell types to induce vasculogenesis and angiogenesis as they not only secrete
vascular endothelial growth factor (VEGF) but can also differentiate in vitro into both
endotheliocytes and pericytes in serum-free culture media. Moreover, hDPSCs can generate
complete blood vessels containing both endothelial and mural layers in vivo, upon transplantation
into the adult brain. However, many of the serum free media employed for the growth of hDPSCs
contain supplements of an undisclosed composition. This generates uncertainty as to which of its
precise components are necessary and which are dispensable for the vascular differentiation of
hDPSCs, and also hinders the transfer of basic research findings to clinical cell therapy. In this work,
we designed and tested new endothelial differentiation media with a fully defined composition
using standard basal culture media supplemented with a mixture of B27, heparin and growth
factors, including VEGF-A165 at different concentrations. We also optimized an in vitro Matrigel
assay to characterize both the ability of hDPSCs to differentiate to vascular cells and their capacity
to generate vascular tubules in 3D cultures. The description of a fully defined serum-free culture
medium for the induction of vasculogenesis using human adult stem cells highlights its potential as
a relevant innovation for tissue engineering applications. In conclusion, we achieved efficient
vasculogenesis starting from hDPSCs using serum-free culture media with a fully defined
composition, which is applicable for human cell therapy purposes.
Keywords: stem cells; DPSCs; neovasculogenesis; endothelial cells; Matrigel; vasculature
Biomedicines 2020, 8, 483; doi:10.3390/biomedicines8110483 www.mdpi.com/journal/biomedicines
129
cells
Article
Wnt-3a Induces Epigenetic Remodeling in Human Dental

Pulp Stem Cells
Verónica Uribe-Etxebarria 1,2, Patricia García-Gallastegui 1, Miguel Pérez-Garrastachu 1,
María Casado-Andrés 1,3, Igor Irastorza 1, Fernando Unda 1, Gaskon Ibarretxe 1,*,† and
Nerea Subirán 4,†
1 Cell Biology and Histology Department, University of the Basque Country (UPV/EHU), Barrio Sarriena, S/N,
48940 Leioa, Spain; vero18791@gmail.com (V.U.-E.); patricia.garcia@ehu.eus (P.G.-G.); mperez282@gmail.com
(M.P.-G.); mdcasado002@gmail.com (M.C.-A.); iirastorza004@gmail.com (I.I.); fernando.unda@ehu.eus (F.U.)
2 Pathology Department, New York University, 550 1st Avenue, New York, NY 10016, USA
3 Unité Mixte de Recherche UMR1029. INSERM-Université de Bordeaux, 33000 Bordeaux, France
4 Physiology Department, University of the Basque Country (UPV/EHU), Barrio Sarriena, S/N, 48940 Leioa, Spain;
nerea.subiran@ehu.eus
* Correspondence: gaskon.ibarretxe@ehu.eus; Tel.: +34-94-601-3218 †
Received: 12 November 2019; Accepted: 4 March 2020; Published: 7 March 2020
Abstract: Dental pulp stem cells (DPSCs) from adult teeth show the expression of a very complete
repertoire of stem pluripotency core factors and a high plasticity for cell reprogramming. Canonical
WntandNotchsignalingpathwaysregulatestemnessandtheexpressionofpluripotencycorefactorsin
DPSCs, and even very short-term (48 h) activations of the Wnt pathway induce a profound
remodeling of DPSCs at the physiologic and metabolic levels. In this work, DPSC cultures were
exposed to treatments modulating Notch and Wnt signaling, and also induced to differentiate to
osteo/adipocytes. DNA methylation, histone acetylation, histone methylation, and core factor
expression levels where assessed by mass spectroscopy, Western blot, and qPCR. A short-term
activation of Wnt signaling by WNT-3A induced a genomic DNA demethylation, and increased
histone acetylation and histone methylation in DPSCs. The efficiency of cell reprogramming
methods relies on the ability to surpass the epigenetic barrier, which determines cell lineage
specificity. This study brings important information about the regulation of the epigenetic barrier
by Wnt signaling in DPSCs, which could contribute to the development of safer and less
aggressive reprogramming methodologies with a view to cell therapy.
Keywords: dental pulp stem cells; chromatin remodeling; cell cycle; pluripotency; DNA methylation;
histone acetylation; histone methylation; Notch pathway; Wnt pathway
131
BASIC SCIENCE
Nanomedicine: Nanotechnology, Biology, and Medicine
31 (2021) 102314
Original Article nanomedjournal.com
Nanostructured scaffolds based on bioresorbable polymers and graphene oxide

induce the aligned migration and accelerate the neuronal differentiation of
neural stem cells
Yurena Polo, MSca,1, Jon Luzuriaga, PhDb,1, Jagoba Iturri, PhDc, Igor Irastorza, MScb,
José Luis Toca-Herrera, PhDc, Gaskon Ibarretxe, PhDb, Fernando Unda, PhDb, Jose-Ramon
Sarasua, PhDd, Jose Ramon Pineda, PhDb,e,⁎, Aitor Larrañaga, PhDd,
a
Polimerbio SL, Donostia-San Sebastian, Spain
b
Department of Cell Biology and Histology, Faculty of Medicine and Nursing, University of the Basque Country (UPV/EHU), Leioa,
Spain
c
Institute for Biophysics, Department of Nanobiotechnology, BOKU University of Natural Resources and Life Sciences, Vienna, Austria
d
Group of Science and Engineering of Polymeric Biomaterials (ZIBIO Group), Department of Mining, Metallurgy Engineering and
Materials Science & POLYMAT, University of the Basque Country (UPV/EHU), Bilbao, Spain
e
Achucarro Basque Center for Neuroscience, University of the Basque Country (UPV/EHU), Leioa, Spain
Revised 17 September 2020
Abstract
Withinthe field of neural tissue engineering,there is a huge need for the development of materials that promote the
adhesion,aligned migration and differentiation of stem cells into neuronal and supportive glial cells. In this study, we have
fabricated bioresorbable elastomeric scaffolds combining an ordered nanopatterned topography together with a surface
functionalization with graphene oxide (GO) in mild conditions. These scaffolds allowed the attachment of murine neural
stem cells (NSCs) without the need of any further coating of its surface with extracellular matrix adhesion proteins. The
NSCs were able to give rise to both immature neurons and supporting glial cells over the nanostructured scaffolds in vitro,
promoting their aligned migration in cell clusters following the nanostructured grooves. This system has the potential to
reestablish spatially oriented neural precursor cell connectivity, constituting a promising tool for future cellular therapy
including nerve tissue regeneration. © 2020 Elsevier Inc. All rights reserved.
Key words: Micro- and nanopatterning; Neural stem cells; Migration; Cell differentiation; Graphene oxide; Biodegradable polymer
Funding sources: Basque Government (GV/EJ) Regeneration of the nervous system still remains very challenging
Department of Education, Linguistic Politics and due to its limited plasticity and poor ability to heal ments for this
Culture (GIC 15/52, IT-927-16), MINECO «Ramón y specific biomedical application play a pivotal role. Much progress
Cajal» program RYC-2013-13450 (JRP), MINECO
has been made in determining the ideal features a biomaterial
PID2019104766RB-C21, The University of The Basque
Country (UPV/EHU) by GIU16/66, UFI 11/44, should have for its use as a neural replacement graft, and in
COLAB19/03 and IKERTU-2020.0155. GV/EJ IT831- understanding the interactions of growing axons within
13, Hazitek ZE-2019/00012-IMABI and ELKARTEK thesebiomaterials;however,theregenerationlevelsinducedbythe
KK-2019/ 00093. Polimerbio and Y. P. have a Bikaintek biomaterial usually do not match those obtained by nerve tissue
PhD grant (20-AF-W2-201800001) and J.L. has a autografts and the development of new and effective nerve
UPV/EHU grant DOKBERRI 2019 (DOCREC19/49). regeneration therapies is still an urgent clinical need.2,3
Conflict of interest: The authors declare that there is no
conflict of interest. The biomaterials for nerve tissue regeneration should be
Correspondence to: J.R. Pineda, Cell Signaling lab,biocompatible and biodegradable, while providing structural cues
University of the Basque Country (UPV/EHU), Leioa, Spain. that promote oriented axon regeneration and guidance signals
Correspondence to: A. Larrañaga, Group of Science from extracellular matrix (ECM)-like components. Additionally,
and Engineering of Polymeric Biomaterials (ZIBIO they shouldalsopresentlong-
Group), University of the Basque Country (UPV/EHU). termstoragecapabilityandeaseofhandling/ suturing.4–6 One
E-mail addresses: joseramon.pinedam@ehu.eus, (J.R. important aspect to take in consideration is that the
Pineda), aitor.larranagae@ehu.eus. (A. Larrañaga).
1
https://doi.org/10.1016/j.nano.2020.102314
1549-9634/© 2020 Elsevier Inc. All rights reserved.
133
Bibliografia
Bibliografia
Aaron JE (2012) Periosteal Sharpey’s fibers: a novel bone matrix regulatory

system? Front Endocrinol (Lausanne) 3: 98. doi:10.3389/fendo.2012.00098.
Abbasi N, Abdal-hay A, Hamlet S, Graham E, Ivanovski S (2019) Effects of Gradient

and Offset Architectures on the Mechanical and Biological Properties of 3-D Melt
Electrowritten (MEW) Scaffolds. ACS Biomater. Sci. Eng. 5: 3448–3461.
doi:10.1021/acsbiomaterials.8b01456.
Abe K, Saito H (2000) Neurotrophic effect of basic fibroblast growth factor is

mediated by the p42/p44 mitogen-activated protein kinase cascade in cultured rat
cortical neurons. Brain Res Dev Brain Res 122: 81–85. doi:10.1016/s0165-
3806(00)00054-7.
Ackema KB, Charité J (2008) Mesenchymal stem cells from different organs are
characterized by distinct topographic Hox codes. Stem Cells Dev 17: 979–991.
doi:10.1089/scd.2007.0220.
Ajlan SA, Ashri NY, Aldahmash AM, Alnbaheen MS (2015) Osteogenic

differentiation of dental pulp stem cells under the influence of three different materials.
BMC Oral Health 15: 132. doi:10.1186/s12903-015-0113-8.
Albrektsson T, Brånemark PI, Hansson HA, Lindström J (1981) Osseointegrated

titanium implants. Requirements for ensuring a long-lasting, direct bone-to-implant
anchorage in man. Acta Orthop Scand 52: 155–170.
Albrektsson T, Johansson C (2001) Osteoinduction, osteoconduction and

osseointegration. Eur Spine J 10 Suppl 2: S96-101. doi:10.1007/s005860100282.
Almeida-Porada G, Porada C, Zanjani ED (2001) Adult stem cell plasticity and

methods of detection. Rev Clin Exp Hematol 5: 26–41. doi:10.1046/j.1468-
0734.2001.00027.x.
137
Alraies A, Waddington RJ, Sloan AJ, Moseley R (2020) Evaluation of Dental Pulp
Stem Cell Heterogeneity and Behaviour in 3D Type I Collagen Gels. Biomed Res Int 2020:
3034727. doi:10.1155/2020/3034727.
Amid R, Kadkhodazadeh M, Enssi M, Dehanvi F (2021) In Vitro Activity of Dental

