US011407811B2

( 12 ) Xu
United States Patent ( 10 ) Patent No .: US 11,407,811 B2
(45 ) Date of Patent : Aug. 9, 2022
( 54 ) FUSION PROTEIN , PREPARATION METHOD ( 58 ) Field of Classification Search
THEREFOR AND USE THEREOF CPC CO7K 14/70557 ; CO7K 2319/30
See application file for complete search history .
( 71 ) Applicant: JIANGSU RONGTAI BIOTECH
CO . , LTD . , Nanjing ( CN) (56 ) References Cited
( 72 ) Inventor: Hanmei Xu , Nanjing ( CN) U.S. PATENT DOCUMENTS
( 73 ) Assignee : JIANGSU RONGTAI BIOTECH 7,538,088 B2 * 5/2009 Anderson CO7K 14/705
514 / 1.1
CO . , LTD ., Nanjing ( CN)
9

FOREIGN PATENT DOCUMENTS

( * ) Notice : Subject to any disclaimer, the term of this
patent is extended or adjusted under 35 WO WO 0067771 A 11/2000
U.S.C. 154 ( b ) by 154 days . WO WO 2009003145 A 12/2008
(21 ) Appl. No .: 16 /496,386 OTHER PUBLICATIONS
(22) PCT Filed : Mar. 5, 2018 Mar. 31 , 2012 (Mar. 31 , 2012 ) , 19 ( 3 ) , pp . 189-194 . PU , Chunyan et
al . Cloning , Expression, Purification, and, Activity of RGD Modi
( 86 ) PCT No .: PCT/CN2018/ 077964 fied Peptide EDSM - Y . Pharmaceutical Biotechnology.
$ 371 ( c ) ( 1 ), * cited by examiner
( 2 ) Date : Sep. 20 , 2019
Primary Examiner Gyan Chandra
( 87 ) PCT Pub . No .: WO2018 /171410 ( 74 ) Attorney, Agent, or Firm — Zhihua Han ; Wen IP
PCT Pub . Date : Sep. 27 , 2018 LLC
( 65 ) Prior Publication Data ( 57 ) ABSTRACT
US 2021/0107968 A1 Apr. 15 , 2021 The invention discloses a fusion protein, preparation method
thereof and use thereof and belongs to the field of biophar
( 30 ) Foreign Application Priority Data maceutical technology. The fusion protein according to the
present invention has anti- tumor, anti -autoimmune diseases
Mar. 20 , 2017 ( CN ) 201710165059.X and anti - inflammatory functions, and therapeutic effects on
ophthalmic diseases . According to the long - acting , multi
( 51 ) Int. Cl. functional fusion protein of the present invention, the
CO7K 14/705 (2006.01 ) EDSM -Y or EDSM - X polypeptide is fused to the antibody
A61P 27/02 ( 2006.01 ) immunoglobulin Fc fragment by a flexible linker so as to
A61P 9/00 ( 2006.01 ) obtain the fusion proteins 1 - V, which can improve the
A61P 19/02 ( 2006.01 ) efficacy, prolong the half -life and enhance stability, have
A61P 27/16 ( 2006.01 ) characteristics of strong effect, low toxicity and the like , and
A61P 29/00 ( 2006.01 ) can be used for the prevention and treatment of solid tumors
A61K 38/00 ( 2006.01 ) and various types of inflammation and neovascular ophthal
COZK 14/47 ( 2006.01 ) mic diseases . The fusion protein is expressed in a prokary
( 52 ) U.S. Cl . otic cell or a eukaryotic cell by a genetic engineering
CPC CO7K 14/70557 (2013.01 ) ; A61K 38/00 method , and the expressed fusion protein is obtained by
(2013.01 ) ; A61P 9/00 ( 2018.01 ) ; A61P 19/02 affinity chromatography.
(2018.01 ) ; A61P 27/02 ( 2018.01 ) ; A61P 27/16 8 Claims , 4 Drawing Sheets
( 2018.01 ) ; A61P 29/00 ( 2018.01 ) ; CO7K
14/4703 ( 2013.01 ) ; C07K 2319/30 (2013.01 ) Specification includes a Sequence Listing .
U.S. Patent Aug. 9, 2022 Sheet 1 of 4 US 11,407,811 B2

1001ke BDSMEY

FIG . 1
(GGGGS ) :
1902- FC
flexible Inker

FIG . 2

miech.He WDSMY

FIG . 3
bike

FIG . 4
he

FIG . 5
Fragment Vector

FIG . 6
U.S. Patent Aug. 9, 2022 Sheet 2 of 4 US 11,407,811 B2

1 2 3 4 5 6 7 8 910 13 12 13 1414 15 1616 17 18 19 20

FIG . 7

1819***
.

?????? ???

res
-

FIG . 8
U.S. Patent Aug. 9, 2022 Sheet 3 of 4 US 11,407,811 B2

FIG . 9
U.S. Patent Aug. 9, 2022 Sheet 4 of 4 US 11,407,811 B2

Rurka Songs
no es

wa

FIG . 10
WWD1A , Wavelength = 280 1453 ( E : 2016'DATAB1452120160321120150321 2016-03-22 16-44-50 ADAMUZM.D )
TAU
7.562
140 Peak area 3120.55

120

100

80

60

20 Heal area 12.2953 Peak area 15.6847

9.13
0

& 30 14 min

FIG . 11
 US 11,407,811 B2
1 2
FUSION PROTEIN , PREPARATION METHOD swelling in the hands or wrists ( especially swelling of the
THEREFOR AND USE THEREOF back of the wrist) as the initial symptoms, and the symptoms
are persistent and cannot be relieved . Although ordinary
CROSS REFERENCE TO RELATED symptomatic treatment can alleviate the symptoms, the
APPLICATION 5 symptoms often relapse due to irregular or insufficient
medication . When the disease progresses , obvious morning
This application is a national stage application of Inter stiffness may occur, usually up to 1 hour or above, and it
national application number PCT/ CN2018 /077964 , filed always gets worse constantly; at the same time , certain joint
Mar. 5 , 2018 , titled “ FUSION PROTEIN , PREPARATION dysfunction occurs . Its basic pathological features are vas
METHOD THEREOF AND USE THEREOF,” which 10 culitis and synovitis . Intra - articular synovial angiogenesis
claims the priority benefit of Chinese Patent Application No. results in pannus, leading to thickening of the synovial
201710165059.X , filed on Mar. 20 , 2017 , which is hereby membrane, increase of exudation , secretion of various cyto
incorporated by reference in its entirety. kines , invasion of cartilage, and bone damage . It can also
erode the muscle cavity, ligament, tendon sheath and
BACKGROUND 15 muscles around it , which affects the stability of thejoint, and
is prone to joint malformation and dysfunction. Vasculitis
Technical Field can also invade all organs of the body, leading to systemic
diseases . In the pathological process of arthritis, angiogen
The invention belongs to the field of biopharmaceutical esis is a characteristic histological change. Neovasculariza
technology, in particular to a fusion protein , a method for 20 tion is accompanied by synovial hyperplasia and inflamma
preparing the same and application thereof, and more par- tory cell infiltration, which is the basis of pannus formation
ticularly to a series of fusion proteins having anti -tumor, and joint destruction . Articular cartilage, which should have
anti -autoimmune ases , and anti - inflammatory functions no blood vessels , has formed new blood vessels due to some
and therapeutic effects on ophthalmic diseases . abnormal changes to erode cartilage, causing joint deforma
25 tion or pain . New blood vessels cause abnormal changes to
Related Art synovial tissues in patients with rheumatoid arthritis . There
fore , inhibition of neovascularization can alleviate or cure
Diseases such as tumors, arthritis, inflammation caused by arthritis - like inflammation diseases to a certain extent.
bacteria , and ophthalmic diseases ( such as AMD ) are called The pathogenesis of iris neovascular eye disease , choroi
vascular -related diseases . 30 dal neovascular eye disease , retinal neovascular eye disease
In recent years , the incidence and mortality of tumor in and corneal neovascular eye disease in ophthalmologic
China have been increasing . Unrestricted growth, invasion , diseases is related to the excessive neovascularization , the
and metastasis are the signs and characteristics of malignant inhibition of neovascularization is an important way to treat
tumors, and are the main reasons of treatment failure and these diseases , while the proliferation and migration of
death . Therefore, controlling growth , invasion and metasta- 35 endothelial cells is an important way to neovascularization .
sis of tumor is the main measure to improve the prognosis Angiogenesis inhibitors are a class of drugs that have
and survival. In 1971 , Folkman first proposed the theory that attracted attention in the treatment of neovascular diseases in
tumor growth depends on angiogenesis. Tumor angiogenesis recent years , and thus blocking the neovascularization may
is the morphological basis of tumor growth and metastasis . become a new means of treating eye diseases in patients
It not only provides nutrition to tumors, but also input a large 40 caused by angiogenesis in the eye . Among these angiogen
number of tumor cells to the host to cause tumor growth and esis inhibitors, especially angiostatin and endostatin attract
metastasis . Most malignant solid tumors such as ovarian most attention . Although these angiogenesis inhibitors have
cancer, liver cancer , cervical cancer and breast cancer are very attractive prospects , their defects are also very obvious .
vascular -dependent tumors . On the one hand , new blood That is , the targets of the antiangiogenesis drugs such as
vessels provide nutrition and oxygen for tumor growth , and 45 endostatin and angiostatin are unclear, their specificity and
on the other hand, they are important pathways for tumor selectivity for blood vessels are not good enough , and the
metastasis . Therefore, inhibition of tumor angiogenesis is an effect is limited , resulting in a larger amount of drugs used
important anticancer measure . in the experiment. Therefore, a good anti - angiogenic drug
Arthritis - like inflammatory diseases refer to inflammatory should be selective for marker molecules of new blood
diseases that occur in joints and surrounding tissues in 50 vessels to achieve a guiding role for the new blood vessels
human , and can be divided into dozens of types . There are and to enhance the inhibitory effect of drugs on angiogenesis
more than 100 million arthritis patients in China , and the as a whole , so as to realize the effect of high -efficiency
number of the patients is increasing . The clinical manifes- angiogenesis inhibition by using only a low dose of drugs.
tations are redness, swelling , heat, pain, dysfunction and Avastin has been successfully used in the treatment of eye
joint deformity , and in severe cases , joint disability is 55 diseases currently, but there is still no such drug indepen
caused , affecting the quality of life of patients. These mainly dently developed in China . The inhibition of angiogenesis
include rheumatic arthritis, rheumatoid arthritis, osteoarthri- by integrin target of the present invention will be a new
tis , gouty arthritis , ankylosing spondylitis, reactive arthritis , option for the treatment of such eye diseases .
infectious arthritis , and the like . Among them , rheumatoid In addition, tumors , arthritis - like inflammation, and eye
arthritis (RA ) is one of the most common inflammatory joint 60 diseases are vascular-related diseases. The growth and
diseases and major cause of disability in clinical . The metastasis of tumor depend on new blood vessels ; inflam
incidence of RA is about 0.5 % to 1.0 % in the world , and mation and angiogenesis are two pathological processes that
about 0.4 % in China . RA is a chronic systemic inflammatory are interrelated and co -developed; ophthalmic diseases such
disease whose cause is not yet clear, with chronic , sym- as age -related macular degeneration (AMD ) are mainly
metrical, multiple synovial arthritis and extra - articular 65 characterized by choroidal neovascularization .
lesions as the main clinical manifestations, and is an auto- Neovascularization is highly regulated under normal
immune inflammatory disease . Patients often have pain and physiological conditions and is an essential process in
 US 11,407,811 B2
3 4
reproduction, embryonic development, tissue repair, and antibodies with anti -tumor activity , the amino acid compo
wound healing . Angiogenesis also occurs under various sition or glycosylation pattern of the Fc segment are opti
pathological conditions , including : tumor growth and metas- mized to enhance ADCC , CDC and the like mediated by
tasis ; inflammatory disorders such as rheumatoid arthritis, them . A non - lytic fusion protein is a fusion of a functional
psoriasis , osteoarthritis, inflammatory bowel disease , 5 protein and a Fc fragment with reduced activity, and the
Crohn's disease , ulcerative colitis and other inflammatory binding affinity of the Fc to relevant receptors is modulated
disorders. by mutational modification of the complement receptor
Integrins are a class of receptors that are widely distrib- binding domain or glycosylation pattern on the Fc fragment
uted on the cell surface, which can mediate the adhesion to reduce or eliminate the ADCC and CDC effects , and
between cells and extracellular matrixes as well as the 10 retains only the biological activity of the functional protein
adhesion between cells . They participate in angiogenesis by and the long half - life of the Fc segment without cytotoxicity.
linking the interaction between intracellular cytoskeletal For example, the researchers fused a hybrid Fc (hyFc)
proteins and extracellular matrix molecules . Recently, at consisting of IgD and IgG4 with erythropoietin ( EPO ) to
least eight integrins ( alßi , a2B1 , a3B1, abß1 , a6B4 , a5B1 , construct a long - acting EPO -hyFc molecule that cannot bind
plays , anavß5
avß3 ) are involved
important in angiogenesis
role. avß3 , wherein
can recognize the Arg avß3
-Gly 15 to FcyR I and Clq , and is not cytotoxic . Its half -life is twice
that of recombinant human EPO -darbepoetin alfa. In addi
Asp ( RGD ) sequence in a ligand molecule . avß3 can be tion to long - acting properties, Fc fragments also can
expressed in a variety of cell types and participates in increase molecular stability. Fusion with Fc can increase the
physiological and pathological processes such as tumor expression of the protein in mammalian cells . On the other
angiogenesis
healing and, coagulation
invasion , metastasis, inflammation
in combination with ,multiple
wound 20 hand , the Fc fragment can specifically bind to a Protein A
affinity column and simplify the purification step of the Fc
ligands in multicellular activity. Therefore , an RGD fusion protein, which is of great significance in the research
sequence - containing polypeptide can function as an integrin and development of related biological products.
antagonist, and the RGD sequence can be used as a carrier
which targeted transport to the neovascular endothelium to 25 SUMMARY
more efficiently treat neovascular diseases . Therefore, the
antiangiogenesis polypeptide can prevent the delivery of 1. Problem to be Solved
oxygen and nutrition to the synovial membrane by inhibiting
angiogenesis, and can also directly causes the blood vessel In view of the high chemical synthesis cost , short half
degeneration, thereby possibly inhibiting the synovial pro- 30 life, and single target of the existing polypeptide, one of the
liferation of the RA . The inhibition of neovascularization is objects of the present invention is to provide a fusion protein
an important way to treat these diseases , while the prolif- comprising an integrin avß3 ligand sequence , an antiangio
eration and migration of endothelial cells is an important genesis polypeptide sequence, and Fc sequence of an anti
way to neovascularization . body IgG1 or IgG2 or IgG4 or HyFc , and the sequences are
Antibody drugs are the focus and hotspot of current drug
research and development, usually can get a marketing
35 linked by a flexible amino acid linker , which can form a
correct high - order structure , with the advantages of long
license faster, and bring greater commercial success . With half - life and high antitumor activity.
the successful platform of traditional antibodies, a new Another object of the present invention is to provide a
functional fusion protein has also developed rapidly, which method for preparing the fusion protein , which links two
fuses proteins or polypeptides with immunoglobulin Fc 40 different active polypeptides by using mammalian cell
fragments, based on antibody structure. Fc fusion protein expression methods, instead of chemical synthesis methods,
refers to a novel protein molecule produced by linking and and is expected to solve the problems that polypeptide
fusion of a functional protein molecule with biological molecules having polyamino acid chain , a secondary struc
activity, a polypeptide molecule and an immunoglobulin Fc ture such as a disulfide bond , and a high -order structure
fragment through a special linker with a technique such as 45 being difficult to synthesize, low in production yield and
genetic engineering, and the functional protein formed can high in synthesis cost ; improving the affinity of the poly
bind to soluble ligand (or receptor) molecules of endogenous peptide molecule to the target and the cytotoxicity of the
receptors ( or ligands ) or other active substances ( i.e. cyto- polypeptide molecule, and enhancing the therapeutic effect
kines ) that require an prolonged half- life . Such fusion pro- of the polypeptide molecule ; as well as overcoming the
teins not only retain the biological activity of functional 50 shortcomings of short half- life and frequent administration
protein molecules , but also have some antibody properties, of the polypeptide molecule .
such as a long half- life . For example, the half - life of a
common recombinant IL - 2 in vivo is only 6.9 min, while the 2. Technical Solution
circulating half- life of a recombinant IL - 2/ Fc fusion protein
in vivo is nearly 700 - fold longer. The Fc fusion protein can 55 In order to solve the above problems, the technical
be classified into cyto - lytic and non - lytic depending on solution adopted by the present invention is as follows.
whether it is desired to exert the biological activity of the Fc A fusion protein comprising an integrin avß3 ligand
segment binding to FcyR to mediate antibody -dependent cell sequence , an antiangiogenesis polypeptide sequence, and an
mediated cytotoxicity (ADCC ) or binding to complement Fc sequence of an antibody IgG1 or IgG2 or IgG4 or HyFc
Clq to mediate complement-dependent cytotoxicity ( CDC ) . 60 is provided .
The former is formed by fusion of a functional protein and There are two antiangiogenesis polypeptide sequences,
a Fc fragment which is natural or has increased activity, respectively EDSM - X and EDSM - Y, in the present inven
which not only has the biological activity and long plasma tion ; in the sequence listing, SEQ ID NO : 1 is the integrin
half - life of the functional protein , but also retains the ability avß3 ligand sequence , and SEQ ID NO : 3 is an amino acid
of the Fc segment to mediate ADCC and CDC effects, and 65 sequence corresponding to EDSM - Y , SEQ ID NO : 5 is an
can realize targeted killing of functional protein receptor amino acid sequence corresponding to EDSM -X , SEQ ID
positive cells . In the field of antibody application, especially NO : 7 is an amino acid sequence corresponding to IgG1 - Fc ,
 US 11,407,811 B2
5 6
SEQ ID NO : 9 is an amino acid sequence corresponding to Further, the dosage form of the medicament is a capsule ,
IgG2 - Fc , SEQ ID NO : 11 is an amino acid sequence a tablet , a pill , an injection, a nasal spray or an aerosol.
corresponding to mIgG4 -Fc, and SEQ ID NO : 13 is an A preparation method of the above fusion proteins
amino acid sequence corresponding to hyFc. includes a synthesis method and a method of recombinant
Further, the amino acid sequences corresponding to the 5 expression by Escherichia coli , yeast , and mammalian cells .
series of fusion proteins are SEQ ID NO : 15 , SEQ ID NO : 3. Beneficial Effect
17 , SEQ ID NO : 19 , SEQ ID NO : 21 , and SEQ ID NO : 23 ,
respectively, wherein the antiangiogenesis polypeptide
sequence constituting the amino acid sequence SEQ ID NO : 10
Compared with the prior art, the beneficial effects of the
15 , SEQ ID NO : 17 , and SEQ ID NO : 19 is linked to the present invention are as follows.
antibody sequence by a flexible amino acid linker, and the ( 1 ) The present invention obtains a series of fusion
polypeptides at both ends can be changed and shifted . proteins by fusion of an EDSM - Y polypeptide and an
SEQ ID NO : 15 is formed by IgG1 - Fc linked to an antibody immunoglobulin Fc fragment via a flexible ( F )
antiangiogenesis polypeptide EDSM - Y via aa flexible linker, 15 linker. The problems of synthesis bottleneck of a polypep
and the structural schematic diagram is as shown in FIG . 1 . tide molecule having a large molecular weight and a com
SEQ ID NO : 17 is formed by IgG2 - Fc linked to an plex structure, in particular macromolecular polypeptide
antiangiogenesis polypeptide EDSM - Y via aa flexible linker, molecules having a secondary structure such as a disulfide
and the structural schematic diagram is shown in FIG . 2 . bond and a high - order structure are solved ; the technical
SEQ ID NO : 19 is formed by mIgG4 - Fc linked to an 20 bottleneck of chemical synthesis difficulty and low yield of
antiangiogenesis polypeptide EDSM - Y via a flexible linker, a large molecular weight polypeptide is overcome , and the
and the structural schematic diagram is shown in FIG . 3 . production cost of the macromolecular polypeptide is sig
SEQ ID NO : 21 is formed by hyFc linked to an antian- nificantly reduced ; the expression of a polypeptide molecule
giogenesis polypeptide EDSM -Y via a flexible linker, and by a living body cell such as a mammalian cell can form a
the structural schematic diagram is shown in FIG . 4 . 25 correct high -order structure, and the affinity of the polypep
SEQ ID NO : 23 is formed by hyFc directly linked to tide molecule to the target molecule is superior to that of the
antiangiogenesis polypeptides EDSM -Y and EDSM - X , and chemically synthesized polypeptide molecule ; the polypep
the structural schematic diagram is shown in FIG . 5 . tide molecule forms a fusion protein molecule with the Fc
For the genes encoding the above fusion proteins , the fragment of antibody IgG1 , IgG2 or IgG4 , and the Fc
nucleic acid sequences encoding SEQ ID NO : 15 , SEQ ID 30 fragment of IgG is prevented from being degraded by a Fc
NO : 17 , SEQ ID NO : 19 , SEQ ID NO : 21 , and SEQ ID NO : receptor (FcRn ) -mediated recycling mechanism , while the
23 are SEQ ID NO : 16 , SEQ ID NO : 18 , SEQ ID NO : 20 , Fc fragment has a larger molecular weight and low renal
SEQ ID NO : 22 and SEQ ID NO : 24 , respectively. clearance, so as to ensure that the half - life of the fusion
Use of the above fusion proteins in the preparation of a protein is significantly longer than that of the polypeptide ,
medicament for treating tumors, autoimmune diseases , 35 and at the same time , the fusion protein formed by the fusion
inflammations and ophthalmic diseases is provided. of the Fc fragment of IgG1 can increase the cytotoxicity of
Further, the tumors include gastric cancer, lung cancer, ADCC and CDC , and can significantly increase the activity
liver cancer, breast cancer, colon cancer, glioma , melanoma , of anti - tumor molecules , and its anti - tumor effect is superior
and cervical cancer, as well as primary or secondary cancer, to that of polypeptide molecules ; and the eukaryotic expres
melanoma , and sarcoma originating from the head and neck , 40 sion system is used to link the antibody Fc fragment to the
brain , thyroid , esophagus, pancreas, lung, liver, stomach , EDSM -Y sequence by linker to prolong the half - life of the
breast, kidney, gallbladder, colon or rectum , ovary, cervix , functional protein EDSM - Y .
uterus, prostate , bladder, and testicle in human. ( 2 ) The fusion protein of the present invention is aa class
Further, the inflammations include rheumatoid arthritis , of integrin blocker polypeptide drugs, which can effectively
osteoarthritis, gouty arthritis, ankylosing spondylitis, psori- 45 inhibit angiogenesis to achieve the functions of anti -tumor,
atic arthritis, reactive arthritis, infectious arthritis, and trau- and treatment of arthritis and inflammation - related ophthal
matic arthritis; the autoimmune diseases include lupus ery- mic diseases.
thematosus and psoriasis . ( 3 ) The fusion protein sequence of the present invention
Further, the ophthalmic diseases include iris neovascular includes an arginine - glycine-aspartate ( RGD ) sequence , the
eye disease , choroidal neovascular eye disease , retinal neo- 50 RGD sequence is an important ligand of integrin , and the
vascular eye disease , or corneal neovascular eye disease . RGD sequence - containing polypeptide Gly -Gly -Gly -Gly
Further, the iris neovascular eye disease includes iris Arg -Gly -Asp can specifically recognize integrins, can effec
neovascular eye diseases caused by neovascular glaucoma, tively inhibit neovascularization , and can be used to treat
diabetic retinopathy or central retinal vein occlusion ; the tumor diseases , arthritis diseases and ophthalmic diseases .
choroidal neovascular eye disease includes age - related 55 The present invention uses a flexible linker to link the two
macular degeneration , central exudative chorioretinopathy, polypeptides EDSM - Y and the Fc fragment of the antibody
ocular histoplasmosis syndrome or serpiginous choroidopa- to obtain the amino acid sequences of the fusion protein :
thy; the retinal neovascular eye disease includes the retinal SEQ ID NO : 15 , SEQ ID NO : 17 , SEQ ID NO : 19 , SEQ ID
neovascular eye diseases associated with diabetes , tumors, NO : 21 , and SEQ ID NO : 23 , which can improve the
retinal detachment, central retinal vein occlusion , retinal 60 efficacy, prolong the half - life, enhance stability, and make
periphlebitis , systemic lupus erythematosus, Eales diseases the fusion protein have certain ADCC and CDC effects at the
or Coat diseases ; the corneal neovascular eye disease same time , and have the characteristics of strong effect and
includes the corneal neovascular eye diseases caused by low toxicity .
cornea contacting an lens, as well as the corneal neovascular ( 4 ) The fusion protein of the present invention can be
eye diseases caused by alkali and other chemical burns, 65 targeted to the neovascular endothelium , and inhibit neo
corneal surgery, bacterial infection , chlamydial infection , vascularization to achieve the effects of preventing or treat
viral infection or protozoal infection . ing vascular and inflammation - related diseases .
 US 11,407,811 B2
7 8
( 5 ) The present invention has an effect of inhibiting FIG . 7 is a diagram showing the results of PCR verifica
various tumors in terms of anti -tumor, and it can be seen tion of bacterial liquid according to the present invention;
from the MTT assay results in Example 2 that the fusion FIG . 8 is a diagram showing the results of capture of
protein I , fusion protein II , fusion protein III , fusion protein fusion protein according to the present invention ;
IV and fusion protein V can effectively inhibit proliferation 5 FIG.9 is a diagram showing the fine purification of fusion
of gastric cancer , lung cancer, liver cancer, breast cancer, protein according to the present invention ;
melanoma , colon cancer, glioma and cervical cancer, the FIG . 10 is a diagram showing the results of analysis of a
inhibition rate on melanoma, gastric cancer and lung cancer fusion protein sample by a SDS - PAGE method according to
reaches 50 % or more at the concentration of 32 ug/mL ; the the present invention ;
inhibition rate on glioma and cervical cancer reaches 40 % or 10 FIG . 11 is a diagram showing the results of analysis of a
more at the concentration of 64 ug /mL ; higher concentration fusion protein sample by HPLC according to the present
is needed for effective inhibition of colon cancer, liver invention .
cancer and breast cancer cells .
( 6 ) According to the present invention , in terms of inhib DETAILED DESCRIPTION
iting the neovascularization , it can be clearly seen from the 15
cell migration experiment of Example 3 that the inhibition of The invention is further described below in conjunction
migration of HUVEC is significant at a concentration of 2 with specific examples.
ug /mL , and the inhibition rate reaches 70 % or more .
9
Example 1
(7 ) According to the present invention , in terms of auto
immune diseases and anti- inflammatory effects, it can be 20
clearly seen from a series of verification model experiments ( 1 ) Acquisition of Fusion Protein Gene and Construction
of Examples 4-10 that fusion protein I , fusion protein II , of Expression Vector
fusion protein III , fusion protein IV and fusion protein V can The fusion protein domain of the present invention com
significantly inhibit lymphocyte proliferation , inhibit IL - 1B prises an integrin avß3 ligand sequence , an antiangiogenesis
inflammatory factors production by macrophages, inhibit 25 polypeptide sequence, and an Fc sequence of an antibody
granuloma formation , reduce capillary permeability in IgG1 or IgG2 or IgG4 or HyFc , where the antiangiogenesis
model groups, inhibit ear swelling and toe swelling in model polypeptide sequence is EDSM -X and EDSM - Y , respec
groups, and reduce the degree of chronic inflammation of tively ; in the sequence listing, SEQ ID NO : 1 is the integrin
adjuvant arthritis in rats . avß3 ligand sequence, SEQ ID NO : 3 is an amino acid
( 8 ) According to the present invention , in terms of the 30 sequence corresponding to EDSM - Y , SEQ ID NO : 5 is an
treatment of ophthalmic diseases, it can be seen from amino acid sequence corresponding to EDSM -X , SEQ ID
Examples 11-19 that fusion protein I , fusion protein II , NO : 7 is an amino acid sequence corresponding to IgG1 - Fc ,
fusion protein III , fusion protein IV and fusion protein V can SEQ ID NO : 9 is an amino acid sequence corresponding to
significantly inhibit proliferation of human retinal vascular IgG2 - Fc , SEQ ID NO : 11 is an amino acid sequence
endothelial cells , inhibit the neovascularization of chicken 35 corresponding to mIgG4 - Fc , and SEQ ID NO : 13 is an
embryo chorioallantoic membrane, inhibit the growth of amino acid sequence corresponding to hyFc.
corneal new blood vessels , inhibit the growth of iris new The human immunoglobulin Fc region and its mutant are
blood vessels in rabbits, promote the increase of choroidal ligated to the EDSM -Y protein by GGGGSx3 Linker to
blood flow in rabbit eyes , reduce the retinal neovascular design five novel Fc fusion proteins Fc - EDSM - Y, which are
plexus in oxygen - induced retinopathy (OIR) mice and 40 named as protein 1 , protein II , protein III , protein IV, and
inhibit neovascularization in oxygen - induced neonatal rat protein V respectively in the following experiments; amino
retinopathy model and has a certain therapeutic effect on acid sequences corresponding to protein I , protein II , protein
diabetic retinopathy. III , protein IV, and protein V are SEQ ID NO : 15 , SEQ ID
NO : 17 , SEQ ID NO : 19 , SEQ ID NO : 21 , and SEQ ID NO :
2

