See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/303666414

Impact of ATM and SLC22A1 Polymorphisms on Therapeutic Response to

Metformin in Iranian Diabetic Patients

Article · March 2016

CITATIONS READS

36 176

8 authors, including:

Fazlollah Shokri Hamid Ghaedi

Shahid Beheshti University of Medical Sciences Queen's University
8 PUBLICATIONS 75 CITATIONS 77 PUBLICATIONS 972 CITATIONS

SEE PROFILE SEE PROFILE

Soudeh Ghafouri-Fard Saeid Abediankenari

Shahid Beheshti University of Medical Sciences Tehran University of Medical Sciences
838 PUBLICATIONS 11,267 CITATIONS 145 PUBLICATIONS 1,468 CITATIONS

SEE PROFILE SEE PROFILE

All content following this page was uploaded by Fazlollah Shokri on 01 May 2020.

The user has requested enhancement of the downloaded file.

IJMCM Original Article
Winter 2016, Vol 5, No 1

Impact of ATM and SLC22A1 Polymorphisms on Therapeutic

Response to Metformin in Iranian Diabetic Patients

Fazlollah Shokri1, Hamid Ghaedi1, Soudeh Ghafouri Fard1, Abolfazl Movafagh1, Saeid Abediankenari2,
Abdolkarim Mahrooz3, Zahra Kashi4, Mir Davood Omrani1

1. Department of Medical Genetics, Faculty of Medicine, Shahid Beheshti University of Medical Sciences,
Tehran, Iran.
2. Immunogenetic Research Center, Faculty of Medicine, Mazandaran University of Medical Sciences, Sari,
Iran.
3. Department of Clinical Biochemistry and Genetics, Faculty of Medicine, Mazandaran University of Medical
Sciences, Sari, Iran.
4. Diabetes Research Center, Imam Teaching Hospital, Mazandaran University of Medical Sciences, Sari, Iran.

Submmited 15 November 2015; Accepted 7 December 2015; Published 5 March 2016

Metabolic syndrome and its pathological sequel, type 2 diabetes are considered as important global health
problems. Metformin is the most common drug prescribed for patients with this disorder. Consequently,
understanding the genetic pathways involved in pharmacokinetics and pharmacodynamics of this drug can have
a considerable effect on the personalized treatment of type 2 diabetes. In this study, we evaluated the association
between rs11212617 polymorphism of ATM gene and rs628031 of SLC22A1 gene with response to treatment in
newly diagnosed type 2 diabetes patients. We genotyped rs11212617 and rs628031 polymorphism by PCR based
restriction fragment length polymorphism (RFLP) and assessed the role of this polymorphisms on response to
treatment in 140 patients who have been recently diagnosed with type 2 diabetes and were under monotherapy
with metformin for 6 months. Response to metformin was defined by HbA1c and fasting blood sugar (FBS)
values. Based on such evaluations, patients were divided into two groups: responders (n= 63) and non-
responders (n= 77). No significant association was found between these polymorphisms and response to
treatment (OR= 0.86, [95% CI 0.52–1.41], P= 0.32) for rs11212617 and (OR= 0.45, [95% CI 0.64–1.76], P=
0.45) for rs 628031. The reported gene variants in ATM and SLC22A1 are not significantly associated with
metformin treatment response in type 2 diabetic patients in an Iranian population.

Key words: Metformin, type 2 diabetes, pharmacogenetic

M etabolic syndrome and its pathological

sequel, type 2 diabetes (T2D) are consid-
ered as global major health problems. T2D is a
silent, chronic, progressive disease in which both


Corresponding author: Department of Medical Genetics, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran,
Iran. E-mail: davood_omrani@sbmu.ac.ir
 Shokri F et al.