Pulp Stem Cells versus the Bone Marrow Stem Cells Cultured in Presence of a Bone
Allograft. J Long Term Eff Med Implants 31: 7–14.
doi:10.1615/JLongTermEffMedImplants.2020036956.
Amini AR, Laurencin CT, Nukavarapu SP (2012) Bone tissue engineering: recent
advances and challenges. Crit Rev Biomed Eng 40: 363–408.
doi:10.1615/critrevbiomedeng.v40.i5.10.
Anderson JM (2001) Biological Responses to Materials. Annual Review of

Materials Research 31: 81–110. doi:10.1146/annurev.matsci.31.1.81.
Anfossi G, Trovati M, Mularoni E, Massucco P, Calcamuggi G, Emanuelli G (1989)

Influence of propranolol on platelet aggregation and thromboxane B2 production from
platelet-rich plasma and whole blood. Prostaglandins Leukot Essent Fatty Acids 36: 1–7.
doi:10.1016/0952-3278(89)90154-3.
Angelini A, Castellani C, Vescovo G, Thiene G (2004) Pathological evidence of

stem cell regeneration in the heart. Int J Cardiol 96: 499–504.
doi:10.1016/j.ijcard.2004.07.001.
Anitua E (1999) Plasma rich in growth factors: preliminary results of use in the
preparation of future sites for implants. Int J Oral Maxillofac Implants 14: 529–535.
Anitua E, Alkhraisat MH, Orive G (2012) Perspectives and challenges in

regenerative medicine using plasma rich in growth factors. J Control Release 157: 29–
38. doi:10.1016/j.jconrel.2011.07.004.
138
Bibliografia
Anitua E, Orive G, Pla R, Roman P, Serrano V, Andía I (2009) The effects of PRGF
on bone regeneration and on titanium implant osseointegration in goats: a histologic
and histomorphometric study. J Biomed Mater Res A 91: 158–165.
doi:10.1002/jbm.a.32217.
Anitua E, Prado R, Troya M, Zalduendo M, de la Fuente M, Pino A, Muruzabal F,

Orive G (2016a) Implementation of a more physiological plasma rich in growth factor
(PRGF) protocol: Anticoagulant removal and reduction in activator concentration.
Platelets 27: 459–466. doi:10.3109/09537104.2016.1143921.
Anitua E, Tejero R, Zalduendo MM, Orive G (2013) Plasma rich in growth factors
promotes bone tissue regeneration by stimulating proliferation, migration, and
autocrine secretion in primary human osteoblasts. J. Periodontol. 84: 1180–1190.
doi:10.1902/jop.2012.120292.
Anitua E, Troya M, Zalduendo M, Tejero R, Orive G (2016b) Progress in the Use

of Autologous Regenerative Platelet-based Therapies in Implant Dentistry. Curr Pharm
Biotechnol 17: 402–413.
Anjos-Afonso F, Bonnet D (2007) Nonhematopoietic/endothelial SSEA-1+ cells

define the most primitive progenitors in the adult murine bone marrow mesenchymal
compartment. Blood 109: 1298–1306. doi:10.1182/blood-2006-06-030551.
Annunziata M, Guida L (2015) The Effect of Titanium Surface Modifications on

Dental Implant Osseointegration. Front Oral Biol 17: 62–77. doi:10.1159/000381694.
Arthur A, Rychkov G, Shi S, Koblar SA, Gronthos S (2008) Adult human dental pulp
stem cells differentiate toward functionally active neurons under appropriate
environmental cues. Stem Cells 26: 1787–1795. doi:10.1634/stemcells.2007-0979.
139
Arthur A, Zannettino A, Gronthos S (2009) The therapeutic applications of

multipotential mesenchymal/stromal stem cells in skeletal tissue repair. J Cell Physiol
218: 237–245. doi:10.1002/jcp.21592.
Atari M, Barajas M, Hernández-Alfaro F, Gil C, Fabregat M, Ferrés Padró E, Giner

L, Casals N (2011) Isolation of pluripotent stem cells from human third molar dental pulp.
Histol Histopathol 26: 1057–1070. doi:10.14670/HH-26.1057.
Atari M, Caballé-Serrano J, Gil-Recio C, Giner-Delgado C, Martínez-Sarrà E,

García-Fernández DA, Barajas M, Hernández-Alfaro F, Ferrés-Padró E, Giner-Tarrida L
(2012a) The enhancement of osteogenesis through the use of dental pulp pluripotent
stem cells in 3D. Bone 50: 930–941. doi:10.1016/j.bone.2012.01.005.
Atari M, Gil-Recio C, Fabregat M, García-Fernández D, Barajas M, Carrasco MA,

Jung H-S, Alfaro FH, Casals N, Prosper F, Ferrés-Padró E, Giner L (2012b) Dental pulp of
the third molar: a new source of pluripotent-like stem cells. J Cell Sci 125: 3343–3356.
doi:10.1242/jcs.096537.
Aurrekoetxea M, Garcia-Gallastegui P, Irastorza I, Luzuriaga J, Uribe-Etxebarria V,

Unda F, Ibarretxe G (2015) Dental pulp stem cells as a multifaceted tool for
bioengineering and the regeneration of craniomaxillofacial tissues. Front Physiol 6.
doi:10.3389/fphys.2015.00289.
Bae S, Kang B, Lee H, Luu H, Mullins E, Kingsley K (2021) Characterization of

Dental Pulp Stem Cell Responses to Functional Biomaterials Including Mineralized
Trioxide Aggregates. J Funct Biomater 12. doi:10.3390/jfb12010015.
Bakopoulou A, Leyhausen G, Volk J, Tsiftsoglou A, Garefis P, Koidis P, Geurtsen

W (2011) Comparative analysis of in vitro osteo/odontogenic differentiation potential
of human dental pulp stem cells (DPSCs) and stem cells from the apical papilla (SCAP).
Arch Oral Biol 56: 709–721. doi:10.1016/j.archoralbio.2010.12.008.
140
Bibliografia
Baulies A, Angelis N, Li VSW (2020) Hallmarks of intestinal stem cells.

Development 147. doi:10.1242/dev.182675.
Beltrami AP, Barlucchi L, Torella D, Baker M, Limana F, Chimenti S, Kasahara H,

Rota M, Musso E, Urbanek K, Leri A, Kajstura J, Nadal-Ginard B, Anversa P (2003) Adult
cardiac stem cells are multipotent and support myocardial regeneration. Cell 114: 763–
776. doi:10.1016/s0092-8674(03)00687-1.
Berthiaume F, Maguire TJ, Yarmush ML (2011) Tissue engineering and

regenerative medicine: history, progress, and challenges. Annu Rev Chem Biomol Eng 2:
403–430. doi:10.1146/annurev-chembioeng-061010-114257.
Bertolini MM, Del Bel Cury AA, Pizzoloto L, Acapa IRH, Shibli JA, Bordin D (2019)
Does traumatic occlusal forces lead to peri-implant bone loss? A systematic review. Braz
Oral Res 33: e069. doi:10.1590/1807-3107bor-2019.vol33.0069.
Bhat S, Chiew GGY, Ng JX, Lin X, Seetharam RN (2021) Optimization of culture

conditions for human bone marrow-derived mesenchymal stromal cell expansion in
macrocarrier-based tide motion system. Biotechnol J: e2000540.
doi:10.1002/biot.202000540.
Bhuptani RS, Patravale VB (2016) Porous microscaffolds for 3D culture of dental

pulp mesenchymal stem cells. Int J Pharm 515: 555–564.
doi:10.1016/j.ijpharm.2016.10.040.
Bianchi M, Urquia Edreira ER, Wolke JGC, Birgani ZT, Habibovic P, Jansen JA,
Tampieri A, Marcacci M, Leeuwenburgh SCG, van den Beucken JJJP (2014) Substrate
geometry directs the in vitro mineralization of calcium phosphate ceramics. Acta
Biomater 10: 661–669. doi:10.1016/j.actbio.2013.10.026.
141
Bianco P, Riminucci M, Gronthos S, Robey PG (2001) Bone marrow stromal stem

cells: nature, biology, and potential applications. Stem Cells 19: 180–192.
doi:10.1634/stemcells.19-3-180.
Blazsek I, Delmas Marsalet B, Legras S, Marion S, Machover D, Misset JL (1999)

Large scale recovery and characterization of stromal cell-associated primitive
haemopoietic progenitor cells from filter-retained human bone marrow. Bone Marrow
Transplant 23: 647–657. doi:10.1038/sj.bmt.1701616.
Boiret N, Rapatel C, Veyrat-Masson R, Guillouard L, Guérin J-J, Pigeon P,

Descamps S, Boisgard S, Berger MG (2005) Characterization of nonexpanded
mesenchymal progenitor cells from normal adult human bone marrow. Exp Hematol 33:
219–225. doi:10.1016/j.exphem.2004.11.001.
Boyan BD, Cheng A, Olivares-Navarrete R, Schwartz Z (2016a) Implant Surface

Design Regulates Mesenchymal Stem Cell Differentiation and Maturation. Adv. Dent.
Res. 28: 10–17. doi:10.1177/0022034515624444.
Boyan BD, Cheng A, Olivares-Navarrete R, Schwartz Z (2016b) Implant Surface

Design Regulates Mesenchymal Stem Cell Differentiation and Maturation. Adv Dent Res
28: 10–17. doi:10.1177/0022034515624444.
Breine U, Brånemark PI (1980) Reconstruction of alveolar jaw bone. An

experimental and clinical study of immediate and preformed autologous bone grafts in
combination with osseointegrated implants. Scand J Plast Reconstr Surg 14: 23–48.
doi:10.3109/02844318009105733.
Bühring H-J, Battula VL, Treml S, Schewe B, Kanz L, Vogel W (2007) Novel markers
for the prospective isolation of human MSC. Ann N Y Acad Sci 1106: 262–271.
doi:10.1196/annals.1392.000.
142
Bibliografia
Cao C, Dong Y, Dong Y (2005) [Study on culture and in vitro osteogenesis of blood-
derived human mesenchymal stem cells]. Zhongguo Xiu Fu Chong Jian Wai Ke Za Zhi 19:
642–647.
Caplan AI (1991) Mesenchymal stem cells. J. Orthop. Res. 9: 641–650.

doi:10.1002/jor.1100090504.
Carnevale G, Pisciotta A, Riccio M, Bertoni L, De Biasi S, Gibellini L, Zordani A,

Cavallini GM, La Sala GB, Bruzzesi G, Ferrari A, Cossarizza A, de Pol A (2018) Human
dental pulp stem cells expressing STRO-1, c-kit and CD34 markers in peripheral nerve
regeneration. J Tissue Eng Regen Med 12: e774–e785. doi:10.1002/term.2378.
Castro-Malaspina H, Gay RE, Resnick G, Kapoor N, Meyers P, Chiarieri D,

