Tropical and Subtropical Agroecosystems, 16 (2013) :143 - 153

ISOLATION AND MOLECULAR CHARACTERIZATION OF Leptospira

borgpetersenii SEROVAR Ballum

[AISLAMIENTO Y CARACTERIZACIÓN MOLECULAR DE Leptospira

borgpetersenii SEROVARIEDAD Ballum]

Carlos Alfredo Carmona Gasca1, Albert I Ko2, Niyaz Ahmed3,

Alejandro De la Peña-Moctezuma1
1
Grupo de Investigación en Leptospira y Leptospirosis, Centro de Enseñanza
Investigación y Extensión en Producción Animal en Altiplano, Facultad de
Medicina Veterinaria y Zootecnia, Universidad Nacional Autónoma de México;
2
Weill Cornell Medical College and Oswaldo Cruz Foundation / Brazilian
Ministry of Health, Salvador, Brazil;
3
Pathogen Biology Laboratory School of Life Sciences, University of Hyderabad,
Room No. LS-296, School of Life Sciences, Central University P.O. Gachibowli,
Hyderabad 500046, India
Email: delapema@unam.mx

SUMMARY RESUMEN

Rodents are the main reservoirs of pathogenic Los roedores son el principal reservorio de leptospiras
leptospires, spreading the organism to the patógenas y por lo tanto diseminan al organismo en el
environment and so the major risk factor for both, ambiente, constituyendo un importante factor de
animals and humans to acquire leptospirosis. To riesgo para adquirir leptospirosis tanto para animales
assess such a role, 50 mice (Mus musculus) were como para el hombre. Para evaluar tal papel, 50
caught in a dairy farm in the municipality of ratones fueron capturados en una unidad de
Teoloyucan, State of Mexico in central Mexico. Anti- producción lechera en el municipio de Teoloyucan,
Leptospira antibody titers (≥1:20), were obtained in Estado de México. Según el análisis morfométrico,
46 % (23) of the animals by the microscopic todos los roedores fueron identificados como Mus
agglutination test (MAT), where the most common musculus. Los títulos de anticuerpos séricos anti-
serovars detected were: Ballum 38 % (19), Canicola Leptospira (≥1:20), se obtuvieron en el 46 % (23) de
10 % (5) and Australis 2 % (1). Three Leptospira los ratones por la prueba de aglutinación
isolates (6 %) were obtained by culture of mice microscópica (AM), donde los sueros reaccionaron
kidneys macerates. The cultures were identified as L. con las serovariedades: Ballum 38 % (19), Canicola
borgpetersenii serovar Ballum by cross-MAT, 10 % (5) y Australis 2 % (1). Tres aislados de
IS1533-based PCR assay, rrs2 (rRNA) sequencing, Leptospira (6 %) fueron obtenidos por cultivo de
restriction fragment length polymorphism (RFLP) macerados de riñones. Los cultivos fueron
and by multiple locus sequencing typing (MLST). As identificados como L. borgpetersenii serovariedad
far as we know, this is the first report on the isolation Ballum por aglutinación microscópica cruzada, PCR
of L. borgpetersenii serovar Ballum recovered from basado en amplificación de IS1533, secuenciación del
Mus musculus in Mexico. gen rrs2, polimorfismo de la longitud de los
fragmentos de restricción (RFLP) y por tipificación
Keywords: Mus musculus; mouse; leptospirosis. por secuencias de locus múltiples (MLST).

Palabras Clave: Mus musculus; ratón; leptospirosis.

INTRODUCTION wolffii (International Committee on Systematics of

Prokaryotes, 2008) and six non-pathogenic species: L.
Leptospirosis is an infectious disease caused by biflexa, L. kmetyi, L. meyeri, L. vanthielii, L.
pathogenic Leptospira serovars. Within this genus, wolbachii and L. yanagawae, (Cerqueira and
thirteen pathogenic species have been identified: L. Picardeau, 2009; Adler and de la Peña-Moctezuma,
alexanderi, L. alstonii, L. borgpetersenii, L. fainei, L. 2010). These species include over 300 serovars,
inadai, L. interrogans, L. kirschneri, L. licerasiae, L. morphologically non distinguishable. L. interrogans
noguchii, L. santarosai, L. terpstrae, L. weilii, L. includes the highest number of pathogenic serovars,