genetic and environmental factors play roles (1, 2). from metformin since the hypoglycemic response is
The prevalence of T2D in Asia has increased not seen in a proportion of patients. Furthermore,
considerably. International Diabetes Federation gastrointestinal side effects make this drug
data suggest that about 30-60% increase will occur intolerable in a subset of patients (2). Although
in the prevalence of T2D in many Asian-Pacific variation in response to a certain drug can be
countries by the year 2025 (3). In addition, T2D has attributed to drug–drug interactions, age, organ
affected younger population in Asia compared with function, simultaneous therapy, the role of genetic
the Western countries (4). The pathophysiology of factors in variability in drug effects is significant
T2D is complex. Both β- cell dysfunction and (13). Metformin has been shown to be actively
insulin resistance contribute in this disorder with absorbed from the gut and eliminated unchanged in
abdominal obesity being a major risk factor for the the urine (2). It is transported into the hepatic cells
latter (3, 5). Hyperglycemia, insulin resistance, and by organic cation transporter1 (OCT)1 (encoded by
hyperinsulinemia have been shown to contribute to SLC22A1) (14, 15), and into the renal tubules by
increased risk for many malignancies in diabetic OCT2 (encoded by SLC22A2) (2, 16). OCT1 has
patients (6, 7). Accordingly, lifestyle interventions been shown to play a significant role in the efficacy
and pharmacotherapy are required to achieve and of metformin (4). Population studies have shown a
maintain optimal glucose control and prevent high level of polymorphisms for OCT1 in different
disease related complications (1). ethnicities (2). Functional polymorphisms in the
Metformin (1, 1- dimethylbiguanide) is the corresponding gene such as rs628031 (Met408Val)
first- choice and the most widely used drug for have been shown to affect its liver uptake, and
treatment of T2D because of its effective, consequently influence its efficacy (7, 17). In
reasonable price and safety (8, 9). Its hypoglycemic addition, ATM (ataxia telangiectasia mutated) is a
mechanisms include reduction of hepatic glucose gene whose role in DNA repair and cell cycle
output, partly via reduced gluconeogenesis, control is evident. It has also been shown to play a
decrease in insulin resistance, especially in liver significant role in the modulation of metformin
and skeletal tissue, up-regulation of glucose uptake effects, and variations in this gene change the
in adipose tissue, and suppression of the intestinal response to this drug (8, 18, 19).
glucose absorption (3, 6, 10). It also reduces plasma Consequently, in this study we aimed at
lipid (10). This drug has been used in the treatment analysis the association between rs11212617
of nonalcoholic fatty liver disease, polycystic polymorphism of ATM and rs628031 of SLC22A1
ovarian syndrome (PCOS), premature puberty as genes and glycemic response to metformin in an
well as prevention of cancer (2-4, 6, 11). It has been Iranian population of diabetic patients.
shown to influence classical cardiovascular risk
factors including LDL-cholesterol, anthropometric Materials and methods
indices and blood pressures as well as atherogenic Patients
dyslipidaemia, inflammation and vascular function. This study included 140 patients (121 women
Furthermore, it improves haemostasis via reduction and 19 men)with newly diagnosed T2D according
of factor VII and Factor XIII levels (3) to WHO (20). The mean age of the patients was
.Additionally, recent studies have indicated an 53.06 (±18) years. Clinical characteristics of
antioxidant effect for metformin (12). patients, including weight, height, blood pressure,
Consequently, this drug is an attractive modality for and BMI, are presented in Table 1. All patients
treatment of T2D. However, not all patients benefit received metformin (1000mg/day) for a 6 month