McKenzie S, Broxmeyer HE, Moore MA (1980) Characterization of human bone marrow
fibroblast colony-forming cells (CFU-F) and their progeny. Blood 56: 289–301.
Chamberlain G, Fox J, Ashton B, Middleton J (2007) Concise review:

mesenchymal stem cells: their phenotype, differentiation capacity, immunological
features, and potential for homing. Stem Cells 25: 2739–2749.
doi:10.1634/stemcells.2007-0197.
Chang C-C, Chang K-C, Tsai S-J, Chang H-H, Lin C-P (2014) Neurogenic
differentiation of dental pulp stem cells to neuron-like cells in dopaminergic and motor
neuronal inductive media. J Formos Med Assoc 113: 956–965.
doi:10.1016/j.jfma.2014.09.003.
Chaudhari AA, Vig K, Baganizi DR, Sahu R, Dixit S, Dennis V, Singh SR, Pillai SR
(2016) Future Prospects for Scaffolding Methods and Biomaterials in Skin Tissue
Engineering: A Review. Int J Mol Sci 17. doi:10.3390/ijms17121974.
143
Chen X, Fu Q, Jin Y, Li M, Yang R, Cui X, Gong M (2017) In vitro studying corrosion

behavior of porous titanium coating in dynamic electrolyte. Mater Sci Eng C Mater Biol
Appl 70: 1071–1075. doi:10.1016/j.msec.2016.03.044.
Chen YK, Huang AHC, Chan AWS, Lin LM (2016) Human dental pulp stem cells
derived from cryopreserved dental pulp tissues of vital extracted teeth with disease
demonstrate hepatic-like differentiation. J Tissue Eng Regen Med 10: 475–485.
doi:10.1002/term.1763.
Cheng L, Qasba P, Vanguri P, Thiede MA (2000) Human mesenchymal stem cells

support megakaryocyte and pro-platelet formation from CD34(+) hematopoietic
progenitor cells. J Cell Physiol 184: 58–69. doi:10.1002/(SICI)1097-
4652(200007)184:1<58::AID-JCP6>3.0.CO;2-B.
Chichester CO, Fernández M, Minguell JJ (1993) Extracellular matrix gene

expression by human bone marrow stroma and by marrow fibroblasts. Cell Adhes
Commun 1: 93–99. doi:10.3109/15419069309095685.
Choi YC, Choi JS, Kim BS, Kim JD, Yoon HI, Cho YW (2012) Decellularized
extracellular matrix derived from porcine adipose tissue as a xenogeneic biomaterial for
tissue engineering. Tissue Eng Part C Methods 18: 866–876.
doi:10.1089/ten.TEC.2012.0009.
Chrcanovic BR, Kisch J, Albrektsson T, Wennerberg A (2018) A retrospective study

on clinical and radiological outcomes of oral implants in patients followed up for a
minimum of 20 years. Clin Implant Dent Relat Res 20: 199–207. doi:10.1111/cid.12571.
Civin CI, Trischmann T, Kadan NS, Davis J, Noga S, Cohen K, Duffy B, Groenewegen
I, Wiley J, Law P, Hardwick A, Oldham F, Gee A (1996) Highly purified CD34-positive cells
reconstitute hematopoiesis. J Clin Oncol 14: 2224–2233.
doi:10.1200/JCO.1996.14.8.2224.
144
Bibliografia
Coelho PG, Granjeiro JM, Romanos GE, Suzuki M, Silva NRF, Cardaropoli G,
Thompson VP, Lemons JE (2009) Basic research methods and current trends of dental
implant surfaces. J. Biomed. Mater. Res. Part B Appl. Biomater. 88: 579–596.
doi:10.1002/jbm.b.31264.
Coelho PG, Jimbo R, Tovar N, Bonfante EA (2015) Osseointegration: hierarchical

designing encompassing the macrometer, micrometer, and nanometer length scales.
Dent Mater 31: 37–52. doi:10.1016/j.dental.2014.10.007.
Coli P, Jemt T (2021) Are marginal bone level changes around dental implants
due to infection? Clin Implant Dent Relat Res. doi:10.1111/cid.12971.
Conget PA, Minguell JJ (1999) Phenotypical and functional properties of human

bone marrow mesenchymal progenitor cells. J Cell Physiol 181: 67–73.
doi:10.1002/(SICI)1097-4652(199910)181:1<67::AID-JCP7>3.0.CO;2-C.
Connelly JT, Wilson CG, Levenston ME (2008) Characterization of proteoglycan

production and processing by chondrocytes and BMSCs in tissue engineered constructs.
Osteoarthritis and Cartilage 16: 1092–1100. doi:10.1016/j.joca.2008.01.004.
Crisan M, Yap S, Casteilla L, Chen C-W, Corselli M, Park TS, Andriolo G, Sun B,
Zheng B, Zhang L, Norotte C, Teng P-N, Traas J, Schugar R, Deasy BM, Badylak S, Buhring
H-J, Giacobino J-P, Lazzari L, Huard J, Péault B (2008) A perivascular origin for
mesenchymal stem cells in multiple human organs. Cell Stem Cell 3: 301–313.
doi:10.1016/j.stem.2008.07.003.
Cuthbert RJ, Giannoudis PV, Wang XN, Nicholson L, Pawson D, Lubenko A, Tan
HB, Dickinson A, McGonagle D, Jones E (2015) Examining the Feasibility of Clinical Grade
CD271+ Enrichment of Mesenchymal Stromal Cells for Bone Regeneration. PLoS One 10.
doi:10.1371/journal.pone.0117855.
145
Dagnino APA, Chagastelles PC, Medeiros RP, Estrázulas M, Kist LW, Bogo MR,
Weber JBB, Campos MM, Silva JB (2020) Neural Regenerative Potential of Stem Cells
Derived from the Tooth Apical Papilla. Stem Cells Dev 29: 1479–1496.
doi:10.1089/scd.2020.0121.
Davies OG, Cooper PR, Shelton RM, Smith AJ, Scheven BA (2015) A comparison
of the in vitro mineralisation and dentinogenic potential of mesenchymal stem cells
derived from adipose tissue, bone marrow and dental pulp. J Bone Miner Metab 33:
371–382. doi:10.1007/s00774-014-0601-y.
DE Colli M, Radunovic M, Zizzari VL, DI Giacomo V, DI Nisio C, Piattelli A, Calvo

Guirado JL, Zavan B, Cataldi A, Zara S (2018) Osteoblastic differentiating potential of
dental pulp stem cells in vitro cultured on a chemically modified microrough titanium
surface. Dent Mater J 37: 197–205. doi:10.4012/dmj.2016-418.
Delorme B, Charbord P (2007) Culture and characterization of human bone

marrow mesenchymal stem cells. Methods Mol Med 140: 67–81. doi:10.1007/978-1-
59745-443-8_4.
Denham M, Conley B, Olsson F, Cole TJ, Mollard R (2005) Stem cells: an overview.
Curr Protoc Cell Biol Chapter 23: Unit 23.1. doi:10.1002/0471143030.cb2301s28.
Dexheimer V, Gabler J, Bomans K, Sims T, Omlor G, Richter W (2016) Differential

expression of TGF-β superfamily members and role of Smad1/5/9-signalling in chondral
versus endochondral chondrocyte differentiation. Sci Rep 6: 36655.
doi:10.1038/srep36655.
Dhanasekaran M, Indumathi S, Lissa RP, Harikrishnan R, Rajkumar JS,

Sudarsanam D (2013) A comprehensive study on optimization of proliferation and
differentiation potency of bone marrow derived mesenchymal stem cells under
prolonged culture condition. Cytotechnology 65: 187–197. doi:10.1007/s10616-012-
9471-0.
146
Bibliografia
Dhandayuthapani B, Yoshida Y, Maekawa T, Kumar DS (2011) Polymeric Scaffolds

in Tissue Engineering Application: A Review. Review Article. International Journal of
Polymer Science. Hindawi, September 11. doi:https://doi.org/10.1155/2011/290602.
https://www.hindawi.com/journals/ijps/2011/290602/.
Diaz-Rodriguez P, Sánchez M, Landin M (2018) Drug-Loaded Biomimetic

Ceramics for Tissue Engineering. Pharmaceutics 10.
doi:10.3390/pharmaceutics10040272.
Digirolamo CM, Stokes D, Colter D, Phinney DG, Class R, Prockop DJ (1999)

Propagation and senescence of human marrow stromal cells in culture: a simple colony-
forming assay identifies samples with the greatest potential to propagate and
differentiate. Br J Haematol 107: 275–281. doi:10.1046/j.1365-2141.1999.01715.x.
Dimitrova-Nakov S, Baudry A, Harichane Y, Kellermann O, Goldberg M, Dr ès

Sciences Naturelles (2014) Pulp stem cells: implication in reparative dentin formation. J
Endod 40: S13-18. doi:10.1016/j.joen.2014.01.011.
Dlaska CE, Andersson G, Brittberg M, Suedkamp NP, Raschke MJ, Schuetz MA

(2015) Clinical Translation in Tissue Engineering—The Surgeon’s View. Curr Mol Bio Rep
1: 61–70. doi:10.1007/s40610-015-0013-3.
Dohan DM, Choukroun J, Diss A, Dohan SL, Dohan AJJ, Mouhyi J, Gogly B (2006)
Platelet-rich fibrin (PRF): a second-generation platelet concentrate. Part II: platelet-
related biologic features. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 101: e45-50.
doi:10.1016/j.tripleo.2005.07.009.
Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, Krause D, Deans

R, Keating A, Prockop D, Horwitz E (2006) Minimal criteria for defining multipotent
mesenchymal stromal cells. The International Society for Cellular Therapy position
statement. Cytotherapy 8: 315–317. doi:10.1080/14653240600855905.
147
Dong R, Du J, Wang L, Wang J, Ding G, Wang S, Fan Z (2014) Comparison of long

noncoding RNA and mRNA expression profiles in mesenchymal stem cells derived from
human periodontal ligament and bone marrow. Biomed Res Int 2014: 317853.
doi:10.1155/2014/317853.
Dorati R, DeTrizio A, Modena T, Conti B, Benazzo F, Gastaldi G, Genta I (2017)

Biodegradable Scaffolds for Bone Regeneration Combined with Drug-Delivery Systems
in Osteomyelitis Therapy. Pharmaceuticals 10: 96. doi:10.3390/ph10040096.
Du X, Yuan Q, Qu Y, Zhou Y, Bei J (2016) Endometrial Mesenchymal Stem Cells

Isolated from Menstrual Blood by Adherence. Stem Cells Int 2016: 3573846.
doi:10.1155/2016/3573846.
Dumic-Cule I, Peric M, Kucko L, Grgurevic L, Pecina M, Vukicevic S (2018) Bone

morphogenetic proteins in fracture repair. International Orthopaedics (SICOT) 42: 2619–
2626. doi:10.1007/s00264-018-4153-y.
Duncan AW, Dorrell C, Grompe M (2009) Stem Cells and Liver Regeneration.
Gastroenterology 137: 466–481. doi:10.1053/j.gastro.2009.05.044.
Eswarakumar VP, Lax I, Schlessinger J (2005) Cellular signaling by fibroblast

growth factor receptors. Cytokine Growth Factor Rev 16: 139–149.
doi:10.1016/j.cytogfr.2005.01.001.
Felthaus O, Gosau M, Klein S, Prantl L, Reichert TE, Schmalz G, Morsczeck C