143
Carmona-Gasca et al., 2012

although other serovars from different species have 2,295 MASL). Fifty Sherman-type traps were used to
also shown to cause disease in man and domestic capture mice and were randomly distributed leaving
animals (Ko et al., 2009). 10 meters between each trap to give the same effort
unit per trap, during 12 hrs for 8 days, giving a total
Since the discovery of the disease, rodents have been of 4,800 hrs / trap. The captured rodents were
recognized as the major reservoirs of pathogenic transported alive to the laboratory where they were
leptospires eliminating large numbers of infecting identified by morphometric analysis and were
organism in the urine (Ko et al., 2009), thus euthanized by an intraperitoneal high dose of sodium
participating directly and indirectly in the penthobarbital (100-180 mg/kg), accordingly to
maintenance and transmission of leptospirosis to man Mexican regulations (NOM-062-ZOO-1999).
and other animal species, coexisting in a geographical Necropsies were practiced under aseptic conditions;
area in countries with favorable climatic conditions blood was obtained by cardiac puncture and sera
(Laras et al., 2002). Despite improvement in separated to perform the MAT. The liver and one
diagnostic techniques and control measures, kidney were inoculated in semisolid Fletcher and
leptospirosis is still a major public health problem, liquid EMJH media for culture of leptospires (Myers,
mainly in under-developed areas of developing 1985). 10-1, 10-2 and 10-3 dilutions in each media were
countries (Ko et al., 2009). done and the cultures incubated at 30 °C for up to
four months with periodical observations under dark
Routine diagnosis of the disease is done by field microscopy, until growth of leptospires was
serological methods, microscopic agglutination test observed. Isolates were purified by dilutions up to
(MAT) and ELISA however; it is of high importance 10-14, considering the higher dilution showing growth
to recover the causing organism in culture, not just as as a pure isolate of Leptospira. Finally, specific
an irrefutable proof of the disease, but also because polyclonal antiserum was prepared by weekly
the epidemiological data obtained to establish further intravenous inoculation of pure cultures of the
prevention and control measures. The identification Leptospira isolates, during one month into two rabbits
of the infecting strain provides information about the each isolate.
common serovars circulating in a given area. Isolates
identification has been achieved among other Cross-agglutination
techniques, by cross absorption agglutination (Ko et
al., 2009), restriction fragment length polymorphism, Hyperimmune sera were produced in 1.5 kg rabbits
arbitrarily primed PCR (Perolat et al., 1994), pulsed by intravenous inoculation at one week intervals of 1,
field gel electrophoresis (Herrmann et al., 1992), 2, 4 and 6 ml, recovered from the so called Dinger
fluorescent amplified fragment length polymorphism zone of the Leptospira isolates grown in Fletcher
(Vijayachari et al., 2004), analysis of the Variable medium incubated at 30 °C per 7–10 days.
Number of Tandem Repeats (VNTR) (Majed et al., Leptospires were inactivated at 56 °C for half an
2005), and the Multiple Locus Sequencing Typing hour, before being inoculated into rabbits (Myers,
(MLST) (Ahmed et al., 2006). In Mexico, previously 1985). Rabbit sera were clarified by centrifugation at
reported Leptospira isolates have been identified as L. 903 xg for 5 min and kept at -20 ºC until the MAT
interrogans by traditional serological approaches was performed. 29 Leptospira reference strains were
(Moles et al., 2002). On the other hand, MAT studies used; the strains were kindly donated by the
have detected the presence of antibodies against WHO/FAO/OIE-Collaborating Centre for Reference
several serovars, which nevertheless have not been and Research on Leptospirosis, Australia and Western
yet isolated in Mexico. We report here three Pacific Region, Brisbane, Queensland, Australia
Leptospira isolates obtained from mice captured in a (Table 1). The strains were cultured in liquid EMJH
dairy farm in central Mexico and their medium at 30 °C for 7 days and the MAT was
characterization as Leptospira borgpetersenii serovar performed as previously described (Myers, 1985). A
Ballum by cross microscopic agglutination, a gspD – titer of 1:20 was considered as the positive cutoff
gspE RFLP, the IS1533- based PCR assay, rrs2 gene point (Sotomayor-Bonilla et al., 2009).
sequence analysis and ultimately by MLST.
DNA extraction and Polymerase Chain Reaction
MATERIALS AND METHODS (PCR)

Rodents handling and bacteriological analysis Isolates obtained were grown in 100 ml of EMJH
medium and centrifuged at 10,000 xg for 30 min,
50 mice (Mus musculus), were captured from October DNA extraction was performed by the guanidine
to December 2007 in different areas of a dairy farm thiocyanate and chloroform-isoamyl alcohol method
located in the municipality of Teoloyucan, State of as described previously by Boom et al. (1990).
Mexico in central Mexico (19º 44' 11" N, 99º 9' 1" E;

144
Tropical and Subtropical Agroecosystems, 16 (2013) :143 - 153

Table 1. Reference strains used for the MAT in this study.

Specie Serogroup Serovar Strain

L. biflexa Semaranga Patoc Patoc I

L. borgpetersenii Ballum Ballum Mus-127

Ballum Castellonis Castellon-3
Sejroe Hardjo Hardjobovis
Javanica Javanica Veldrat Bat 46
Mini Mini Sari
Sejroe Sejroe Sejroe M-84
Tarassovi Tarassovi Perepelitsin

L. interrogans Australis Australis Ballico

Autumnalis Autumnalis Akiyami A
Bataviae Paidjan Paidjan
Bataviae Bataviae Van Tienen
Australis Bratislava Jez Bratislava
Canicola Canicola Hond Utrech IV
Djasiman Djasiman Djasiman
Sejroe Hardjo Hardjoprajitno
Hebdomadis Hebdomadis Hebdomadis
Ictero* Ictero* RGA
Ictero* Lai Lai
Pomona Pomona Pomona
Pyrogenes Pyrogenes Salinem
Sejroe Wolffi 3705

