International Biodeterioration & Biodegradation xxx (2012) 1e7

Contents lists available at SciVerse ScienceDirect

International Biodeterioration & Biodegradation

journal homepage: www.elsevier.com/locate/ibiod

The role of the copper-binding enzyme e laccase e in the biodegradation

of polyethylene by the actinomycete Rhodococcus ruber
Miriam Santo, Ronen Weitsman, Alex Sivan*
The Department of Biotechnology Engineering, Ben Gurion University of the Negev, P.O. Box 653, Beer Sheva 84105, Israel

a r t i c l e i n f o a b s t r a c t

Article history: Polyethylene is considered one of the most durable plastic polymers. Virtually, non-biodegradable
Received 15 January 2012 polyethylene accumulates in the environment, thus posing an ecological threat to man and wildlife.
Received in revised form We have previously isolated a strain of the actinomycete Rhodococcus ruber (designated C208; EC
4 March 2012
1.10.3.2.) capable of utilizing and degrading polyethylene. Here, we report the role of the bacterial
Accepted 4 March 2012
copper-binding enzyme, laccase, in the oxidation and degradation of polyethylene by this strain. Copper
Available online xxx
markedly affected the induction and activity of laccase, resulting in polyethylene degradation. mRNA
quantification by RT-PCR, revealed a 13-fold increase in laccase mRNA levels, in copper-treated cultures
Keywords:
Laccase
compared with the untreated control. Addition of copper to C208 cultures containing polyethylene
Polyethylene enhanced the biodegradation of polyethylene by 75%, as compared with the non-amended control.
Biodegradation Furthermore, when an extracellular isoform of laccase collected from the media of copper-induced cells
Copper-binding enzymes was incubated with polyethylene, reductions of 20% and 15% were obtained in the Average Molecular
Weight (Mw) and Average Molecular Number (Mn) with the polymer, respectively. FTIR analysis of
similar polyethylene films incubated with the extracellular laccase exhibited an increase in the carbonyl
peak, indicating that enzymatic oxidation by laccase plays a major role in the biodegradation of
polyethylene.
Ó 2012 Elsevier Ltd. All rights reserved.

1. Introduction 1998). By contrast, experiments comparing the durability of an

oxidized polyethylene with that of non-oxidized counterpart,
Polyethylene films comprise a massive portion of municipal and showed only a minimal decrease in the molecular weight of both
industrial waste. Polyethylene is also used in large quantities in polyethylene types after a three months incubation with Penicillium
agriculture for soil mulching and green-house construction. Because simplicissimum (Yamada-Onodera et al., 2001). Modification and
of its high durability, polyethylene accumulates in the environment degradation of polyethylene with oxidative ad enzymes have also
at an alarming rate. Accordingly, significant efforts to degrade been attempted. Zhao et al. (2004) reported on the modification of
polyethylene have been undertaken. Long-term studies aimed at the the surface of polyethylene films that were treated with soybean
biodegradation of polyethylene have, however, yielded limited peroxidase. Biodegradation of nylon and polyethylene membranes
results. After ten years of incubation of 14C-labeled polyethylene in by the laccase-mediator system has also been demonstrated
soil, less than 0.5% carbon (in terms of CO2) by weight was derived (Nishida et al., 2001). However, the three-dimensional structure of
from a UV-irradiated polyethylene sheet. Non-irradiated poly- the membrane polymer may have been drastically different from
ethylene emitted less than 0.2% carbon dioxide over the same period that of standard polyethylene and the high porosity of the
(Albertsson and Karlsson, 1990). Biodegradation of thermo-oxidized membranes rendered them very fragile. Accordingly similar exper-
polyethylene incubated with Arthrobacter paraffineus for 3.5 years iments on nylon fibers realized far more limited results (Nishida
resulted in oxidation of the polyethylene and formation of organic et al., 1998). Previous studies in our laboratory using enrichment
acids. Simultaneously, a small increase in the molecular weight of techniques gave rise to the isolation of several unique soil bacteria
the polyethylene was recorded, attributed to the consumption of the able to grow on low-density polyethylene as a sole carbon source,
lower molecular weight fragments by the bacteria (Albertsson et al., reducing up to 11% of its gravimetric weight in 30 days (Gilan et al.,
2004; Hadad et al., 2005). Biodegradation of the polyethylene was
obtained with pre-irradiated (to obtain partial photooxidation) or
* Corresponding author. Tel.: þ972 8 64619; fax: þ972 8 6479035. non-irradiated films. The maximal degrading activity was obtained
E-mail address: sivan@bgu.ac.il (A. Sivan). with Rhodococcus ruber strain C208 (Gilan et al., 2004) and with the

0964-8305/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved.
doi:10.1016/j.ibiod.2012.03.001