(2014a) Dexamethasone-related osteogenic differentiation of dental follicle cells
depends on ZBTB16 but not Runx2. Cell Tissue Res 357: 695–705. doi:10.1007/s00441-
014-1891-z.
Felthaus O, Gosau M, Morsczeck C (2014b) ZBTB16 induces osteogenic

differentiation marker genes in dental follicle cells independent from RUNX2. J
Periodontol 85: e144-151. doi:10.1902/jop.2013.130445.
148
Bibliografia
Ferro F, Spelat R, D’Aurizio F, Puppato E, Pandolfi M, Beltrami AP, Cesselli D, Falini

G, Beltrami CA, Curcio F (2012) Dental pulp stem cells differentiation reveals new
insights in Oct4A dynamics. PLoS One 7: e41774. doi:10.1371/journal.pone.0041774.
Fijnheer R, Pietersz RN, de Korte D, Gouwerok CW, Dekker WJ, Reesink HW, Roos
D (1990) Platelet activation during preparation of platelet concentrates: a comparison
of the platelet-rich plasma and the buffy coat methods. Transfusion 30: 634–638.
doi:10.1046/j.1537-2995.1990.30790385523.x.
Fraser JK, Wulur I, Alfonso Z, Hedrick MH (2006) Fat tissue: an underappreciated

source of stem cells for biotechnology. Trends Biotechnol 24: 150–154.
doi:10.1016/j.tibtech.2006.01.010.
Friedenstein AJ, Chailakhjan RK, Lalykina KS (1970) The development of fibroblast

colonies in monolayer cultures of guinea-pig bone marrow and spleen cells. Cell Tissue
Kinet 3: 393–403. doi:10.1111/j.1365-2184.1970.tb00347.x.
Friedenstein AJ, Gorskaja JF, Kulagina NN (1976) Fibroblast precursors in normal

and irradiated mouse hematopoietic organs. Exp Hematol 4: 267–274.
Galindo-Moreno P, León-Cano A, Ortega-Oller I, Monje A, O Valle F, Catena A

(2015) Marginal bone loss as success criterion in implant dentistry: beyond 2 mm. Clin
Oral Implants Res 26: e28–e34. doi:10.1111/clr.12324.
Gang EJ, Bosnakovski D, Figueiredo CA, Visser JW, Perlingeiro RCR (2007) SSEA-4
identifies mesenchymal stem cells from bone marrow. Blood 109: 1743–1751.
doi:10.1182/blood-2005-11-010504.
Gasik M, Braem A, Chaudhari A, Duyck J, Vleugels J (2015) Titanium implants with

modified surfaces: meta-analysis of in vivo osteointegration. Mater Sci Eng C Mater Biol
Appl 49: 152–158. doi:10.1016/j.msec.2014.12.074.
149
Gervois P, Struys T, Hilkens P, Bronckaers A, Ratajczak J, Politis C, Brône B,

Lambrichts I, Martens W (2015) Neurogenic maturation of human dental pulp stem cells
following neurosphere generation induces morphological and electrophysiological
characteristics of functional neurons. Stem Cells Dev 24: 296–311.
doi:10.1089/scd.2014.0117.
Giannini S, Cielo A, Bonanome L, Rastelli C, Derla C, Corpaci F, Falisi G (2015)

Comparison between PRP, PRGF and PRF: lights and shadows in three similar but
different protocols. Eur Rev Med Pharmacol Sci 19: 927–930.
Giuliani A, Manescu A, Langer M, Rustichelli F, Desiderio V, Paino F, De Rosa A,

Laino L, d’Aquino R, Tirino V, Papaccio G (2013) Three years after transplants in human
mandibles, histological and in-line holotomography revealed that stem cells
regenerated a compact rather than a spongy bone: biological and clinical implications.
Stem Cells Transl Med 2: 316–324. doi:10.5966/sctm.2012-0136.
Goldberg M, Smith AJ (2004) CELLS AND EXTRACELLULAR MATRICES OF DENTIN

AND PULP: A BIOLOGICAL BASIS FOR REPAIR AND TISSUE ENGINEERING. Crit Rev Oral
Biol Med 15: 13–27. doi:10.1177/154411130401500103.
Gothard D, Dawson JI, Oreffo ROC (2013) Assessing the potential of colony
morphology for dissecting the CFU-F population from human bone marrow stromal
cells. Cell Tissue Res 352: 237–247. doi:10.1007/s00441-013-1564-3.
Goto N, Fujimoto K, Fujii S, Ida-Yonemochi H, Ohshima H, Kawamoto T, Noshiro

M, Shukunami C, Kozai K, Kato Y (2016) Role of MSX1 in Osteogenic Differentiation of
Human Dental Pulp Stem Cells. Stem Cells Int 2016: 8035759.
doi:10.1155/2016/8035759.
Graziano A, d’Aquino R, Cusella-De Angelis MG, De Francesco F, Giordano A,

Laino G, Piattelli A, Traini T, De Rosa A, Papaccio G (2008) Scaffold’s surface geometry
150
Bibliografia
significantly affects human stem cell bone tissue engineering. J. Cell. Physiol. 214: 166–
172. doi:10.1002/jcp.21175.
Griffiths MJD, Bonnet D, Janes SM (2005) Stem cells of the alveolar epithelium.
Lancet 366: 249–260. doi:10.1016/S0140-6736(05)66916-4.
Gronthos S, Brahim J, Li W, Fisher LW, Cherman N, Boyde A, DenBesten P, Robey

PG, Shi S (2002) Stem cell properties of human dental pulp stem cells. J Dent Res 81:
531–535. doi:10.1177/154405910208100806.
Gronthos S, Mankani M, Brahim J, Robey PG, Shi S (2000) Postnatal human dental
pulp stem cells (DPSCs) in vitro and in vivo. Proc. Natl. Acad. Sci. U.S.A. 97: 13625–13630.
doi:10.1073/pnas.240309797.
Gronthos S, Zannettino ACW, Hay SJ, Shi S, Graves SE, Kortesidis A, Simmons PJ
(2003) Molecular and cellular characterisation of highly purified stromal stem cells
derived from human bone marrow. J Cell Sci 116: 1827–1835. doi:10.1242/jcs.00369.
Grottkau BE, Purudappa PP, Lin Y (2010) Multilineage differentiation of dental

pulp stem cells from green fluorescent protein transgenic mice. Int J Oral Sci 2: 21–27.
doi:10.4248/IJOS10015.
Guo X, Bai Y, Zhang L, Zhang B, Zagidullin N, Carvalho K, Du Z, Cai B (2018)

Cardiomyocyte differentiation of mesenchymal stem cells from bone marrow: new
regulators and its implications. Stem Cell Research & Therapy 9: 44.
doi:10.1186/s13287-018-0773-9.
Han N, Zheng Y, Li R, Li X, Zhou M, Niu Y, Zhang Q (2014) β-catenin enhances

odontoblastic differentiation of dental pulp cells through activation of Runx2. PLoS One
9: e88890. doi:10.1371/journal.pone.0088890.
151
Han Y-J, Kang Y-H, Shivakumar SB, Bharti D, Son Y-B, Choi Y-H, Park W-U, Byun J-
H, Rho G-J, Park B-W (2017) Stem Cells from Cryopreserved Human Dental Pulp Tissues
Sequentially Differentiate into Definitive Endoderm and Hepatocyte-Like Cells in vitro.
Int J Med Sci 14: 1418–1429. doi:10.7150/ijms.22152.
Haynesworth SE, Baber MA, Caplan AI (1992) Cell surface antigens on human
marrow-derived mesenchymal cells are detected by monoclonal antibodies. Bone 13:
69–80. doi:10.1016/8756-3282(92)90363-2.
Hench LL, Polak JM (2002) Third-generation biomedical materials. Science 295:

1014–1017. doi:10.1126/science.1067404.
Hilkens P, Gervois P, Fanton Y, Vanormelingen J, Martens W, Struys T, Politis C,

Lambrichts I, Bronckaers A (2013) Effect of isolation methodology on stem cell
properties and multilineage differentiation potential of human dental pulp stem cells.
Cell Tissue Res 353: 65–78. doi:10.1007/s00441-013-1630-x.
Hodgkinson T, Yuan X-F, Bayat A (2009) Adult stem cells in tissue engineering.
Expert Rev Med Devices 6: 621–640. doi:10.1586/erd.09.48.
Honda MJ, Imaizumi M, Tsuchiya S, Morsczeck C (2010) Dental follicle stem cells
and tissue engineering. J Oral Sci 52: 541–552. doi:10.2334/josnusd.52.541.
Horwitz EM, Keating A (2000) Nonhematopoietic mesenchymal stem cells: what

are they? Cytotherapy 2: 387–388.
Horwitz EM, Le Blanc K, Dominici M, Mueller I, Slaper-Cortenbach I, Marini FC,

Deans RJ, Krause DS, Keating A, International Society for Cellular Therapy (2005)
Clarification of the nomenclature for MSC: The International Society for Cellular Therapy
position statement. Cytotherapy 7: 393–395. doi:10.1080/14653240500319234.
152
Bibliografia
Ibarretxe G, Crende O, Aurrekoetxea M, García-Murga V, Etxaniz J, Unda F

(2012a) Neural crest stem cells from dental tissues: a new hope for dental and neural
regeneration. Stem Cells Int 2012: 103503. doi:10.1155/2012/103503.
Ibarretxe G, Crende O, Aurrekoetxea M, García-Murga V, Etxaniz J, Unda F

(2012b) Neural crest stem cells from dental tissues: a new hope for dental and neural
regeneration. Stem Cells Int 2012: 103503. doi:10.1155/2012/103503.
Irastorza I, Luzuriaga J, Martinez-Conde R, Ibarretxe G, Unda F (2019) Adhesion,

integration and osteogenesis of human dental pulp stem cells on biomimetic implant
surfaces combined with plasma derived products. Eur Cell Mater 38: 201–214.
doi:10.22203/eCM.v038a14.
Ishkitiev N, Yaegaki K, Imai T, Tanaka T, Nakahara T, Ishikawa H, Mitev V,

Haapasalo M (2012) High-purity hepatic lineage differentiated from dental pulp stem
cells in serum-free medium. J Endod 38: 475–480. doi:10.1016/j.joen.2011.12.011.
Ishkitiev N, Yaegaki K, Kozhuharova A, Tanaka T, Okada M, Mitev V, Fukuda M,

Imai T (2013) Pancreatic differentiation of human dental pulp CD117 + stem cells. Regen
Med 8: 597–612. doi:10.2217/rme.13.42.
Isobe Y, Koyama N, Nakao K, Osawa K, Ikeno M, Yamanaka S, Okubo Y, Fujimura

K, Bessho K (2016) Comparison of human mesenchymal stem cells derived from bone
marrow, synovial fluid, adult dental pulp, and exfoliated deciduous tooth pulp.
International Journal of Oral and Maxillofacial Surgery 45: 124–131.
doi:10.1016/j.ijom.2015.06.022.
Iviglia G, Kargozar S, Baino F (2019) Biomaterials, Current Strategies, and Novel

Nano-Technological Approaches for Periodontal Regeneration. J Funct Biomater 10.
doi:10.3390/jfb10010003.
153
Jameson CA (2007) Autologous Platelet Concentrate for the Production of