BRIEF DESCRIPTION OF THE DRAWINGS 45 23 , respectively, where SEQ ID NO : 15 is formed by

IgG1 -Fc linked to an antiangiogenesis polypeptide
FIG . 1 is a structural schematic diagram of a fusion EDSM -Y via aa flexible linker, and the structural schematic
protein corresponding to SEQ ID NO : 15 according to the diagram is as shown in FIG . 1 ; SEQ ID NO : 17 is formed
present invention , wherein the linker by IgG2 -Fc linked to an antiangiogenesis polypeptide
GGGGSGGGGSGGGGS corresponds to SEQ ID NO : 25 ; 50 EDSM -Y via a flexible linker, and the structural schematic
FIG . 2 is a structural schematic diagram of a fusion diagram is shown in FIG . 2 ; SEQ ID NO : 19 is formed by
protein corresponding to SEQ ID NO : 17 according to the mIgG4 - Fc linked to an antiangiogenesis polypeptide
present invention , wherein the linker EDSM -Y via a flexible linker, and the structural schematic
GGGGSGGGGSGGGGS corresponds to SEQ ID NO : 25 ; diagram is shown in FIG . 3 ; SEQ ID NO : 21 is formed by
FIG . 3 is a structural schematic diagram of a fusion 55 hyFc directly linked to an antiangiogenesis polypeptide
protein corresponding to SEQ ID NO : 19 according to the EDSM - Y , and the structural schematic diagram is shown in
present invention , wherein the linker FIG . 4 ; SEQ ID NO : 23 is formed by hyFc directly linked
GGGGSGGGGSGGGGS corresponds to SEQ ID NO : 25 ; to antiangiogenesis polypeptides EDSM - Y and EDSM - X ,
FIG . 4 is a structural schematic diagram of a fusion and the structural schematic diagram is shown in FIG . 5 .
protein corresponding to SEQ ID NO : 21 according to the 60 According to the codon preference of CHO cells , the coding
present invention ; sequences of five novel Fc fusion proteins Fc - EDSM - Y are
FIG . 5 is a structural schematic diagram of a fusion optimized , and the EcoRI enzyme cleavage sites , Kozak
protein corresponding to SEQ ID NO : 23 according to the sequences , signal peptides are introduced at the 3 ' end, and
present invention ; Xhol enzyme cleavage sites are introduced at the 5 ' end . The
FIG . 6 is an electrophoretogram of a fragment obtained by 65 DNA sequence is obtained by a whole gene synthesis
recovering IgG1-Fc /EDSM - Y and expression vector method, and the nucleic acid sequences encoding SEQ ID
pcDNA3.4 /MCS ( + ) gel according to the present invention ; NO : 15 , SEQ ID NO : 17 , SEQ ID NO : 19 , SEQ ID NO : 21 ,
 US 11,407,811 B2
9 10
and SEQ ID NO : 23 are sequentially SEQ ID NO : 16 , SEQ tubes which were stored at -80 ° C. At this point, the
ID NO : 18 , SEQ ID NO : 20 , SEQ ID NO : 22 , and SEQ ID construction of the IgG1 - Fc/ EDSM -Y expression vector was
NO : 24, respectively. finished .
The DNA sequences of the above five fusion proteins ( II ) Expression of Fusion Protein
Fc - EDSM -Y were synthesized by a commissioned biotech- 5 Transient transfection is one of the ways to introduce
nology company, ligated to a pUC57 vector to form a DNA into eukaryotic cells . In transient transfection , recom
cloning vector, and stored in E. coli DH5a to form a clone binant DNA is introduced into highly infectious cell lines to
strain, which was sent as bacteria penetrans. The five fusion obtain transient but high levels of expression of the target
proteins all used pcDNA3.4 /MCS ( + ) as the expression vec gene. Enough proteins can be obtained for experiments in a
tors , and the vector construction processes were completely 10 transfection
short period of time , saving cell screening time in stable
identical. Therefore, IgG1 - Fc /EDSM - Y was taken as an express five. novel The Expi293 Expression System is used to
example , and the experimental procedures were as follows. expression process offusion proteins Fc - EDSM - Y . Since the
1. Under sterile conditions , the IgG1 - Fc /EDSM - Y clone tical , the IgG1 - Fc /EDSM -Y is protein
the fusion is completely iden
used as an example. The
strain sent by the biotechnology company was picked up 15 experimental procedures are as follows.
from the surface of the bacteria penetrans and inoculated 1. Plasmid preparation .
into two tubes containing 5 mL of Amp -resistant LB A glycerol tube preserving strain with IgG1 - Fc/ EDSM -Y
medium at 37 ° C. , 120 rpm under shaking overnight. expression vector was taken from a -80 ° C. refrigerator,
2. After the culture of the bacteria solution in the two inoculated into a 2 L shake flask containing 500 mL of
tubes, 2.5 mL of sterile 60% glycerol was added in one tube , 20 Amp -resistant LB medium , and cultured at 37 ° C. , 160 rpm
mixed well , and then charged into sterile centrifuge tubes , under shaking overnight.
with 1 mL per tube , to prepare glycerin tubes, which were After the completion of the culture, the mixture was
frozen and stored at -80 ° C. The bacteria solution in the centrifuged at 5000 g for 5 min to collect thalli, and the
other tube was centrifuged at 12,000 rpm for 1 min to collect plasmid was extracted using a commercial EndoFree Plas
thalli, and a cloning vector of IgG1 - Fc /EDSM - Y was 25 mid Maxi Kit . The plasmid concentration was controlled to
extracted by using a conventional commercial plasmid mini- be 1 mg /mL or above (if it is lower than this concentration,
prep kit. concentration is required ), and then sterilized by filtration
3. The restriction endonuclease EcoRI/Xhol was used to using a sterile 0.22 um pore size filter to complete plasmid
perform double enzyme digestion of the IgG1 - Fc/ EDSM -Y preparation
cloning vector and the expression vector pcDNA3.4 /MCS 30 2. Early - Stage Preparation of Transient Transfection of
( + ) , and the inserted fragment IgG1 - Fc /EDSM - Y having Cells
cohesive ends and the expression vector pcDNA3.4 /MCS ( +) The 293F cells used for transfection were passaged at a
were separated by horizontal nucleic acid electrophoresis cell density of 0.4 * 10 cells/mL for every four days from the
and recovered using a commercial DNA gel recovery kit . day of thawing, and at least three passages were performed,
The DNA fragment recovery results are shown in FIG . 6 . 35 followed by the transient transfection . During the passage ,
4. Using the T4 ligase , the inserted fragment IgG1 - Fc / the passage volume was expanded as needed based on the
EDSM -Y and the expression vector pcDNA3.4 /MCS ( + ) volume of the final transfection medium .
obtained by gel recovery were ligated at 16 ° C. according to 3. Transient Transfection ( Taking 30 mL Transfection
the molar ratio of inserted fragment to vector of 1 : 5 for 16 Volume as an Example, Multiply as Needed )
h. 40 ( 1 ) One day before the experiment, 6 * 107 live cells were
5. 20 uL DNA ligation was added to 100 uL of freshly inoculated into 30 mL of Expi293 Expression Medium , and
thawed E. coli TOP10 competent cells , mixed gently, and cultured at 37 ° C. , 8 % CO2, 125 rpm under shaking.
placed in an ice bath for 30 min . After being heat - shocked ( 2 ) On the day of the experiment, the cells cultured on the
at 42 ° C. for 45 s , the mixture was quickly placed in an ice previous day were counted firstly, the cell density should be
bath for 2 to 3 minutes. 900 uL of non -resistant LB medium 45 3-5 * 10 cells/mL , and the viability was greater than 95 % .
was added to the mixture, and cultured at 37 ° C. for 1 h with ( 3 ) 7.5 * 107 cells were aspirated into a new 125 mL
shaking. The mixture was centrifuged at 4500 rpm for 1 min Erlenmeyer flask and the preheated Expi293 Expression
at 4 ° C. , 900 uL of supernatant was discarded under sterile Medium was added to 25.5 mL .
conditions , the remaining bacterial solution and the precipi- ( 4 ) Preparation of Plasmid - Transfection Reagent Mixture
tated thalli were mixed evenly via gentle blowing - suction , 50 a . 30 ug of plasmid DNA was re - dissolved in 1.5 mL of
all of which was aspirated by a pipette, and coated to an Opti - MEM I Reduced Serum
Amp - resistant LB solid plate and statically cultured at 37 ° C. Medium and mixed gently.
for 12 h . b . 81 uL of ExpiFectamine 293 Reagent was added to
6. 20 single colonies were picked up and inoculated in a Opti - MEM I Reduced Serum Medium to a volume of 1.5
tube containing 5 mL of Amp- resistant LB medium , and 55 mL . The mixture was gently mixed and incubated for 5 min
cultured at 37 ° C. , 120 rpm under shaking overnight. at room temperature (long incubation period affects conver
7. Among the strains inoculated in the previous step , each sion efficiency ).
of normally growing strains was stored in 3 glycerol tubes. c . The above two solutions were mixed gently , incubated
At the same time , each strain was tested by bacterial PCR for 20-30 min at room temperature to complete the prepa
verification ( see FIG . 7 ) , positive clones were screened , and 60 ration of the plasmid - transfection reagent mixture.
the preserved glycerol tubes were sent to the biotechnology ( 5 ) 3 mL of plasmid - transfection reagent mixture was
company for sequencing verification . The correct expression added to the cell culture liquid of step (3 ) to 28.5 mL in total .
vector was finally obtained . ( 6 ) The mixture was cultured at 37 ° C. , 8 % CO2 :, 125 rpm
8. The glycerol tubes preserving the strain having correct under shaking for 20 h .
sequencing was taken out , inoculated into a 250 mL shake 65 ( 7 ) 150 uL of ExpiFectamine 293 Transfection Enhancer
flask containing 30 mL of Amp -resistant LB medium , cul- 1 and 1.5 mL of ExpiFectamine 293 Transfection Enhancer
tured at 37 ° C. , 120 rpm overnight, stored in 20 glycerol 2 were added . At this point, the total volume was 30 mL .
 US 11,407,811 B2
11 12
( 8 ) The mixture was cultured at 37 ° C. , 8 % CO2 , 125 rpm ( 4 ) The sample was collected , peak 3 was the target
under shaking. The culture was terminated after 6 days and protein peak , for the collection of peak 3 , collection was
protein purification was carried out . started at onset 10 mAu peak and stopped at post -peak 10
(III ) Purification of Fusion Protein mAu .
Protein A is a cell -wall protein isolated from Staphylo- 5
( 5 ) Finally, the column was stored with 0.1 M NaOH and
coccus aureus , which binds to mammalian IgG mainly the flow rate is 10 mL /min .
through the Fc fragment and has very high specificity and ( 6 ) Ultrafiltration concentration of sample: the samples of
binding ability, and is widely used for purification of IgG peak 3 were combined and subjected to ultrafiltration con
antibodies and IgG - Fc fusion proteins. The five novel fusion 10 centration . A 10 kDa ultrafiltration membrane was selected ,
proteins Fc - EDSM - Y have IgG - Fc fragments and thus the and the sample was concentrated to a target protein concen
purification processes are completely identical. Therefore, tration of more than 5 mg/mL , and then the sample was
IgG1- Fc /EDSM - Y produced by transient transfection at 1.6 charged and stored in a refrigerator at -80 ° C. The initial
L scale is used as an example. The experimental procedures concentration was about 0.29 mg/mL , and the sample was
are as follows. 15 finally concentrated to 27 mL , and the concentration was
1. Sample pretreatment: 1.6 L of transiently transfected about 5.53 mg/mL ; the sample was charged and cryopre
cell culture liquid after culture termination was centrifuged served . At the same time , samples were subjected to release
at 7500 rpm for 20 min at 4 ° C. , and the supernatant obtained testing by SDS - PAGE and HPLC (FIG . 10 and FIG . 11 ) , and
was about 1.46 L for the next protein A capture . then used for druggability evaluation studies .
2. Affinity capture of target protein ( See FIG . 8 ) 20
The column information is as follows: Example 2
Inhibitory Effect of Fusion Protein on Proliferation of
Packing Mabselect SuRe Various Tumor Cells
Column XK50 /20 25 The MTT assay was used to detect the inhibitory effect of
Column height (cm) 10 the integrin blocker fusion protein obtained in Example 1 on
Cross - sectional area of column ( cm ) 19.62 the proliferation of various tumor cells , including melanoma
Packing volume (mL ) 196.2
cell B16F10 , gastric cancer cell MGC - 803 , lung cancer cell
A549 , liver cancer cell Hep - G2 , breast cancer cell MDA
( 1 ) The sterilization was first performed with 500 mL of 30 MB - 231 , colon cancer cell HCT-116 , human glioma U87 ,
0.2 M NaOH at a flow rate of 10 mL /min . and cervical cancer cell Hela .
(2 ) The column was equilibrated with 20 mM PB and 0.15 The tumor cells were cultured in a 5 % CO , incubator at
M NaCl , pH 7.0 , the volume was about 1000 mL , and the 37 ° C. to a density of 90 % or more, and collected by
flow rate was 20 mL /min .
(3 ) Loading: the sample was pre -adjusted to a neutral pH , 35 trypsinization
liquid and
. The cells were resuspended in the culture