Please cite this article in press as: Santo, M., et al., The role of the copper-binding enzyme e laccase e in the biodegradation of polyethylene by
the actinomycete Rhodococcus ruber, International Biodeterioration & Biodegradation (2012), doi:10.1016/j.ibiod.2012.03.001
2 M. Santo et al. / International Biodeterioration & Biodegradation xxx (2012) 1e7

thermophilic bacterium Brevibacillus borstelensis strain 707 (Hadad the biofilm was removed and the polyethylene was dried overnight
et al., 2005). and weighed gravimetrically. Laccase activity was determined at
With these observations in mind, we sought to determine 37  C, in potassium phosphate buffer (pH 7; modified after
whether oxidative enzymes such as peroxidases, oxygenases and Johannes and Majcherczyk, 2000). Specific activity was defined as
laccases play a major place in the biodegradation of polyethylene. the amount of protein required to oxidize 30 mM of 2,6-
Laccases (phenol oxidases) are a part of a larger group of enzymes dimethoxyphenol (DMP) by increasing absorbance at 470 nm by
designated as multi-copper enzymes. Such enzymes include three 1 m Au during 1 h. Laccase activity tests were carried out in 96-well
spectroscopically distinct copper ions (designated type I, II and III) plates (Kartell, Noviglio, Italy) using an ELISA reader (EL808, BioTek
and are classified, therefore, as multi-copper blue enzymes (Suzuki Inc., Winooski, VT) set at 470 nm at 10-min intervals. Specific
et al., 2003). activity of laccase was expressed as the Delta O.D. (470 nm) h1 mg
Laccases are widespread in plants, fungi and bacteria; however, protein1.
their biological functions are not yet completely understood. They Laccase activity for rapid screening was also assayed on SM agar
have been implicated in many diverse processes such as sporula- plates supplemented with 0.1% xylan as carbon source and 0.04%
tion, pigment production, rhizomorph formation and lignin (w/v) of the laccase indicators Ramazol Brilliant Blue R or syrin-
degradation (Coll et al., 1993). Laccase has been used for numerous galdazine (Yaver et al., 1996; Kiiskinen et al., 2004).
biotechnological applications, such as drug analysis to distinguish
morphine from codeine, wine clarification, and most importantly, 2.4. Induction of laccase activity
in the degradation of several recalcitrant pollutants such as tri-
chlorophenol, alkenes, bisphenol A and fluorene as well as herbi- Strain C208 cells were cultured in 250 ml flasks each containing
cides and other persistent and toxic molecules, in addition to 50 ml SM supplemented with 0.1% mannitol as carbon source on
decolorization of synthetic azo dyes (Mayer and Staples, 2002). In a rotary shaker (150 rpm) at 30  C for up to 6 days. Copper (5, 10 and
the present study, we describe an extracellular laccase excreted by 20 mM) was added daily. A cell-free fraction was obtained by
the polyethylene-degrading actinomycete R. ruber strain C208, centrifugation at 17,000 g. The supernatant was dialyzed over-
isolated by Gillan (Orr) et al. (2004). night against 5 l of potassium phosphate buffer (0.2 mM, frozen
We have characterized and optimized the activity of this at 85  C and lyophilized). Lyophilyzates originating from 50 ml of
bacterial laccase and demonstrated the role of copper in the dialyzates were redissolved in 1 ml potassium phosphate buffer.
induction of extracellular laccase and the involvement of the Laccase activity was measured at 5- or 10-min intervals, for up to
enzyme in polyethylene degradation. 110 min.

2. Materials and methods

2.5. Effect of pH on laccase activity
2.1. Polyethylene
Determination of the pH range that facilitates extracellular
3 laccase activity was realized using lyophilized supernatants (as
Branched low-density (0.92 g cm ) polyethylene (LDPE) film,
above) dissolved in potassium phosphate buffer (0.2 mM) to attain
with an average molecular weight of 191,000 (IpitenÒ111; Carmel
the desired pH levels (ranging from 5.8 to 8.0). Laccase activity, at
Olefins, Haifa, Israel) and thickness of 0.2 mm was produced by
each pH level was determined using DMP as substrate. To eliminate
Plastopil Hazorea (Hazarded, Israel) and was kindly provided by Mr.
the effects of pH on oxidation of DMP pre-set pH solutions sup-
R. Harpaz, Kibbutz.
plemented with copper and incubated without bacteria provided
baseline values and served as control.
2.2. Media and culture conditions