Int J Mol Cell Med Winter 2016; Vol 5 No 1 2

Impact of ATM and SLC22A1 Genetic Variants on Metformin Therapy

period. None of the patients were receiving insulin each primer. The designed primers used for
therapy or oral anti-diabetic (ODA) medication SLC22A1- rs628031 polymorphism were F5'-
prior to their diabetes diagnosis. Exclusion criteria CTAAACCCAGTGATTCATGCTCTTT- 3' and
for the study were type 1 diabetes, chronic hepatic R5'_ TTTGTTCTCATTCCAGAGGCTTATC -3',
disease, renal failure, autoimmune diseases, and for ATM- rs11212617 polymorphism were F5’_
malignant diseases, and pregnancy. The protocol TGGGTTGCTTGTGGATAACATATAGTTGG-
study was performed in accordance with the ethical 3'and R5'- GAGAAGGCAGTAAAGTGAAGG-
standards of the institutional ethics committee and AATACAGAG- 3'.
with the Helsinki Declaration of 1975, as revised in PCR for SLC22A1- rs628031 polymorphism
2008. Informed consent was obtained from all was accomplished at 95 ⁰ C for 5 min, followed by
participants before enrollment. All patients 35 cycles of 95 ⁰ C for 30 s, 64 ⁰ C for 35 s, and 72
underwent a physical examination, and information ⁰ C for 60 s, with a final extension step of 72 ⁰ C
about medical history, demographic parameters, for 5 min. Amplification products from each sample
and medication use was obtained using a (422 bp) were cleaved by MscI (Fermentas,
questionnaire. Most patients had a family history of Lithuania) after 15 h incubation at 37 ⁰ C and
diabetes, and taking antihypertensive medication resulted in 154 and 268- bp fragments, which were
such as losartan, an ACE inhibitor, or a beta subjected to electrophoresis on a 2% agarose gel.
blocker, and most patients were receiving lipid- PCR for ATM- rs11212617 polymorphism was
lowering therapy. accomplished at 95 ⁰ C for 5 min, followed by 35
Based on the response to metformin, patients cycles of 95 ⁰ C for 30 s, 64.5 ⁰ C for 35 s, and 72
were classified into two groups: responder group ⁰ C for 60 s, with a final extension step of 72 ⁰ C
(who showed a decrease in HbA1c levels by at for 5 min. Amplification products from each sample
least1% from the baseline) and non- responder (209 bp) were cleaved by TaaI (HpyCH4III)
group. (Fermentas, Lithuania) after 15 h incubation at 65
Laboratory analyses ⁰ C and resulted in 153 and 56- bp fragments,
The HbA1c levels were assayed by boronate which were subjected to electrophoresis on a 2 %
affinity technique (Axis Shield PoC AS, Oslo, agarose gel.
Norway; accuracy, failure<5 %). Standard enzym- Statistical analyses
atic tests were used to assay values of fasting blood All statistical analyses were performed by
sugar (FBS), triglycerides (TGs), total cholesterol statistical software package for social sciences
(TC), HDL-C, ALT, and AST after an overnight (SPSS 18.0, Chicago). The clinical and laboratory
fast. The LDL-C values were calculated according data were expressed as mean± SD or percentages.
to the Friedewald method (21). To determine variable distributions, we used
Genotype determination Kolmogorov Simonov normality test. Mann–
Genomic DNA was extracted from samples Whitney U test was used to analyze differences of
containing EDTA. PCR-based restriction fragment non- parametric variables. The association between
length polymorphism (RFLP) was used to genotype categorical variables, such as genotype groups and
the mentioned variant. In brief, DNA was amplified metformin response was determined with chi-
in 25 µL of reaction mixture consisted of 1 unit of square test. The odds ratios (ORs) and 95%
Taq DNA polymerase, 400- 500 ng genomic DNA, confidence intervals (CIs) were calculated as a
200 mM of each dNTP, 1.5 mM MgCl2, 280 nM of measure of the association of SLC22A1-

3 Int J Mol Cell Med Winter 2016; Vol 5 No 1

 Shokri F et al.

rs628031and ATM- rs11212617 variants with non- responders) and 19 were men (8 were
metformin response. The chi-square goodness-of-fit responders and 11 were non- responders). Values of
test with one degree of freedom was used for the study parameters at baseline and after
testing Hardy–Weinberg equilibrium. P values ≤ metformin therapy based on responder and non-
0.05 were considered to be statistically significant. responder status are presented in Table 1.
As shown in Table 1, there was a
Results statistically significant difference between
In this monotherapy study, the subjects were responders and non-responders after metformin
split into two groups: responders (n= 63) and non- therapy with respect to systolic blood pressure
responders (n =77). The groups did not differ (SBP) and diastolic blood pressure (DBP). The
significantly in age (53.68± 9.68 years in the allele frequencies and genotypes distribution of
responder group, 52.96± 10.34 years in the non- ATM- rs11212617 and SLC22A1- rs628031
responder group, P= 0.51). Of the 140 participants, polymorphisms are shown in Table 2 and 3,
121 were women (55 were responders and 66 were respectively.

