Protein Synthesis Worksheet Name ________________________

Living Environment Mr. Buckley

This activity was modified from an original posting by Kim Foglia.

DNA is the molecule that stores the genetic information in your cells. That information is coded
in the four bases of DNA: C (cytosine), G (guanine), A (adenine), and T (thymine). The DNA
directs the functions of the cell on a daily basis and will also be used to pass on the genetic
information to the next generation. Because of its critical role in all the functions of the cell,
DNA is kept protected in the nucleus of your cells.

DNA is organized in sections called genes. Genes code for proteins, and it is proteins that do
all the work in the cell. They function as structural proteins — serving as the building blocks of
cells and bodies. And they function as enzymes — directing all the chemical reactions in living
organisms. Proteins also function as antibodies which are produced by certain white blood cells
to destroy antigens.

Proteins are made in the cytoplasm by ribosomes. So the information from DNA must be
transmitted from the nucleus to the cytoplasm. Since DNA is too large to move from through the
nuclear membrane, it must undergo the process of transcription. Transcription uses a DNA
strand as a template to produce a strand of RNA. Each gene on the DNA is read and codes
directly for a messenger RNA (mRNA) molecules. The mRNA is made by matching its
complementary bases — C, G, A, and U (uracil) — to the DNA bases. It is important to note
that the base T (thymine) is replaced by the base U (uracil) in RNA. The mRNA molecule
then leaves the nucleus and carries the code for making the protein from the DNA gene to the
ribosome in the cytoplasm.

The ribosome reads the sequence of

bases on the mRNA in sets of three —
the triplet codons. Another type of RNA
— transfer RNA (tRNA) — brings the
protein building blocks — amino
acids — to the ribosome as they are
needed. The ribosome bonds the amino
acids together to build the protein coded
for by the gene back in the nucleus. This
process of assembling the protein on the
ribosomes is called translation. This
analogy makes sense, because we have
now changed from the language of
nitrogenous bases to that of amino acids
in making the protein.

Image source:
http://pmj.bmj.com/content/83/986/731/F1.large.jpg
1
Page
Assessment

1. List three functions of proteins in living things.

__________________________________________________________________________

__________________________________________________________________________

__________________________________________________________________________

__________________________________________________________________________

Use the universal codon chart on the next page, the introductory reading, as well as your
knowledge of biology to complete the following questions.

2
Page
Use the DNA sequence below to determine the associated mRNA sequence and protein
fragment it codes for.
1 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

TACAGCCACTGAGCTCCCGAGCTCCGAACT
2. Neatly record the sequence of the mRNA transcribed from this DNA strand.
1 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

3. Divide the mRNA sequence into its triplet codons and rewrite them in order below as
3-base groups (triplet codon).

4. Record the amino acid sequence that this mRNA coded for. You can use the 3 letter
amino acid abbreviation found in the universal genetic code chart.

MUTATIONS

Sometimes when DNA is copied errors occur. We call these mutations. Sometimes mutations
cause only minor changes to a gene and therefore make only minor changes in the protein
produced from that gene. These types of mutations may cause only minor effects to the way an
organism looks or functions — the phenotype of the organism. But sometimes mutations can
cause great changes to the gene and therefore greatly alter the protein that is made from that
gene. This is because a mutation can produce a change in the amino acid sequence making up a
protein. Different amino acids have different charges. The way these charges interact
influence the way the protein folds, producing its shape. Remember from our study of the lock
and key concept that the shape of a protein determines its function by the way it fits with other
molecules. These changes may have great effects on the organism, since the protein will not be
able to perform its normal function. This may lead to the inheritance of a genetic disease.

One mutation is called a point mutation where only one base in the gene is copied incorrectly
during DNA replication.
3
Page
Use the DNA sequence below assess the change a point mutation could produce on the
associated mRNA sequence and protein fragment it codes for.

5. Below, rewrite the original DNA sequence (from above), but simulating a point mutation
at the 13th base. It was accidentally changed during DNA replication from a G to an A.

6. Divide the mRNA sequence into its triplet codons and rewrite them in order below as
3-base groups (triplet codon) in the first row below. Then translate your mRNA
triplet codons from this row into the sequence of amino acids composing the protein in
the bottom row. You can use the 3 letter amino acid abbreviation found in the
universal genetic code chart.

7. Did this change in the DNA sequence cause any significant change to the amino
acid sequence and therefore the protein produced? Support your answer.

______________________________________________________________________________

______________________________________________________________________________
Now we will simulate the effect of a point mutation having a less dramatic effect. Use the DNA
sequence below assess the change a point mutation could produce on the associated mRNA
sequence and protein fragment it codes for.

8. Below, rewrite the original DNA sequence (from above), but let’s simulate a point
mutation at the 9th base. It was accidentally changed during replication from a C to a T.

9. Divide the mRNA sequence into its triplet codons and rewrite them in order below as
3-base groups (triplet codon) in the first row below. Then translate your mRNA triplet
codons from this row into the sequence of amino acids composing the protein as in
the previous example.
4
Page
10. Did this change in the DNA sequence cause any significant change to the amino
acid sequence and therefore the protein produced? Support your answer.

______________________________________________________________________________

______________________________________________________________________________

11. Why do cells have to produce RNA from DNA? __________________________________

______________________________________________________________________________

12. Where does protein synthesis occur in a cell? ____________________________________

13. Define the following terms in reference to our study of genetics.

replication ___________________________________________________________________

transcription __________________________________________________________________

translation ____________________________________________________________________

14. Explain in your own words the meaning of the following quotation.
“DNA gets all the glory, but proteins do all the work!”

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

15. The translation of proteins from mRNA is often compared to the translation of a
foreign language. Explain this analogy.

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

16. Explain how a change in one nitrogenous base produces a change in the function
of a protein.

______________________________________________________________________________

______________________________________________________________________________
5

______________________________________________________________________________
Page