Bacterial cultures of the polyethylene-degrading R. ruber strain 2.6. Effects of temperature on laccase activity
C208 were maintained on nutrient broth (NB) or nutrient agar (NA)
media (Difco). Unless otherwise specified, liquid cultures (50 ml) Crude enzyme-containing lyophilyzates originating from 50 ml
were incubated in flasks (250 ml) on a rotary shaker of supernatant were re-suspended in 1 ml of potassium phosphate
(150 rpm min1) at 30  C. The synthetic medium (SM) used for buffer (pH 7.0) and maintained for 30 and 120 min at various
assaying the biodegradation of polyethylene and biofilm formation temperatures (30, 50, 70 and 100  C) to test enzyme thermosta-
contained the following elements (in distilled water): 1.0 g l1 bility. Relative residual activities were calculated proportional to
NH4NO3, 1.0 g l1 K2HPO4, 0.2 g l1 MgSO4$7H2O, 0.15 g l1 KCl, the activity of enzyme incubated at 30  C. The effect of temperature
0.1 g l1 CaCl2$2H2O and each of the following microelements: on laccase activity was measured at different temperatures
1.0 mg l1 FeSO4$6H2O, 1.0 mg l1 ZnSO4$7H2O and 1.0 mg l1 (30e100  C), after a 20-min incubation with DMP.
MnSO4.
To facilitate accurate measurement of residual polyethylene 2.7. Enzymatic degradation of polyethylene films
weight, bacterial biofilms were washed off the polyethylene surface
with 2% (v/v) sodium dodecyl sulfate (SDS) overnight, followed by Fifty ml of bacterial culture containing 1010 cells/ml were pel-
rinsing with distilled water (Hadad et al., 2005). leted by centrifugation. The supernatant was dialyzed and lyophi-
lized as mentioned above to obtain a crude extracellular laccase
2.3. Polyethylene degradation assays (gravimetric and molecular preparation. The dried enzyme was concentrated ten-fold upon
weight losses) dissolution in 5 ml potassium buffer (pH 7.0), filter sterilized and
applied daily to three polyethylene films, previously irradiated by
Polyethylene films (Carmel Olefins, Haifa, Israel) were added to UV light for 60 h (3 cm  3 cm, approximate weight 100 mg), in
SM medium as the sole carbon source. Two ml culture aliquots 50 ml flasks on a rotary shaker (100 rpm) at 37  C. Sterile potassium
were withdrawn, washed by centrifugation, re-suspended in SM phosphate buffer was added daily to control treatments. Experiments
and added to polyethylene-containing SM (final cell density with Trametes versicolor laccase (Sigma) were similarly using
0.5e1.0  107 cells/ml). At the end of the desired incubation time, a culture filtrate with 1.5 U/ml laccase activity with the exception of

Please cite this article in press as: Santo, M., et al., The role of the copper-binding enzyme e laccase e in the biodegradation of polyethylene by
the actinomycete Rhodococcus ruber, International Biodeterioration & Biodegradation (2012), doi:10.1016/j.ibiod.2012.03.001
 M. Santo et al. / International Biodeterioration & Biodegradation xxx (2012) 1e7 3

the use of acetate buffer (pH 4.5; the preferred acidity for fungal ABI PRISM dye terminator cycle sequencing ready reaction kit with
laccases). AmpliTaq DNA polymerase FS and ABI model 373A DNA sequencer
(PerkineElmer, Waltham, MA).
2.8. Analytical measurements of polyethylene