Table 1. Values of the study parameters at baseline and after metformin therapy based on responder and non-
responder status
Baseline After 25 Weeks
parameter Non-Responders Responders P-value Non-Responders Responders P-value
Age 52.96±10.34 53.68± 9.68 0.51 52.96±10.34 53.68± 9.68 0.51
SBP (mmHg) 135.02±15.03 129.49±16.12 0.13 127.82±18.34 122.38±22.46 0.04
DBP (mmHg) 90.96±79.67 79.32±10.27 0.20 79.65±10.16 76.44±10.34 0.03
Weight 79.28±15.85 76.23±13.88 0.73 78.37±15.81 74.90±14.02 0.54
Height 1.58±0.08 1.57±0.07 0.39 1.58±0.08 1.57±0.07 0.39
BMI 31.49±5.58 30.94±5.62 0.84 31.12±5.49 30.43±5.70 0.88
FBS (mg/dL) 142.10±22.77 146.72±28.54 0.68 143.22±40.33 118.91±19.33 0.00
HbA1C (%) 7.54±0.81 7.96±0.80 0.03 7.64±1.15 6.29±0.70 0.00
TG1 (mg/dL) 171.60±81.14 185.38±82.64 0.29 174.34±88.84 152.55±55.39 0.36
TC (mg/dL) 182.55±43.70 185.86±38.99 0.58 176.70±35.29 167.64±33.75 0.75
HDL (mg/dL) 48.83±15.03 46.03±15.00 0.11 48.14±13.02 49.83±16.28 0.77
LDL (mg/dL) 99.39±34.73 101±34.36 0.60 90.74±23.39 86.64±26.93 0.98
SBP: systolic blood pressure; DBP: diastolic blood pressure; BMI: body mass index; FBS: fasting blood sugar; TG1: triglyceride fraction 1; TC:
total cholesterol; HDL: high-density lipoprotein; LDL: low-density lipoprotein.

Table 2. Genotypes and alleles frequencies of ATM- rs11212617

Responder n (%) Non-Responder n (%) OR (95% CI) P

Genotype
TT 23 (36.50) 36 (46.75) 0.65a (0.33-1.29) 0.14
TG 34 (53.97) 31 (40.26) 1.74b (0.88-3.41) 0.07
GG 6 (9.53) 10 (12.91) 0.61c (0.20-1.85) 0.27
Allele
T 80 (63.49) 103 (66.88)
G 46 (36.51) 51 (33.12) 0.86d (0.52-1.41) 0.32
a
AA versus Aa+aa, bAa versus AA+aa, caa versus AA+Aa, dA versus a

Int J Mol Cell Med Winter 2016; Vol 5 No 1 4

Impact of ATM and SLC22A1 Genetic Variants on Metformin Therapy

Table 3. Genotypes and alleles frequencies of SLC22A1- rs628031

Responder n (%) Non- Responder n (%) OR (95% CI) P

Genotype
AA 29 (46.03) 37 (48.05) 0.92a (0.47-1.79) 0.47
b
AG 28 (44.44) 29 (37.66) 1.32 (0.67- 2.60) 0.26
GG 6 (9.52) 11 (14.28) 0.63c (0.22-1.81) 0.27
Allele
A 86 (68.25) 103 (66.88)
G 40 (31.75) 51 (33.12) 1.06d (0.64-1.76) 0.45
a
AA versus Aa+aa, bAa versus AA+aa, caa versus AA+Aa, dA versus a

Discussion decreased by approximately 1% compared with

In this study, we have defined the response to placebo. Data of previous studies of OAD drugs
metformin in 140 patients with T2D. Contrary to indicate that they reduce HbA1c levels by 0.5–1.5%
our hypothesis, no association was found between (1). Thus, in the present study, a reduction of 1≤ %
variants in SLC22A1 and ATM genes, and glycemic in HbA1c after 25 weeks was deemed a response to
response to metformin. metformin therapy.
There is a huge clinical variation in response In our study, the effect of metformin in the
to metformin, and this drug is usually combined treatment of diabetes or improvement of relevant
with other agents such as sulfonylureas to treat glycemic traits was not magnified among the
diabetes. Clinical trials data have indicated that carriers of the C allele at rs11212617 in the ATM
more than one third of patients receiving metformin gene. Our finding concurred with a previous report
monotherapy do not achieve acceptable control of which showed no association between this
fasting glucose levels (22). The main reason for the polymorphism and insulin sensitivity, fasting
lack of a dramatic response in the treatment of these glucose, HbA1c, or disposition index diabetes
patients may be a variation of genes involved in prevention program (DPP) (8). However, this
pharmacokinetics and pharmacodynamics of the finding does not support the previously reported
drug (2, 23, 24). association of this allele with improved metformin
It has been demonstrated that the OCTs and action on glycemic control (18). A previous study
ATM proteins play a dominant role in glycemic conducted in T2D patients in the Netherlands and
response to metformin (14, 15, 18). the UK has identified rs11212617 as the first
HbA1c level has been assessed as a marker of robustly replicated common susceptibility locus
treatment response in diabetic patients in many associated with metformin treatment response (19).
studies. In some of them, treatment success has However, the function of this gene variant is not
been defined as the ability to reach the treatment elucidated so far (25).
target of an HbA1c≤ 7 % (8, 18, 19). However, Although OCT1 encoded by SLC22A1 gene
Shikata et al. selected reduction of HbA1c values has been shown to play a significant role in the
by more than 0.5 % as a cut off point for dividing efficacy of metformin, the association of rs628031
patients into responders and non- responders (17). variant with glycemic response has not been
As reported in a systematic review, over a 3-month assessed before. So, our study is the first study in
period of metformin therapy, HbA1c values this regard which shows no significant association