L. kirschneri Cynopteri Cynopteri 3522-C

Grippotyphosa Grippotyphosa Moskva V
Pomona Mozdok 5621

L. noguchii Australis Muenchen C90

Panama Panama CZ214K

L. santarosai Shermani Shermani 1342-K

L. weillii Celledoni Celledoni Celledoni

Ictero*= Icterohaemorrhagiae

To determine whether isolates were pathogenic or IS1533-based PCR assay

nonpathogenic, two PCR assays were done using the
GI:GII set of primers for pathogenic species of This assay was previously reported by Zuerner et al.
Leptospira (exception made of L. kirschneri) and the (1995) and was applied for the identification of the
B64-1:B64-2 set of primers specific for L. kirschneri isolates with slight modifications. PCR reactions were
(Gravekamp et al., 1993), and the MILL1801 and done in a 50 μl final volume, containing 25 ng DNA,
MILL1802 set of primers, specifically designed to 10 pmol of the forward EPL-2 and the EPR-2 reverse
amplify a 1,289 bp DNA fragment from the primers, 200 μmol of dNTPs (Roche®), 2 U of
saprophyte L. biflexa serovar Patoc rfb Expand Long High Fidelity DNA-polymerase
lipopolysaccharide biosynthetic locus (Picardeau et (Roche®) and 3.5 mM MgCl2. Conditions were as
al., 2008). The amplified DNA fragments were follow: one denaturation step at 94 °C / 5 min,
visualized on 1 % agarose gels stained with ethidium followed by 40 cycles of denaturation at 94 °C / 30
bromide (5 µg/ 100ml). Analysis of the DNA sec, alignment at 55 °C / 50 sec and extension at 68
amplicons obtained was done in an image analyzer °C / 6 min, increasing 10 seconds each cycle from
(Gel Logic 200, Kodak®). cycle 15 up to cycle 40 and a final extension step at

145
Carmona-Gasca et al., 2012

68 °C / 7 min. Amplified DNA fragments were molecular biology laboratory, Salvador, Brazil and
analyzed as previously described. further editing and sequence alignment was done with
the Sequencher® version 4.6 software. Sequences
RFLP of a gspD-gspE DNA amplicon analysis was done using the Basic Local Alignment
Search Tool (BLAST) on line
Two degenerate primers were designed: the forward (http://blast.ncbi.nlm.nih.gov/Blast.cgi), to search for
MILL2357 and the reverse MILL2358 primers (Table similar sequences in the databases (Altschul et al.,
2), to amplify a 1,650 bp DNA fragment expanding 1990); alleles were grouped based on the alignments
from gspD through to gspE, (Mena-Bañuelos, 2009 obtained with the BioEdit tool (Hall, 1999). The
personal com.). Amplicons were obtained from 7 phylogenic tree was constructed using the Neighbor-
serovars representative of five pathogenic Leptospira Joining method with 2,000 replicates and the Kimura
species. DNA amplification was done in 50 μl 2-parameters model in the MEGA 4.0 program
reactions, containing 25 ng DNA, 10 pmol of each (Felsenstein, 1985; Saitou and Nei, 1987; Tamura et
primer, 200 μmol dNTPs (Invitrogen®), 2 U of Taq al., 2007). The accession number for the mice isolates
DNA Polymerase (Roche®) and 3.5 mM MgCl2. PCR rrs2 sequence is: HM776722.
conditions were: an initial denaturation step at 94 °C /
5 min, followed by 40 cycles of denaturation at 94 °C Multiple Locus Sequencing Typing (MLST)
/ 50 sec, alignment at 58 °C / 50 sec, and extension at
72 °C / 110 sec and a final extension step at 72 °C / 7 MLST on Leptospira was firstly reported by Ahmed
min. PCR products were digested in a final 25 μl et al. (2006). On the other hand, the website for
reaction volume with each HindIII, EcoRV, BgIlI, Leptospira MLST (http:// leptospira.mlst.net),
ClaI and KplI restriction enzymes (Invitrogen®). operates with a different set of genes
Digestions included 1 μl BSA buffer (Invitrogen®) (Thaipadungpanit et al., 2007). Such MLST schemes
and were incubated at 37 °C for 1 h. DNA digests are based on the comparative analysis of the
were analyzed as described for PCR products. sequences of amplicons from the adk, secY, icdA,
lipL32, lipL41 and rrs2 (Ahmed et al., 2006), or the
rrs2 sequencing glmU, pntA, sucA, tpiA, mreA, pfkB and fadD genes
(Thaipadungpanit et al., 2007). In order to determine
The sequencing of the 16S rRNA gene (rrs2), of the the suitability of such MLST schemes, we compared
isolates was performed at the Fio-Cruz Institute both to characterize the mice Leptospira isolates.

Table 2. Primer sets used in the present study. Genome position was found on *Leptospira interrogans serovar Lai,
+L. biflexa serovar Patoc and πL. borgpetersenii serovar Hardjobovis. No †L. kirschneri genome is available up to
date.

Primer Sequence 5´-3´ gene Size in Genome Reference

bp position
GI CTGAATCGCTGTATAAAAGT *secY 285 772349- Gravekamp et al.
772368 (1993)
GII GGAAAACAAATGGTCGGAAG 772084-
772103
†
B64-1 ACTAACTGAGAAACTTCTAC nadD 563 ---------
B64-2 TCCTTAAGTCGAACCTATGA ---------
MILL1801 CATGAACCAAGGCATACC +Putative 1,289 2117074- Picardeau et al.,
galE-wecE-1 2117091 (2008).
MILL1802 AGAAGAAGTTTAACGGGG 2118347-
2118363
MILL2357 ACNGTNAAYGAYCARGARGC +gspD-gspE 1,707 2350290- Mena-Bañuelos
2350309 (2009) personal
MILL2358 ACCATDATNACRTCNGGRTC 2348583- communication
3348602
π
EPL-2 CTCAACTCTCCAGCACGTTT IS1533 and variable variable Zuerner et al.
EPR-2 CTCGCAAACTCTCGTCCATT IS1533-like (1995)
sequences