Changes in polyethylene structure following UV irradiation and 2.12. Total RNA extraction
the subsequent incubation with bacteria or enzyme were analyzed
by ATR-FTIR (Impact 410, Nicolet, Ettingen, Germany), using the Bacterial cultures were grown on SM supplemented with 0.1%
ATR 350 method with a ZnSe crystal. Enzymatic oxidation of mannitol, with or without copper entation (20 mM/day). After 2
polyethylene film was expressed as the carbonyl index, AC ¼ O:A days, 1 ml (109 cells) aliquot was remo1ved and centrifuged at
CH2 (i.e. the ratio the absorbance peak of carbonyl at 1712 cm1 to 16,000 rpm for 1 min. Extraction of total RNA was performed using
that of CH2 at 1462-cm1, which served as an internal standard). of Illustra RNA spin mini kit (GE healthcare, Uppsala, Sweden),
Differential Scanning Colorimetry (DSC) Crystallinity and melting according to the manufacturer’s instructions. RNA samples were
behavior were quantified with a DSC20 (Mettler Toledo, Columbus, processed immediately after extraction.
OH), using samples weighing 1e5 mg. The heating and cooling Reverse transcriptase and quantitative PCR were performed
rates were 10  C/min, with thermo-grams being recorded in heat- using PowerScript Reverse Transcriptase (Clonetech, Mountain
ing from 50  C to 160  C. Crystallinity was calculated using Star-E View, CA), according to the manufacturer’s instructions, in a total
software for thermal analysis, version SW 9.01 (Mettler Toledo). reaction volume of 20 ml. Briefly, the cDNA template was diluted
ten-fold and amplified in a thermocycler combined with a fluores-
2.9. Dependence of laccase on copper cence spectrometer (ABI 7000 sequence detection system, Applied
Biosystems, Foster City, CA). For each reaction 10 ml of two-fold
The specificity and the effect of copper on laccase activity were SYBR Advantage qPCR Premix (Clonetech) was mixed with 0.4 ml
further studied using the high-affinity copper chelator e Tetra of the forward and reverse primers, 0.4 ml ROX dye, 2 ml cDNA
ethylene pentamine (TEPA). C208 was cultured for 4 days in SM diluted ten-fold and 6.8 ml of double-distilled water. Primers for
containing 20 mM Cu and dialyzed against potassium phosphate amplification of the 220-laccase mRNA segment (220 bp) were:
buffer, supplemented with 0.2 mM TEPA and incubated for 30 min at Forward e TGCTCGGTACCGACCTGAGTN and Reverse e AGAC-
room temperature (R.T.). The samples were amended (or not) with CAGCGCGAAGGTGTGCCCGT1G. Detection of the ‘housekeeping
20 mM Cu and incubated (R.T.) for additional 30 min. The laccase gene’ 16S rRNA was performed with the universal primers: 8F
activity (2,6-dimethoxyphenol oxidation) was determined after GGATCCAGACTTTGAT(C/T)(A/C)TGGCTAG (Weisburg et al. (1991))
each of the 30 min incubation (R.T.). SM void of Cu or TAPA served and 341R CTGCTGCCTCCCGTAGG (defining a 360 bp segment; Saito
as control. et al. (2006)) The real-time cycle consisted of 2 min at 50  C and
15 s at 95  C, followed by 40 cycles of 15 s at 95  C and 1 min at
2.10. Gel Permeation Chromatography (GPC) 60  C. Analysis of relative expression was achieved with ABI Prism
700 SDS software (Applied Biosystems).
Analysis of the molecular weight of polyethylene samples was
performed at the Technion, Israel Institute of Technology, using an
Alliance GPC-2000 high temperature GPC device (Waters Corp., 3. Results
Milford, MA). Data processing was performed using Millennium
Ver. 4.2 software (Waters.). 3.1. pH optimum and thermal stability of laccase

2.11. Partial sequencing of strain C208 laccase Our working hypothesis was that biodegradation of poly-
ethylene can be affected by oxidative enzymes. We have detected
Total genomic DNA from bacterial cultures grown overnight was the secretion of laccase by strain C208 (Accession Number: DSM
extracted using a MoBio Microbial DNA isolation kit (MoBio Labo- 45332) upon oxidation of the laccase-specific substrates, syringal-
ratories, Solana Beach, CA). The purified DNA was stored at 20  C dazine and Ramazol Brilliant Blue R. Further characterization of the
until used. DNA concentrations were determined with an NlaD- effects of pH on laccase activity revealed that the optimal pH was 7.
1000 UVeVis spectrophotometer (NanoDrop Technologies, Wil- Strain C208 laccase exhibited high level of thermal stability, only
mington, DE). DNA amplification was performed in iTGradient 26% and 36% activity were lost during incubation at 100  C for 30
thermocycler (Biometra GmbH, Göttingen, Germany). The PCR and 120 min, respectively (Table 1). Preliminary tests to determine
reaction mixtures contained 50 ml Reddy Mix (PCR master mix laccase stability after long-term incubation revealed that optimal
containing 1.5 mM MgCl2 and a 0.2 mM concentration of each activity was obtained at 70  C (Fig. 1). However, at that tempera-
deoxynucleoside tripotassium phosphate (ABgene, Surrey, United ture, a decrease of 40% in laccase activity was obtained after 20 h
Kingdom), 4 pmol each of the forward and reverse primers, (Sigma) incubation with DMP as substrate (Table 1). Therefore, enzymatic
4 ml of the DNA template and water to bring the total volume to assays with polyethylene were conducted at 37  C. Treatment of
100 ml. A laccase fragment was amplified (using an initial dena-
turing hot start of 4 min at 95  C followed by 30 cycles of the Table 1
following incubation pattern: 94  C for 30 s, 50  C for 40 s, and 72  C Temperature stability of laccase of Rhodococcus ruber.
for 1.5 min) with the sense primer, 1F (50 CGCAACGACATGGACGGN
Residual laccase activity (%)
30 ) and the anti-sense primer, 1R (50 TAGTCGTTGTGGCAGTGN 30 ).
Temp.  C 30 min 120 min
Degenerate primers were designed and produced based, mainly, on
0 100 100
the homology with the nucleotide sequence around the copper- 50 97 88
binding sites of laccases from Streptomyces lavendulae (AB092576) 70 86 78
and Rhodococcus RHA1YP (702340). An additional fragment was 100 74 64
sequenced using the sense primer, 2F (50 CCGTCCACTCGACCCGN 30 ) Crude enzyme was incubated at 30  C or 120 min. Residual activity was calculated
and the anti-sense primer, 1R. Sequencing was performed using an relatively to enzyme activity at 30  C.