5 Int J Mol Cell Med Winter 2016; Vol 5 No 1

 Shokri F et al.

between rs628031 alleles and metformin response. is not fully understood.

In the present study, the frequency of the mutant In addition, a more complete investigation of
allele of SLC22A1-rs628031(M408V) variant SLC22A1 variants may identify novel
between responders and non-responders was not polymorphisms which can affect the metformin
significantly different. The M408V variant has been response. Additional investigations would identify
associated with gastrointestinal side effects in 246 the ethnic variability in the SLC22A1 and ATM
metformin users. A significant lower average genes and the inter- individual differences in
HbA1c level in the presence of a lower average response to metformin.
dose of metformin in those cases implies a possible Conflict of interests
relationship between better response to metformin The uthors declared no conflict of interests.
and susceptibility to side effects (26). The local
increase of drug concentration in the intestinal References
tissue is proposed as a mechanism of metformin 1. Sherifali D, Nerenberg K, Pullenayegum E, et al. The effect of

intolerance. As SLC22A1 and SLC22A3 are also oral antidiabetic agents on A1C levels: a systematic review and
expressed in enterocytes, it has been suggested that meta-analysis. Diabetes care 2010;33:1859-64.
genetic variants in these genes may also affect the 2. Zhou K, Donnelly LA, Kimber CH, et al. Reduced-function

intestinal metformin uptake and consequently SLC22A1 polymorphisms encoding organic cation transporter 1
induce gastrointestinal side effects (14). and glycemic response to metformin: a GoDARTS study.
Previous studies showed that OAD drugs Diabetes 2009;58:1434-9.

effectively decrease HbA1c levels by 0.5–1.5 % 3. Chan JC, Deerochanawong C, Shera AS, et al. Role of
(1). This result demonstrates that the greater metformin in the initiation of pharmacotherapy for type 2
proportion of the decrease in HbA1c levels in all diabetes: an Asian-Pacific perspective. Diabetes research and
patients after metformin therapy was associated clinical practice 2007;75:255-66.
with responders, suggesting that metformin 4. Mahrooz A, Parsanasab H, Hashemi-Soteh MB, et al. The role
response can be important in evaluating HbA1c as a of clinical response to metformin in patients newly diagnosed
key indicator in monitoring the long- term glycemic with type 2 diabetes: a monotherapy study. Clinical and
control. experimental medicine 2015;15:159-65.
The limitation of our present study was that 5. Valizadeh M, Alavi N, Mazloomzadeh S, et al. The risk
we did not assay plasma metformin concentrations factors and incidence of type 2 diabetes mellitus and metabolic
to examine the link between the metformin levels syndrome in women with previous gestational diabetes.
and the allelic and genotypic distribution of the International journal of endocrinology and metabolism

studied variant. 2015;13:e21696.

Inconsistent results in the mentioned studies 6. Aljada A, Mousa SA. Metformin and neoplasia: implications
could be due to multiple reasons including the and indications. Pharmacology & therapeutics 2012;133:108-15.

different definitions of metformin responses in 7. Emami Riedmaier A, Fisel P, Nies AT, et al. Metformin and
different studies, the different efficacies for cancer: from the old medicine cabinet to pharmacological pitfalls
metformin at different HbA1c baselines, and more and prospects. Trends in pharmacological sciences 2013;34:126-

importantly variations in different populations. 35.