146
Tropical and Subtropical Agroecosystems, 16 (2013) :143 - 153

Primer sets and PCR conditions were as previously 1:B64-2 set of primers specific for L. kirschneri nor
reported, amplicons were submitted for sequencing to the MILL1801:MILL1802 specific set of primers for
Macrogen Inc., Seoul, Korea. Sequence analysis and non pathogenic leptospires, (data not shown).
editing were done with the Sequencher® version 4.6 Serological identification of the isolates was
package. The sequence type for the isolates (ST), was performed by cross-agglutination with the rabbit
obtained by comparison of their amplicons sequences specific antiserum and a panel of 23 reference strains,
with a database kindly provided by Prof. Niyaz where the homologous antiserum showed titers as
Ahmed, School of Life Sci., Hyderabad Univ. - high as 1:25,600 against the L. borgpetersenii serovar
Hyderabad, India. Similarly, the ST for Ballum Mus 127 reference strain, the same titer as
Thaipadungpanit et al. scheme (2007) was obtained that showed by the homologous mice isolates.
by submission of the sequences of the corresponding
alleles to the Leptospira MLST website curator. IS1533-based PCR assay

RESULTS We used the primers EPL-2 and EPR-2 described by

Zuerner et al. (1995), to obtain the electrophoretic
Isolates, PCR and cross-agglutination pattern of amplicons for different Leptospira serovars
identification (Table 1). Not all serovars showed DNA amplicons
with such a primer set, but only those from serovars
23 out of 50 mice (46 %) were considered as positive of L. borgpetersenii: Ballum Mus, Ballum
in the MAT at titers ≥ 1:20. Serovars detected were: Castellonis, Tarassovi Tarassovi; from L.
Ballum 38 % (19), Canicola 10 % (5) and Australis 2 interrogans: Bataviae Paidjan, Sejroe Sejroe, Sejroe
% (1). The highest antibody titers were 1:80 to Wolffi; from L. noguchii: Australis Muenchen and
serovar Ballum. Three isolates (6 %) were obtained from L. weillii: Celledoni Celledoni. These resulted in
out of the 50 mice captured. Mice 13 and 14 showed a unique electrophoretic pattern characteristic for
MAT titers 1:40 against serovar Ballum, in contrast each serovar. When comparing the three mice
mouse 28 did not react to any serovar in the MAT. isolates: CRAN13, CRAN14 and CRAN28, all
Isolates were identified as pathogenic by the showed the same pattern of amplicons that also was
amplification of a 285 bp DNA fragment with the identical to that from serovar Ballum strain Mus 127
specific set of primers GI:GII (Gravekamp et al., (Figure 1).
1993); no amplification was obtained with the B64-

Figure 1. Agarose gel electrophoresis of the IS1533-based PCR assay over diverse Leptospira serovars. Lane 1:
Ballum Castellonis, Lane 2: Ballum Mus 127, Lanes 3 through to 5: Mice isolates CRAN 13, CRAN14, CRAN28,
Lane 6: Celledoni Celledoni, Lane 7: Sejroe Sejroe, Lane 8: Tarassovi Tarassovi, Lane 9: Bataviae Paidjan, Lane 10:
Muenchen C90, Lane 11: Sejroe Wolffi, Lane 12: Molecular weight marker Invitrogen® 1kb plus. DNA sizes in bp
are marked at the right hand of the figure.

147
Carmona-Gasca et al., 2012

RFLP of the gspD-gspE DNA amplicon. three mice isolates, CRAN13, CRAN14 and CRAN28
(Figure 2).
A 1,650 bp DNA fragment expanding from gspD to
gspE was amplified with degenerate primers from rrs2 sequence analysis
seven representative strains of five Leptospira species
and the three mice isolates. EcoRV digestion of such Analysis of the rrs2 sequence from the three
an amplicon, showed one restriction site on Leptospira isolates confirmed identity with serovars
Grippotyphosa and Panama serovars, and two of L. borgpetersenii. The Megablast tool was used to
restriction sites on the five other serovars. BgIlI search for highly similar sequences, showing 99%
digestion showed one restriction site for similarity with the reported rrs2 sequence for L.
Hardjoprajitno, Canicola, Shermani and Ballum borgpetersenii serovar Ballum (GenBank accession
serovars and two restriction sites for Grippotyphosa no. FJ154591). In addition, the sequences analysis
and Panama. On the other hand, ClaI did not cut on showed the same allelic form among the three
Hardjoprajitno, Canicola, Grippotyphosa or Panama isolates; representative sequences from each
DNA, but showed one restriction site in serovars Leptospira species were obtained from GenBank and
Ballum and Castellonis. Serovar Shermani showed a were aligned with the BioEdit software package. The
dissimilar pattern of digestion with ClaI with at least evolutionary relationship based on the DNA
two restriction sites. Finally, there were no HindIII sequencing of the 16S rRNA of the three isolates and
nor KplI restriction sites on any of the amplicons. the highly similar sequences obtained from Genbank
Analysis of the restriction patterns with the suggested was illustrated by a Neighbor Joining built
enzymes showed no difference between the serovars phylogram, showing distinct clades of the Leptospira
Castellonis and Mus of serogroup Ballum and the borgpetersenii serovars (Figure 3).