Please cite this article in press as: Santo, M., et al., The role of the copper-binding enzyme e laccase e in the biodegradation of polyethylene by
the actinomycete Rhodococcus ruber, International Biodeterioration & Biodegradation (2012), doi:10.1016/j.ibiod.2012.03.001
4 M. Santo et al. / International Biodeterioration & Biodegradation xxx (2012) 1e7

0.2
2000 Control

(ΔO.D. 490 nm) hr-1(μg protein)-1

20 µM Cu+2
Activity (mAu/min)

20 µM Fe+3
0.16

Laccase specific activity

1500 20 µM Mg+2
20 µM Mn+2

1000 0.12

500 0.08

0 0.04
20 30 40 50 60 70 80 90 100 110
Temperature (ºC)
0
Fig. 1. Temperature dependence of C208 laccase activity. Crude enzyme was incubated
0 10 20 30
in potassium phosphate buffer with DMP for 20 min at various temperatures. Activity
Time (min)
was determined by measuring DMP oxidation at 490 nm after incubation.
Fig. 3. Laccase activity as affected by metal ions.

crude laccase with Proteinase K resulted in complete loss of

oxidative activity (not shown). laccase activity (Fig. 4). Since copper increased the production of
A number of additives (such as ethanol and xylan) and growth extracellular laccase in strain C208, we proposed that if laccase is
conditions were tested as potential inducers of laccase. The best of involved in polyolefin biodegradation, addition of copper may
which was copper. Extracellular laccase activity, as well as total improve biodegradation by strain C208. Fig. 5 shows the effect of
protein production and growth were monitored every two days for addition of copper on polyethylene biodegradation in cultures of
up to 6 days. Optimization of laccase production was carried out in C208 grown on polyethylene films as the sole carbon source. The
the presence of different concentrations of copper in cultures data show that addition of copper enhanced polyethylene biodeg-
grown with 0.1% (w/v) mannitol as carbon source. A daily addition radation by ca. 75%, as compared to non-amended cultures. On the
of copper up to 20 mM after six days of incubation resulted in an other hand, both biodegradation analyses showed no effect on
increase in the specific activity of laccase (Fig. 2). While higher polyethylene when tested in a sterile medium amended with
concentrations had no effect on laccase activity (not shown), the copper (not shown). This result was confirmed by DSC analysis,
binding specificity of other metal ions revealed that copper which revealed the difference in biodegradation of the amorphous
exhibited the highest level of specifity (Fig. 3). polyethylene fraction relative to that of the crystalline (Fig. 6). As
In the absence of an effective laccase inhibitor we have used expected, amorphous polyethylene is degraded first. Therefore, the
a specific copper chaelator. TEPA. The high affinity of Cu to TEPA enhancement of biodegradation by copper resulted in an increase
resulted in chaelation of copper ions making them unavailable for in the relative amount of the crystalline fraction. To verify the
the laccase. Consequently, resulting in loss of enzymatic activity. hypothesis that extracellular laccase activity of C208 is involved in
However, further addition of Cu resulted in full restoration of polyethylene biodegradation, a culture of C208 cells was grown in
the presence of copper as described above. After six days with
optimal copper concentrations, crude extracellular enzyme was
450 collected and applied to polyethylene films. After two weeks of
- cu
400 + 5µM cu
+ 10µM cu
350
+ 20µM cu
Activity (mAu/min)

300

250

200

150

100

50

0
0 2 4 6
Time (days)
Fig. 2. The effect of copper concentration on specific activity of laccase in Rhodococcus
ruber. Bacterial cultures were incubated for up to 6 days in synthetic medium sup- Fig. 4. The effect of stepwise addition of copper and the copper chelator, tetraethylene
plemented with 0.1% mannitol. Varying concentrations of copper were added daily. pentamine (TEPA), on extracellular laccase-specific activity in C208. The specific
Laccase-specific activity was expressed as the change in absorbance (490 nm) obtained activity was determined in void of copper and TEPA (control) free SM. Consecutive
by oxidation of 2,6-dimethoxyphenol (DMP) during 1 h of incubation with 1 mg incubation periods, 30 min each, was carried out with 20 mM of CuSO4, followed by
extracellular protein. addition of 0.2 mM of TEPA and finally with additional 20 mM of CuSO4.

Please cite this article in press as: Santo, M., et al., The role of the copper-binding enzyme e laccase e in the biodegradation of polyethylene by
the actinomycete Rhodococcus ruber, International Biodeterioration & Biodegradation (2012), doi:10.1016/j.ibiod.2012.03.001
 M. Santo et al. / International Biodeterioration & Biodegradation xxx (2012) 1e7 5

Table 2
Molecular weight changes of polyethylene after exposure to crude extracellular
laccase from Rhodococcus ruber.