counted under a microscope. The cell concentra
and the flow rate was 20 mL /min .
(4 ) The column was washed with 20 mM PB and 0.15 M was inoculated into aa3.0x10
tion was adjusted to
96 -
+ cells /mL . The cell suspension
well plate at 100 ul per well and
NaCl , pH 7.0 , the volume was about 800 mL , and the flow cultured overnight in a 5 % CO2 incubator at 37 ° C. The
rate was 20 mL /min .
(5) The target protein was eluted with 50 mM citric 40 were fusiondiluted
proteinswithI, IIthe, IIIculture
, IV, V ,liquid
and theto respective
positive drug Taxol
acid- sodium citrate, and 0.15 M NaCl , pH 3.0 , collection mined concentrations. After the cells were fully predeter
was started at onset 20 mAu and stopped at post -peak 20 each dilution was added to a 96 -well plate at 100adhered uL per
,
mAu ; and the flow rate is 20 mL /min .
( 6 ) The column was finally washed with 500 mL of 0.2 M well , respectively. The integrin blocker fusion proteins I , II ,
NaOH , and rinsed with water to neutral, and the column was 45 III , IV , and V were added as an administration group, Taxol
stored with 20% ethanol. was used as a positive control group , and the culture liquid
3. Further separation and purification by gel chromatog without any drug was used as a blank control group , and
raphy ( FIG . 9 ) incubated in a 5 % CO2 incubator at 37 ° C. for 48 hours . 20
Column Parameters : uL of 5 mg/mL MTT was added to each well of a 96 - well
50 plate , and incubation was continued for 4 hours . The
Packing Superdex200
medium was aspirated and 100 uL of DMSO per well were
added to dissolve . The absorbance was measured at 570 nm
Column XK50 / 60 with a microplate reader with a reference wavelength of 630
Column height (cm) 58
55
nm , and the proliferation inhibition (PI ) was calculated . The
Cross -sectional area of column ( cm² ) 19.62 formula is as follows:
Packing volume (mL ) 1138
Flow rate mL /min
Loading 1-10 % loading volume
PI ( %) = 1 - Ntest x 100 %
Ncontrol
( 1 ) The sterilization was first performed with 300 mL of 60
0.5 M NaOH at a flow rate of 10 mL /min , and rinsed with
ultrapure water to about neutral. where Niest is the OD value of the test group and Nccontrol
(2 ) The column was equilibrated with a PBS buffer, pH is the OD value of the blank control group .
7.4 , the equilibrium volume was about 1500 mL , and the Data Statistics:
flow rate was 10 mL /min . 65 The test was repeated 5 times independently. The results
(3 ) Loading : the sample was a protein A eluent, and the obtained from the test were calculated as mean + SD , and
loading volume was 40 mL . statistical t - test was performed . P <0.05 was considered as a
 US 11,407,811 B2
13 14
significant difference, and P <0.01 was considered as an TABLE 2 - continued
extremely significant difference. The experimental results
are shown in Tables 1-8 . Inhibitory effect of fusion protein I , protein II , protein III , protein
IV and protein V on proliferation of gastric cancer cell MGC -803
TABLE 1 5 Group (n 5 ) Dose (ug /mL ) A570 nm / A630 nm PI (%)
Inhibitory effect of fusion protein I , protein II , protein III , protein 64 0.3216 + 0.0331 ** 73.68 %
IV and protein V on proliferation ofmelanoma cell line B16F10 128 0.2016 + 0.0217 ** 83.50 %
256 0.1023 + 0.0231 ** 91.63 %
Group (n = 5 )
=
Dose (ug/mL ) A570 nm / A630 nm PI (% ) Protein II 1 1.1122 + 0.0374 8.98 %
10 2 1.0149 + 0.0253 16.94 %
Protein I 1 1.0974 + 0.0157 12.47 % 4 0.8231 + 0.0396 * 32.64 %
2 1.0013 0.0781 20.13 % 8 0.7231 + 0.0215 * 40.82 %
4 0.8603 + 0.0640 * 31.38 % 16 0.5216 + 0.0192 ** 57.31 %
8 0.6959 + 0.0419 ** 44.49 % 32 0.4398 + 0.0347 ** 64.01 %
16 0.5221 + 0.0778 ** 58.36 % 64 0.3378 + 0.0286 ** 72.35 %
32 0.4330 + 0.0579 ** 65.46 % 15 128 0.2203 + 0.0147 ** 81.97 %
64 0.3029 + 0.0286 ** 75.84 % 256 0.0987 + 0.0159 ** 91.92 %
128 0.1942 + 0.0450 ** 84.51 % Protein III 1 1.1084 + 0.0332 9.29 %
256 0.0817 + 0.0301 ** 93.48 % 2 1.1077 + 0.0292 9.35 %
Protein II 1 1.1137 + 0.0370 11.17 % 4 0.8854 + 0.0273 * 27.54 %
2 1.0250 + 0.0230 18.24 % 8 0.7222 + 0.0316 40.90 %
4 0.8986 + 0.0731 * 28.32 % 16 0.5254 + 0.0198 ** 57.00 %
8 0.7243 + 0.0421 ** 42.23 % 20 32 0.4285 + 0.0249 ** 64.93 %
16 0.6400 + 0.0661 ** 48.95 % 64 0.3269 + 0.0217 ** 73.25 %
32 0.5034 + 0.0286 ** 59.85 % 128 0.2089 + 0.0206 ** 82.90 %
64 0.3867 + 0.0195 ** 69.16 % 256 0.0999 + 0.0193 ** 91.82 %
128 0.293 5 + 0.0313 ** 76.59 % Protein IV 1 1.1201 + 0.0432 8.33 %
256 0.1777 + 0.0212 ** 85.83 % 2 1.1181 + 0.0385 8.49 %
Protein III 1 1.1086 + 0.0151 11.57 % 25 4 0.890 + 0.0362 * 27.16 %
2 1.0009 + 0.0772 20.16 % 8 0.7213 + 0.0319 * 40.97 %
4 0.8592 + 0.0637 * 31.47 % 16 0.5345 + 0.0297 ** 56.26 %
8 0.6961 + 0.0412 ** 44.48 % 32 0.4198 + 0.0255 ** 65.64 %
16 0.5219 + 0.0775 ** 58.37 % 64 0.3169 + 0.0213 ** 74.06 %
32 0.4327 + 0.0579 ** 65.49 % 128 0.2211 + 0.0198 ** 81.91 %
64 0.3029 + 0.0284 ** 75.84% 30 256 0.0970 + 0.0203 ** 92.06 %
128 0.1944 + 0.0493 ** 84.49 % Protein V 1.1075 + 0.0402 9.36 %
256 0.0818 + 0.0302 ** 93.48 % 1.1062 0.0299 9.47 %
Protein IV 1 1.1128 + 0.0377 11.24% 0.8868 + 0.0342 * 27.42 %
2
4
1.0241
0.8977
+ 0.0233
+ 0.0734 *
18.31 %
28.40 %
$
to
-01 0.7302 + 0.0245 *
0.5164 + 0.0197 *
40.24 %
57.74 %
8 0.7234 + 0.0428 ** 42.30 %
35 0.4333 + 0.0218 ** 64.54 %
16 0.6401 + 0.0668 ** 48.94 % 0.3388 + 0.0324 ** 72.27 %
32 0.5025 + 0.0293 ** 59.92 % 128 0.2099 + 0.0310 ** 82.82 %
64 0.3858 + 0.0202 ** 69.23 % 256 0.0862 + 0.0293 ** 92.95 %
128 0.2925 + 0.0320 ** 76.67 % Taxol 5 0.6011 + 0.0148 50.81 %
256 0.1768 + 0.0219 ** 85.90 % control 1.2219 0.00 %
Protein V 1 1.1130 + 0.0372 11.22 %
2 1.0243 + 0.0228 18.30 % 40
* P < 0.05 ,
4 0.8979 + 0.0729 * 28.38 % ** P < 0.01 vs control.
8 0.7236 + 0.0423 ** 42.28 %
16 0.6403 + 0.0663 ** 48.93 %
32 0.5027 + 0.0288 ** 59.90 % The results showed that fusion protein I , protein II ,
64
128
0.3860 + 0.0197 **
0.2927 + 0.0315 **
69.21 %
76.65 % 45
protein III , protein IV and protein V could effectively inhibit
256 0.1770 + 0.0214 ** 85.88 % gastric cancer cell MGC - 803 , and the inhibition rate reached
Taxol 5 0.5996 + 0.0139 ** 52.15 % about 40 % at a concentration of 8 ug /mL.
control 1.2537 + 0.0418 0.00 %
* P < 0.05 ,
TABLE 3
** P < 0.01 vs control. 50 Inhibitory effect of fusion protein I , protein II , protein III , protein
IV and protein V on proliferation of lung cancer cell A549
The results showed that fusion protein I , protein II ,
protein III , protein IV and protein V could effectively inhibit Group (n = 5 )
=
Dose (ug /mL ) A570 nm / A630 nm PI ( % )
melanoma cell line B16F10 , and the inhibition rate reached Protein I 1 0.9036 + 0.0441 6.72 %
40 % or more at a concentration of 8 ug/mL . 55 2 0.8409 + 0.0378 13.19 %
4 0.7865 + 0.0417 * 18.81 %
TABLE 2 8 0.6665 + 0.0373 31.20 %
16 0.5789 + 0.0267 * 40.24 %
Inhibitory effect of fusion protein I , protein II , protein III , protein 32 0.4687 + 0.0384 ** 51.62 %
IV and protein V on proliferation of gastric cancer cell MGC -803 64 0.3323 + 0.0333 ** 65.70 %
60
128 0.1745 + 0.0219 ** 81.99 %
Group (n = 5 ) Dose (ug/mL) A570 nm / A630 nm PI (%) 256 0.0896 + 0.0233 ** 90.75 %
Protein II 1 0.8885 + 0.0374 8.28 %
Protein I 1.1091 + 0.0439 9.23 % 2 0.7933 + 0.0253 18.11 %
2 1.0111 + 0.0376 * 17.25 % 4 0.7005 + 0.0396 27.69 %
4 0.8768 + 0.0417 28.24 % 8 0.6325 + 0.0215 * 34.71 %
8 0.7121 + 0.0373 * 41.72 % 16 0.5923 + 0.0192 ** 38.86 %
16 0.5439 + 0.0265 ** 55.49 % 65 32 0.5006 + 0.0347 ** 48.32 %
32 0.4426 + 0.0382 ** 63.78 % 64 0.4106 + 0.0286 ** 57.61 %
 US 11,407,811 B2
15 16
TABLE 3 - continued TABLE 4 - continued
Inhibitory effect of fusion protein I , protein II , protein III , protein Inhibitory effect of fusion protein I , protein II , protein III , protein
IV and protein V on proliferation of lung cancer cell A549 IV and protein V on proliferation of liver cancer cell Hep -G2
Group (n = 5 ) 5 Group (n = 5 )
Dose (ug/mL) A570 nm /A630 nm PI (%) Dose (ug /mL ) A570 nm / A630 nm PI (%)
128 0.2008 + 0.0147 ** 79.27 % Protein IV 1 0.6656 + 0.0194 2.80 %
256 0.1165 + 0.0159 ** 87.97 % 2 0.6232 + 0.0380 9.00 %
Protein III 1 0.9105 + 0.0332 6.01 % 4 0.5899 + 0.0369 13.86 %
2 0.8560 + 0.0292 11.63 % 8 0.5578 + 0.0357 18.55 %
4 0.7769 + 0.0273 * 19.80 % 10 16 0.4966 + 0.0284 27.48 %
8 0.6949 + 0.0316 28.26 % 32 0.4486 + 0.0253 34.49 %
16 0.5897 + 0.0198 39.12 % 64 0.4006 + 0.0214 41.50 %
32 0.4436 + 0.0249 * 54.21 % 128 0.3698 + 0.0203 46.00 %
64 0.3165 + 0.0217 ** 67.33 % 256 0.3111 + 0.0206 54.57 %
128 0.2116 + 0.0206 ** 78.16 % Protein V 1 0.6700 + 0.0419 2.16 %
256 0.1212 + 0.0195 ** 87.49 % 15 2 0.6213 + 0.0322 9.27 %
Protein IV 1 0.8992 + 0.0434 7.17 % 4. 0.5910 + 0.0341 13.70 %
2 0.8690 + 0.0385 10.29 % 8 0.5601 + 0.0247 18.21 %
4 0.7613 + 0.0364 * 21.41 % 16 0.5056 + 0.0199 26.17 %
8 0.6796 + 0.0321 * 29.84% 32 0.4578 + 0.0217 33.15 %
16 0.5993 + 0.0299 ** 38.13 % 64 0.4005 + 0.0323 41.52 %
32 0.434 + 0.0257 ** 55.20 % 128 0.3613 + 0.0308 47.24 %
64 0.3396 + 0.0215 ** 64.94% 20 256 0.3017 + 0.0297 55.95 %
128 0.2398 0.0200 ** 75.25 % Taxol 5 0.3258 52.42 %
256 0.1331 0.0205 ** 86.26 % control 0.6848 0.00 %
Protein V 1 0.8911 + 0.0404 8.01 %
2 0.8599 + 0.0301 11.23 % * P < 0.05,
4 0.7439 + 0.0344 * 23.21 % ** P < 0.01 vs control.
8 0.6632 + 0.0247 31.54 % 25
16 0.5555 + 0.0199 * 42.66 % The results showed that fusion protein I , protein II ,
32
64
0.4488
0.3489
+ 0.0220 **
+ 0.0326 **
53.67 %
63.98 %
protein III , protein IV and protein V had a certain inhibitory
128 0.2249 + 0.0312 ** 76.78 % effect on liver cancer cell Hep -G2, and the inhibition rate
256 0.1029 + 0.0295 ** 89.38 % increased with the increase of concentration .
Taxol 5 0.4269 55.93 % 30
control 0.9687 0.00 % TABLE 5
* P < 0.05 , Inhibitory effect of fusion protein I , protein II , protein III , protein
** P < 0.01 vs control. IV and protein V on proliferation of breast cancer cell MDA -MB -231
The results showed that fusion protein I , protein II, 35 Group ( n = 5 ) Dose (ug /mL ) A570 nm / A630 nm PI (%)
protein III , protein IV and protein V could effectively inhibit
lung cancer cell A549 , and the inhibition rate reached about Protein I 1
2
0.9977 + 0.0403
0.9665 + 0.0397
3.96 %
6.96 %
40 % at a concentration of 16 ug /mL . 4 0.9201 + 0.0382 11.43 %
8 0.8815 + 0.0410 15.14 %
TABLE 4 40
16 0.8006 + 0.0287 22.93 %
32 0.7586 0.0336 26.97 %
Inhibitory effect of fusion protein I , protein II , protein III , protein 64 0.6988 = 0.0296 32.73 %
IV and protein V on proliferation of liver cancer cell Hep -G2 128 0.6587 + 0.0314 36.59 %
256 0.6023 + 0.0327 42.02 %
Group (n = 5 )
=
Dose (ug/mL ) A570 nm / A630 nm PI ( % ) Protein II 1 0.9859 + 0.0397 5.09 %
2 0.9552 + 0.0419 8.05 %
Protein I 1 0.6669 + 0.0428 2.61 % 45 4 0.9150 + 0.0283 11.92 %
2 0.6009 + 0.0362 12.25 % 8 0.8806 + 0.0345 15.23 %
4 0.5879 + 0.0404 14.15 % 16 0.8110 + 0.0298 21.93 %
8 0.5555 + 0.0373 18.88 % 32 0.7546 + 0.0274 27.36 %
16 0.5220 + 0.0259 23.77 % 64 0.6945 + 0.0326 33.14 %
32 0.4862 + 0.0330 29.00 % 128 0.6589 + 0.0287 36.57 %
64 0.4397 + 0.0327 35.79 % 50 256 0.6012 + 0.0311 42.13 %
128 0.3836 + 0.0218 43.98 % Protein III 1 0.9913 + 0.0412 4.57 %
256 0.3223 + 0.0233 52.94% 2 0.9663 + 0.0392 6.98 %
Protein II 1 0.6746 + 0.0372 1.49 % 4 0.9103 + 0.0387 12.37 %
2 0.6132 0.0253 10.46 % 8 0.8714 + 0.0354 16.11 %
4 0.5799 + 0.0396 15.32 % 16 0.7956 0.0291 23.41 %
8 0.5499 + 0.0215 19.70 % 55 32 0.7601 + 0.0275 26.83 %
16 0.5190 + 0.0185 24.21 % 64 0.6963 + 0.0211 32.97 %
32 0.4706 + 0.0374 31.28 % 128 0.6613 + 0.0255 36.34 %
64 0.4256 + 0.0268 37.85 % 256 0.6213 + 0.0230 40.19 %
128 0.3801 + 0.0174 44.49 % Protein IV 0.9905 + 0.0413 4.65 %
256 0.3156 + 0.0151 53.91 % 2
+
A
0.9642 + 0.0409 7.18 %
Protein III 1 0.6726 + 0.0335 1.78 % 4 0.9203 + 0.0385 11.41 %
60
2 0.6111 – 0.0287 10.76 % 8 0.8756 + 0.0396 15.71 %
4 0.5862 = 0.0275 14.40 % 16 0.7988 + 0.0358 23.10 %
8 0.5586 + 0.0105 18.43 % 32 0.7585 + 0.0312 26.98 %
16 0.5102 + 0.0214 25.50 % 64 0.6946 + 0.0292 33.13 %
32 0.4756 + 0.0245 30.55 % 128 0.6425 + 0.0300 38.15 %
64 0.4213 + 0.0219 38.48 % 256 0.6003 + 0.0275 42.21 %
128 0.3786 + 0.0214 44.71 % 65 Protein V 1 0.9868 + 0.03972 5.01 %
256 0.3259 + 0.0194 52.41 % 2 0.9505 + 0.0337 8.50 %
 US 11,407,811 B2
17 18
TABLE 5 - continued TABLE 6 - continued
Inhibitory effect of fusion protein I , protein II , protein III , protein Inhibitory effect of fusion protein I , protein II , protein III , protein
IV and protein V on proliferation of breast cancer cell MDA- MB - 231 IV and protein V on proliferation of colon cancer cells HCT-116
5 Group (n = 5 ) Dose ( ug/mL ) A570 nm / A630 nm PI (%)
Group (n = 5 )=
Dose (ug/mL ) A570 nm /A630 nm PI ( % )
Taxol 0.4103 = 0.0287 53.39 %
4 0.9103 + 0.0358 12.37 % control 0.8802 + 0.0536 00.00%
8 0.8789 + 0.03131 15.39 %
16 23.30 %
P < 0.05 ,
*
**