Platelet Gel. Laboratory Medicine 38: 39–42. doi:10.1309/3UA5HWYVKNCE01AR.
Jang J-H, Lee H-W, Cho KM, Shin H-W, Kang MK, Park SH, Kim E (2016) In vitro
characterization of human dental pulp stem cells isolated by three different methods.
Restor Dent Endod 41: 283–295. doi:10.5395/rde.2016.41.4.283.
Jemat A, Ghazali MJ, Razali M, Otsuka Y (2015) Surface Modifications and Their
Effects on Titanium Dental Implants. Biomed Res Int 2015: 791725.
doi:10.1155/2015/791725.
Jones EA, English A, Kinsey SE, Straszynski L, Emery P, Ponchel F, McGonagle D

(2006) Optimization of a flow cytometry-based protocol for detection and phenotypic
characterization of multipotent mesenchymal stromal cells from human bone marrow.
Cytometry B Clin Cytom 70: 391–399. doi:10.1002/cyto.b.20118.
Jones EA, Kinsey SE, English A, Jones RA, Straszynski L, Meredith DM, Markham
AF, Jack A, Emery P, McGonagle D (2002) Isolation and characterization of bone marrow
multipotential mesenchymal progenitor cells. Arthritis Rheum 46: 3349–3360.
doi:10.1002/art.10696.
Jovani-Sancho MDM, Sheth CC, Marqués-Mateo M, Puche-Torres M (2016)

Platelet-Rich Plasma: A Study of the Variables that May Influence Its Effect on Bone
Regeneration. Clin Implant Dent Relat Res 18: 1051–1064. doi:10.1111/cid.12361.
Kahan BW, Ephrussi B (1970) Developmental potentialities of clonal in vitro

cultures of mouse testicular teratoma. J. Natl. Cancer Inst. 44: 1015–1036.
Kanafi M, Majumdar D, Bhonde R, Gupta P, Datta I (2014) Midbrain cues dictate

differentiation of human dental pulp stem cells towards functional dopaminergic
neurons. J Cell Physiol 229: 1369–1377. doi:10.1002/jcp.24570.
154
Bibliografia
Karamzadeh R, Eslaminejad MB (2013) Dental-Related Stem Cells and Their

Potential in Regenerative Medicine. Regenerative Medicine and Tissue Engineering.
IntechOpen, May 22. doi:10.5772/55927.
https://www.intechopen.com/books/regenerative-medicine-and-tissue-
engineering/dental-related-stem-cells-and-their-potential-in-regenerative-medicine.
Karbalaie KH, Tanhaei S, Rabiei F, Kiani-Esfahani A, Masoudi NS, Nasr-Esfahani

MH, Baharvand H (2021) Stem Cells from Human Exfoliated Deciduous Tooth Exhibit
Stromal-Derived Inducing Activity and Lead to Generation of Neural Crest Cells from
Human Embryonic Stem Cells. Cell J 23: 140–142. doi:10.22074/cellj.2021.7931.
Kattimani VS, Kondaka S, Lingamaneni KP (2016) Hydroxyapatite–-Past, Present,

and Future in Bone Regeneration. Bone�Tissue�Regen�Insights 7: BTRI.S36138.
doi:10.4137/BTRI.S36138.
Kawashima N (2012) Characterisation of dental pulp stem cells: a new horizon

for tissue regeneration? Arch Oral Biol 57: 1439–1458.
doi:10.1016/j.archoralbio.2012.08.010.
Kerkis I, Kerkis A, Dozortsev D, Stukart-Parsons GC, Gomes Massironi SM, Pereira

LV, Caplan AI, Cerruti HF (2006) Isolation and characterization of a population of
immature dental pulp stem cells expressing OCT-4 and other embryonic stem cell
markers. Cells Tissues Organs 184: 105–116. doi:10.1159/000099617.
Khan SN, Cammisa FP, Sandhu HS, Diwan AD, Girardi FP, Lane JM (2005) The
biology of bone grafting. J Am Acad Orthop Surg 13: 77–86.
Khanabdali R, Saadat A, Fazilah M, Bazli KFK, Qazi R-M, Khalid RS, Hasan Adli DS,
Moghadamtousi SZ, Naeem N, Khan I, Salim A, Shamsuddin SA, Mohan G (2016)
Promoting effect of small molecules in cardiomyogenic and neurogenic differentiation
of rat bone marrow-derived mesenchymal stem cells. Drug Des Devel Ther 10: 81–91.
doi:10.2147/DDDT.S89658.
155
Khang G, Kim HL, Hong M, Lee D (2012) Neurogenesis of bone marrow-derived

mesenchymal stem cells onto β-mercaptoethanol-loaded PLGA film. Cell Tissue Res 347:
713–724. doi:10.1007/s00441-011-1232-4.
Khurana R, Kudva PB, Husain SY (2017) Comparative evaluation of the isolation

and quantification of stem cells derived from dental pulp and periodontal ligament of a
permanent tooth and to assess their viability and proliferation on a platelet-rich fibrin
scaffold. J Indian Soc Periodontol 21: 16–20. doi:10.4103/jisp.jisp_182_16.
Király M, Kádár K, Horváthy DB, Nardai P, Rácz GZ, Lacza Z, Varga G, Gerber G
(2011) Integration of neuronally predifferentiated human dental pulp stem cells into rat
brain in vivo. Neurochem Int 59: 371–381. doi:10.1016/j.neuint.2011.01.006.
Kleinsmith LJ, Pierce GB (1964) Multipotentiality of single embrional carcinoma

cells. Cancer Res. 24: 1544–1551.
Knychala J, Bouropoulos N, Catt CJ, Katsamenis OL, Please CP, Sengers BG (2013)
Pore geometry regulates early stage human bone marrow cell tissue formation and
organisation. Ann Biomed Eng 41: 917–930. doi:10.1007/s10439-013-0748-z.
Kobayashi E, Flückiger L, Fujioka-Kobayashi M, Sawada K, Sculean A, Schaller B,

Miron RJ (2016) Comparative release of growth factors from PRP, PRF, and advanced-
PRF. Clin Oral Investig 20: 2353–2360. doi:10.1007/s00784-016-1719-1.
Koç ON, Peters C, Aubourg P, Raghavan S, Dyhouse S, DeGasperi R, Kolodny EH,

Yoseph YB, Gerson SL, Lazarus HM, Caplan AI, Watkins PA, Krivit W (1999) Bone marrow-
derived mesenchymal stem cells remain host-derived despite successful hematopoietic
engraftment after allogeneic transplantation in patients with lysosomal and peroxisomal
storage diseases. Exp Hematol 27: 1675–1681. doi:10.1016/s0301-472x(99)00101-0.
Kokubo T, Takadama H (2006) How useful is SBF in predicting in vivo bone

bioactivity? Biomaterials 27: 2907–2915. doi:10.1016/j.biomaterials.2006.01.017.
156
Bibliografia
Krampera M, Marconi S, Pasini A, Galiè M, Rigotti G, Mosna F, Tinelli M, Lovato

L, Anghileri E, Andreini A, Pizzolo G, Sbarbati A, Bonetti B (2007) Induction of neural-like
differentiation in human mesenchymal stem cells derived from bone marrow, fat, spleen
and thymus. Bone 40: 382–390. doi:10.1016/j.bone.2006.09.006.
Kumar KR, Genmorgan K, Abdul Rahman SM, Rajan MA, Kumar TA, Prasad VS
(2016) Role of plasma-rich fibrin in oral surgery. J Pharm Bioallied Sci 8: S36–S38.
doi:10.4103/0975-7406.191963.
Lakshmi R, Sasikumar S (2015) Influence of needle-like morphology on the

bioactivity of nanocrystalline wollastonite--an in vitro study. Int J Nanomedicine 10
Suppl 1: 129–136. doi:10.2147/IJN.S79986.
Langenbach F, Handschel J (2013) Effects of dexamethasone, ascorbic acid and

β-glycerophosphate on the osteogenic differentiation of stem cells in vitro. Stem Cell
Res Ther 4: 117. doi:10.1186/scrt328.
Le Guéhennec L, Soueidan A, Layrolle P, Amouriq Y (2007) Surface treatments of

titanium dental implants for rapid osseointegration. Dent Mater 23: 844–854.
doi:10.1016/j.dental.2006.06.025.
Lee CP, Colombo JS, Ayre WN, Sloan AJ, Waddington RJ (2015a) Elucidating the
cellular actions of demineralised dentine matrix extract on a clonal dental pulp stem cell
population in orchestrating dental tissue repair. J Tissue Eng 6: 2041731415586318.
doi:10.1177/2041731415586318.
Lee J-S, Kim S-K, Gruber R, Kim C-S (2020) Periodontal healing by periodontal
ligament fiber with or without cells: A preclinical study of the decellularized periodontal
ligament in a tooth replantation model. J Periodontol 91: 110–119.
doi:10.1002/JPER.19-0126.
157
Lee J-T, Choi S-Y, Kim H-L, Kim J-Y, Lee H-J, Kwon T-G (2015b) Comparison of gene
expression between mandibular and iliac bone-derived cells. Clin Oral Invest 19: 1223–
1233. doi:10.1007/s00784-014-1353-8.
Lenkiewicz AM (2019) Epidermal Stem Cells. Adv Exp Med Biol 1201: 239–259.
doi:10.1007/978-3-030-31206-0_12.
Leucht P, Kim J-B, Amasha R, James AW, Girod S, Helms JA (2008) Embryonic
origin and Hox status determine progenitor cell fate during adult bone regeneration.
Development 135: 2845–2854. doi:10.1242/dev.023788.
Liu N, Zhou M, Zhang Q, Yong L, Zhang T, Tian T, Ma Q, Lin S, Zhu B, Cai X (2018)
Effect of substrate stiffness on proliferation and differentiation of periodontal ligament
stem cells. Cell Prolif 51: e12478. doi:10.1111/cpr.12478.
Luzuriaga J, Irurzun J, Irastorza I, Unda F, Ibarretxe G, Pineda JR (2020)

Vasculogenesis from Human Dental Pulp Stem Cells Grown in Matrigel with Fully Defined
Serum-Free Culture Media. Biomedicines 8. doi:10.3390/biomedicines8110483.
Luzuriaga J, Pastor-Alonso O, Encinas JM, Unda F, Ibarretxe G, Pineda JR (2019a)

Human Dental Pulp Stem Cells Grown in Neurogenic Media Differentiate Into
Endothelial Cells and Promote Neovasculogenesis in the Mouse Brain. Front. Physiol. 10.
doi:10.3389/fphys.2019.00347.
https://www.frontiersin.org/articles/10.3389/fphys.2019.00347/full.
Luzuriaga J, Pineda JR, Irastorza I, Uribe-Etxebarria V, García-Gallastegui P,

Encinas JM, Chamero P, Unda F, Ibarretxe G (2019b) BDNF and NT3 Reprogram Human
Ectomesenchymal Dental Pulp Stem Cells to Neurogenic and Gliogenic Neural Crest
Progenitors Cultured in Serum-Free Medium. Cell Physiol Biochem 52: 1361–1380.
doi:10.33594/000000096.
158
Bibliografia
Luzuriaga J, Polo Y, Pastor-Alonso O, Pardo-Rodríguez B, Larrañaga A, Unda F,