Sample Molecular number (Mn) Molecular weight (Mw) MWD

Control 40,383 116,453 2183
Laccase 34,201 93,646 2738
Change (%) 15 20 5

Polyethylene samples treated with laccase for two weeks were analyzed by Gel
Permeation Chromatography.

organisms, as well as primers for conserved sequences at the

beginning of the gene. The deduced amino acid sequence consists
of 424 residues (Fig. 7). All four copper-binding sites characteristic
of laccases were found in the deduced amino acid sequence of
strain C208 laccase. Comparative phylogenetic analyses of the
sequencing ClustalW and MEGA sequence alignment programs
Fig. 5. Enhancement of biodegradation of polyethylene films by copper. Polyethylene
films (3  3 cm) were incubated for 30 days with strain C208 in carbon-free synthetic revealed that C208 laccase is highly similar to many multi-copper
medium (SM) amended with 50 mM CuSO4. Sterile SM served as a control. oxidases (Fig. 8).

incubation with the extracellular fraction containing laccase, the

films were analyzed by FTIR microscopy. The carbonyl peak of the
UV-irradiated films incubated with laccase increased by almost
40%, as compared to the laccase-free control (unpublished). Simi-
larly, the calculated carbonyl index of the polyethylene increased
from 0.154 in the control to 0.214 after the laccase treatment. On
the other hand, T. versicolor laccase had no effect on the FTIR
spectrum of the polyethylene films (data not shown). In order to
establish a relationship between laccase activity and polyethylene
biodegradation, samples of irradiated polyethylene incubated for 2
weeks with extracellular laccase were analyzed by GPC to detect
changes in the average molecular weight (Mw) and average
molecular number (Mn). The results clearly indicated a reduction in
Mw and Mn of approximately 20% and 15%, respectively (Table 2).

3.2. Sequencing of the laccase gene

Partial sequencing (1273 bp) of the laccase gene was obtained

using primers for copper-binding regions of laccases in similar

Fig. 6. Differential Scanning Calorimetry (DSC) analysis of polyethylene biodegrada-

tion with addition of copper. Polyethylene films were incubated for 30 days with C208
in carbon-free synthetic medium (SM) containing 50 mM CuSO4. Sterile SM served as
a control. Fig. 7. Nucleotide sequence and the deduced amino acid of C208 laccase.

Please cite this article in press as: Santo, M., et al., The role of the copper-binding enzyme e laccase e in the biodegradation of polyethylene by
the actinomycete Rhodococcus ruber, International Biodeterioration & Biodegradation (2012), doi:10.1016/j.ibiod.2012.03.001
6 M. Santo et al. / International Biodeterioration & Biodegradation xxx (2012) 1e7

Fig. 8. Alignment of putative copper-binding motifs of C208 and of other laccases.

3.3. Induced transcription of laccase mRNA 4. Discussion

To determine whether laccase activity was simply enhanced by This study elucidates the role of a putative bacterial laccase
copper addition or rather was a result of an induction effect relative enzyme in polyethylene biodegradation. To the best of our knowl-
real-time (RT) PCR was used to analyze expression levels of laccase edge, this is the first reported enzyme that degrades polyethylene.
mRNA with or without copper supplementation (Fig. 9). mRNA Laccase is best known in lignin-biodegrading fungi, where it
levels of the laccase gene were inspected and normalized to the catalyses the oxidation of aromatic compounds. However, there is
amount of a ‘housekeeping gene’, in this case 16S ribosomal RNA. To evidence that shows activity of laccase on non-aromatic substrates
test for the specificity of the primers used for amplification of both (Mayer and Staples, 2002). Since laccase is a copper-binding
genes, a dissociation plot was generated at a temperatures range of enzyme with 4 binding sites that may contribute to its oxidizing
60e95  C. The singularity of the product was confirmed by the activity (Morozova et al., 2007) we have postulated that copper
distinct peak obtained from the dissociation plot (not shown). To might affect laccase activity and contribute to the biodegradation of
verify that the amplified fragment of the laccase gene was correct, polyethylene. The specificity of copper in the oxidative activity of
the fragment was sequenced and aligned with the strain C208 laccase was demonstrated by the use of a highly specific copper
laccase sequence. The resulting alignment shows 100% compati- chaelator (TAPA). The data obtained from RT-PCR, showing up to
bility to that region corresponding to the fragment that bound by 13-fold increase in laccase mRNA levels, confirmed that copper is
the forward and reverse primers designed for the real-time PCR. involved in the induction of laccase by strain C208. Similarly, the
Two experiments, each examining expression levels in cultures addition of 400 mM of copper resulted in an 18-fold increase in the
grown on SM supplemented with 0.1% mannitol, with or without laccase activity of T. versicolor (Collins and Dobson 1997). Likewise,
addition of copper, were considered. Each culture was subjected to Palmieri et al. (2000) reported that addition of CuSO4 increased the
relative real-time PCR in triplicate. The resulting relative quantifi- laccase activity of Pleurotus ostreatus by up to 50-fold. Nevertheless,
cation was computed using ABI Prism 700 SDS software, with a 95% laccase of T. versicolor did not affect polyethylene (Santo and Sivan,
confidence level. The relative quantities of laccase mRNA in cells unpublished). This may have resulted from difference in enzyme
grown with copper showed an increase of 8e13-fold after 2 days of activity and/or due to mediators present in the laccase preparation
induction (Fig. 9). of C208. Partial sequencing of C208 laccase has enabled us to
quantify the induction of laccase mRNA. This finding is supported
by the fact that a variety of species of the actinomycete Strepto-
myces also produced elevated levels of laccase in the presence of
25 copper (Endo et al., 2002). Likewise, Southern blot analysis of lac-
case cDNA produced by the fungi P. ostreatus and Trametes pubes-
cens revealed that copper has an inductive effect on laccase cDNA
20 production (Palmieri et al., 2000; Galhaup et al., 2002). One of the
main features of the laccase of strain C208 is its high level of
Relative Quantities