0.7968 + 0.0299
10 ** P < 0.01 vs control.
32 0.7546 + 0.0234 27.36 %
64 0.6988 + 0.0216 32.73 %
128 0.6431 + 0.0225 38.09 % The results showed that fusion protein I , protein II ,
256 0.6100 = 0.0199 41.28 % protein III , protein IV and protein V could effectively inhibit
Taxol 5 0.4156 + 0.0287 59.99 % colon cancer cell HCT - 116 , and the inhibition rate reached
control 1.0388 0.054 0.00 % 15 40% or more at a concentration of 128 ug /mL.
P < 0.05 , TABLE 7
** P < 0.01 vs control.
Inhibitory effect of fusion protein I , protein II , protein III ,
protein IV and protein V on proliferation of human glioma U87
The results showed that fusion protein I , protein II , 20
protein III , protein IV and protein V could effectively inhibit Group (n = 5 ) Dose (ug /mL ) A570 nm / A630 nm PI ( % )
breast cancer cell line MDA - MB - 231 , and the inhibition rate Protein I 1 0.6805 + 0.0403 2.77 %
reached 40% or more at a concentration of 256 ug/mL . 2 0.658 + 0.0377 5.99 %
4 0.6102 + 0.0324 12.82 %
25 8 0.5521 + 0.0403 21.12 %
TABLE 6 16 0.5120 + 0.0275 26.85 %
Inhibitory effect of fusion protein I , protein II , protein III , protein 32 0.4612 + 0.0361 34.10 %
IV and protein V on proliferation of colon cancer cells HCT-116 64 0.3833 + 0.0266 45.24%
128 0.2921 + 0.0345 58.27 %
Group (n = 5 ) 256 0.2113 + 0.0374 69.81 %
=
Dose (ug/mL ) A570 nm / A630 nm PI (%) 30 Protein II 0.6788 + 0.0374 3.01 %
Protein I 1 0.8205 + 0.0411 6.78 %
AN 0.6523 + 0.0405 6.80 %

Foto
16
32
4
0.7859
0.7587
0.7110
0.6778
0.6114
+
+
+
+
+
0.0382
0.0371
0.0413
0.0285
0.0331
10.71 %
13.80 %
19.22 %
22.99 %
30.54 % 35
16
32
64
0.6021
0.5423
0.5006
+ 0.0233
+ 0.0357
+ 0.0282
0.4652 + 0.0249
0.4080 + 0.0366
13.97 %
22.52 %
28.48 %
33.53 %
41.71 %
64 0.5468 + 0.0296 37.88 % 128 0.3143 + 0.0279 55.09 %
128 0.4988 = 0.0315 43.33 % 256 0.2222 + 0.0316 68.25 %
256 0.4458 + 0.0324 49.35 % Protein III 1 0.6923 + 0.0424 1.09 %
Protein II 1 0.8310 + 0.0394 5.59 % 3
5
9
)
0.6655 + 0.0327 4.91 %
2 0.7925 + 0.0415 9.96 % 4. 0.6132 + 0.0372 12.39 %
4 0.7555 + 0.0283 14.17 % 0.5461 + 0.0341 21.97 %
8 0.7023 + 0.0347 20.21 % 40 16 0.5012 + 0.0218 28.39 %
16 0.6556 + 0.0292 25.52 % 32 0.4589 + 0.0256 34.43 %
32 0.6113 + 0.0279 30.55 % 64 0.3520 + 0.0219 49.71 %
64 0.5498 + 0.0374 37.54% 128 0.2465 + 0.0253 64.78 %
128 0.4898 + 0.0289 44.35 % 256 0.1989 + 0.0208 71.58 %
256 0.4497 + 0.0316 48.91 % Protein IV 1 0.6887 + 0.0432 1.60 %
Protein III 1 0.8333 + 0.0414 5.33% 45 2 0.6531 + 0.0391 6.69 %
2 0.7964 + 0.0397 9.52 % 4 0.6154 + 0.0352 12.07 %
4 0.7623 + 0.0382 13.39 % 8 0.5471 0.0360 21.83 %
8 0.7022 + 0.0351 20.22 % 16 0.5078 + 0.0383 27.45 %
16 0.6663 + 0.0298 24.30 % 32 0.4602 + 0.0322 34.25 %
32 0.6023 + 0.0276 31.57 % 64 0.3623 + 0.0229 48.24 %
64 0.5557 + 0.0219 36.87 % 50 128 0.2755 + 0.0305 60.64%
128 0.4878 + 0.0253 44.58 % 256 0.2057 + 0.0251 70.61 %
256 0.4502 + 0.0238 48.85 % Protein V 1 0.6822 + 0.0372 2.53 %
Protein IV 1 0.823 + 0.0412 6.50 % 2 0.6577 + 0.0373 6.03 %
2 0.7878 + 0.0401 10.50 % 4 0.6189 + 0.0382 11.57 %
4 0.7544 + 0.0382 14.29 % 8 0.5579 + 0.0331 20.29 %
8 0.7101 + 0.0390 19.33 % 55 16 0.5111 + 0.0299 26.98 %
16 0.6787 + 0.0353 22.89 % 32 0.4658 + 0.0246 33.45 %
32 0.6135 + 0.0312 30.30 % 64 0.3687 + 0.0260 47.32 %
64 0.5654 + 0.0299 35.76 % 128 0.2741 + 0.0257 60.84 %
128 0.4879 + 0.0305 44.57 % 256 0.2155 + 0.0196 69.21 %
256 0.4421 0.0271 49.77 % Taxol 5 0.2177 + 0.0277 68.90 %
Protein V 1 0.8256 + 0.0392 6.20 % control 0.6999 + 0.0572 00.00 %
60
0.7811 + 0.0333 11.26 %
0.7333 + 0.0352 16.69 % * P < 0.05 ,
0.7113 + 0.0311 19.19 % ** P < 0.01 vs control.
comoacANI
64
0.6798
0.6154
0.5582
+ 0.0283
+ 0.0236
+ 0.0210
22.77 %
30.08 %
36.58 %
The results showed that fusion protein I , protein II ,
128 0.4888 + 0.0227 44.47 % 65 protein III , protein IV , and protein V could significantly
256 0.4411 + 0.0196 49.89 % inhibit human glioma U87 , and the inhibition rate reached
about 50 % at a concentration of 64 ug/mL.
 US 11,407,811 B2
19 20
TABLE 8 Example 3
Inhibitory effect of fusion protein I , protein II , protein III , protein Detection of Inhibitory Effects of Fusion Protein I , Protein
IV and protein V on proliferation of cervical cancer cell Hela
II , Protein III , Protein IV , and Protein V on Migration of
Group (n = 5 ) Dose (ug/mL) A570 nm / A630 nm PI (%) 5 Human Umbilical Vein Endothelial Cells by Three -Dimen
Protein I 1 0.7882 + 0.0412 1.38 % sional Transwell Assay
2 0.7454 + 0.0374 6.73 % Human umbilical vein endothelial cells (HUVECs) were
4
8
0.6879
0.6135
+
+
0.0381
0.0362
13.93 %
23.24 %
cultured with endothelial cell culture fluid containing 5 %
10 fetal bovine serum and 1xECGS in a 5 % CO2 incubator at
a
16 0.5365 = 0.0293 32.87 %
32 0.4587 + 0.0325 42.61 % 37 ° C. , to a confluence of 90 % or more , and then inhibitory
64 0.3878 + 0.0287 51.48 % effects of fusion protein I , protein II , protein III , protein IV ,
128
256
0.2655
0.1522
+
+
0.0302
0.0315
66.78 %
80.96 % and protein V on migration of endothelial cells were
Protein II 1 0.7798 + 0.0386 2.43% detected by transwell assay, in which only endothelial cells
2 0.7412 + 0.0407 7.26 % 15 HUVEC of passage 2 to 8 were used , and the specific
4 0.6946 + 0.0272 13.09 % operation was as follows.
8 0.6312 + 0.0313 21.02 %
16 0.5418 + 0.0286 32.21 %
( 1 ) 10 mg/mL Matrigel was diluted with a DMEM
32 0.4788 + 0.0262 40.09 % medium at a ratio of 1 : 4 , coated on a transwell chamber
64 0.4023 + 0.0314 49.66 % membrane, and air - dried at room temperature.
128 0.2878 + 0.0275 63.99 % 20 ( 2 ) HUVEC cells cultured to logarithmic phase were
Protein III
256
1
0.1748
0.7806
+
+
0.0303
0.0400
78.13 %
2.33 %
digested with 0.2 % EDTA , collected , washed twice with
2 0.7465 + 0.0381 6.59 % PBS , followed by resuspended in an endothelial cell culture
4 0.6888 + 0.0374 13.81 % liquid containing 0.1 % BSA , counted under a microscope,
8 0.6254 + 0.0342
0.5478 + 0.0279
21.75 %
31.46 %
and the cell concentration was adjusted to 1x10 cells/mL ;
16
32 0.4825 + 0.0263 39.63 %
25
( 3 ) Test solutions for each group were formulated and
64 0.4121 + 0.0199 48.44% diluted to 100 uL with aa cell culture liquid containing 0.1 %
128 0.3022 + 0.0242 62.19 % BSA ;
256 0.1879 + 0.0228 76.49 % Groups were divided as follows:
Protein IV 1 0.7856 + 0.0401
0.7512 + 0.0397
1.70 %
6.01 % 30
Blank control group : a cell culture liquid containing no
2
4 0.7012 + 0.0373 12.26 %
drug;
8 0.6313 + 0.0384 21.01 % Endostar group : 5 mg/mL Endostar solution diluted to a
16 0.5571 + 0.0346 30.29 % predetermined concentration with a cell culture liquid con
32
64
0.4922 + 0.0301 38.41 % taining no drug;
128
0.4023 + 0.0279
0.3044 = 0.0297
49.66 %
61.91 % 35 Fusion protein group: the fusion protein diluted to 10
256 0.2016 + 0.0268 74.77 % ug /mL with a cell culture liquid containing no drug.
Protein V 1 0.7784 + 0.0386 2.60 % ( 4 ) The cells were inoculated into aa transwell chamber at
2
4
0.7354 + 0.0325
0.6879 + 0.0346
7.98 %
13.93 %
100 uL per well , and test solutions for each group were
8 0.6121 + 0.0301 23.41 %
added to the chamber. To a 24 - well plate , 0.6 mL of
16 0.5346 + 0.0287 33.11 % 40 endothelial cell culture liquid containing 5 % fetal bovine
32 0.4897 + 0.0222 38.73 % serum and 1xECGS was added to stimulate cell migration ,
64 0.4155 = 0.0204 48.01 % and incubated at 5 % CO2 for 24 h at 37 ° C.
128
256
0.3111
0.2004
– 0.0213
+ 0.0182
61.07 %
74.92 %
( 5 ) The culture liquid in the well was discarded . The cells
Taxol 5 0.2114 + 0.0275 73.55 % were fixed with 90 % alcohol at room temperature for 30
control 0.7992 + 0.0592 0.00 % 45 min , stained with 0.1 % crystal violet for 10 min at room
temperature, and rinsed with water. Un -migrated cells in the
* P < 0.05,
** P < 0.01 vs control.
upper layer were gently wiped off by a cotton swab . The
observation was carried out under microscope and four
fields of view were selected for taking photos and counting.
The results showed that fusion protein 1, protein II 50 The migration inhibition (MI) was calculated according to
protein III , protein IV , and protein V could significantly,
the formula :
inhibit cervical cancer cell Hela , and the inhibition rate
reached about 45 % at a concentration of 64 ug /mL.
Taken together, the inhibitory effects of fusion protein I , 55 MI ( % ) = 1 Niest x 100 %
protein II , protein III , protein IV , and protein V integrin N control
blockers on proliferation of various tumor cells are shown in
Tables 1-8 . The fusion protein can effectively inhibit pro- where N test is the migration cell number in the test group ,
liferation of gastric cancer, lung cancer, liver cancer, breast and N control is the migration cell number in the blank control
cancer, melanoma , colon cancer, glioma , and cervical can 60 group .
cer . Among them , the inhibition rate of melanoma, gastric Data Statistics:
cancer and lung cancer reached 50 % or more at the con The test was repeated 3 times independently. The results
centration of 32 ug /mL , the inhibition rate of glioma and obtained from the test were calculated as mean : SD , and
cervical cancer reached 40 % or more at the concentration of statistical t - test was performed . P <0.05 was considered as a
64 ug /mL; higher concentrations were required to achieve 65 significant difference, and P<0.01 was considered as an
effective inhibition on colon cancer , liver cancer, and breast extremely significant difference . The experimental results
cancer cells . are shown in Table 9 .
 US 11,407,811 B2
21 22
TABLE 9 experimental groups . After each group was added with
spleen lymphocyte suspension, 100 uL per well , the blank
Migration inhibition of HUVEC by fusion protein I ,
protein II, protein III, protein IV , and protein V control group was added with 100 uL of empty 1640 culture
liquid , ConA group was added with ConA ( final concentra
Group (n = 5 ) Dose (ug/mL) Migration cell number MI (%) 5 tion of 5 ug /mL ), and Dex group was added with Dex , and
Protein I 0.25 2031.0 + 184.39 19.18 %
protein A and protein G were added with ConA ( final
0.5 1748.5 = 361.22 * 30.42 % concentration of 5 ug /mL ) on the basis of addition of