Sarasua J-R, Pineda JR, Ibarretxe G (2021) Advances and Perspectives in Dental Pulp
Stem Cell Based Neuroregeneration Therapies. Int J Mol Sci 22.
doi:10.3390/ijms22073546.
Ma G-F, Ali A, Verzijl N, Hanemaaijer R, TeKoppele J, Konttinen YT, Salo J (2006)

Increased collagen degradation around loosened total hip replacement implants.
Arthritis Rheum 54: 2928–2933. doi:10.1002/art.22064.
Ma S, Xie N, Li W, Yuan B, Shi Y, Wang Y (2014) Immunobiology of mesenchymal

stem cells. Cell Death Differ. 21: 216–225. doi:10.1038/cdd.2013.158.
Madarieta Pardo I, García Urquia N, Fernandez García R (2017) Method for

Producing a Decellularized Tissue Matrix. July 6.
Majo F, Rochat A, Nicolas M, Jaoudé GA, Barrandon Y (2008) Oligopotent stem

cells are distributed throughout the mammalian ocular surface. Nature 456: 250–254.
doi:10.1038/nature07406.
Mansergh FC, Wride MA, Rancourt DE (2000) Neurons from stem cells:
implications for understanding nervous system development and repair. Biochem Cell
Biol 78: 613–628.
Marchionni C, Bonsi L, Alviano F, Lanzoni G, Di Tullio A, Costa R, Montanari M,

Tazzari PL, Ricci F, Pasquinelli G, Orrico C, Grossi A, Prati C, Bagnara GP (2009) Angiogenic
potential of human dental pulp stromal (stem) cells. Int J Immunopathol Pharmacol 22:
699–706. doi:10.1177/039463200902200315.
Martin GR (1980) Teratocarcinomas and mammalian embryogenesis. Science

209: 768–776.
159
Marx RE, Carlson ER, Eichstaedt RM, Schimmele SR, Strauss JE, Georgeff KR
(1998) Platelet-rich plasma: Growth factor enhancement for bone grafts. Oral Surg Oral
Med Oral Pathol Oral Radiol Endod 85: 638–646. doi:10.1016/s1079-2104(98)90029-4.
Marx RE (2004) Platelet-rich plasma: evidence to support its use. J Oral Maxillofac
Surg 62: 489–496. doi:10.1016/j.joms.2003.12.003.
Masuki H, Okudera T, Watanebe T, Suzuki M, Nishiyama K, Okudera H, Nakata K,

Uematsu K, Su C-Y, Kawase T (2016) Growth factor and pro-inflammatory cytokine
contents in platelet-rich plasma (PRP), plasma rich in growth factors (PRGF), advanced
platelet-rich fibrin (A-PRF), and concentrated growth factors (CGF). Int J Implant Dent 2:
19. doi:10.1186/s40729-016-0052-4.
Matsuda C, Takagi M, Hattori T, Wakitani S, Yoshida T (2005) Differentiation of

Human Bone Marrow Mesenchymal Stem Cells to Chondrocytes for Construction of
Three-dimensional Cartilage Tissue. Cytotechnology 47: 11–17. doi:10.1007/s10616-
005-3751-x.
Mayer Y, Ginesin O, Khutaba A, Machtei EE, Zigdon Giladi H (2018)

Biocompatibility and osteoconductivity of PLCL coated and noncoated xenografts: An in
vitro and preclinical trial. Clin Implant Dent Relat Res 20: 294–299.
doi:10.1111/cid.12596.
McElreavey KD, Irvine AI, Ennis KT, McLean WH (1991) Isolation, culture and
characterisation of fibroblast-like cells derived from the Wharton’s jelly portion of
human umbilical cord. Biochem Soc Trans 19: 29S. doi:10.1042/bst019029s.
Miron RJ, Sculean A, Cochran DL, Froum S, Zucchelli G, Nemcovsky C, Donos N,

Lyngstadaas SP, Deschner J, Dard M, Stavropoulos A, Zhang Y, Trombelli L, Kasaj A,
Shirakata Y, Cortellini P, Tonetti M, Rasperini G, Jepsen S, Bosshardt DD (2016)
Twenty years of enamel matrix derivative: the past, the present and the future. J Clin
Periodontol 43: 668–683. doi:10.1111/jcpe.12546.
160
Bibliografia
Miura M, Gronthos S, Zhao M, Lu B, Fisher LW, Robey PG, Shi S (2003) SHED: stem
cells from human exfoliated deciduous teeth. Proc Natl Acad Sci U S A 100: 5807–5812.
doi:10.1073/pnas.0937635100.
Mohanram Y, Zhang J, Tsiridis E, Yang XB (2020) Comparing bone tissue

engineering efficacy of HDPSCs, HBMSCs on 3D biomimetic ABM-P-15 scaffolds in vitro
and in vivo. Cytotechnology 72: 715–730. doi:10.1007/s10616-020-00414-7.
Moraschini V, Poubel LA da C, Ferreira VF, Barboza E dos SP (2015) Evaluation of

survival and success rates of dental implants reported in longitudinal studies with a
follow-up period of at least 10 years: a systematic review. Int J Oral Maxillofac Surg 44:
377–388. doi:10.1016/j.ijom.2014.10.023.
Morejón L, Delgado JA, Antunes Ribeiro A, Varella de Oliveira M, Mendizábal E,

García I, Alfonso A, Poh P, van Griensven M, Balmayor ER (2019) Development,
Characterization and In Vitro Biological Properties of Scaffolds Fabricated From Calcium
Phosphate Nanoparticles. Int J Mol Sci 20. doi:10.3390/ijms20071790.
Murphy CM, Haugh MG, O’Brien FJ (2010) The effect of mean pore size on cell
attachment, proliferation and migration in collagen-glycosaminoglycan scaffolds for
bone tissue engineering. Biomaterials 31: 461–466.
Muruganandan S, Roman AA, Sinal CJ (2009) Adipocyte differentiation of bone

marrow-derived mesenchymal stem cells: cross talk with the osteoblastogenic program.
Cell Mol Life Sci 66: 236–253. doi:10.1007/s00018-008-8429-z.
Nada OA, El Backly RM (2018) Stem Cells From the Apical Papilla (SCAP) as a Tool
for Endogenous Tissue Regeneration. Front Bioeng Biotechnol 6: 103.
doi:10.3389/fbioe.2018.00103.
161
Nakamura N, Ito A, Kimura T, Kishida A (2019) Extracellular Matrix Induces

Periodontal Ligament Reconstruction In Vivo. Int J Mol Sci 20.
doi:10.3390/ijms20133277.
Navarro M, Michiardi A, Castaño O, Planell JA (2008) Biomaterials in

orthopaedics. J R Soc Interface 5: 1137–1158. doi:10.1098/rsif.2008.0151.
Naves MM, Menezes HHM, Magalhães D, Ferreira JA, Ribeiro SF, de Mello JDB,
Costa HL (2015) Effect of Macrogeometry on the Surface Topography of Dental Implants.
Int J Oral Maxillofac Implants 30: 789–799.
Nemeth CL, Janebodin K, Yuan AE, Dennis JE, Reyes M, Kim D-H (2014) Enhanced
chondrogenic differentiation of dental pulp stem cells using nanopatterned PEG-GelMA-
HA hydrogels. Tissue Eng Part A 20: 2817–2829. doi:10.1089/ten.TEA.2013.0614.
Nishiyama K, Okudera T, Watanabe T, Isobe K, Suzuki M, Masuki H, Okudera H,

Uematsu K, Nakata K, Kawase T (2016) Basic characteristics of plasma rich in growth
factors (PRGF): blood cell components and biological effects. Clin Exp Dent Res 2: 96–
103. doi:10.1002/cre2.26.
Nuti N, Corallo C, Chan BMF, Ferrari M, Gerami-Naini B (2016) Multipotent

Differentiation of Human Dental Pulp Stem Cells: a Literature Review. Stem Cell Rev 12:
511–523. doi:10.1007/s12015-016-9661-9.
O’Brien FJ (2011) Biomaterials & scaffolds for tissue engineering. Materials Today
14: 88–95. doi:10.1016/S1369-7021(11)70058-X.
Olivares-Navarrete R, Hyzy SL, Hutton DL, Erdman CP, Wieland M, Boyan BD,
Schwartz Z (2010) Direct and indirect effects of microstructured titanium substrates on
the induction of mesenchymal stem cell differentiation towards the osteoblast lineage.
Biomaterials 31: 2728–2735. doi:10.1016/j.biomaterials.2009.12.029.
162
Bibliografia
Onizuka S, Iwata T, Park S-J, Nakai K, Yamato M, Okano T, Izumi Y (2016) ZBTB16
as a Downstream Target Gene of Osterix Regulates Osteoblastogenesis of Human
Multipotent Mesenchymal Stromal Cells. J Cell Biochem 117: 2423–2434.
doi:10.1002/jcb.25634.
Orimo H (2010) The mechanism of mineralization and the role of alkaline

phosphatase in health and disease. J Nippon Med Sch 77: 4–12. doi:10.1272/jnms.77.4.
Osathanon T, Sawangmake C, Nowwarote N, Pavasant P (2014) Neurogenic

differentiation of human dental pulp stem cells using different induction protocols. Oral
Dis 20: 352–358. doi:10.1111/odi.12119.
Pagella P, Miran S, Neto E, Martin I, Lamghari M, Mitsiadis TA (2020) Human

dental pulp stem cells exhibit enhanced properties in comparison to human bone
marrow stem cells on neurites outgrowth. The FASEB Journal 34: 5499–5511.
doi:https://doi.org/10.1096/fj.201902482R.
Paknejad M, Shayesteh YS, Yaghobee S, Shariat S, Dehghan M, Motahari P (2012)

Evaluation of the Effect of Plasma Rich in Growth Factors (PRGF) on Bone Regeneration.
J Dent (Tehran) 9: 59–67.
Pałka K, Pokrowiecki R (2018) Porous Titanium Implants: A Review. Advanced

Engineering Materials 20: 1700648. doi:https://doi.org/10.1002/adem.201700648.
Perrotti V, Palmieri A, Pellati A, Degidi M, Ricci L, Piattelli A, Carinci F (2013) Effect

of titanium surface topographies on human bone marrow stem cells differentiation in
vitro. Odontology 101: 133–139. doi:10.1007/s10266-012-0067-0.
Phinney DG, Kopen G, Righter W, Webster S, Tremain N, Prockop DJ (1999) Donor

variation in the growth properties and osteogenic potential of human marrow stromal
cells. J Cell Biochem 75: 424–436.
163
Pilipchuk SP, Plonka AB, Monje A, Taut AD, Lanis A, Kang B, Giannobile WV (2015)
Tissue engineering for bone regeneration and osseointegration in the oral cavity. Dent
Mater 31: 317–338. doi:10.1016/j.dental.2015.01.006.
Pineda Martí JR, Luzuriaga González J, Unda Rodríguez F, Pastor Alonso O,