thermal stability, maintaining more than 60% of its original activity

15 even after 2 h incubation at 100  C. Conversely, incubation of
T. versicolor laccase for 30 min at 100  C resulted in a complete loss
of activity (Santo and Sivan, unpublished). Furthermore, the
10
optimal laccase activity of C208 was obtained at 70  C. This
temperature is markedly higher than that of thermostable bacterial
laccases of Bacillus subtilis and the actinomycete S. lavendulae and of
5
the thermophilic fungus Chaetomium thermophillium (Suzuki et al.,
2003). The high thermal stability of the laccase may pave the way
0 for degradation of polyethylene at high temperatures, facilitating
- cu - cu + cu + cu
a high kinetic reaction. In contrast, S. lavendulae and T. versicolor
laccases reached their optimum at around 50  C (Suzuki et al.,
Fig. 9. Relative expression levels strain C208 laccase with or without addition of 2003; Han et al., 2005). In accordance with the stimulation of lac-
copper. Cultures were grown on SM supplemented with 0.1% mannitol with or without case expression, copper enhanced polyolefin biodegradation (as
addition of copper, for 2 days. Each experiment was subjected to relative real-time PCR
in triplicates. Data in each experiment represent the average of 3 replicates  S.D.
determined as weight loss) of polyethylene by 75%, thus confirming
Polyethylene films were incubated for 30 days with C208 in carbon-free synthetic the role of laccase in polyolefin biodegradation. FTIR spectra of
medium (SM) containing 50 mM CuSO4. Sterile SM served as control. polyethylene revealed that more than 40 percent increase in the

Please cite this article in press as: Santo, M., et al., The role of the copper-binding enzyme e laccase e in the biodegradation of polyethylene by
the actinomycete Rhodococcus ruber, International Biodeterioration & Biodegradation (2012), doi:10.1016/j.ibiod.2012.03.001
 M. Santo et al. / International Biodeterioration & Biodegradation xxx (2012) 1e7 7