28-04
923.0 + 153.98 ** 63.27 % different concentrations of extracts . The cells were statically
743.0 + 233.57 ** 70.43 % cultured in a cell incubator at 37 ° C. for 48 h . After the
795.0 + 45.32 ** 68.36 % 10 completion of the culture, 20 uL of MTT was added to each
1397.0 + 176.19 * 44.41 %
Protein II 0.25 2108.0 + 75.27 16.12 % well , and the culture was continued for 4 h . Finally, all the
0.5 1203.5 + 220.14 ** 52.11 % solutions in each well were discarded, 100 uL of DMSO was
677.0 24.72 ** 73.06 % added to each well , and the mixture was shaken and detected
569.5 = 270.29 ** 77.34 % by a microplate reader for OD value at 570 nm . 5 parallels
8
858.0
1762.0
+ 145.87 **
+ 183.97 *
65.86 %
29.88 %
15 were preformed for per well . The experimental results are
Protein III 0.25 2139 + 184.39 * 14.88 % shown in Table 10 .
0.5 1209 + 307.58 ** 51.89 %
1 873 + 142.04 ** 65.26 % TABLE 10
2 752 + 192.37 ** 70.08 %
4. 538 54.26 ** 78.59 % Effect of fusion protein I , protein II , protein III , protein IV ,
8 1420 + 136.22 * 43.49 % 20 protein V on the proliferation of mouse spleen lymphocytes
Protein IV 0.25 1999 † 194.25 * 20.45 %
0.5 1456 + 122.37 ** 42.06 % Group (n = =
5) Dose (ug /mL ) A570 nm / A630 nm PI (%)
1 752 + 87.54 ** 70.08 %
2 591 + 69.28 ** 76.48 % Protein I 8 0.5412 + 0.0231 7.80 %
4 647 + 31.35 ** 74.25 % 0.4733 + 0.0194 * 19.37 %
8 1346 + 177.36 * 46.44 % 25 128 0.3726 + 0.0208 ** 28.21 %
Protein V 0.25 2058 + 169.52 * 18.11 % Protein II 8 0.5514 + 0.0187 6.84 %
0.5 1332 + 84.87 ** 47.00 % 0.4637 + 0.0159 * 21.66 %
1 943 + 53.96 ** 62.48 % 128 0.3825 + 0.0103 ** 35.38 %
2 533 + 32.33 ** 78.79 % Protein III 8 0.5618 + 0.0169 5.09 %
4 702 + 64.43 ** 72.07 % 32 0.4827 + 0.0103 * 18.45 %
8 1139 + 145.66 * 54.68 % 30 128
?
*
??
???
° 0.3746 + 0.0874 ** 27.82 %
Sunitinib 8.0 10-6 449.0 + 153.86 ** 82.13 % Protein IV 8 0.5603 + 0.0258 5.34 %
Control 2513.0 = 79.16 0.00 % 32 0.4936 + 0.0903 * 16.61 %
128 0.3949 + 0.0121 ** 33.28 %
* P < 0.05 , Protein V 8 0.5492 + 0.0111 7.21 %
** P < 0.01 vs control 32 0.4836 + 0.0302 * 18.30 %
35 128 0.3942 + 0.0183 ** 33.40 %
As seen from the experimental results, under the action of ConA
Dex
0.6033 + 0.0341
0.3401 + 0.1131 ** 41.19 %
fusion protein I , protein II , protein III , protein IV and protein control 0.5919 + 0.0518
V , the number of migrated endothelial cells was significantly
reduced compared with that of the negative control, and the ***PP<<0.05 ,
0.01 vs control.
migration inhibition of HUVEC was significant at the con 40
centration of 2 ug /mL . The inhibition rate was 70% or more , The results showed that fusion protein I , protein II ,
and the inhibition rate on cell migration was extremely protein III , protein IV, and protein V could inhibit mouse
significant compared with that of the negative control spleen lymphocytes to some extent compared with the ConA
( P<0.01 ) . Between 0.5 ug /mL and 4 ug /mL , the best inhibi group .
tory effect was achieved . 45
Example 5
Example 4
Effect of Fusion Protein I , Protein II , Protein III , Protein
Effect of Fusion Protein I , Protein II , Protein III , Protein IV and Protein V on IL - 1B Production by Mouse Peritoneal
IV and Protein V on Proliferation of Mouse Spleen Lym- 50 Macrophages
phocytes ( 1 ) IL - 1ß production: mice were intraperitoneally injected
The spleen of a mouse was taken out under sterile with 1 mL of broth medium containing 6 % starch , and three
conditions , washed 3 times with empty 1640 medium , days later, the mouse peritoneal macrophages were asepti
ground in 5 mL syringe core , filtered through a 200 -mesh cally taken , washed twice with a 1640 medium , and the cell
sieve , and prepared into a single cell suspension, the single 55 concentration was adjusted to 2x106 cells/mL, inoculated
cell suspension was centrifuged ( 1000 rpm , 5 min ), and the into a 24 -well culture plate at 1 mL /well, incubated for 3 h
supernatant was discarded . Tris - NH_C1 was used to break in aa cell incubator, and shaken once every 30 min, so that the
the red blood cells , which were allowed to stand in an ice cells were allowed to adhere sufficiently. Then, the cells
water bath for 4 min and centrifuged ( 1000 rpm , 5 min ), the were washed twice with a culture liquid to remove un
supernatant was discarded , and the cells were washed twice 60 adhered cells . The blank group was added with PBS , the
with sterile PBS . Finally, cells were suspended in a 10 % positive group was added with the positive drug dexametha
fetal calf serum RPMI 1640 culture liquid ( 5 mL ) , counted , sone Dex , and the control group was the low, medium and
adjusted to a cell concentration of 5x106 cells/mL , and high concentrations of fusion protein I , protein II , protein III ,
cultured in a 96 - well culture plate . protein IV, protein V. After administration , the culture was
The experiment comprises , a blank control group, a 65 continued for 48 h , the cells were centrifuged at 1000 r /min
concanavalin A (Con? ) group , a dexamethasone ( Dex ) for 15 min . The supernatant was taken as a sample for testing
group ( 0.02 mg/mL ), and protein A and protein G used as activity of IL - 1ß .
 US 11,407,811 B2
23 24
(2 ) Determination of IL - 1ß content: the detection was incision was about 1 cm long and the subcutaneous tissue
performed by using mouse IL - 1B enzyme-linked immu- was expanded with a vascular clamp. A sterile dry tampon
nosorbent assay kit from R& D company. According to the was subcutaneously implanted into one side of the groin , the
instructions of the kit , the procedures were as follows: the incision was sutured, and an appropriate amount of amoxi
reaction well for the test samples and different concentra- 5 cillin was spread at the incision to prevent infection . After
tions of standards were sealed with sealing tapes, respec- the surgery was finished, the groups were administered once
tively, incubation was performed at 37 ° C. for 90 min ; the by injection from the day of surgery (EDSM needed to be
plate was washed four times ; a biotinylated antibody work- administered twice a day) . The rats were sacrificed by
ing solution ( 100 uL /well) was added , the reaction well was 10 cervical dislocation at the 24th hour after administration, the
sealed with sealing tapes , and incubation was performed at inguinal skin was cut , the tampon was taken out together
37 ° C. for 60 min ; the plate was washed four times ; an with the surrounding granulation tissue and the surrounding
enzyme conjugate working solution ( 100 uL /well) was tissue was removed . After drying for additional 48 h in an
added, the reaction well was sealed with sealing tapes , oven at 60 ° C. , the weight was accurately weighed. The
incubation was performed at 37 ° C. for 30 min; the plate was 15 granuloma weight was calculated: granuloma weight (mg/
washed four times ; a developer ( 100 uL /well) was added , 100 g body weight ) = net weight of granulation (mg )/ rat body
incubation was performed at 37 ° C. for 10 to 20 min, a stop weight ( 100 g) . The experimental results are shown in Table
solution ( 100 uL /well) was added and mixed and the OD450 12.
value was measured . The experimental results are shown in
Table 11 . 20 TABLE 12
TABLE 11 Effect of fusion protein I , protein II , protein III , protein IV ,
protein V on subacute inflammation of tampon granuloma in rat
Effect of fusion protein I , protein II , protein III , protein IV Granuloma (mg)
and protein V on IL - 1B production by mouse peritoneal macrophages Group (n = 10 )
= Weight gain ( g) Weight ( 100 g) PI ( % )
25
Group ( n = 5)
=
Dose (ug/mL ) IL - 1B (pg mL
/ ) PI (%) Protein I 30.20 + 11.84 * 0.25 + 0.08 * 51.92 %
Protein II 32.16 + 10.13 * 0.23 + 0.05 * 55.77 %
Protein I 8 731.65 + 9.76 13.59 % Protein III 33.31 + 8.17 ** 0.34 + 0.07 ** 34.62 %
32 470.01 + 14.36 * 44.49 % Protein IV 33.74 + 12.12 ** 0.45 + 0.06 ** 13.46 %
128 318.44 + 11.33 ** 62.39 % Protein V 32.45 + 8.57 ** 0.43 + 0.05 ** 17.31 %
Protein II 8 746.38 + 16.59 11.85 %
32 596.02 + 19.97 * 29.61 %
30 Dex ( 10 mg/kg) -30.46 + 6.28 ** 0.21 + 0.02 ** 58.00 %
control 21.56 + 7.28 * 0.52 + 0.23 *
128 440.56 + 11.38 ** 47.97 %
Protein III 8 741.77 + 8.11 12.40 % *p < 0.05 ,
32 496.11 + 15.12 * 41.41 % ** P < 0.01 vs control .
128 302.13 + 10.12 ** 64.32 %
Protein IV 8 756.17 + 9.21 10.70 %
32 487.34 + 14.11 * 42.44 %
35 The experimental results showed that fusion protein I ,
128 310.12 + 11.18 ** 63.37 % protein II , protein III , protein IV and protein V could
Protein V 8 780.54 10.23 7.82 % significantly inhibit tampon granuloma in rat at an effective
32
128
496.54 + 12.65 *
320.23 + 13.76 **
41.36 %
62.18 % dose of 64 mg/kg , compared with the blank model group .
Dex 20 310.25 + 20.32 ** 63.36 % Although the positive drug had a higher inhibition rate, the
Model group 846.73 + 9.04 ** 0.00 % 40 weight loss of the rat was obvious , and the side effects were
control 8.45 + 2.23 * larger. In contrast, the fusion protein was relatively safe.
* p < 0.05 ,
** P < 0.01 vs control.
Example 7
The results showed that fusion protein I , protein II , 45 Effect of Fusion Protein I , Protein II , Protein III , Protein
protein III , protein IV and protein V could significantly IV and Protein V on Peritoneal Capillary Permeability in
inhibit IL - 1ß production by mouse peritoneal macrophages. Mice
80 Kunming mice were randomly divided into 8 groups
Example 6 with 10 mice for each group , which were a blank model
50 group , a dexamethasone positive group ( 10 mg/kg ), and
Effect of Fusion Protein I , Protein II , Protein III , Protein fusion protein I , protein II , protein III , protein. IV , protein V
IV and Protein V on Subacute Inflammation of Tampon experimental groups at high , medium and low doses ( 128 ,
Granuloma in Rat 32 , 8 mg/kg ), respectively. The drug was administered once
40 parts of degreasing cotton , 30 mg for each part, were by injection ( EDSM needed to be administered twice a day) ,
accurately weighed with an analytical balance and kneaded 55 and the blank model group was given an equal volume of
into balls having substantially the same shape and size, physiological saline and fed normally . On the 5th day, a 5
which were autoclaved at 1.5 kpa for 30 min and dried at 50 ° g/L Evans blue physiological saline solution was injected
C. for further use . into the tail vein at 10 kg /mL , followed by intraperitoneal
40 male SD rats were randomly divided into 4 groups with injection ( 10 kg /mL ) of aa HAC solution ( 6 mL/L ) to induce
10 rats for each group . The groups were a model group , a 60 inflammation . After 20 min , the mice were sacrificed by
dexamethasone positive group ( 10 mg/kg ), and fusion pro- cervical dislocation . 5 mL of physiological saline was intra
tein I , protein II , protein III , protein IV , protein V experi- peritoneally injected , the abdomen was gently rubbed for 2
mental groups at an effective dose of 64 mg/kg, respectively. min , the abdominal cavity was cut , a peritoneal washing
Rats were anesthetized with sodium pentobarbital ( 40 solution was collected and centrifuged at 4000 rpm for 10
mg/kg ) via intraperitoneal injection before administration . 65 min , 1 mL of supernatant was taken , and 3 mL of physi
The abdominal coat was cut off, and the skin of middle of ological saline was added to obtain 4 mL of dilution . The
the lower abdomen was cut under sterile conditions . The absorbance OD value of the dilution was measured by an
 US 11,407,811 B2
25 26
ultraviolet spectrophotometer at a wavelength of 590 nm , TABLE 14
and the amount of pigment exudation was expressed by the
OD590 nm value , and the peritoneal capillary permeability Effect of fusion protein I , protein II , protein III , protein
in mice was examined . The experimental results are shown IV , protein V on xylene-induced ear swelling in mice
in Table 13 . 5
Group (n = 10 )
= Dose (mg/kg) Swelling degree (mg) PI ( % )
TABLE 13 Protein I 8 6.24 + 0.26 6.17 %
32 5.08 + 0.32 * 23.61 %
Effect of fusion protein I , protein II , protein III , protein 128 4.03 + 0.27 ** 39.40 %
IV , protein V on peritoneal capillary permeability in mice 10 Protein II 8 6.21 + 0.23 6.62 %
32 5.18 + 0.89 * 22.11 %
128 3.87 + 0.45 ** 41.80 %
Group (n = 10 ) =
Dose (mg/kg) Exudation rate ( OD590 ) PI ( % ) Protein III 8 6.18 + 0.29 7.07 %
32 5.23 + 0.16 * 21.35 %
Protein I 8 0.51 + 0.04 26.09 %
15 128 4.31 + 0.22 ** 35.19 %
32 0.47 + 0.03 * 31.88 %
Protein IV 8 6.32 + 0.11 4.96 %
128 0.28 + 0.06 ** 59.42 % 32 5.47 + 0.31 * 17.74 %
Protein II 8 0.51 + 0.06 26.09 % 128 4.22 0.55 ** 36.54 %
32 0.34 + 0.03 * 50.72 % Protein V 8 6.14 + 0.12 7.67 %
128 0.32 + 0.07 ** 53.62 % 32 5.34 + 0.34 * 19.70 %
Protein III 8 0.54 + 0.04 21.74 % 20
128 4.76 + 0.43 ** 28.42 %
32 0.41 + 0.07 * 40.58 % Aspirin 200 3.12 + 0.34 ** 53.08 %
128 0.31 + 0.03 ** 55.07 % control 6.65 + 0.70 *
Protein IV 8 0.56 + 0.02 18.84 %
32 0.36 + 0.05 * 47.83 % * P < 0.05 ,
128 0.28 + 002 ** 59.42 % 25 ** P < 0.01 vs control.
Protein V 8 0.55 + 0.07 20.29 %
32 0.39 + 0.02 * 43.48 % The experimental results showed that high doses of fusion
128 0.26 + 0.08 ** 62.32 % protein I , protein II , protein III , protein IV and protein V
Dex 10 0.22 + 0.03 ** 68.12 %
30
could significantly inhibit xylene - induced ear swelling in
control 0.69 + 0.08 * mice , and the inhibitory effect could be enhanced with the
increase of dose .
* P < 0.05 ,
** P < 0.01 vs control.
Example 9
35
The experimental results showed that fusion protein I ,
protein II , protein III , protein IV and protein V could Effect of Fusion Protein I , Protein II , Protein III , Protein
significantly inhibit the increase of peritoneal capillary per IV and Protein V on Acute Inflammation of Toe Swelling in
meability in mice induced by glacial acetic acid . The higher Rat Induced by Carrageenan
the dose , the stronger the effect. 40 80 SD rats were randomly divided into 8 groups with 10
mice for each group . The groups were a blank model group ,
Example 8 a dexamethasone positive group ( 5 mg/kg) and fusion pro
tein I , protein II , protein III , protein IV , protein V experi
mental groups at high , medium and low doses ( 128 , 32 , 8
Effect of Fusion Protein I , Protein II , Protein
IV , Protein V on Xylene- Induced Ear Swelling in Mice
III , Protein 45 mg/kg ), respectively. The drug was administered once by
injection, and the model group was given an equal volume
80 Kunming mice were divided into 8 groups with 10 of physiological saline and fed normally. On the third day,
mice for each group and numbered . A physiological saline 0.1 mL of 1 % carrageenan was injected subcutaneously into
group was used as a blank control group , an aspirin group the right hind toes of the rats to induce inflammation . The
(200 mg/kg ) was used as a positive control group , and fusion 50 foot volume was measured at 1 h, 3 h, 5 h, and 7 h after
protein I , protein II , protein III , protein IV and protein V at inflammation . The swelling degree of the foot was calcu
high , medium and low doses ( 128 , 32 , 8 mg/kg ) were used lated according to the following formula : the swelling
as experimental groups. Mice were administered once by degree of the foot (mL ) = the volume of the foot after
injection , while EDSM needed to be administered twice a 55 inflammation the volume before inflammation . The num
day for 5 consecutive days. The blank control group was ber of milliliters of spilled liquid was recorded (method: the
given an equal volume of physiological saline . After the fifth protruding point of the right joint was circled with a ball
day, 0.05 mL of xylene was applied to both sides of the right point pen and used as a measurement mark , and the right
ears of the mice to induce inflammation , and the left ears hind feet of the rat were sequentially placed in the volume
were not applied and were normal ears . After 2 h , the mice 60 measuring device , so that the hind limbs were exposed
were sacrificed by dislocation, and the ears were cut along outside the cylinder, and the depth of the immersion was
the auricle. Ear pieces were taken with a puncher and limited to the overlap of the circle and the liquid level. After
weighed , and the swelling degree and swelling rate were the foot entered the liquid , the liquid level was raised, and
calculated . Swelling degree = right ear piece weight - left ear the volume of the spilled liquid was the volume of the right
piece weight, swelling rate = ( swelling degree / left ear piece 65 hind foot of the rat, and the normal volume of the right hind
weight )x100 % . The experimental results are shown in Table foot of each rat is sequentially determined ). The experimen
14 . tal results are shown in Table 15 .
 US 11,407,811 B2
27 28
TABLE 15
Effect of fusion protein I , protein II , protein III , protein IV , protein
V on acute inflammation of toe swelling in rat induced by carrageenan
Group Dose Swelling degree (mL)
(n 10) (mg /kg ) 1 h 3h 5h 7h

Protein I 8 0.26 + 0.15 0.33 + 0.12 0.42 + 0.14 0.36 + 0.11 *

32 0.22 + 0.19 * 0.35 + 0.17 0.31 + 0.15 * 0.37 + 0.18 *
128 0.27 + 0.12 * 0.38 + 0.16 ** 0.34 + 0.14 * 0.43 + 0.16 **
Protein II 8 0.29 + 0.25 ** 0.34 + 0.09 * 0.36 + 0.12 0.41 + 0.09 *
32 0.27 + 0.06 0.41 + 0.18 * 0.37 0.11 * 0.33 + 0.02 **
128 0.21 + 0.16 * 0.32 + 0.10 * 0.41 + 0.05 0.36 + 0.16 **
Protein III 8 0.24 + 0.04 0.37 + 0.16 * 0.35 + 0.07 0.41 + 0.18 *
32 0.28 + 0.17 * 0.31 + 0.22 ** 0.37 + 0.14 * 0.39 + 0.12 **
128 0.24 + 0.12 * 0.36 + 0.11 ** 0.40 + 0.10 * 0.43 + 0.18 **
Protein IV 8 0.23 + 0.09 * 0.34 + 0.12 0.46 + 0.07 * 0.33 + 0.14 **
32 0.29 + 0.16 0.35 + 0.10 * 0.48 0.09 0.32 + 0.13 **
128 0.27 + 0.13 0.42 + 0.15 * 0.34 + 0.19 0.45 + 0.16 **
Protein V 8 0.25 + 0.10 ** 0.30 + 0.08 0.41 + 0.06 0.40 + 0.08 *
32 0.23 + 0.16 ** 0.39 + 0.09 0.38 + 0.05 * 0.46 + 0.17 **
128 0.22 + 0.09 * 0.33 + 0.15 0.47 + 0.04 0.35 + 0.19 **
Dex 10 0.21 + 0.11 ** 0.23 + 0.04 0.25 + 0.09 0.27 + 0.12 *
control 0.23 + 0.12 0.43 + 0.08 0.51 + 0.05 0.31 + 0.23
* P < 0.05 ,
** P < 0.01 vs control.
25
The experimental results showed that the toes of the rats arthritis occurred ) at the contralateral non - inflammatory foot
in each group were rapidly swollen after modeling, and the ( right hind foot ), the administration was started . The volume
peak of swelling was reached at about 3-5 h , which began to of the left and right hind feet was measured every 2 days ,
subside at 7 h . The fusion protein I , protein II , protein III , and the degree of primary and secondary toe swelling was
protein IV and protein V at high doses could significantly 30 determined , which was calculated as follows :
inhibit toe swelling in rat induced by carrageenan , and the Primary toe swelling (mL ) = left hind foot volume on the
inhibitory effect was not significant at low dose. day of measurement- initial volume of left hind foot
Example 10 Secondary toe swelling (mL ) = right hind foot volume on
35 the day of measurement - initial volume of right hind foot 2 .
Effect of Fusion Protein I , Protein II , Protein III , Protein Clinical score
IV and Protein V on Chronic Inflammation of Adjuvant after the onset Systemic score : the systemic score was taken every 2 days
Arthritis in Rat of secondary inflammation .
Model Establishment: Hind foot: no swelling=0 score , one hind foot swelling= 1
80 SPF SD rats were randomly divided into 8 groups. Rats 40 score , two :hind
Forefoot feet swelling
no swelling =2 scores
= 0 score , one ;forefoot swelling= 1
in each group were lightly anesthetized with ether. Then, 0.1
mL of complete Freund's adjuvant containing inactivated score , two forefeet swelling =2 scores ;
Mycobacterium tuberculosis was injected subcutaneously Ear : no redness and nodules = 0 score , redness or nodules
into the left hind foot of the rats. Primary arthritis occurred in one ear = 1 score, redness and nodules in both ears = 2
in the left hind foot of the rat, and at about 13 days 45 scores;
post -modeling, secondary arthritis occurred in the right hind Nose : no swelling =0 score , obvious swelling = 1 score ;
foot. A blank control group was injected with an equal Tail: no nodules = 0 score , with nodules = 1 score ; full score
volume of physiological saline . The drug was administered was 8 scores .
13 days after modeling . A methotrexate group was admin- Arthritis index score : the arthritis index score was per
istered by injection every 5 days for 15 days, 4 times in total ; 50 formed every 2 days after the onset of secondary inflam
the fusion protein I , protein II , protein III , protein IV , and mation .
protein V at high , medium and low doses ( 128 mg/kg, 32 Normal = 0 score ; erythema and mild swelling in the ankle
mg/kg, 8 mg/kg ) were administered by injection every 5 joint = 1 score ; erythema and mild swelling from the ankle to
days for 15 days. the metatarsophalangeal joint or metacarpal joint= 2 scores ;
Efficacy Evaluation : 55 erythema and moderate swelling from the ankle to the
1. Primary and Secondary Toe Swelling Degree metatarsophalangeal joint or metacarpal joint = 3 scores ; ery
Using a foot volume measuring method , a marker was thema and severe swelling from the ankle to the metatar
made with a fat - soluble marker at the left and right posterior sophalangeal joint or metacarpal joint = 4 scores ; each foot
ankle joint of each rat, and the left and right hind feet of the had a full score of 4 scores, and each rat had a maximum
animal were respectively immersed in the volume measuring 60 score of 16 scores .
device . The immersion depth was bounded by the marker, 3. Weight Gain
and the reading value at the scale pipette of the device was The initial body weight of each group of rats was weighed
the initial volume of the animal's left and right hind feet. before modeling. The body weight was measured every 2
The day of modeling was considered as the oth day and days from dl after modeling , from which the initial body
recorded as do . The volume of the left hind foot (modeling 65 weight was subtracted to obtain the weight gain of each
foot) was measured from the first day dl after modeling group of rats . The experimental results are shown in Table
every 2 days. When the swelling occurred (i.e. , secondary 16 .
 US 11,407,811 B2
29 30
TABLE 16
Effect of fusion protein I, protein II, protein III , protein IV , protein V on chronic inflammation of adjuvant arthritis in rat
Group Dose Foot swelling degree (mL ) Clinical score
(n = 10 ) (mg/kg) Left Right Whole body Arthritis index Weight gain (g )
Protein I 8 1.76 + 0.31 1.92 + 0.09 2.11 + 0.16 * 6.77 + 0.53 43.97 + 20.59
32 1.62 + 0.11 ** 1.54 + 0.17 * 1.82 + 0.35 5.71 + 0.38 * 49.02 + 17.15 *
128 1.41 + 0.22 ** 1.34 + 0.08 ** 1.55 + 0.10 ** 4.44 + 0.48 ** 52.15 15.91 *
Protein II 8 1.95 + 0.12 1.77 + 0.54 2.23 + 0.26 * 6.92 + 0.55 44.96 + 12.11
32 1.60 + 0.19 * 1.54 + 0.33 * 1.81 + 0.32 5.69 + 0.37 * 48.10 + 9.19 *
128 1.35 + 0.14 ** 1.35 + 0.73 * 1.54 + 0.19 ** 4.17 + 0.64 ** 50.83 + 15.19 **
Protein III 8 1.91 + 0.29 1.94 + 0.16 1.87 + 0.22 6.78 + 0.54 44.27 + 15.33
32 1.63 + 0.08 ** 1.61 + 0.21 * 1.77 + 0.37 5.64 + 0.46 * 48.02 + 14.66 *
128 1.34 + 0.23 ** 1.41 + 0.08 ** 1.52 0.07 ** 4.44 + 0.49 ** 51.55 + 12.10 **
Protein IV 8 1.89 + 0.31 1.91 + 0.09 2.09 + 0.17 * 6.79 + 0.52 43.82 + 19.04
32 1.66 + 0.08 ** 1.57 + 0.20 * 1.84 + 0.39 5.73 + 0.47 * 47.09 + 17.75 *
128 1.39 + 0.21 ** 1.36 + 0.06 ** 1.54 + 0.07 ** 4.41 0.45 ** 53.63 + 12.29 *
Protein V 8 1.92 + 0.09 1.76 + 0.55 2.21 + 0.24 * 6.95 + 0.56 44.75 17.46
32 1.61 + 0.21 * 1.59 + 0.31 * 1.86 + 0.34 5.71 + 0.42 * 47.33 + 15.29 *
128 1.32 + 0.16 ** 1.33 + 0.72 * 1.53 + 0.18 ** 4.19 + 0.65 ** 51.97 + 9.03 **
Methotrexate 1 1.19 + 0.20 ** 1.22 + 0.13 ** 1.31 + 0.17 ** 2.00 0.54 ** 47.32 = 17.20 **
control 2.14 + 0.07 2.06 + 0.16 2.61 + 0.26 7.52 + 0.35 29.51 + 19.94
* P <0.05 ,
** P < 0.01 vs control.