In summary, future large- scale studies are 8. Florez JC, Jablonski KA, Taylor A, et al. The C allele of ATM
needed for the identification of novel loci affecting rs11212617 does not associate with metformin response in the

treatment response especially considering the fact Diabetes Prevention Program. Diabetes care 2012;35:1864-7.
that the biology of metformin working mechanism 9. Nasri H, Baradaran A, Ardalan MR, et al. Bright

Int J Mol Cell Med Winter 2016; Vol 5 No 1 6

 Impact of ATM and SLC22A1 Genetic Variants on Metformin Therapy

renoprotective properties of metformin: beyond blood glucose 19. van Leeuwen N, Nijpels G, Becker ML, et al. A gene variant
regulatory effects. Iranian journal of kidney diseases near ATM is significantly associated with metformin treatment
2013;7:423-8. response in type 2 diabetes: a replication and meta-analysis of

10. Ota S, Horigome K, Ishii T, et al. Metformin suppresses five cohorts. Diabetologia 2012;55:1971-7.
glucose-6-phosphatase expression by a complex I inhibition and 20. Bennett PH. Impact of the new WHO classification and
AMPK activation-independent mechanism. Biochemical and diagnostic criteria. Diabetes, obesity & metabolism 1999;1 Suppl

biophysical research communications 2009;388:311-6. 2:S1-6.

11. Salpeter SR, Buckley NS, Kahn JA, et al. Meta-analysis: 21. Friedewald WT, Levy RI, Fredrickson DS. Estimation of the
metformin treatment in persons at risk for diabetes mellitus. The concentration of low-density lipoprotein cholesterol in plasma,

American journal of medicine 2008;121:149-57 e2. without use of the preparative ultracentrifuge. Clinical chemistry
12. Nasri H, Rafieian-Kopaei M. Metformin and diabetic kidney 1972;18:499-502.
disease: a mini-review on recent findings. Iranian journal of 22. Shu Y, Sheardown SA, Brown C, et al. Effect of genetic
pediatrics 2014;24:565-8. variation in the organic cation transporter 1 (OCT1) on
13. Kerb R. Implications of genetic polymorphisms in drug metformin action. The Journal of clinical investigation
transporters for pharmacotherapy. Cancer letters 2006;234:4-33. 2007;117:1422-31.
14. Semiz S, Dujic T, Causevic A. Pharmacogenetics and 23. Lozano E, Herraez E, Briz O, et al. Role of the plasma
personalized treatment of type 2 diabetes. Biochemia medica membrane transporter of organic cations OCT1 and its genetic
2013;23:154-71. variants in modern liver pharmacology. BioMed research

15. Viollet B, Guigas B, Sanz Garcia N, et al. Cellular and international 2013;2013:692071.
molecular mechanisms of metformin: an overview. Clinical 24. Sissung TM, Troutman SM, Campbell TJ, et al. Transporter
science 2012;122:253-70. pharmacogenetics: transporter polymorphisms affect normal
16. Kimura N, Masuda S, Tanihara Y, et al. Metformin is a physiology, diseases, and pharmacotherapy. Discovery medicine
superior substrate for renal organic cation transporter OCT2 2012;13:19-34.
rather than hepatic OCT1. Drug metabolism and 25. Becker ML, Pearson ER, Tkac I. Pharmacogenetics of oral
pharmacokinetics 2005;20:379-86. antidiabetic drugs. International journal of endocrinology
17. Shikata E, Yamamoto R, Takane H, et al. Human organic 2013;2013:686315.
cation transporter (OCT1 and OCT2) gene polymorphisms and 26. Tarasova L, Kalnina I, Geldnere K, et al. Association of

therapeutic effects of metformin. Journal of human genetics genetic variation in the organic cation transporters OCT1, OCT2
2007;52:117-22. and multidrug and toxin extrusion 1 transporter protein genes
18. GoDarts, Group UDPS, Wellcome Trust Case Control C, et with the gastrointestinal side effects and lower BMI in

al. Common variants near ATM are associated with glycemic metformin-treated type 2 diabetes patients. Pharmacogenetics
response to metformin in type 2 diabetes. Nature genetics and genomics 2012;22:659-66.
2011;43:117-20.

7 Int J Mol Cell Med Winter 2016; Vol 5 No 1

View publication stats