Figure 2. Restriction fragment length polymorphism on the 1,650 bp DNA amplicons expanding gspD through to
gspE of seven different Leptospira serovars and the three mice isolates. Lane A: Molecular weight marker
Invitrogen® 1kb plus, Lanes 1 through to 10: EcoRV digests; Lanes 11 through to 20: ClaI digests; Lanes 21
through to 30: BgIlI digests. Lanes 1, 11 and 21: Hardjo Hardjoprajitno; Lanes 2, 12 and 22: Canicola Hound Utrecht
IV; Lanes 3, 13 and 23: Grippotyphosa Moskva V; Lanes 4, 14 and 24: Panama CZ 214K; Lanes 5, 15 and 25:
Shermani 1342 K; Lanes 6, 16 and 26: Castellonis Castellon 3; Lanes 7, 17 and 27: Ballum Mus 127; Lanes 8, 18
and 28: mice isolate CRAN13; Lanes 9, 19 and 29: mice isolate CRAN14; Lanes 10, 20 and 30: mice isolate
CRAN28. DNA fragment lengths in bp are shown at the left hand side of the figure.

148
Tropical and Subtropical Agroecosystems, 16 (2013) :143 - 153

Figure 3. Evolutionary tree derived from the analysis of the 16S rRNA sequences of 17 Leptospira strains and the
sequences of the three mice isolates obtained in this study. The phylogram was inferred using the Neighbor-Joining
method, with 2,000 replicates. There were a total of 1,469 positions in the final dataset.

MLST DISCUSSION

Isolates were ultimately characterized as serovar Leptospirosis is an emerging disease with a raise in
Ballum using the MLST scheme proposed by Ahmed case numbers around the world (Pappas et al., 2008).
et al. (2006), based on the identical sequence type The disease is considered the most widespread
(ST250), showed among the three mice isolates zoonosis worldwide with mortality rates up above
CRAN 13, 14 and 28 and the type strain Ballum Mus 20% in some outbreaks (Bharti et al., 2003; Ko et al.,
127. In contrast, amplicons were obtained only for the 2009). The aim of this study was to evaluate the role
glmU and pntA in the Thaipadungpanit et al. MLST of mice as Leptospira carriers in a dairy farm in
scheme (2007), for this reason, no ST was obtained Central Mexico. Previous reports have shown
using such a scheme. evidence of Leptospira infection in domestic animals
by isolation of L. interrogans serovar Hardjo
(Hardjoprajitno) from cattle (Moles et al., 2002), and
149
Carmona-Gasca et al., 2012

more recently the isolation of L. kirschneri serovar fragment with the GI:GII specific set of primers for
Grippotyphosa, L. santarosai serovars Tarassovi and pathogenic Leptospira strains (excluding L.
Mini also from beef cattle (Carmona-Gasca et al., kirschneri). No amplicon was obtained with the B64-
2011). L.interrogans serovar Portlandvere has been 1:B64-2 set of primers specific for L. kirschneri
isolated from a pig kidney (Cisneros et al., 2002); and strains (Gravekamp et al., 1993). In the same manner,
there are several reports on the presence of L. the 1,289 bp amplicon specific for non-pathogenic
interrogans serovars Canicola (Castillo-Sánchez et leptospires was not obtained with the
al., 2007), Portlandvere and Icterohaemorrhagiae MILL1801:MILL1802 set of primers.
(Luna et al., 2008), in dogs. Diagnosis of
leptospirosis in both, animals and humans is done The presence of IS1533 insertion elements have been
traditionally by the MAT. Antibody titers against reported in approximately 40 copies per genome in L.
leptospires such as L. borgpetersenii serovars Ballum borgpetersenii serovar Hardjobovis by Zuerner and
and Tarassovi, L.interrogans serovars Pomona and Bolin (1988). The IS1533-based PCR assay was
Bratislava and L. weilii serovar Celledoni have also designed to exploit the presence of different copy
been detected in different domestic animals, numbers of such insertion sequences in the genomes
nevertheless these serovars have not yet been isolated of some Leptospira serovars as a characterization tool
in Mexico. As far as we know, this is the first report (Zuerner et al., 1995). In agreement with that, most of
on the isolation of Leptospira borgpetersenii serovar the serovars and strains we used in the present study
Ballum from kidneys of mice (Mus musculus) in showed DNA amplicons using the IS1533-based PCR
México. assay. In addition, serovars and strains other than
those tested by Zuerner et al. (1995), such as:
Rodents mainly rats, have been identified as the most Australis Ballico, Autumnalis Akiyami A, Djasiman
important reservoirs of Leptospira (Vijayachari, Djasiman, Grippotyphosa Moskva V, Canicola Hond
2008), and as the potential source of infection for Utrecht IV, Pomona Pomona, Pyrogenes Salinem,
other animal species and the main risk factor for Javanica Veldrat Bataviae 46 and
outbreaks in human populations (Gonzalez et al., Icterohaemorrhagiae RGA, did not show any
2004; Ko et al., 2009). Mice have been previously evidence of IS1533 elements using the EPR2 and
associated as the source for serovar Ballum infection EPL2 set of primers in the PCR assays. Nevertheless,
in some cases of leptospirosis in humans; such as an the assay was discriminative enough to be used for
infection in a large laboratory colony of Swiss albino typification of the three mice isolates: CRAN13,
mice (Stoenner et al., 1958) and an accidental human CRAN14 and CRAN28; which showed the same
infection in a laboratory, where mice were the source IS1533 pattern as that of the serovar Ballum, Mus 127
of infection (Wolff et al., 1949). Important outbreaks reference strain (Figure 1). It is important to state that
caused by serovar Ballum have been identified in serovar Ballum was not tested either in the assay
Cuba, assuming that rodents were the source of the originaly reported by Zuerner et al. (1995).
infection (Gonzalez et al., 2004). In this work, a
direct relationship was detected between antibody The evolutionary relationship of the three mice
titers 1:40 in mice 13 and 14 and the isolation of isolates was determined by the sequence of the 16S
L.borgpetersenii serovar Ballum. No titers were rRNA gene and comparison with the GenBank
found in mouse 28 despite the isolation of the same databases. As shown by the phylogram in Figure 3,
serovar Ballum from its kidneys. the highest relationship of the three mice isolates was
with L. borgpetersenii serogroup Ballum serovars
In Mexico, there are many endemic mice species such Castellonis Castellon 3 and Ballum Mus 127. Like
as those of the Baiomys, Liomys, Peromyscus, ribotyping, other studies have been used to identify
Osgoodomys, Oryzomys, Reithrodontomys genera and new Leptospira isolates, such as PCR / RFLP
introduced mice species such as Mus musculus, strategies applied on different genes such as flaB
(Ceballos et al., 2005); hence their presence (Kawabata et al., 2001), rrs and rrl (Ralph et al.,
represents a potential risk factor of leptospirosis to 1993), and the primer pairs GI:GII or B64-1:B64-2
animals and humans. In a study done in the Cozumel (Brown and Levett, 1997). In this report, we further
Island, Mexico (Sotomayor-Bonilla et al., 2009), a achieved to identify the species of three mice isolates
95.7% of MAT positive reactors (≥1:20), was found using the RFLP of a 1,650 bp gspE to gspD DNA
in mice of the species Oryzomys couesi and Mus amplicon, being this suitable and a straightforward
musculus, a seroprevalence rate more the double alternative to identify the species of Leptospira
when compared with the 46% MAT positive mice we isolates. Actually, there was no previous information
observed in this work. about serovar Ballum restriction sites in this
particular gspD-E region.
We confirmed the identity of our isolates as
pathogens by the amplification of a 285 bp DNA