The experimental results showed that after modeling , the 25 which were incubated in a 5 % CO2 incubator at 37 ° C. for
left hind foot in each group was swollen rapidly (primary 48 hours. 20 uL of 5 mg/mL MTT was added to each well
inflammation ), and on the 13th day, the hind foot ( non- of a 96 - well plate, and incubation was continued for 4 hours.
contralateral inflammatory foot) began to be red and swollen The medium was aspirated and 100 uL of DMSO was added
( i.e. , secondary inflammation occurred ). The arthritis index per well for dissolution . The absorbance was measured at
and systemic score began to increase , reaching the highest 30 570 nm with a microplate reader with a reference wave
value on the 19th day , and the swelling degree and score of length of 630 nm , and the proliferation inhibition ( PI ) was
each group are gradually decreased along with administra- calculated . The formula was as follows:
tion . The primary toe swelling degree was used to reflect the
therapeutic effect of each treatment group on primary arthri 35 Ntest
tis . The high and medium doses of each administration PI( %) = 1 Ncontrol x 100 %
group could treat primary arthritis to a certain extent com
pared with the model group . The positive drug methotrexate
had the best effect, and the fusion protein I , protein II , where Ntest is the OD value of the test group and Nccontrol
protein III , protein IV , and protein V were effective in high 40 is the OD value of the blank control group .
dose groups, with extremely significant differences Data Statistics :
( ** P <0.01 ) . The secondary toe swelling degree was used to The test was repeated 5 times independently. The results
reflect the therapeutic effect of each treatment group on obtained from the test were calculated as mean - SD , and
secondary arthritis. statistical t -test was performed. P< 0.05 was considered as
Example 11 45 significant difference, and P <0.01 was considered as
extremely significant difference . The experimental results
are shown in Table 17 .
Inhibitory Effect of Fusion Protein I , Protein II , Protein
III , Protein IV and Protein V on Proliferation of Human TABLE 17
Retinal Vascular Endothelial Cell ( HRCEC ) 50
The activity of the integrin blocker polypeptide to inhibit Inhibitory effect of fusion protein I , protein II , protein
III , protein IV , and protein V on proliferation of
proliferation of human retinal vascular endothelial cells was human retinal vascular endothelial cell (HRCEC )
examined by MTT assay. HRCEC cells were cultured in a
5 % CO , incubator at 37 ° C. to a density of 90 % or more , and Group (n = 5 ) Dose (ug /mL)
=
A570 nm / A630 nm PI (%)
then collected by trypsinization. The cells were resuspended 55 Protein I 1 1.1856 + 0.0395 11.99 %
in the culture liquid and counted under a microscope. The 2 1.0024 + 0.0401 25.59 %
cell concentration was adjusted to 3.0x104 cells/mL . The 4 0.9248 + 0.0383 31.35 %
cell suspension was inoculated into a 96 - well plate at 100 uL 8
16
0.9014
0.8314
+ 0.0368
+ 0.0344
33.09 %
38.28 %
per well and cultured in a 5 % CO2 incubator at 37 ° C. 32 0.7284 + 0.0299 45.93 %
overnight. The polypeptide I , the polypeptide II , the poly- 60 64 0.5879 + 0.0327 56.36 %
peptide III , and the Avastin were diluted with the culture 128 0.3849 + 0.0311 71.43 %
liquid to respective predetermined concentrations. After the Protein II
256 0.1488
1.1122
+ 0.0296
+ 0.0385
88.95 %
17.44 %
cells were fully adhered, each dilution was added to a 1
2 1.0002 + 0.0405 25.75 %
96 -well plate at 100 uL per well , respectively . The integrin
9 4 0.9287 + 0.0288 31.06 %
blocker polypeptide was used as a administration group , and 65 8 0.8999 + 0.0320 33.20 %
Avastin was used as a positive control group , and a culture 16 0.8225 + 0.0291 38.94 %
liquid containing no drug was used as a blank control group ,
 US 11,407,811 B2
31 32
TABLE 17 - continued with forceps to expose the chorioallantoic membrane . Lens
Inhibitory effect of fusion protein I , protein II , protein
paper having a diameter of 5 mm was used as a loading
III , protein IV, and protein V on proliferation of carrier, and was placed on the chorioallantoic membrane of
human retinal vascular endothelial cell (HRCEC ) 5
the chicken embryo air sac . Filter paper with PBS was used
Group (n = 5 ) Dose (ug/mL) A570 nm / A630 nm PI (%)
as a blank group , and the administration group was added
=
with different doses of fusion protein . The positive control
32 0.7348 + 0.0277 45.45 % was Avastin .
64
128
0.5748
0.3628
+
+
0.0314
0.0282
57.33 %
73.07 %
( 3 ) The chicken embryo air sac was sealed with a sterile
256 0.1495 + 0.0314 88.90 % 10
transparent tape , and after culturing at 37 ° C. for 72 hours ,
Protein III 1 1.1125 + 0.0403 17.42 % the chicken embryo air sac was opened , and a fixative
2
4
0.9945 + 0.0375
0.9168 + 0.0362
26.17
31.94%
% ( formaldehyde: acetone = 1 : 1) was added for fixation for 15
8 0.8997 + 0.0358 33.21 %
minutes. The chorioallantoic membrane to which the lens
16 0.8347 + 0.0274 38.04% paper was adhered was taken out , the distribution of the new
32 0.7451 + 0.0280 44.69 % 15 blood vessels was observed , and the new blood vessels were
64 0.5974 + 0.0193 55.65 % counted and photographed . Five replicates were set for each
128 0.3789 + 0.0238 71.87 %
256 0.1453 + 0.0247 89.21 % dose and the results were statistically analyzed.
Protein IV 1 1.1002 + 0.0393 18.33 % The analysis results of the activity of fusion protein to
2
4
0.9999 = 0.0385
0.9146 + 0.0374
25.77 %
32.11 %
inhibit angiogenesis in vivo by the chicken embryo chorio
8 0.8858 + 0.0389 34.24% 20 allantoic membrane (CAM ) assay were as follows: negative
16 0.8367 + 0.0351 37.89 % control was treated with PBS , the dose of positive control
32 0.7386 + 0.0294 45.17 % Avastin was 10 fusion protein I , protein II , protein III ,
64
128
0.5613 + 0.0273
0.3741 = 0.0284
58.33 %
72.23 % protein IV , protein V were used to treat the chicken embryos
256 0.1552 = 0.0277 88.48 % at high , medium and low doses of 128 ug , 32 ug and 8 ug ,
Protein V 1 1.0522 + 0.0379 21.89 % 25 respectively. The results are shown in Table 18 .
2 0.9858 + 0.0335 26.82 %
4 0.9154 + 0.0342 32.05 %
8 0.8991 + 0.0328 33.26 %
TABLE 18
16 0.8298 + 0.0294 38.40 % Inhibitory effect of fusion protein I , protein II ,
32 0.7288 + 0.0276 45.90 %
64 0.5589 + 0.0243 58.51 % 30
protein III , protein IV , protein Von angiogenesis
128 0.3652 + 0.0222 72.89 %
of chicken embryo chorioallantoic membrane
256 0.1467 0.0199 89.11 %
Taxol 5 0.2387 + 0.0257 82.28 %
Group (n = 5 ) Dose (ug) Blood vessel number PI ( % )
control 1.3471 0.0583 0.00 % Protein I 8 93 + 5 24.39 %
32 76 + 2 38.21 %
* P < 0.05 , 35 128 50 + 9 ** 59.35 %
** P < 0.01 vs control. Protein II 8 102 + 10 17.07%
32 83 + 11 32.52 %
The results showed that fusion protein I , protein II , 128 66 + 7* 46.34 %
protein III , protein IV and protein V could significantly Protein III 8 93 +7 24.39 %
inhibit the proliferation of human retinal vascular endothe 32
128
75
49
+1
+ 10 **
39.02 %
60.16%
lial cells (HRCEC ) in a dose -dependent manner. At a con- 40 Protein IV 8 101 + 9 17.89 %
centration of 64 ug /mL, the inhibition rate reached 50 % or 32 81 + 11 34.15 %
more . 128 64 + 9* 47.97 %
Protein V 8 98 + 8 20.33 %
32 84 + 10
Example 12 128 65 + 8*
31.71 %
47.15 %
45 Avastin 10 57 + 16 ** 53.66 %
Activity of Fusion Protein I , Protein II , Protein III , Protein control 123 + 13 0.00 %
IV, Protein V to Inhibit Angiogenesis In Vivo Analyzed by *P < 0.05 ,
Chicken Embryo Chorioallantoic Membrane (CAM ) ** P < 0.01 vs control.
In this study, CAM assay was used to investigate the
activity of fusion protein I , protein II , protein III , protein IV , 50 The results showed that fusion protein I , protein II ,
and protein V to inhibit angiogenesis in vivo . The study has protein III , protein IV, and protein V could inhibit angio
shown that the biosynthesis rate of collagen reached the genesis of CAM , and had a strong inhibitory effect ( nearly
maximum on the 8th to 11th day of chicken embryo devel- 50%) at high dose .
opment, which was the most vigorous stage of angiogenesis ,
and the body's immune system had not yet been fully Example 13
55
established at that time , and thus the chicken embryos
developed to the 8th day was selected to be administered . Effect of Fusion Protein I , Protein II , Protein III , Protein
Considering that the polypeptide on drug - loaded paper had IV and Protein V on Corneal Neovascularization in Mice
a certain diffusion range limitation on the chicken embryo ( 1 ) Preparation of Corneal Neovascularization Model
chorioallantoic membrane, only the number of new blood 60 Induced by Alkali Burn in BALB / c Mice :
vessels within aa radius of 5 mm from the edge of the paper 15 healthy male BALB /c mice with weight of 20-25 g
was counted in the test . The following steps were used . were examined under a slit lamp microscope for the anterior
( 1 ) The White Leghorn chicken embryos on day 6 were segment of both eyes and the appendage to exclude ocular
cultured in a 37 ° C. incubator at 60 % -70 % humidity for two lesions . The eyes were given 0.3 % loxacin eye drops 1 day
days. 65 before the preparation of alkali burn model , twice a day.
(2 ) A 1.0 cmx1.0 cm window was drilled above the After the mice were anesthetized by intraperitoneal injection
chicken embryo air sac , and the inner membrane was torn off of 1.8 % Avertin , single -layer filter paper with aa diameter of
 US 11,407,811 B2
33 34
2 mm was clamped with tweezers , and immersed in a 1 The results showed that CD31 was used as a microvas
mol/ L sodium hydroxide solution to reach a saturated state , cular marker, which was mainly expressed in the cytoplasm
and the excess liquid was removed . The filter paper was of vascular endothelial cells . The stained positive cells were
placed in the central corneal of BALB / c mice for 40 s and vascular endothelial cells stained tan or brown without
then discarded , and the burned area and conjunctival sac 5 background staining. The number of CD31 -positive new
were immediately rinsed with 15 mL of PBS for 1 min . blood vessels in fusion protein I , protein II , protein III ,
Excess water was wiped away with cotton swabs , and under protein IV , protein V experimental groups was significantly
an operating microscope, the corneal epithelium was vorti reduced
cally scraped off by paralleling a corneal scraping knife to protein I ,compared with that of the control group. Fusion
protein II , protein III , protein IV , and protein V
the limbus corneae . The subcutaneous stromal layer and 10 groups had significant difference compared with the control
limbus corneae was carefully not to be injured, and after group . The experimental results showed that fusion protein
surgery, an erythromycin eye ointment was applied into the I , protein II , protein III , protein IV , protein V could inhibit
conjunctival sac to prevent infection . the growth of corneal new blood ssels , and can be used as
( 2 ) Experimental Animal Grouping and Sample Acquisi- a medicament for the treatment of corneal neovascular eye
tion : 15 diseases.
15 mice were randomly divided into fusion protein I,
protein II , protein III , protein IV, protein V groups and a
2 Example 14
control group , with 5 rats in each group . After alkali burn ,
64 ug of fusion protein I , protein II , protein III , protein IV , Effect of Fusion Protein I , Protein II , Protein III , Protein
protein V and physiological saline were given via intravit- 20 IV and Protein V on Iris Neovascularization in Rabbits
real injection once every 3 days for 1 week, and the The argon ion laser at 577 nm was used to occlude the
inflammatory reaction and neovascularization of the cornea major branch vein of rabbit retina, and a success venous
in each group were observed under a slit lamp microscope occlusion was confirmed by fundus fluorescein angiography
on day 1 , day 7 , and day 14 after alkali burn . On day 14 after (FFA ). After 5-12 days , the iris fluorescein angiography
alkali burn , the neovascularization of the corneal in each 25
group was photographed and recorded under the slit lamp
( IFA ) showed that the fluorescein leakage was obvious in the
iris vessels compared with the normal control group , con
microscope for photographing anterior segment of the eye . firming the formation of the animal model of the iris
Then, all the mice were sacrificed by cervical dislocation neovascularization (NVI).
and the eyeballs were removed . The blood was washed with 9 eyes successful in modeling were randomly divided into
physiological saline , and the eyeballs were fixed in 4 % 30 3 groups with 3 eyes for each group . They were labeled as
paraformaldehyde for 1.5 h , dehydrated in PBS containing a negative control group , and fusion protein I , protein II ,
30 % sucrose overnight, embedded in an OCT tissue freezing protein III , protein IV and protein V treatment groups ,
med m , stored in a refrigerator at -80 ° subjected respectively, which were respectively given physiological
cryosection at 8 and detected by immunohistochemistry for saline , 128 ug of fusion protein I , 128 ug of protein II , 128
CD31 expression . 35 ug of protein III , 128 ug of protein IV and 128 ug of protein
(3 ) Quantitative Measurement for Microvessel Density of V via intravitreal injection once every 5 days for 2 weeks .
Corneal Tissue : The observation was performed with an optical and electron
Microvessel density (MVD ) is an indicator for evaluating microscope on the third week .
angiogenesis . An anti -CD31 antibody immunohistochemis- Results : under the optical microscope, it was observed
try was used to label vascular endothelial cells and the 40 that the anterior surface of the iris was a fibrous vascular
number of microvessels per unit area was counted to mea- membrane remnant mainly consisting of fibrous tissue , and
sure the extent of neovascularization . Standards for counting there were few open vascular lumens. Vascular residues can
microvessels were that under a microscope, the endothelial be seen in the iris matrix , which are necrotic cells and cell
cells or cell clusters which were clearly demarcated from debris. The iris surface of the control eye under a light
adjacent tissues in the corneal tissue and were stained tan or 45 microscope is a fibrous vascular membrane with branches
brown were counted as the new blood vessels . The number and potential lumens .
of new blood vessels in the entire section was counted under The ultrastructure of the iris in the treatment group
a 10x20 microscope. After the corneal tissue was photo- showed a series of degenerative changes. The endothelial
graphed , the area of the entire corneal tissue was calculated cells of the large blood vessels in the middle of the iris
by image processing software Image J , and the density of 50 matrix had normal nucleus, cytoplasm and cell junctions.
new blood vessels in the entire section in this example was There were capillary residues in the iris matrix and on the
determined . The results are shown in Table 19 . anterior surface of the iris , which were surrounded by cell
debris and macrophage infiltration . No capillary with poten
TABLE 19 tial lumens and degenerated parietal cells indicated regres
55 sion of new blood vessels .
MVD count showing effect of fusion protein I , protein II , protein Through animal model experiments of iris neovascular
III, protein IV , protein V on corneal neovascularization in mice
ization , it was demonstrated that fusion protein I , protein II ,
Group (n = 5 ) Dose (ug) MVD protein III , protein IV , and protein V could inhibit neovas
Protein I 64 26.94 + 5.91 * cularization and regress the formed blood vessels .
64 60
Protein II 24.64 + 4.24 *
Protein III 64 25.74 + 5.39 * Example 15
Protein IV 64 24.62 + 4.81 *
Protein V 64 25.57 + 4.76 *
control 51.03 + 7.57 * Effect of Fusion Protein I , Protein II , Protein III , Protein
IV and Protein V on Choroidal Blood Flow in Rabbit Eyes
*P < 0.05 , 65 New Zealand white rabbits with weight of 2.5-3.0 kg were
**P < 0.01 vs control. randomly divided into 3 groups , which were labeled as a
control group , and fusion protein I , protein II , protein III ,
 US 11,407,811 B2
35 36
protein IV , and protein V groups. White rabbits in each 12 , the mice were returned to indoor air and the retinal blood
group were anesthetized with 35 mg/kg xylazine via intra- vessels exposed to hyperoxia rapidly disappeared , which
muscular injection, and then anesthesia was maintained with caused extensive abnormal neovascularization , and the cen
half of the initial amount via intramuscular injection per tral part of the retina remained largely avascular for a long
hour. The intraocular pressure of the left eye was increased 5 time . After the blood vessels disappeared completely, the
to 40 mmHg, under which the blood flow can be reduced to fusion protein (administration group , the doses of fusion
1/3 of the normal value . The left ventricle was cannulated protein I , protein II , protein III , protein IV , and protein V
through right carotid artery for injection of microspheres were all 64 ug ) or physiological saline (negative group ) was
( for the calculation of ocular blood flow ), and the femoral 10 injected into the vitreous body on day 13. Retinal vessels
artery was cannulated for blood collection . Each group was were evaluated on day 17 ( labeled as unclosed vessels , 50
given physiological saline , 128 ug of fusion protein I , 128 ug mL of Texas Red- labeled tomato lectin was injected into the
of protein II , 128 ug of protein III , 128 ug of protein IV , and left ventricle and cycled for 5 minutes ). The experimental
128 ug of protein V via intravitreal injection . The ocular results are shown in Table 21 .
blood flow of rabbit eyes with high intraocular pressure was 15
measured by a color microsphere technique at 0 , 30 , and 60 TABLE 21
minutes after administration. At each time point, 0.2 mL Effect of fusion protein I , protein II , protein III , protein
( about 2 million) of microspheres were injected. Immedi IV , protein V on retinal blood vessels in OIR mice
ately after the microspheres were injected , blood was col
lected through the femoral artery for 60 seconds , and placed Group (n = 5 ) Dose (ug) Area (mm²) Reduce (%)
in a heparinized anticoagulant tube, and the amount of blood 20 Protein I 64 0.101 + 0.036 * 52.13 %
collected was recorded . After the last blood collection, the Protein II 64 0.146 + 0.011 * 30.81 %
animals were sacrificed with 100 mg/kg phenobarbital via Protein III o
to
64 0.104 + 0.041 * 50.71 %
intravenous infusion . The eyeballs were removed , and the Protein IV
Protein V
64
64
0.152 + 0.013 *
0.144 + 0.015 *
27.96 %
31.75 %
retina, choroid , iris and ciliary body were separated, and the 25 control 0.211 0.039 0.00 %
tissue weight was recorded . The tissue blood flow at each
time point was calculated with the following formula: Qm= ***PP<<0.050.01, vs control.
(CmxQr) /Cr, where Om represented tissue blood flow in
UL /min /mg; Cm was the number of microspheres per mil The results showed that the administration of fusion
ligram of tissue ; Qr was blood flow in uL /min ; and Cr was 30 protein I , protein II , protein III , protein IV , and protein V to
the number of blood microspheres as a reference . The OIR mice could alleviate pathological neovascularization .
experimental results are shown in Table 20 . Compared with the negative control, the neovascular clus
TABLE 20 ters in the retina of OIR mice treated with fusion protein I ,
protein II , protein III , protein IV , and protein V were
Effect of fusion protein I , protein II , protein III , protein 35 significantly reduced, and the areas occupied by neovascular
IV , protein V on choroidal blood flow in white rabbit eyes clusters were decreased by 52.13 % , 30.81 % , 50.71 % ,
Group (n = 3 )
==
Dose (ug) Time (min) Blood flow (UL /min /mg) 27.96 % , and 31.75 % , respectively.
Protein I 128 0 21.9 + 2.3 Example 17
128 30 16.9 + 3.1 40
128 60 15.1 + 1.6
Protein II 128 0 22.9 + 2.5 Effect of Fusion Protein I , Protein II , Protein III , Protein
128 30 15.7 + 1.3 IV and Protein V on Neovascularization in Premature Rat
128 60 13.9 + 1.2 Retinopathy Model
Protein III 128
128
0
30
22.1 +
17.1 + 2.9
2.2 A fluctuating oxygen - induced animal model was adopted,
128 60 14.9 + 1.5 45 and newborn rats (within 12 hours ) spontaneously delivered
Protein IV 128 0 22.7 + 2.4 on the same day were randomly divided into three groups:
128 30 15.5 + 1.2 an oxygen model group, an oxygen treatment group , and a
Protein V
128
128
60
0
13.7
22.8
+
+
1.3
2.1
normal control group . The oxygen model was subdivided
128 30 15.8 + 1.4 into three model subgroups, which were placed in a semi
128 60 13.8 + 1.1 50 closed oxygen chamber made of plexiglass together with the
control 0 11.9 + 1.2 treatment group . The medical oxygen was introduced into
30
60
9.5 + 1.4
5.3 + 1.7
the chamber, and the oxygen concentration was adjusted to
80% £ 2 % with an oxygen meter. After 24 hours, nitrogen gas
was introduced into the oxygen chamber, and then the
The results showed that choroidal blood flow was signifi- 55 oxygen concentration was rapidly adjusted to 10 % £ 2 % and
cantly increased in the fusion protein I , protein II , protein III , maintained for 24 hours . The operation was repeated, the
protein IV , and protein V treatment groups at all observation oxygen concentration in the oxygen chamber was main
time points. tained to be alternated between 80 % and 10 % every 24 hours
for 7 days, and then the rats were transferred to the air and
Example 16 60 fed . The oxygen concentration was monitored 8 times a day,
and the ambient temperature in the chamber was controlled
Effect of Fusion Protein I , Protein II , Protein III , Protein to 23 ° C. + 2 ° C. The litter was replaced, food was added ,
IV , and Protein V on Retinal Blood Vessels in OIR Mice water was changed, and mother rat was replaced once . The
Establishment of the OIR model : young mice and their normal control group was placed in an animal house feeding
mothers were exposed to 75 % hyperoxic environment from 65 environment. Compared with the control group , if the retinal
day 7 to day 12 after birth of C57 /B16 mice so that stretched preparation stained with ADPase in the model
capillaries in the central retina rapidly disappeared . On day group showed obvious vascular changes, the nucleus count
 US 11,407,811 B2
37 38
of vascular endothelial cells that broke through the inner (27.452 2.110 ) , the nucleus counts of retinal vascular
limiting membrane of the retina into the vitreous body was endothelial cells were significantly reduced , which proved
increased , and the difference was statistically significant, the that they can inhibit the neovascularization in the oxygen
model was successfully established . induced neonatal rat retinopathy model to a certain extent.
The oxygen treatment group was divided into two sub- 5 Example 19
groups. On day 7 of modeling , the administration was
performed via intravitreal injection, in which the fusion
protein I , protein II , protein III , protein IV , and protein V IVEffect
and
of Fusion Protein I , Protein II , Protein III , Protein
Protein V on Neovascularization in Diabetic Ret
were administered at a dose of 100 respectively. The oxygen inopathy Rat Model
model group and the control group were given only physi- 10 The experimental diabetic rat model was established with
ological saline for one week . streptozotocin STZ . STZ was dissolved in 0.1 mol / L citrate
On day 14 , after the rats was sacrificed with ether anes buffer at pH 4.5 to prepare a 2 % solution . All experimental
thesia , the eyeballs were removed and fixed in a 40 g/L Wistar rats were fasted for 12 h before injection, and each rat
paraformaldehyde solution for 24 hours. The eyeballs were was intraperitoneally injected with a 2 % STZ solution at a
dehydrated with gradient alcohols and hyalinized with 15 dose of 65 mg/kg. After the injection, the rats were fed in
xylene. After being immersed in wax , the eyeballs were single cages , and urine sugar and blood sugar were detected
continuously sectioned to a thickness of 4 avoiding the at the 48th hour. When urine sugar was +++ or above , and
surrounding of the optic disc as much as possible. The blood glucose was higher than 16.7 mmol /L , the model
sections were parallel to the sagittal plane of the cornea to establishment requirement is reached . The diabetic retinopa
the optic disc. 10 sections were randomly selected from each 20 thy model was successfully established by detecting blood
eyeball to be stained with hematoxylin and eosin , and the glucose , urine glucose , and urine volume and retinal VEGF
nucleus of vascular endothelial cells that broke through the immunohistochemistry.
inner limiting membrane of the retina was counted ( only the 15 rats were randomly divided into three groups, which
nucleus of vascular endothelial cells closely related to the were labeled as a control group , and fusion protein I , protein
inner limiting membrane were counted ), and the average 25 II , protein III , protein IV and protein V treatment groups.
number of cells per section per eyeball was counted . The administration was performed via intravitreal injection
Results : no or few nucleus of vascular endothelial cells once every 5 days for 2 weeks , in which the control group
that broke through the inner limiting membrane of the retina was injected with physiological saline ( 0.1 mL ) , and the
into the vitreous body was found in the control group . More fusion protein I , protein II , protein III , protein IV, and
nucleuses of vascular endothelial cell that broke through the 30 protein V were all administered with 100 ug ( 0.1 mL ) .
inner limiting membrane of the retina were found in the Observation was performed on week 4 , week 8 , and week
model group , some of which appeared alone, some clus- 12. The experimental results are shown in Table 23 .
tered , and some nucleuses of vascular endothelial cells were
found to be adjacent to the deep retinal vessels on some TABLE 23
sections , confirming that they were originated from the 35 Effect of fusion protein I , protein II , protein III , protein IV ,
retina instead of the vitreous body or other tissues in eyes . protein V on neovascularization in diabetic retinopathy rat model
Only a few nucleuses of vascular endothelial cell that broke
through the inner limiting membrane of the retina were Group (n = 5 ) Week 4 Week 8 Week 12
found in the sections of the treatment group . The experi 219.96 + 3.59
mental results are shown in Table 22 . 40 Protein I 181.15 + 3.16 262.49 + 1.21
Protein II 190.94 + 2.53 217.42 + 4.48 255.17 + 3.54
Protein III 179.33 = 2.54 220.03 + 3.61 257.38 + 1.19
TABLE 22 Protein IV 189.35 + 2.48 225.43 = 4.32 261.22 + 2.91
Protein V 187.33 + 2.39 221.49 + 3.82 256.30 + 3.24
Nucleus count of vascular endothelial cells in each group control 201.69 + 4.17 206.93 + 1.04 196.25 3.56