Encinas Pérez JM, Ibarretxe Bilbao G, Irastorza Epelde I (2020) Cellular Aggregates for
Use in Vascularisation Therapy. January 9.
Pisciotta A, Bertani G, Bertoni L, Di Tinco R, De Biasi S, Vallarola A, Pignatti E,

Tupler R, Salvarani C, de Pol A, Carnevale G (2020) Modulation of Cell Death and
Promotion of Chondrogenic Differentiation by Fas/FasL in Human Dental Pulp Stem Cells
(hDPSCs). Front Cell Dev Biol 8. doi:10.3389/fcell.2020.00279.
Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, Moorman
MA, Simonetti DW, Craig S, Marshak DR (1999) Multilineage potential of adult human
mesenchymal stem cells. Science 284: 143–147. doi:10.1126/science.284.5411.143.
Ponnaiyan D, Jegadeesan V (2014) Comparison of phenotype and differentiation

marker gene expression profiles in human dental pulp and bone marrow mesenchymal
stem cells. Eur J Dent 8: 307–313. doi:10.4103/1305-7456.137631.
Portmann-Lanz CB, Schoeberlein A, Huber A, Sager R, Malek A, Holzgreve W,

Surbek DV (2006) Placental mesenchymal stem cells as potential autologous graft for
pre- and perinatal neuroregeneration. Am. J. Obstet. Gynecol. 194: 664–673.
doi:10.1016/j.ajog.2006.01.101.
Posfai E, Schell JP, Janiszewski A, Rovic I, Murray A, Bradshaw B, Yamakawa T,

Pardon T, El Bakkali M, Talon I, De Geest N, Kumar P, To SK, Petropoulos S, Jurisicova A,
Pasque V, Lanner F, Rossant J (2021) Evaluating totipotency using criteria of increasing
stringency. Nat Cell Biol 23: 49–60. doi:10.1038/s41556-020-00609-2.
164
Bibliografia
Potten CS, Loeffler M (1990) Stem cells: attributes, cycles, spirals, pitfalls and
uncertainties. Lessons for and from the crypt. Development 110: 1001–1020.
Powers CJ, McLeskey SW, Wellstein A (2000) Fibroblast growth factors, their
receptors and signaling. Endocr Relat Cancer 7: 165–197. doi:10.1677/erc.0.0070165.
Prockop DJ (1997) Marrow stromal cells as stem cells for nonhematopoietic

tissues. Science 276: 71–74. doi:10.1126/science.276.5309.71.
Rahman SU, Nagrath M, Ponnusamy S, Arany PR (2018) Nanoscale and

Macroscale Scaffolds with Controlled-Release Polymeric Systems for Dental
Craniomaxillofacial Tissue Engineering. Materials (Basel) 11. doi:10.3390/ma11081478.
Raik S, Kumar A, Rattan V, Seth S, Kaur A, Bhatta Charyya S (2020) Assessment of

Post-thaw Quality of Dental Mesenchymal Stromal Cells After Long-Term
Cryopreservation by Uncontrolled Freezing. Appl Biochem Biotechnol 191: 728–743.
doi:10.1007/s12010-019-03216-6.
Rani VVD, Vinoth-Kumar L, Anitha VC, Manzoor K, Deepthy M, Shantikumar VN

(2012) Osteointegration of titanium implant is sensitive to specific nanostructure
morphology. Acta Biomater 8: 1976–1989. doi:10.1016/j.actbio.2012.01.021.
Rao SM, Ugale GM, Warad SB (2013) Bone Morphogenetic Proteins: Periodontal
Regeneration. N Am J Med Sci 5: 161–168. doi:10.4103/1947-2714.109175.
Reuss B, von Bohlen und Halbach O (2003) Fibroblast growth factors and their
receptors in the central nervous system. Cell Tissue Res 313: 139–157.
doi:10.1007/s00441-003-0756-7.
Riccio M, Resca E, Maraldi T, Pisciotta A, Ferrari A, Bruzzesi G, De Pol A (2010)

Human dental pulp stem cells produce mineralized matrix in 2D and 3D cultures. Eur J
Histochem 54: e46. doi:10.4081/ejh.2010.e46.
165
Roberts TT, Rosenbaum AJ (2012) Bone grafts, bone substitutes and

orthobiologics: the bridge between basic science and clinical advancements in fracture
healing. Organogenesis 8: 114–124. doi:10.4161/org.23306.
Roosa SMM, Kemppainen JM, Moffitt EN, Krebsbach PH, Hollister SJ (2010) The
pore size of polycaprolactone scaffolds has limited influence on bone regeneration in an
in vivo model. J Biomed Mater Res A 92: 359–368. doi:10.1002/jbm.a.32381.
Rupp F, Liang L, Geis-Gerstorfer J, Scheideler L, Hüttig F (2018) Surface

characteristics of dental implants: A review. Dent Mater 34: 40–57.
doi:10.1016/j.dental.2017.09.007.
Salou L, Hoornaert A, Stanovici J, Briand S, Louarn G, Layrolle P (2015)

Comparative bone tissue integration of nanostructured and microroughened dental
implants. Nanomedicine (Lond) 10: 741–751. doi:10.2217/nnm.14.223.
Sanchez-Ramos J, Song S, Cardozo-Pelaez F, Hazzi C, Stedeford T, Willing A,

Freeman TB, Saporta S, Janssen W, Patel N, Cooper DR, Sanberg PR (2000) Adult Bone
Marrow Stromal Cells Differentiate into Neural Cells in Vitro. Experimental Neurology
164: 247–256. doi:10.1006/exnr.2000.7389.
Santos F dos, Andrade PZ, Abecasis MM, Gimble JM, Chase LG, Campbell AM,
Boucher S, Vemuri MC, Silva CL da, Cabral JMS (2011) Toward a clinical-grade expansion
of mesenchymal stem cells from human sources: a microcarrier-based culture system
under xeno-free conditions. Tissue Eng Part C Methods 17: 1201–1210.
doi:10.1089/ten.tec.2011.0255.
Scintu F, Reali C, Pillai R, Badiali M, Sanna MA, Argiolu F, Ristaldi MS, Sogos V
(2006) Differentiation of human bone marrow stem cells into cells with a neural
phenotype: diverse effects of two specific treatments. BMC Neurosci 7: 14.
doi:10.1186/1471-2202-7-14.
166
Bibliografia
Seale P, Asakura A, Rudnicki MA (2001) The Potential of Muscle Stem Cells.

Developmental Cell 1: 333–342. doi:10.1016/S1534-5807(01)00049-1.
Sedgley CM, Botero TM (2012) Dental stem cells and their sources. Dent Clin
North Am 56: 549–561. doi:10.1016/j.cden.2012.05.004.
Seo B-M, Miura M, Gronthos S, Bartold PM, Batouli S, Brahim J, Young M, Robey
PG, Wang C-Y, Shi S (2004) Investigation of multipotent postnatal stem cells from human
periodontal ligament. Lancet 364: 149–155. doi:10.1016/S0140-6736(04)16627-0.
Shi S, Gronthos S (2003) Perivascular niche of postnatal mesenchymal stem cells

in human bone marrow and dental pulp. J Bone Miner Res 18: 696–704.
doi:10.1359/jbmr.2003.18.4.696.
Short B, Brouard N, Occhiodoro-Scott T, Ramakrishnan A, Simmons PJ (2003)

Mesenchymal stem cells. Arch Med Res 34: 565–571.
doi:10.1016/j.arcmed.2003.09.007.
Shyamala K, Yanduri S, Girish HC, Murgod S (2015) Neural crest: The fourth germ
layer. J Oral Maxillofac Pathol 19: 221–229. doi:10.4103/0973-029X.164536.
da Silva Meirelles L, Chagastelles PC, Nardi NB (2006) Mesenchymal stem cells

reside in virtually all post-natal organs and tissues. J Cell Sci 119: 2204–2213.
doi:10.1242/jcs.02932.
Simmons PJ, Torok-Storb B (1991) Identification of stromal cell precursors in

human bone marrow by a novel monoclonal antibody, STRO-1. Blood 78: 55–62.
Simonović J, Toljić B, Rašković B, Jovanović V, Lazarević M, Milošević M, Nikolić

N, Panajotović R, Milašin J (2019) Raman microspectroscopy: toward a better distinction
and profiling of different populations of dental stem cells. Croat Med J 60: 78–86.
Slack JM (2000) Stem cells in epithelial tissues. Science 287: 1431–1433.
167
Smith AG (2001) Embryo-derived stem cells: of mice and men. Annu. Rev. Cell
Dev. Biol. 17: 435–462. doi:10.1146/annurev.cellbio.17.1.435.
Solchaga LA, Penick KJ, Welter JF (2011) Chondrogenic Differentiation of Bone

Marrow-Derived Mesenchymal Stem Cells: Tips and Tricks. Methods Mol Biol 698: 253–
278. doi:10.1007/978-1-60761-999-4_20.
Song B, Jiang W, Alraies A, Liu Q, Gudla V, Oni J, Wei X, Sloan A, Ni L, Agarwal M

(2016) Bladder Smooth Muscle Cells Differentiation from Dental Pulp Stem Cells: Future
Potential for Bladder Tissue Engineering. Stem Cells Int 2016: 6979368.
doi:10.1155/2016/6979368.
Sordi MB, Curtarelli RB, da Silva IT, Fongaro G, Benfatti CAM, de Souza Magini R,
Cabral da Cruz AC (2021) Effect of dexamethasone as osteogenic supplementation in in
vitro osteogenic differentiation of stem cells from human exfoliated deciduous teeth. J
Mater Sci Mater Med 32: 1. doi:10.1007/s10856-020-06475-6.
Stevens LC, Little CC (1954) Spontaneous Testicular Teratomas in an Inbred Strain

of Mice. Proc. Natl. Acad. Sci. U.S.A. 40: 1080–1087.
Stevens MM (2008) Biomaterials for bone tissue engineering. Materials Today

11: 18–25. doi:10.1016/S1369-7021(08)70086-5.
Świeczko-Żurek B (2009) Porous Materials Used as Inserted Bone Implants.