150
Tropical and Subtropical Agroecosystems, 16 (2013) :143 - 153

The two most commonly used MLST schemes are REFERENCES

those proposed by Ahmed et al. (2006) and
Thipadungpanit et al. (2007). We found that Ahmed Adler, B., de la Peña-Moctezuma, A. 2010.
et al. (2006) MLST scheme was discriminative Leptospira and Leptospirosis. Veterinary
enough to assign the ST number 250 to the three mice Microbiology. 140:287–296.
isolates, being those identical to that of serovar
Ballum strain Mus 127. In contrast, Thaipadungpanit Ahmed, N., Devi, S.M., Valverde, M. de L.,
et al. (2007) scheme was not discriminative enough Vijayachari, P., Machangu, R.S., Ellis, W.A.,
for MLST typification, because five out of seven Hartskeerl, R.A. 2006. Multilocus sequence
genes were not amplified. This might be the result of typing method for identification and
this scheme being intra species directed (L. genotypic classification of pathogenic
interrogans), in contrast to Ahmed et al. (2006) Leptospira species. Annals of Clinical
MLST scheme, that is suitable for other Leptospira Microbiology and Antimicrobials. 23:5-28.
species in addition to L. interrogans. In overall, the
two more discriminative methods for typification of Altschul, S.F., Gish, W., Miller, W., Myers, E.W.,
the mice isolates were the IS1533-based PCR assay Lipman, D.J. 1990. Basic local alignment
and MLST that allowed the identification down to the search tool. Journal of Molecular Biology.
serovar level. Ribotyping on the other hand, showed a 215:403–410.
99 % identity between the sequences of the Ballum
Mus 127 and Castellonis Castellon 3 reference strains Bharti, A.R., Nally, J.E., Ricaldi, J.N., Matthias,
and those of the three mice isolates, resulting in the M.A., Diaz, M.M., Lovett, M.A., Levett,
phylogram shown in Figure 3. However, the sequence P.N., Gilman, R.H., Willig, M.R., Gotuzzo,
of a smaller 462 bp DNA fragment of the same rrs2 E., Vinetz, J.M. 2003. Leptospirosis: a
gene selected for the MLST approach, showed a 100 zoonotic disease of global importance. The
% identity among Ballum Mus 127 and the three mice Lancet Infectious Diseases. 3:757–771.
Leptospira isolates.
Boom, R., Sol, C.J.A., Salimans, M.M.M., Jansen,
The isolation of L. borgpetersenii serovar Ballum C.L., Wertheim van Dillen, P.M.E., Van der
from the kidneys of three mice provides information Noordaa, J. 1990. Rapid and simple method
for future epidemiological studies on the role of mice for purification of nucleic acids. Journal of
as reservoirs of pathogenic leptospires and the Clinical Microbiology. 28:495-503.
potential implication on public health and so, the
implementation of appropriate control measures. Brown, P.D., Levett, P.N. 1997. Differentiation of
Isolation of Leptospira from clinical cases and Leptospira species and serovars by PCR-
identification is a task of high importance, this restriction endonuclease analysis, arbitrarily
because serodiagnosis of leptospirosis is done based primed PCR and low-stringency PCR.
on the serovars present in a specific geographical area Journal of Medical Microbiology. 2:173-181.
(Ko et al., 2009). So that serovar Ballum should be
included in the set of serovars used in the MAT for Carmona-Gasca, C.A., León, L.L., Castillo-Sánchez,
diagnosis in central Mexico. L.O., Ramírez-Ortega, J.M., Ko, A., Luna,
P.C., de la Peña-Moctezuma, A. 2011.
Acknowledgements Detection of Leptospira santarosai and L.
kirschneri in cattle: new isolates with
The authors are thankful to Dr. Jorge Ávila García potential impact in bovine production and
and Mr. Enrique Herrero for the opportunity to public health. Revista Veterinaria Mexico.
perform this study at the “Cantarranas” dairy farm; to 42:277-288.
Biol. Eliot Zarza for his technical guidance in
capturing rodents and to Dr. Rodrigo Medellin for Castillo-Sánchez, L.O., Roa, R.M.A., De la Peña-
lending us the Sherman-type traps. This project was Moctezuma, A. 2007. Detection of
supported by the PAPIIT IN222806, IN221409 and pathogenic Leptospira in asymptomatic
the MACROPROYECTO No. 7 grants from the dogs. Vth Meeting of the International
Universidad Nacional Autonoma de Mexico; as well Leptospirosis Society (ILS). Quito, Ecuador.
by the SEP-CONACyT 83123 grant from the Consejo September 17-20. p61.
Nacional de Ciencia y Tecnología (CONACYT). The
scholarship No. 165530 granted by CONACYT, Ceballos, G., Arroyo-Cabrales, J., Medellín, R.A.,
México, for the doctorate studies of Carlos Carmona, Domínguez-Castellanos, Y. 2005. Lista
is highly appreciated. actualizada de los mamíferos de México.

