GHOSH Et Al., 2018, Role of Rhizospheric Microbes in Soil

Vijay Singh Meena Editor
Role of
Rhizospheric
Microbes in Soil
Volume 1: Stress Management and
Agricultural Sustainability
Role of Rhizospheric Microbes in Soil
Vijay Singh Meena
Editor
Role of Rhizospheric
Microbes in Soil
Volume 1: Stress Management
and Agricultural Sustainability
Editor
Vijay Singh Meena
ICAR-Vivekananda Institute of Hill Agriculture
Almora, Uttarakhand, India
ISBN 978-981-10-8401-0 ISBN 978-981-10-8402-7 (eBook)

https://doi.org/10.1007/978-981-10-8402-7
Library of Congress Control Number: 2018938099
© Springer Nature Singapore Pte Ltd. 2018

This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of
the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation,
broadcasting, reproduction on microfilms or in any other physical way, and transmission or information
storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology
now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication
does not imply, even in the absence of a specific statement, that such names are exempt from the relevant
protective laws and regulations and therefore free for general use.
The publisher, the authors and the editors are safe to assume that the advice and information in this book
are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the
editors give a warranty, express or implied, with respect to the material contained herein or for any errors
or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims
in published maps and institutional affiliations.
Printed on acid-free paper
This Springer imprint is published by the registered company Springer Nature Singapore Pte Ltd.
The registered company address is: 152 Beach Road, #21-01/04 Gateway East, Singapore 189721,
Singapore
Contents
1 Rhizospheric Microbes for Sustainable Agriculture:

An Overview �� 1
Ashok Kumar, Jai Singh Patel, and Vijay Singh Meena
2 Current Perspectives on Rhizobacterial-EPS interactions
in Alleviation of Stress Responses: Novel Strategies
for Sustainable Agricultural Productivity �� 33
P. V. Bramhachari, Ganji Purnachandra Nagaraju, and E. Kariali
3 Role of ACC Deaminase as a Stress Ameliorating Enzyme
of Plant Growth-Promoting Rhizobacteria Useful in Stress
Agriculture: A Review �� 57
Pallab Kumar Ghosh, Tarun Kumar De, and Tushar Kanti Maiti
4 Toward the Unculturable Microbes for Sustainable
Agricultural Production�� 107
Reeta Goel, Vinay Kumar, Deep Chandra Suyal, Narayan,
and Ravindra Soni
5 Induction of Anatomical, Enzymatic, and Molecular Events
in Maize by PGPR Under Biotic Stress�� 125
Yachana Jha
6 Bioremediation of Metal Contaminated Soil for Sustainable
Crop Production�� 143
M. L. Dotaniya, N. R. Panwar, V. D. Meena, C. K. Dotaniya,
K. L. Regar, Manju Lata, and J. K. Saha
7 Biofertilizers Based on Bacterial Endophytes Isolated
from Cereals: Potential Solution to Enhance These Crops�� 175
Lorena Celador-Lera, Alejandro Jiménez-Gómez,
Esther Menéndez, and Raul Rivas
v
vi Contents
8 Plant Growth-Promoting Rhizobacteria: A Biological

Approach Toward the Production of Sustainable Agriculture�� 205
Mona Nagargade, Vishal Tyagi, and M. K. Singh
9 Application and Mechanisms of Bacillus subtilis
in Biological Control of Plant Disease�� 225
X. Q. Wang, D. L. Zhao, L. L. Shen, C. L. Jing, and C. S. Zhang
10 Mycorrhizae: A Potential Microorganism and Its Implication
in Agriculture �� 251
Debabrata Nath and Vijay Singh Meena
11 Using Mycorrhiza Helper Microorganisms (MHM) to Improve
the Mycorrhizal Efficiency on Plant Growth�� 277
A. Lies, A. Delteil, Y. Prin, and R. Duponnois
12 Sustainable Crop Production and Soil Health Management
Through Plant Growth-Promoting Rhizobacteria�� 299
Hanuman Prasad Parewa, Vijay Singh Meena, Lokesh Kumar Jain,
and Anirudh Choudhary
13 Bioherbicidal Potential of Rhizosphere Microorganisms
for Ecofriendly Weed Management�� 331
S. S. Sindhu, Aakanksha Khandelwal, Manisha Phour,
and Anju Sehrawat
14 Biofertilizers and Biopesticides in Sustainable Agriculture�� 377
Vankayalapati Vijaya Kumar
Contributors
P. V. Bramhachari Department of Biotechnology, Krishna University,