Advances in Materials Science 9: 51–60. doi:10.2478/v10077-009-0010-4.
Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, Yamanaka S

(2007) Induction of pluripotent stem cells from adult human fibroblasts by defined
factors. Cell 131: 861–872. doi:10.1016/j.cell.2007.11.019.
168
Bibliografia
Takahashi K, Yamanaka S (2006) Induction of pluripotent stem cells from mouse

embryonic and adult fibroblast cultures by defined factors. Cell 126: 663–676.
doi:10.1016/j.cell.2006.07.024.
Tatullo M ed. (2017) MSCs and Innovative Biomaterials in Dentistry. Humana

Press. Stem Cell Biology and Regenerative Medicine.
//www.springer.com/us/book/9783319556444.
Thesleff I, Aberg T (1999) Molecular regulation of tooth development. Bone 25:

123–125. doi:10.1016/s8756-3282(99)00119-2.
Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall VS,
Jones JM (1998) Embryonic stem cell lines derived from human blastocysts. Science 282:
1145–1147.
Tian H, Bharadwaj S, Liu Y, Ma H, Ma PX, Atala A, Zhang Y (2010) Myogenic

Differentiation of Human Bone Marrow Mesenchymal Stem Cells on a 3D Nanofibrous
Scaffold for Bladder Tissue Engineering. Biomaterials 31: 870–877.
Tirino V, Paino F, d’Aquino R, Desiderio V, De Rosa A, Papaccio G (2011) Methods

for the identification, characterization and banking of human DPSCs: current strategies
and perspectives. Stem Cell Rev 7: 608–615. doi:10.1007/s12015-011-9235-9.
Tziafas D, Smith AJ, Lesot H (2000) Designing new treatment strategies in vital
pulp therapy. J Dent 28: 77–92. doi:10.1016/s0300-5712(99)00047-0.
Vats A, Bielby RC, Tolley NS, Nerem R, Polak JM (2005) Stem cells. Lancet 366:
592–602. doi:10.1016/S0140-6736(05)66879-1.
Vega-Lopez GA, Cerrizuela S, Aybar MJ (2017) Trunk neural crest cells: formation,
migration and beyond. Int J Dev Biol 61: 5–15. doi:10.1387/ijdb.160408gv.
169
Vimalraj S, Arumugam B, Miranda PJ, Selvamurugan N (2015) Runx2: Structure,

function, and phosphorylation in osteoblast differentiation. Int J Biol Macromol 78: 202–
208. doi:10.1016/j.ijbiomac.2015.04.008.
Wagers AJ, Weissman IL (2004) Plasticity of adult stem cells. Cell 116: 639–648.
doi:10.1016/s0092-8674(04)00208-9.
Wang D, Li J, Zhang Y, Zhang M, Chen J, Li X, Hu X, Jiang S, Shi S, Sun L (2014)

Umbilical cord mesenchymal stem cell transplantation in active and refractory systemic
lupus erythematosus: a multicenter clinical study. Arthritis Res. Ther. 16: R79.
doi:10.1186/ar4520.
Wang D-R, Wang Y-H, Pan J, Tian W-D (2020) Neurotrophic effects of dental pulp
stem cells in repair of peripheral nerve after crush injury. World J Stem Cells 12: 1196–
1213. doi:10.4252/wjsc.v12.i10.1196.
Wang KC, Helms JA, Chang HY (2009) Regeneration, repair and remembering
identity: the three Rs of Hox gene expression. Trends Cell Biol 19: 268–275.
doi:10.1016/j.tcb.2009.03.007.
Wang L, Johnson JA, Zhang Q, Beahm EK (2013) Combining decellularized human

adipose tissue extracellular matrix and adipose-derived stem cells for adipose tissue
engineering. Acta Biomater 9: 8921–8931. doi:10.1016/j.actbio.2013.06.035.
Wehrhan F, Hyckel P, Amann K, Ries J, Stockmann P, Schlegel K, Neukam F,

Nkenke E (2011) Msx-1 is suppressed in bisphosphonate-exposed jaw bone analysis of
bone turnover-related cell signalling after bisphosphonate treatment. Oral Dis 17: 433–
442. doi:10.1111/j.1601-0825.2010.01778.x.
Whitman DH, Berry RL, Green DM (1997) Platelet gel: an autologous alternative
to fibrin glue with applications in oral and maxillofacial surgery. J Oral Maxillofac Surg
55: 1294–1299. doi:10.1016/s0278-2391(97)90187-7.
170
Bibliografia
Winning L, El Karim IA, Lundy FT (2019) A Comparative Analysis of the Osteogenic

Potential of Dental Mesenchymal Stem Cells. Stem Cells and Development 28: 1050–
1058. doi:10.1089/scd.2019.0023.
Wu J, Zhang W, Ran Q, Xiang Y, Zhong JF, Li SC, Li Z (2018) The Differentiation

Balance of Bone Marrow Mesenchymal Stem Cells Is Crucial to Hematopoiesis. Stem
Cells Int 2018: 1540148. doi:10.1155/2018/1540148.
Xiao L, Tsutsui T (2013) Characterization of human dental pulp cells-derived

spheroids in serum-free medium: stem cells in the core. J Cell Biochem 114: 2624–2636.
doi:10.1002/jcb.24610.
Xu J, Li Z, Hou Y, Fang W (2015) Potential mechanisms underlying the Runx2

induced osteogenesis of bone marrow mesenchymal stem cells. Am J Transl Res 7: 2527–
2535.
Yadav P, Vats R, Bano A, Bhardwaj R (2020) Hematopoietic Stem Cells Culture,

Expansion and Differentiation: An Insight into Variable and Available Media. Int J Stem
Cells 13: 326–334. doi:10.15283/ijsc19157.
Yagi Mendoza H, Yokoyama T, Tanaka T, Ii H, Yaegaki K (2018) Regeneration of

insulin-producing islets from dental pulp stem cells using a 3D culture system. Regen
Med 13: 673–687. doi:10.2217/rme-2018-0074.
Yang J-Z, Qiu L-H, Xiong S-H, Dang J-L, Rong X-K, Hou M-M, Wang K, Yu Z, Yi C-G
(2020) Decellularized adipose matrix provides an inductive microenvironment for stem
cells in tissue regeneration. World J Stem Cells 12: 585–603.
doi:10.4252/wjsc.v12.i7.585.
Yildirim S (2013) Dental Pulp Stem Cells. New York: Springer-Verlag.

SpringerBriefs in Stem Cells. doi:10.1007/978-1-4614-5687-2.
https://www.springer.com/gp/book/9781461456865.
171
Zanicotti DG, Duncan WJ, Seymour GJ, Coates DE (2018) Effect of Titanium
Surfaces on the Osteogenic Differentiation of Human Adipose-Derived Stem Cells. Int J
Oral Maxillofac Implants 33: e77–e87. doi:10.11607/jomi.5810.
Zhang H-T, Liu Z-L, Yao X-Q, Yang Z-J, Xu R-X (2012) Neural differentiation ability
of mesenchymal stromal cells from bone marrow and adipose tissue: a comparative
study. Cytotherapy 14: 1203–1214. doi:10.3109/14653249.2012.711470.
Zhang J, Ding H, Liu X, Sheng Y, Liu X, Jiang C (2019) Dental Follicle Stem Cells:
Tissue Engineering and Immunomodulation. Stem Cells Dev 28: 986–994.
doi:10.1089/scd.2019.0012.
Zhang J, Lian M, Cao P, Bao G, Xu G, Sun Y, Wang L, Chen J, Wang Y, Feng G, Cui
Z (2017) Effects of Nerve Growth Factor and Basic Fibroblast Growth Factor Promote
Human Dental Pulp Stem Cells to Neural Differentiation. Neurochem Res 42: 1015–1025.
doi:10.1007/s11064-016-2134-3.
Zhang N, Chen B, Wang W, Chen C, Kang J, Deng SQ, Zhang B, Liu S, Han F (2016)
Isolation, characterization and multi-lineage differentiation of stem cells from human
exfoliated deciduous teeth. Mol Med Rep 14: 95–102. doi:10.3892/mmr.2016.5214.
Zhao X, Gong P, Lin Y, Wang J, Yang X, Cai X (2012) Characterization of α-smooth

muscle actin positive cells during multilineage differentiation of dental pulp stem cells.
Cell Prolif 45: 259–265. doi:10.1111/j.1365-2184.2012.00818.x.
Zheng Y-H, Xiong W, Su K, Kuang S-J, Zhang Z-G (2013) Multilineage

differentiation of human bone marrow mesenchymal stem cells in vitro and in vivo. Exp
Ther Med 5: 1576–1580. doi:10.3892/etm.2013.1042.
172
Bibliografia
173

Tesis Igor Irastorza Epelde

Uploaded by

Copyright:

Available Formats

Tesis Igor Irastorza Epelde

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Tesis Igor Irastorza Epelde

Uploaded by

Copyright:

Available Formats

DEPARTMENT OF CELL BIOLOGY AND HISTOLOGY

SCHOOL OF MEDICINE AND NURSING

STUDY OF HUMAN DENTAL PULP STEM

Igor Irastorza Epelde

(c) 2021 Igor Irastorza Epelde

Bone tissue engineering is a multidisciplinary and relatively new field that

Once we studied the effects of these two titanium surfaces on hDPSCs, we

Lastly, another problem in dental implantology is the loss of periodontal

ALP= Alkaline phosphatase

ESC= Embryonic stem cell

PDL= Periodontal ligament

Introduction to tissue engineering

The main objective of tissue engineering is to restore, maintain, or improve

After blood transfusion, bone transplantation is the most common tissue

Particularly, periodontal regenerative therapy has a well-reported guided

Stem cells must meet, to be defined as such, three main characteristics.

Depending on the developmental stage, the stem cells show different

Multipotent: The differentiation potential of these stem cells is restricted to their

1.1. Adult stem cells

Figure 2. Human adult stem cell locations. (Hodgkinson et al., 2009)

1.1.1. Mesenchymal stem cells (MSCs)

Mesenchymal stem cells must fulfill certain requirements to be considered as

1.1.1.1. Dental pulp stem cells (DPSCs)

As mentioned before, DPSCs have a neural crest origin. During the

Figure 3. The main structures of the tooth. (Yildirim, 2013)

b. DPSC surface markers

DPSCs demonstrated having cell marker differences as a consequence of the

Due to their neural crest origin, it is important to mention the expression of

Moreover, because of the variety of DPSC subpopulations, the expression of

DPSCS SHED PDLSCS DFPCS SCAPS GSCS BMSCS

c. Cell Differentiation of DPSCs

As previously said, DPSCs have an ectomesenchymal origin. Due to this

The osteogenic differentiation is one of the most well-known cell differentiation

For chondroblastic differentiation, the most used culture media contain L-

In the case of the adipogenic differentiation media, apart from dexamethasone,

DPSCs differentiation potential

Figure 5. DPSCs differentiation potential. (Aurrekoetxea et al., 2015).

1.1.1.2. Bone marrow stem cells (BMSCs)

Friedenstein and colleagues discovered bone marrow mesenchymal stem cells in

It is being suggested that the main function of BMSCs is to contribute to the

b. BMSC surface markers

BMSCs are characterized by the negative expression of markers as CD14

The osteogenic differentiation of BMSCs is based on the supplementation of the

Moreover, for the chondrogenic differentiation the essential molecules are

In addition, BMSCs are also capable to differentiate to other mesenchymal cell

Since the BMSCs are mesenchymal origin cells, the aforementioned

2. Scaffolds for bone tissue engineering

The term scaffold refers to three-dimensional (3D) biomaterials that provide an

In bone tissue engineering, scaffolds must meet three characteristics to be used

Historically, the main characteristic of the first-generation of biomaterials was

Moreover, trying to avoid those non-specific immune response, biointeractivity

The third-generation of scaffolds, in which we are nowadays, are bioresponsive

Nowadays, natural or synthetic polymers and inorganic materials compose the

Another relevant characteristic of scaffolds to take account of is the form of the

osteointegration capacity (Albrektsson et al., 1981; Breine and Brånemark, 1980).

As mentioned before, different investigations concluded that the small pores

Another important reason in the development of porous titanium is also to

Titanium solid core Figure 8. Porous surface made on

The titanium alloys can be classified into three groups:

The activation of surrounding mesenchymal cells of the affected alveolar bone