151
Carmona-Gasca et al., 2012

Revista Mexicana de Mastozoología. 9:21- polymorphism (RFLP) analysis are an

71. efficient tool for detection and identification
of Leptospira spp. Microbiology and
Cerqueira, G.M., Picardeau, M. 2009. A century of Immunology. 6:491-496.
Leptospira strain typing. Infection, Genetics
and Evolution. 9:760–768. Ko, A.I., Goarant, C., Picardeau, M. 2009.
Leptospira: the dawn of the molecular
Cisneros, P.M.A., Ramírez, N.R., Moles, C.L.P., genetics era for an emerging zoonotic
Gavaldón, R.D., Torres, B.J., Rojas S.N. pathogen. Nature Reviews Microbiology.
2002. Aislamiento de Leptospira Portland 7:736–747.
vere a partir de cerdas que abortaron en
México. Revista Cubana de Medicina Laras, K., Cao, B.V., Bounlu, K., Nguyen, T.K.,
Tropical. 54:52-80. Olson, J.G., Thongchanh, S., Tran, N.V.,
Hoang, K.L., Punjabi, N., Ha, B.K., Ung,
Felsenstein, J. 1985. Confidence limits on S.A., Insisiengmay, S., Watts, D.M.,
phylogenies: An approach using the Beecham, H.J., Corwin, A.L. 2002. The
bootstrap. Evolution. 39:783-791. importance of leptospirosis in Southeast
Asia. American Journal of Tropical
González, M., Batista, N., Machado, M., Savournin, Medicine and Hygiene. 67:278–286.
O., Saltarén, A., Sanamé, A., Ochoa, I.,
Rodríguez, Y., Naranjo, M., Valdés, Y., Luna, A.M.A., Moles, C.L.P., Gavaldón, R.D., Nava,
González, I., Sierra, G. 2004. V.C., Salazar, G.F. 2008. Leptospirosis
Caracterización de cepas de Leptospira canina y su problemática en México. Revista
Ballum aisladas de casos clínicos. Inmunidad de Salud Animal. 30:1-11.
cruzada en hámsters vacunados con vax-
SPIRAL®. Biotecnología Aplicada. 21:77- Majed, Z., Bellenger, E., Postic, D., Pourcel, C.,
81. Baranton, G., Picardeau, M. 2005.
Identification of variable-number tandem-
Gravekamp, C., Van de Kemp, H., Franzen, M., repeat loci in Leptospira interrogans sensu
Carrington, D., Schoone, G.J., Van Eys, G.J., stricto. Journal of Clinical Microbiology.
Everard, C.O., Hartskeerl, R.A., Terpstra, 43:539-545.
W.J. 1993. Detection of seven species of
pathogenic leptospires by PCR using two Moles, C.L.P., Cisneros, P.M.A., Gavaldón, R.D.,
sets of primers. Journal of General Rojas, S.N., Torres, B.J.I. 2002. Estudio
Microbiology. 139:1691–1700. serológico de leptospirosis bovina en
México. Revista Cubana de Medicina
Hall, T.A. 1999. BioEdit: a user-friendly biological Tropical. 1:24-27.
sequence alignment editor and analysis
program for Windows 95/98/NT. Nucleic Myers, D.M. 1985. Manual de métodos para el
Acids Symposium Series. 41:95-98. diagnóstico de laboratorio de leptospirosis.
Centro Panamericano de Zoonosis. Buenos
Herrmann, J.L., Bellenger, E., Perolat, P., Baranton, Aires. OPS, Nota Técnica 30.
G., Saint-Girons, I. 1992. Pulsed field gel
electrophoresis of NotI digests of leptospiral Pappas, G., Papadimitriou, P., Siozopoulou, V.,
DNA: a new rapid method of serovar Christou, L., Akritidis, N. 2008. The
identification. Journal of Clinical globalization of leptospirosis: worldwide
Microbiology. 30:1696-1702. incidence trends. International Journal of
Infectious Diseases. 12:351-357.
International Committee on Systematics of
Prokaryotes. 2008. Subcommittee on the Perolat, P., Merien, F., Ellis, W.A., Baranton, G.
taxonomy of Leptospiraceae. International 1994. Characterization of Leptospira isolates
Journal of Systematic and Evolutionary from serovars hardjo by Ribotyping,
Microbiology. 58:1049–1050. arbitrarily primed PCR, and mapped
restriction site polymorphisms. Journal of
Kawabata, H., Dancel, L.A., Villanueva, S.Y., Clinical Microbiology. 32:1949-1957.
Yanagihara, Y., Koizumi, N., Watanabe, H.
2001. flaB-polymerase chain reaction (flaB- Picardeau, M., Bulach, D.M., Bouchier, C., Zuerner,
PCR) and its restriction fragment length R.L., Zidane, N., Wilson, P.J., Creno, S.,