Group 45
Dose (ug) Nucleus number
The results showed that under an optical microscope , the
Protein I
Protein II
100
100
6.502 + 2.011
7.238 + 1.194
number of ganglion cells in 10 retina of posterior pole in
Protein III 100 6.471 + 2.017 each eyeball was counted, and the thickness of 10 retina of
Protein IV 100 7.226 1.215 posterior pole in each eyeball was measured . Compared with
Protein V
Model group
100 6.954 + 1.003 50 the control group , the thickness of each layer of the retinal
control
26.945 + 1.943
1.199 + 0.297
tissue of the experimental group was increased. Compared
with the control group , the number of ganglion cells in the
retinal of rats in the experimental group was increased .
The results showed that the nucleus counts of retinal Compared with the control group , the number of visual cells
vascular endothelial cells in the fusion protein I , protein II , 55 in the treatment group was increased . It was indicated that
protein III , protein IV, and protein V treatment groups were fusion protein I , protein II , protein III , protein IV and protein
6.502 + 2.011 , 7.238 + 1.194 , 6.471 2.017 , 7.226 1.215 , and V could produce a certain therapeutic effect on diabetic
6.954 1.003 , compared with the oxygen model group retinopathy at 100 ug dose .
SEQUENCE LISTING

< 160 > NUMBER OF SEQ ID NOS : 25

< 210 > SEQ ID NO 1
< 211 > LENGTH : 3
< 212 > TYPE : PRT
 US 11,407,811 B2
39 40
- continued
< 213 > ORGANISM : Artificial Sequence
< 220 > FEATURE :
< 223 > OTHER INFORMATION : synthesized
< 400 > SEQUENCE : 1
Arg Gly Asp
1

< 210 > SEQ ID NO 2

< 211 > LENGTH : 9
< 212 > TYPE : DNA
< 213 > ORGANISM : Artificial Sequence
< 220 > FEATURE :
< 223 > OTHER INFORMATION : synthesized
< 400 > SEQUENCE : 2
cgtggtgac 9

< 210 > SEQ ID NO 3

< 211 > LENGTH : 50
< 212 > TYPE : PRT
< 213 > ORGANISM : Artificial Sequence
< 220 > FEATURE :
< 223 > OTHER INFORMATION : synthesized
< 400 > SEQUENCE : 3
Phe Gin Pro Val Leu His Leu Val Ala Leu Asn Ser Pro Leu Ser Gly
1 5 10 15

Gly Met Arg Gly Ile Arg Gly Ala Asp Phe Gin Cys Phe Gin Gin Ala
20 25 30

Arg Ala Val Gly Leu Ala Gly Thr Phe Arg Ala Gly Gly Gly Gly Arg
35 40 45

Gly Asp
50

< 210 > SEQ ID NO 4

< 211 > LENGTH : 150
< 212 > TYPE : DNA
< 213 > ORGANISM : Artificial Sequence
< 220 > FEATURE :
< 223 > OTHER INFORMATION : synthesized
< 400 > SEQUENCE : 4
ttccaacctg ttcttcacct tgttgctctt aactctcctc tttctggtgg tatgcgtggt 60

atccgtggtg ctgacttcca atgcttccaa caagctcgtg ctgttggtct tgctggtact 120

ttccgtgctg gtggtggtgg tcgtggtgac 150

< 210 > SEQ ID NO 5

< 211 > LENGTH : 50
< 212 > TYPE : PRT
< 213 > ORGANISM : Artificial Sequence
< 220 > FEATURE :
< 223 > OTHER INFORMATION : synthesized
< 400 > SEQUENCE : 5
Arg Gly Asp Gly Gly Gly Gly Phe Gin Pro Val Leu His Leu Val Ala
1 5 10 15

Leu Asn Ser Pro Leu Ser Gly Gly Met Arg Gly Ile Arg Gly Ala Asp
20 25 30

Phe Gin Cys Phe Gin Gin Ala Arg Ala Val Gly Leu Ala Gly Thr Phe
35 40 45

Arg Ala
 US 11,407,811 B2
41 42
- continued
50

< 210 > SEQ ID NO 6

< 211 > LENGTH : 150
< 212 > TYPE : DNA
< 213 > ORGANISM : Artificial Sequence
< 220 > FEATURE :
< 223 > OTHER INFORMATION : synthesized
< 400 > SEQUENCE : 6
cgtggtgacg gtggtggtgg tttccaacct gttcttcacc ttgttgctct taactctcct 60

ctttctggtg gtatgcgtgg tatccgtggt gctgacttcc aatgcttcca acaagctcgt 120

gctgttggtc ttgctggtac tttccgtgct 150

< 210 > SEQ ID NO 7

< 211 > LENGTH : 232
< 212 > TYPE : PRT
< 213 > ORGANISM : Artificial Sequence
< 220 > FEATURE :
< 223 > OTHER INFORMATION : synthesized
< 400 > SEQUENCE : 7
Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala
1 5 10 15

Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro
20 25 30

Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val
35 40 45

Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val
50 55 60

Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin
65 70 75 80

Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin
85 90 95

Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala
100 105 110

Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro
115 120 125

Arg Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr
130 135 140

Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser
145 150 155 160

Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr
165 170 175

Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr
180 185 190

Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe
195 200 205

Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys
210 215 220

Ser Leu Ser Leu Ser Pro Gly Lys

225 230

< 210 > SEQ ID NO 8

< 211 > LENGTH : 696
< 212 > TYPE : DNA
< 213 > ORGANISM : Artificial Sequence
< 220 > FEATURE :
 US 11,407,811 B2
43 44
- continued
< 223 > OTHER INFORMATION : synthesized
< 400 > SEQUENCE : 8
gagcccaaat cttgtgacaa aactcacaca tgcccaccgt gcccagcacc tgaactcctg 60

gggggaccgt cagtcttcct cttcccccca aaacccaagg acaccctcat gatctcccgg 120

acccctgagg tcacatgcgt ggtggtggac gtgagccacg aagaccctga ggtcaagttc 180

aactggtacg tggacggcgt ggaggtgcat aatgccaaga caaagccgcg ggaggagcag 240

tacaacagca cgtaccgtgt ggtcagcgtc ctcaccgtcc tgcaccagga ctggctgaat 300

ggca aggagt acaagtgcaa ggtctccaac aaagccctcc cagcccccat cgagaaaacc 360

atctccaaag ccaaagggca gccccgagaa ccacaggtgt acaccctgcccccatcccgg 420

gatgagctga ccaagaacca ggtcagcctg acctgcctgg tcaaaggctt ctatcccagc 480

gacatcgccg tggagtggga gagcaatggg cagccggaga acaactacaa gaccacgcct 540

cccgtgctgg actccgacgg ctccttcttc ctctacagca agctcaccgt ggacaagage 600

aggtggcagc aggggaacgt cttctcatgc tccgtgatgc atgaggctct gcacaaccac 660

tacacgcaga agagcctctc cctgtctccg ggtaaa 696

< 210 > SEQ ID NO 9

< 211 > LENGTH : 228
< 212 > TYPE : PRT
< 213 > ORGANISM : Artificial Sequence
< 220 > FEATURE :
< 223 > OTHER INFORMATION : synthesized
< 400 > SEQUENCE : 9
Glu Arg Lys Cys Cys Val Glu Cys Pro Pro Cys Pro Ala Pro Pro Val
1 5 10 15

Ala Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu
20 25 30

Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser
35 40 45

His Glu Asp Pro Glu Val Gin Phe Asn Trp Tyr Val Asp Gly Val Glu
50 55 60

Val is Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Phe Asn Ser Thr
65 70 75 80

Phe Arg Val Val Ser Val Leu Thr Val Val His Gin Asp Trp Leu Asn
85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ala Pro
100 105 110

Ile Glu Lys Thr Ile Ser Lys Thr Lys Gly Gin Pro Arg Glu Pro Gin
115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gin Val
130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ser Val
145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro
165 170 175

Pro Met Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr
180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val
195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu
210 215 220
 US 11,407,811 B2
45 46
- continued

Ser Pro Gly Lys

225

< 210 > SEQ ID NO 10

< 211 > LENGTH : 684
< 212 > TYPE : DNA
< 213 > ORGANISM : Artificial Sequence
< 220 > FEATURE :
< 223 > OTHER INFORMATION : synthesized
< 400 > SEQUENCE : 10
gagcgcaaat gttgtgtcga gtgcccaccg tgcccagcac cacctgtggc aggaccgtca 60

gtcttcctct tccccccaaa acccaaggac accctcatga tctcccggac ccctgaggtc 120

acgtgcgtgg tggtggacgt gagccacgaa gaccccgagg tccagttcaa ctggtacgtg 180

gacggcgtgg aggtgcataa tgccaagaca aagccacggg aggagcagtt caacagcacg 240

ttccgtgtgg tcagcgtcct caccgtcgtg caccaggact ggctgaacgg caaggagtac 300

aagtgcaagg tctccaacaa aggcctccca gcccccatcg agaaaaccat ctccaaaacc 360

aaagggcagc cccgagaacc acaggtgtac accctgcccc catcccggga ggagatgacc 420

aagaaccagg tcagcctgac ctgcctggtc aaaggcttct accccagcga catctccgtg 480

gagtgggaga gcaatgggca gccggagaac aactacaaga ccacgcctcc catgctggac 540

tccgacggct ccttcttcct ctacagcaag ctcaccgtgg acaagagcag gtggcagcag 600

gggaacgtct tctcatgctc cgtgatgcat gaggctctgc acaaccacta cacgcagaag 660

agcctctccc tgtctccggg taaa 684

< 210 > SEQ ID NO 11

< 211 > LENGTH : 229
< 212 > TYPE : PRT
< 213 > ORGANISM : Artificial Sequence
< 220 > FEATURE :
< 223 > OTHER INFORMATION : synthesized
< 400 > SEQUENCE : 11
Ala Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu
1 5 10 15

Ala Ala Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp
20 25 30

Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp
35 40 45

Val Ser Gin Glu Asp Pro Glu Val Gin Phe Asn Trp Tyr Val Asp Gly
50 55 60

Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Phe Asn
65 70 75 80

Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp
85 90 95

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro
100 105 110

Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu
115 120 125

Pro Gin Val Tyr Thr Leu Pro Pro Ser Gin Glu Glu Met Thr Lys Asn
130 135 140

Gin Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile
145 150 155 160

Ala Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr
 US 11,407,811 B2
47 48
- continued
165 170 175

Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg
180 185 190

Leu Thr Val Asp Lys Ser Arg Trp Gin Glu Gly Asn Val Phe Ser Cys
195 200 205

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu
210 215 220

Ser Leu Ser Leu Gly

225

< 210 > SEQ ID NO 12

< 211 > LENGTH : 684
< 212 > TYPE : DNA
< 213 > ORGANISM : Artificial Sequence
< 220 > FEATURE :
< 223 > OTHER INFORMATION : synthesized
< 400 > SEQUENCE : 12
gccgagtcta agtacggccc tccttgcoca ccttgccctg ctccagaagc tgctggcggc 60

ccttccgtgt tcctgttccccccaaagccc aaggacaccc tgatgatctc ccggaccccc 120

gaagtgacct gcgtggtggt ggatgtgtcccaggaagatc ccgaggtgca gttcaattgg 180

tacgtggacg gcgtggaagt gcacaacgcc aagaccaagc ccagagagga acagttcaac 240

tccacctacc gggtggtgtc cgtgctgacc gtgctgcacc aggattggct gaacggcaaa 300

gagtacaagt gcaaggtgtc caacaagggc ctgccctcca gcatcgaaaa gaccatctcc 360

aaggccaagg gccagccccg ggaaccccag gtgtacacac tgcctccaag ccaggaagag 420

atgaccaaga accaggtgtc cctgacctgt ctcgtgaagg gottctaccc ctccgatatc 480

gccgtggaat gggagtccaa cggccagcct gagaacaact acaagaccac cccccctgtg 540

ctggactccg acggctcctt cttcctgtac tcccgcctga ccgtggacaa gtccagatgg 600

caggaaggca acgtgttctc ctgctccgtg atgcacgagg ccctgcacaa ccactacacc 660

cagaagtccc tgtccctgtc tctg 684

< 210 > SEQ ID NO 13

< 211 > LENGTH : 245
< 212 > TYPE : PRT
< 213 > ORGANISM : Artificial Sequence
< 220 > FEATURE :
< 223 > OTHER INFORMATION : synthesized
< 400 > SEQUENCE : 13
Arg Asn Thr Gly Arg Gly Gly Glu Glu Lys Lys Lys Glu Lys Glu Lys
1 5 10 15

Glu Glu Gin Glu Glu Arg Glu Thr Lys Thr Pro Glu Cys Pro Ser His
20 25 30

Thr Gin Pro Leu Gly Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr
35 40 45

Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val
50 55 60

Ser Gin Glu Asp Pro Glu Val Gin Phe Asn Trp Tyr Val Asp Gly Val
65 70 75 80

Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Phe Asn Ser
85 90 95

Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu
100 105 110
 US 11,407,811 B2
49 50
- continued
Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser
115 120 125

Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro
130 135 140

Gin Val Tyr Thr Leu Pro Pro Ser Gin Glu Glu Met Thr Lys Asn Gin
145 150 155 160

Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala
165 170 175

Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr
180 185 190

Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu
195 200 205

Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser
210 215 220

Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser
225 230 235 240

Leu Ser Leu Gly Lys

245

< 210 > SEQ ID NO 14

< 211 > LENGTH : 735
< 212 > TYPE : DNA
< 213 > ORGANISM : Artificial Sequence
< 220 > FEATURE :
< 223 > OTHER INFORMATION : synthesized
< 400 > SEQUENCE : 14
agaaatactg gcagaggcgg cgaggaaaag aagaaagaga aagaaaaaga ggaacaggaa 60

gagagagaga ctaagacccc cgagtgcccc tcccacacac agcctctggg cgtgttcctg 120

tttcccccaa agcccaagga caccctgatg atctcccgga cccccgaagt gacctgcgtg 180

gtggtggatg tgtcccagga agatcccgag gtgcagttca attggtacgt ggacggcgtg 240

gaagtgcaca acgccaagac caagccccgc gaggaacagt tcaactccac ctaccgggtg 300

gtgtccgtgc tgaccgtgct gcaccaggat tggctgaacg gcaaagagta caagtgcaag 360

gtgtccaaca agggcctgcc ctccagcatc gaaaagacca tctccaaggc caagggccag 420

ccccgggaac cccaggtgta cacactgcct ccaagccagg aagaaatgac caagaaccag 480

gtgtccctga cctgtctcgt gaagggcttc tacccctccg atatcgccgt ggaatgggag 540

tccaacggcc agcctgagaa caactacaag accacccccc ctgtgctgga ctccgacggc 600

tccttcttcc tgtactcccg cctgaccgtg gacaagtcca gatggcagga aggcaacgtg 660

ttctcctgct ccgtgatgca cgaggccctg cacaaccact acacccagaa gtccctgtcc 720

ctgtctctgg gcaag 735

< 210 > SEQ ID NO 15

< 211 > LENGTH : 297
< 212 > TYPE : PRT
< 213 > ORGANISM : Artificial Sequence
< 220 > FEATURE :
< 223 > OTHER INFORMATION : synthesized
< 400 > SEQUENCE : 15
Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala
1 5 10 15

Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro
20 25 30
 US 11,407,811 B2
51 52
- continued
Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val
35 40 45

Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val
50 55 60

Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin
65 70 75 80

Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin
85 90 95

Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala
100 105 110

Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro
115 120 125

Arg Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr
130 135 140

Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser
145 150 155 160

Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr
165 170 175

Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr
180 185 190

Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe
195 200 205

Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys
210 215 220

Ser Leu Ser Leu Ser Pro Gly Lys Gly Gly Gly Gly Ser Gly Gly Gly
225 230 235 240

Gly Ser Gly Gly Gly Gly Ser Phe Gin Pro Val Leu His Leu Val Ala
245 250 255

Leu Asn Ser Pro Leu Ser Gly Gly Met Arg Gly Ile Arg Gly Ala Asp
260 265 270

Phe Gin Cys Phe Gin Gin Ala Arg Ala Val Gly Leu Ala Gly Thr Phe
275 280 285

Arg Ala Gly Gly Gly Gly Arg Gly Asp

290 295

< 210 > SEQ ID NO 16

< 211 > LENGTH : 891
< 212 > TYPE : DNA
< 213 > ORGANISM : Artificial Sequence
< 220 > FEATURE :
< 223 > OTHER INFORMATION : synthesized
< 400 > SEQUENCE : 16
gagcccaaat cttgtgacaa aactcacaca tgcccaccgt gcccagcacc tgaactcctg 60

gggggaccgt cagtcttcct cttcccccca aaacccaagg acaccctcat gatctcccgg 120

acccctgagg tcacatgcgt ggtggtggac gtgagccacg aagaccctga ggtcaagtto 180

aactggtacg tggacggcgt ggaggtgcat aatgccaaga caaagccgcg ggaggagcag 240

tacaacagca cgtaccgtgt ggtcagcgtc ctcaccgtcc tgcaccagga ctggctgaat 300

ggcaaggagt acaagtgcaa ggtctccaac aaagccctcc cagcccccat cgagaaaacc 360

atctccaaag ccaaagggca gccccgagaa ccacaggtgt acaccctgcc cccatcccgg 420

gatgagctga ccaagaacca ggtcagcctg acctgcctgg tcaaaggett ctatcccago 480

gacatcgccg tggagtggga gagcaatggg cagccggaga acaactacaa gaccacgcct 540

 US 11,407,811 B2
53 54
- continued
cccgtgctgg actccgacgg ctccttcttc ctctacagca agctcaccgt ggacaagagc 600
aggtggcago aggggaacgt cttctcatgc tccgtgatgc atgaggctct gcacaaccac 660

tacacgcaga agagcctctc cctgtctccg ggtaaaggcg goggaggatc tggcggaggc 720

ggttctggtg gtggtggctc tttccaacct gttcttcacc ttgttgctct taactctcct 780

ctttctggtg gtatgcgtgg tatccgtggt gctgacttcc aatgcttcca acaagctcgt 840

gctgttggtc ttgctggtac tttccgtgct ggtggtggtg gtcgtggtga o 891

< 210 > SEQ ID NO 17

< 211 > LENGTH : 293
< 212 > TYPE : PRT
< 213 > ORGANISM : Artificial Sequence
< 220 > FEATURE :
< 223 > OTHER INFORMATION : synthesized
< 400 > SEQUENCE : 17
Glu Arg Lys Cys Cys Val Glu Cys Pro Pro Cys Pro Ala Pro Pro Val
1 5 10 15

Ala Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu
20 25 30

Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser
35 40 45

His Glu Asp Pro Glu Val Gin Phe Asn Trp Tyr Val Asp Gly Val Glu
50 55 60

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Phe Asn Ser Thr
65 70 75 80

Phe Arg Val Val Ser Val Leu Thr Val Val His Gin Asp Trp Leu Asn
85 90 95

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ala Pro
100 105 110

Ile Glu Lys Thr Ile Ser Lys Thr Lys Gly Gin Pro Arg Glu Pro Gin
115 120 125

Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val
130 135 140

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ser Val
145 150 155 160

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro
165 170 175

Pro Met Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr
180 185 190

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val
195 200 205

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu
210 215 220

Ser Pro Gly Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly
225 230 235 240

Gly Gly Ser Phe Gin Pro Val Leu His Leu Val Ala Leu Asn Ser Pro
245 250 255

Leu Ser Gly Gly Met Arg Gly Ile Arg Gly Ala Asp Phe Gin Cys Phe
260 265 270

Gin Gin Ala Arg Ala Val Gly Leu Ala Gly Thr Phe Arg Ala Gly Gly
275 280 285

Gly Gly Arg Gly Asp

290
 US 11,407,811 B2
55 56
- continued

< 210 > SEQ ID NO 18

< 211 > LENGTH : 879
< 212 > TYPE : DNA
< 213 > ORGANISM : Artificial Sequence
< 220 > FEATURE :
< 223 > OTHER INFORMATION : synthesized
< 400 > SEQUENCE : 18
gagcgcaaat gttgtgtcga gtgcccaccg tgcccagcac cacctgtggc aggaccgtca 60

gtcttcctct tccccccaaa acccaaggac accctcatga tctcccggac ccctgaggto 120

acgtgcgtgg tggtggacgt gagccacgaa gaccccgagg tccagttcaa ctggtacgtg 180

gacggcgtgg aggtgcataa tgccaagaca aagccacggg aggagcagtt caacagcacg 240

ttccgtgtgg tcagcgtcct caccgtcgtg caccaggact ggctgaacgg caaggagtac 300

aagtgcaagg tctccaacaa aggcctccca gcccccatcg agaaaaccat ctccaaaacc 360

aaagggcagc cccgagaacc acaggtgtac accctgcccc catcccggga ggagatgacc 420

aagaaccagg tcagcctgac ctgcctggtc aaaggettct accccagcga catctccgtg 480

gagtgggaga gcaatgggca gccggagaac aactacaaga ccacgcctcc catgctggac 540

tccgacggct ccttcttcct ctacagcaag ctcaccgtgg acaagagcag gtggcagcag 600

gggaacgtct tctcatgctc cgtgatgcat gaggctctgc acaaccacta cacgcagaag 660

agcctctccc tgtctccggg taaaggcggc ggaggatctg gcggaggcgg ttctggtggt 720

ggtggctctt tccaacctgt tcttcacctt gttgctctta actctcctct ttctggtggt 780

atgcgtggta tccgtggtgc tgacttccaa tgcttccaac aagctcgtgc tgttggtctt 840

gctggtactt tccgtgctgg tggtggtggt cgtggtgac 879

< 210 > SEQ ID NO 19

< 211 > LENGTH : 294
< 212 > TYPE : PRT
< 213 > ORGANISM : Artificial Sequence
< 220 > FEATURE :
< 223 > OTHER INFORMATION : synthesized
< 400 > SEQUENCE : 19
Ala Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu
1 5 10 15

Ala Ala Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp
20 25 30

Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp
35 40 45

Val Ser Gin Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly
50 55 60

Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Phe Asn
65 70 75 80

Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp
85 90 95

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro
100 105 110

Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu
115 120 125

Pro Gin Val Tyr Thr Leu Pro Pro Ser Gin Glu Glu Met Thr Lys Asn
130 135 140

Gin Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile
145 150 155 160
 US 11,407,811 B2
57 58
- continued

Ala Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr
165 170 175

Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg
180 185 190

Leu Thr Val Asp Lys Ser Arg Trp Gin Glu Gly Asn Val Phe Ser Cys
195 200 205

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu
210 215 220
Ser Leu Ser Leu Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly
225 230 235 240

Gly Gly Gly Ser Phe Gin Pro Val Leu His Leu Val Ala Leu Asn Ser
245 250 255

Pro Leu Ser Gly Gly Met Arg Gly Ile Arg Gly Ala Asp Phe Gin Cys
260 265 270

Phe Gln Gln Ala Arg Ala Val Gly Leu Ala Gly Thr Phe Arg Ala Gly
275 280 285

Gly Gly Gly Arg Gly Asp

290

< 210 > SEQ ID NO 20

< 211 > LENGTH : 882
< 212 > TYPE : DNA
< 213 > ORGANISM : Artificial Sequence
< 220 > FEATURE :
< 223 > OTHER INFORMATION : synthesized
< 400 > SEQUENCE : 20
gccgagtcta agtacggccc tccttgccca ccttgccctg ctccagaagc tgctggcggc 60

ccttccgtgt tcctgttccc cccaaagccc aaggacaccc tgatgatctc ccggaccccc 120

gaagtgacct gcgtggtggt ggatgtgtcccaggaagatc ccgaggtgca gttcaattgg 180

tacgtggacg gcgtggaagt gcacaacgcc aagaccaagc ccagagagga acagttcaac 240

tccacctacc gggtggtgtc cgtgctgacc gtgctgcacc aggattggct gaacggcaaa 300

gagtacaagt gcaaggtgtc caacaagggc ctgccctcca gcatcgaaaa gaccatctcc 360

aaggccaagg gccagccccg ggaaccccag gtgtacacac tgcctccaag ccaggaagag 420

atgaccaaga accaggtgtc cctgacctgt ctcgtgaagg gottctaccc ctccgatatc 480

gccgtggaat gggagtccaa cggccagcct gagaacaact acaagaccac cccccctgtg 540

ctggactccg acggctcctt cttcctgtac tcccgcctga ccgtggacaa gtccagatgg 600

caggaaggca acgtgttctc ctgctccgtg atgcacgagg ccctgcacaa ccactacacc 660

cagaagtccc tgtccctgtc tctgggcggc ggcggaggat ctggcggagg cggttctggt 720

ggtggtggct ctttccaacc tgttcttcac cttgttgctc ttaactctcc tctttctggt 780

ggtatgcgtg gtatccgtgg tgctgacttc caatgcttcc aacaagctcg tgctgttggt 840

cttgctggta ctttccgtgc tggtggtggt ggtcgtggtg ac 882

< 210 > SEQ ID NO 21

< 211 > LENGTH : 295
< 212 > TYPE : PRT
< 213 > ORGANISM : Artificial Sequence
< 220 > FEATURE :
< 223 > OTHER INFORMATION : synthesized
< 400 > SEQUENCE : 21
Arg Asn Thr Gly Arg Gly Gly Glu Glu Lys Lys Lys Glu Lys Glu Lys
 US 11,407,811 B2
59 60
- continued
1 5 10 15

Glu Glu Gin Glu Glu Arg Glu Thr Lys Thr Pro Glu Cys Pro Ser His
20 25 30

Thr Gln Pro Leu Gly Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr
35 40 45

Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val
50 55 60

Ser Gin Glu Asp Pro Glu Val Gin Phe Asn Trp Tyr Val Asp Gly Val
65 70 75 80

Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Phe Asn Ser
85 90 95

Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu
100 105 110

Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser
115 120 125

Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro
130 135 140

Gin Val Tyr Thr Leu Pro Pro Ser Gin Glu Glu Met Thr Lys Asn Gin
145 150 155 160

Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala
165 170 175

Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr
180 185 190

Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu
195 200 205

Thr Val Asp Lys Ser Arg Trp Gin Glu Gly Asn Val Phe Ser Cys Ser
210 215 220

Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser
225 230 235 240

Leu Ser Leu Gly Lys Phe Gin Pro Val Leu His Leu Val Ala Leu Asn
245 250 255

Ser Pro Leu Ser Gly Gly Met Arg Gly Ile Arg Gly Ala Asp Phe Gin
260 265 270

Cys Phe Gln Gln la Arg Ala Val Gly Leu Ala Gly Th : Phe Arg Ala
275 280 285

Gly Gly Gly Gly Arg Gly Asp

290 295

< 210 > SEQ ID NO 22

< 211 > LENGTH : 885
< 212 > TYPE : DNA
< 213 > ORGANISM : Artificial Sequence
< 220 > FEATURE :
< 223 > OTHER INFORMATION : synthesized
< 400 > SEQUENCE : 22
agaaatactg gcagaggcgg cgaggaaaag aagaaagaga aagaaaaaga ggaacaggaa 60

gagagagaga ctaagacccc cgagtgcccc tcccacacac agcctctggg cgtgttcctg 120

tttcccccaa agcccaagga caccctgatg atctcccgga cccccgaagt gacctgcgtg 180

gtggtggatg tgtcccagga agatcccgag gtgcagttca attggtacgt ggacggcgtg 240

gaagtgcaca acgccaagac caagccccgc gaggaacagt tcaactccac ctaccgggtg 300

gtgtccgtgc tgaccgtgct gcaccaggat tggotgaacg gcaaagagta caagtgcaag 360

gtgtccaaca agggcctgcc ctccagcatc gaaaagacca tctccaaggc caagggccag 420

 US 11,407,811 B2
61 62
- continued

ccccgggaac cccaggtgta cacactgcct ccaagccagg aagaaatgac caagaaccag 480

gtgtccctga cctgtctcgt gaagggcttc tacccctccg atatcgccgt ggaatgggag 540

tccaacggcc agcctgagaa caactacaag accacccccc ctgtgctgga ctccgacggc 600

tccttcttcc tgtactcccg cctgaccgtg gacaagtcca gatggcagga aggcaacgtg 660

ttctcctgct ccgtgatgca cgaggccctg cacaaccact acacccagaa gtccctgtcc 720

ctgtctctgg gcaagttcca acctgttctt caccttgttg ctcttaactc tcctctttct 780

ggtggtatgc gtggtatccg tggtgctgac ttccaatgct tccaacaagc tcgtgctgtt 840

ggtcttgctg gtactttccg tgctggtggt ggtggtcgtg gtgac 885

< 210 > SEQ ID NO 23

< 211 > LENGTH : 345
< 212 > TYPE : PRT
< 213 > ORGANISM : Artificial Sequence
< 220 > FEATURE :
< 223 > OTHER INFORMATION : synthesized
< 400 > SEQUENCE : 23
Arg Gly Asp Gly Gly Gly Gly Phe Gin Pro Val Leu His Leu Val Ala
1 5 10 15

Leu Asn Ser Pro Leu Ser Gly Gly Met Arg Gly Ile Arg Gly Ala Asp
20 25 30

Phe Gin Cys Phe Gin Gin Ala Arg Ala Val Gly Leu Ala Gly Thr Phe
35 40 45

Arg Ala Phe Gln Pro Val Leu His Leu Val Ala Leu Asn Ser Pro Leu
50 55 60

Ser Gly Gly Met Arg Gly Ile Arg Gly Ala Asp Phe Gin Cys Phe Gln
65 70 75 80

Gin Ala Arg Ala Val Gly Leu Ala Gly Thr Phe Arg Ala Gly Gly Gly
85 90 95

Gly Arg Gly Asp Arg Asn Thr Gly Arg Gly Gly Glu Glu Lys Lys Lys
100 105 110

Glu Lys Glu Lys Glu Glu Gin Glu Glu Arg Glu Thr Lys Thr Pro Glu
115 120 125

Cys Pro Ser His Thr Gin Pro Leu Gly Val Phe Leu Phe Pro Pro Lys
130 135 140

Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val
145 150 155 160
Val Val Asp Val Ser Gin Glu Asp Pro Glu Val Gin Phe Asn Trp Tyr
165 170 175

Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu
180 185 190

Gin Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His
195 200 205

Gin Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys
210 215 220

Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin
225 230 235 240

Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Gin Glu Glu Met
245 250 255

Thr Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro
260 265 270

Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn
 US 11,407,811 B2
63 64
- continued
275 280 285

Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu
290 295 300

Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gin Glu Gly Asn Val
305 310 315 320

Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln
325 330 335

Lys Ser Leu Ser Leu Ser Leu Gly Lys

340 345

< 210 > SEQ ID NO 24

< 211 > LENGTH : 1035
< 212 > TYPE : DNA
< 213 > ORGANISM : Artificial Sequence
< 220 > FEATURE :
< 223 > OTHER INFORMATION : synthesized
< 400 > SEQUENCE : 24
cgtggtgacg gtggtggtgg tttccaacct gttcttcacc ttgttgctct taactctcct 60

ctttctggtg gtatgcgtgg tatccgtggt gctgacttcc aatgcttcca acaagctcgt 120

gctgttggtc ttgctggtac tttccgtgct ttccaacctg ttcttcacct tgttgctctt 180

aactctcctc tttctggtgg tatgcgtggt atccgtggtg ctgacttcca atgcttccaa 240

caagctcgtg ctgttggtct tgctggtact ttccgtgctg gtggtggtgg tcgtggtgac 300

agaaatactg gcagaggcgg cgaggaaaag aagaaagaga aagaaaaaga ggaacaggaa 360

gagagagaga ctaagacccc cgagtgcccc tcccacacac agcctctggg cgtgttcctg 420

tttcccccaa agcccaagga caccctgatg atctcccgga cccccgaagt gacctgcgtg 480

gtggtggatg tgtcccagga agatcccgag gtgcagttca attggtacgt ggacggcgtg 540

gaagtgcaca acgccaagac caagccccgc gaggaacagt tcaactccac ctaccgggtg 600

gtgtccgtgc tgaccgtgct gcaccaggat tggctgaacg gcaaagagta caagtgcaag 660

gtgtccaaca agggcctgcc ctccagcatc gaaaagacca tctccaaggc caagggccag 720

ccccgggaac cccaggtgta cacactgcct ccaagccagg aagaaatgac caagaaccag 780

gtgtccctga cctgtctcgt gaagggcttc tacccctccg atatcgccgt ggaatgggag 840

tccaacggcc agcctgagaa caactacaag accacccccc ctgtgctgga ctccgacggc 900

tccttcttcc tgtactcccg cctgaccgtg gacaagtcca gatggcagga aggcaacgtg 960

ttctcctgct ccgtgatgca cgaggccctg cacaaccact acacccagaa gtccctgtcc 1020

ctgtctctgg gcaag 1035

< 210 > SEQ ID NO 25

< 211 > LENGTH : 15
< 212 > TYPE : PRT
< 213 > ORGANISM : Artificial Sequence
< 220 > FEATURE :
< 223 > OTHER INFORMATION : Synthesized
< 400 > SEQUENCE : 25
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
1 5 10 15
 US 11,407,811 B2
65 66
What is claimed is : 6. The method use according to claim 3 , wherein the
1. A fusion protein comprising an antiangiogenesis poly- ophthalmic diseases include iris neovascular eye disease ,
peptide sequence and an Fc sequence of an antibody IgGi , choroidal neovascular eye disease , retinal neovascular eye
wherein the amino acid sequence of the fusion protein disease , or corneal neovascular eye disease .
comprises SEQ ID NO : 15 . 5
7. The method according to claim 6 , wherein the iris
2. A gene encoding the fusion protein according to claim neovascular eye disease includes iris neovascular eye dis
1 , wherein the nucleic acid sequences encoding SEQ ID NO : eases caused by neovascular glaucoma , diabetic retinopathy
15 comprises SEQ ID NO : 16 .
3. A method of preparation of aa medicament for treating or eye
central retinal vein occlusion ; the choroidal neovascular
disease includes age - related macular degeneration , cen
tumors, autoimmune diseases, inflammations and ophthal- 10 tral exudative chorioretinopathy, ocular histoplasmosis syn
mic diseases using the composition of claim 1 . drome or serpiginous choroidopathy; the retinal neovascular
4. The method according to claim 3 , wherein the tumors
include gastric cancer , lung cancer, liver cancer, breast eye disease includes the retinal neovascular eye diseases
cancer, colon cancer, glioma , melanoma , and cervical can associated with diabetes, tumors, retinal detachment, central
cer, as well as primary or secondary cancer, melanoma and 15 retinal vein occlusion , retinal periphlebitis , systemic lupus
sarcoma originating from the head and neck , brain , thyroid , erythematosus, Eales diseases or Coat diseases ; the corneal
esophagus, pancreas, lung, liver, stomach, breast, kidney, neovascular eye disease includes the corneal neovascular
gallbladder, colon or rectum , ovary , cervix , uterus, prostate , eye diseases caused by cornea contacting an lens , as well as
the corneal neovascular eye diseases caused by alkali and
bladder and testicle in human .
5. The method according to claim 3 , wherein the inflam- 20 other chemical burns, corneal surgery, bacterial infection,
mations include rheumatoid arthritis, osteoarthritis, gouty chlamydial infection , viral infection or protozoal infection .
8. The method according to claim 3 , wherein a dosage
arthritis, ankylosing spondylitis, psoriatic arthritis, reactive
form of the medicament is a capsule, a tablet , a pill , an
arthritis, infectious arthritis and traumatic arthritis; and the injection
autoimmune diseases include lupus erythematosus and pso , a nasal spray or an aerosol.
riasis .