carbonyl index (AC¼O:ACH2), indicating that laccase may play a role Gilan(Orr), I., Hadar, Y., Sivan, A., 2004. Colonization, biofilm formation and
biodegradation of polyethylene by a strain of Rhodococcus ruber. Applied
in oxidation of the hydrocarbon backbone of polyethylene. One of
Microbiology and Biotechnology 65, 97e104.
the most important indicators of polyethylene biodegradation is Hadad, D., Geresh, S., Sivan, A., 2005. Biodegradation of polyethylene by the ther-
molecular weight reduction. We data demonstrated that cell-free mophilic bacterium Brevibacillus borstelensis. Journal of Applied Microbiology
laccase incubated with polyethylene resulted in a reduction of ca. 98, 1093e1100.
Han, M.J., Choi, H.T., Song, H.G., 2005. Purification and characterization of laccase
20% and 15% in the average molecular weight and average molec- from the white rot fungus Trametes versicolor. Journal of Microbiology 43,
ular number of the polyethylene, respectively. These results are 555e560.
consistent with a reduction of 25% in the weight average molecular Johannes, C., Majcherczyk, 2000. Laccase activity tests and laccase inhibitors.
Journal of Biotechnology 78, 193e199.
weight of identical polyethylene films incubated for 30 days with Kiiskinen, L.L., Rato, M., Kruus, K., 2004. Screening for novel laccase producing
the thermophilic bacterium B. borstelensis (Hadad et al., 2005). The microbes. Journal of Applied Microbiology 97, 640e646.
insignificant changes in the molecular dispersity index indicate Mayer, A.M., Staples, R.C., 2002. Laccase: new functions for an old enzyme. Phyto-
chemistry 60, 561e565.
that chain breakage occurs at the ends of the molecular chains or Morozova, O.V., Shumakovich, G.P., Shleev, S.V., Yaropolov, Y., Aiuia, I., 2007. Applied
branches rather than at the center of the molecule. Our findings Biochemistry and Microbiology 43, 523e535.
advocate that copper and copper-binding enzymes may play Nishida, T., Deguchi, T., Kakezawa, M., 1998. Nylon biodegradation by lignin-
degrading fungi. Applied and Environmental Microbiology 63, 329e331.
a major role in biodegradation of polyethylene and possibly of other Nishida, T., Fujisawa, M., Hirai, H., 2001. Degradation of polyethylene and Nylon-66
synthetic polymers. by the laccase-mediator system. Journal of Polymers and the Environment 9,
103e108.
Palmieri, G., Giardinni, P., Bianco, C., Fontanella, B., Sannia, G., 2000. Copper
induction of laccase iso-enzymes in the ligninolytic fungus Pleurotus ostreatus.
References Applied and Environmental Microbiology 66, 920e924.
Saito, D., Leonardo, R.T., Rodrigues, J.L., Tsai, S.M., Hofling, J.F., Goncalves, R.B., 2006.
Albertsson, A.C., Erlandsson, B., Hakkarainen, M., Karlsson, S., 1998. Molecular Identification of bacteria in endodontic infections by sequence analysis of 16S
weight changes and polymeric matrix changes correlated with the formation of rDNA clone libraries. J Med Microbiol 55, 101e107.
degradation products in biodegraded polyethylene. Journal of Environmental Suzuki, T., Endo, K., Ir o, M., Tsujibo, H., Miyamoto, K., Inamori, Y., 2003.
Polymer Degradation 6, 187e195. A thermostable laccase from Streptomyces lavendulae REN-7: purification,
Albertsson, A.C., Karlsson, S., 1990. The influence of biotic and abiotic environments characterization, nucleotide sequence and expression bioscience. Biotechnology
on the degradation of polyethylene. Progress in Polymer Science 15, 177e192. and Biochemistry 6, 2167e2175.
Coll, P.M., Fernandes-abalos, J.M., Villanueva, J.R., Santamaria, R., Perez, P., 1993. Weisburg, W.G., Barns, S.M., Pelletier, D.A., Lane, D.J., 1991. 16 ribosomal DNA
Purification and characterization of a phenoloxidase (laccase) from the lignin- amplification for phylogenetic study. J. Bacteriol 173, 697e703.
degrading basidiomycete PM1. Applied and Environmental Microbiology 59, Yamada-Onodera, K., Mukumoto, H., Katsuyaya, Y., Saiganji, A., Tani, Y., 2001.
2607e2613. Degradation of polyethylene by a fungus, Penicillium simplicissimum YK. Poly-
Collins, P.J., Dobson, A.D.W., 1997. Regulation of laccase gene transcription in I mer Degradation and Stability 72, 323e327.
versicolor. Applied and Environmental Microbiology 63, 3444e3450. Yaver, D.S., Xu, F., Colightly, E.J., Brown, K.M., Brown, S.H., Rey, M.D., Schneider, P.,
Endo, K., Hosono, K., Beppu, T., Ueda, K., 2002. A novel extracytoplasmic phenol Halkie, T., Mondorf, K., Dalboge, H., 1996. Purification, characterization,
oxidase of Streptomyces: it’s possible involvement in the onset of morphogen- molecular cloning and expression of two laccase genes from the white rot
esis. Microbiology 148, 1767e1778. Basidiomycete vilosa. Applied and Environmental Microbiology 62, 834841.
Galhaup, C., Goller, S., Peterbauer, C.K., Strauss, J., Haltrich, A., 2002. Characteriza- Zhao, J., Zhian, G., Xiaoyan, M., Guozheng, L., Junlong, W., 2004. Novel surface
tion of the major laccase isoenzymes from Trametes pubescens and regulation of modification of high-density polyethylene films by using enzymatic catalysis.
its synthesis by metal ions. Microbiology 148, 2159e2169. Journal of Applied Polymer Science 91, 3673e3678.

Please cite this article in press as: Santo, M., et al., The role of the copper-binding enzyme e laccase e in the biodegradation of polyethylene by
the actinomycete Rhodococcus ruber, International Biodeterioration & Biodegradation (2012), doi:10.1016/j.ibiod.2012.03.001