152
Tropical and Subtropical Agroecosystems, 16 (2013) :143 - 153

Kuczek, E.S., Bommezzadri, S., Davis, J.C., Thaipadungpanit, J., Wuthiekanun, V., Chierakul, W.,
McGrath, A., Johnson, M.J., Boursaux-Eude, Smythe, L.D., Petkanchanapong, W.,
C., Seemann, T., Rouy, Z., Coppel, R.L., Limpaiboon, R., Apiwatanaporn, A., Slack,
Rood, J.I., Lajus, A., Davies, J.K., Medigue, A.T., Suputtamongkol Y., White, N.J.,
C., Adler, B. 2008. Genome sequence of the Edward, J., Feil, D., Nicholas, P.J., Peacock,
saprophyte Leptospira biflexa provides S.J. 2007. A dominant clone of Leptospira
insights into the evolution of Leptospira and interrogans associated with an outbreak of
the pathogenesis of leptospirosis. PLoS human leptospirosis in Thailand. PLoS
ONE. 3:e1607. Neglected Tropical Diseases. 1:e56.

Ralph, D., McClelland, M., Welsh, J., Baranton, G., Vijayachari, P., Ahmed, N., Sugunan, A.P.,
Perolat, P. 1993. Leptospira species Ghousunnisa, S., Rao, K.R., Hasnain, S.E.,
categorized by arbitrarily primed polymerase Sehgal, S.C. 2004. Use of fluorescent
chain reaction (PCR) and by mapped amplified fragment length polymorphism for
restriction polymorphisms in PCR-amplified molecular epidemiology of leptospirosis in
rRNA genes. Journal of Bacteriology. 4:973- India. Journal of Clinical Microbiology.
981. 42:3575-3580.

Saitou, N., Nei, M. 1987. The neighbor-joining Vijayachari, P., Sugunan, A.P., Shriram, A.N. 2008.
method: A new method for reconstructing Leptospirosis: an emerging global public
phylogenetic trees. Molecular Biology and health problem. Journal of Biosciences.
Evolution. 4:406-425. 33:557–569.

Sotomayor-Bonilla, J.J,, Ayanegui-Alcérreca, M.A., Wolff, J.W., Bohlander, H., Ruys, A.C. 1949.
Cuarón A.D., Suzán, G., De la Peña- Researches on Leptospira Ballum: The
Moctezuma, A. 2009. Seroprevalence of detection of urinary carriers in laboratory
leptospiral serovars among native and exotic mice. Antonie van Leeuwenhoek. 15:1.
rodent species in Cozumel Island, Mexico.
VIth Meeting of International Leptospirosis Zuerner, R.L., Alt, D., Bolin, C.A. 1995. IS1533-
Society (ILS). Cochin, India. September 21- based PCR assay for identification of
24. pO5. Leptospira interrogans sensu lato serovars.
Journal of Clinical Microbiology. 33:3284-
Stoenner, H.G., Grimes, E.F., Thrailkill, F.B., Davis, 3289.
E. 1958. Elimination of Leptospira Ballum
from a colony of Swiss albino mice by use of Zuerner, R.L., Bolin, C.A. 1988. Repetitive sequence
chlortetracycline hydrochloride. American element cloned from Leptospira interrogans
Journal of Tropical Medicine and Hygiene. serovar hardjo type hardjo-bovis provides a
7:4. sensitive diagnostic probe for leptospirosis.
Journal of Clinical Microbiology. 26:2495-
Tamura, K., Dudley, J., Nei, M., Kumar, S. 2007. 2500.
MEGA4: Molecular Evolutionary Genetics
Analysis (MEGA) software version 4.0.
Molecular Biology and Evolution. 24:1596-
1599.

Submitted August 30, 2010– Accepted February 07, 2012

Revised received June 17, 2012

153