Machilipatnam, Andhra Pradesh, India
Lorena Celador-Lera Departamento de Microbiología y Genética, Universidad
de Salamanca, Salamanca, Spain
Instituto Hispano-Luso de Investigaciones Agrarias (CIALE), Salamanca, Spain
Anirudh Choudhary College of Agriculture, Agriculture University, Jodhpur,
Pali, Rajasthan, India
Tarun Kumar De Department of Marine Science, Ballygunge Science College
Campus, Calcutta University, Kolkata, India
A. Delteil Arysta Life Science, Parc Technopolitain Atalante, Saint-Malo Cedex,
France
IRD, UMR LSTM, Montpellier, France
C. K. Dotaniya Department of Soil Science & Agricultural Chemistry, College of
Agriculture, SKRAU, Bikaner, India
M. L. Dotaniya ICAR-Indian Institute of Soil Science, Bhopal, India
R. Duponnois IRD, UMR LSTM, Montpellier, France
Pallab Kumar Ghosh Department of Marine Science, Ballygunge Science College
Campus, Calcutta University, Kolkata, India
Reeta Goel Department of Microbiology, CBSH, G.B. Pant University of
Agriculture and Technology, Pantnagar, Uttarakhand, India
Lokesh Kumar Jain College of Agriculture, Agriculture University, Jodhpur, Pali,
Rajasthan, India
Yachana Jha N. V. Patel College of Pure and Applied Sciences, S. P. University,
Anand, Gujarat, India
vii
viii Contributors
Alejandro Jiménez-Gómez Departamento de Microbiología y Genética,

Universidad de Salamanca, Salamanca, Spain
C. L. Jing Pest Integrated Management Key Laboratory of China Tobacco, Tobacco
Research Institute of Chinese Academy of Agricultural Sciences, Qingdao, China
E. Kariali School of Life Sciences, Sambalpur University, Sambalpur, Odisha,
India
Aakanksha Khandelwal Department of Microbiology, CCS Haryana Agricultural
University, Hisar, India
Ashok Kumar Department of Soil Science and Agricultural Chemistry, Institute
of Agricultural Sciences, Banaras Hindu University, Varanasi, Uttar Pradesh, India
Department of Botany, MMV, Banaras Hindu University, Varanasi, India
Vankayalapati Vijaya Kumar Core Green Sugar and Fuels Private Limited,
Tumkur, Karnataka, India
Vinay Kumar ICAR-National Institute of Biotic Stress Management, Raipur,
Chhattisgarh, India
Manju Lata Barkatullah University, Bhopal, India
A. Lies Agronutrition, Parc Activestre, Carbonne, France
Tushar Kanti Maiti Microbiology Laboratory, CAS, Department of Botany,
Burdwan University, Burdwan, WB, India
V. D. Meena ICAR-Indian Institute of Soil Science, Bhopal, India
Vijay Singh Meena ICAR-Vivekananda Institute of Hill Agriculture, Almora,
Uttarakhand, India
Department of Soil Science and Agricultural Chemistry, Institute of Agricultural
Sciences, Banaras Hindu University, Varanasi, Uttar Pradesh, India
Esther Menéndez ICAAM (Instituto de Ciências Agrárias e Ambientais
Mediterrânicas), Universidadede Évora, Évora, Portugal
Departamento de Microbiología y Genética, Universidad de Salamanca, Salamanca,
Spain
Ganji Purnachandra Nagaraju Department of Hematology and Medical
Oncology, Winship Cancer Institute, Emory University, Atlanta, GA, USA
Contributors ix
Mona Nagargade Department of Agronomy, Institute of Agricultural Sciences,

Banaras Hindu University, Varanasi, Uttar Pradesh, India
Narayan Department of Agricultural Microbiology, College of Agriculture, Indira
Gandhi Krishi Vishva Vidyalaya, Raipur, Chhattisgarh, India
Debabrata Nath Department of Soil Science and Agricultural Chemistry,
Institute of Agricultural Sciences, Banaras Hindu University, Varanasi, India
ICAR-Indian Institute of Soil Science, Bhopal, Madhya Pradesh, India
N. R. Panwar ICAR-Central Arid Zone Research Institute, Jodhpur, India
Hanuman Prasad Parewa College of Agriculture, Agriculture University,
Jodhpur, Pali, Rajasthan, India
Jai Singh Patel Department of Botany, MMV, Banaras Hindu University, Varanasi,
Uttar Pradesh, India
Manisha Phour Department of Microbiology, CCS Haryana Agricultural
Y. Prin CIRAD, UMR LSTM, Montpellier, France
K. L. Regar Department of Soil Science & Agricultural Chemistry, IAS, BHU,
Varanasi, India
Raul Rivas Departamento de Microbiología y Genética, Universidad de Salamanca,
Salamanca, Spain
Unidad Asociada Universidad de Salamanca-CSIC (IRNASA), Salamanca, Spain
J. K. Saha ICAR-Indian Institute of Soil Science, Bhopal, India
Anju Sehrawat Department of Microbiology, CCS Haryana Agricultural
L. L. Shen Pest Integrated Management Key Laboratory of China Tobacco,
Tobacco Research Institute of Chinese Academy of Agricultural Sciences, Qingdao,
China
S. S. Sindhu Department of Microbiology, CCS Haryana Agricultural University,
Hisar, India
M. K. Singh Department of Agronomy, Institute of Agricultural Sciences, Banaras
Hindu University, Varanasi, Uttar Pradesh, India
Ravindra Soni Department of Agricultural Microbiology, College of Agriculture,
Indira Gandhi Krishi Vishva Vidyalaya, Raipur, Chhattisgarh, India
Deep Chandra Suyal Department of Microbiology, CBSH, G.B. Pant University
of Agriculture and Technology, Pantnagar, Uttarakhand, India
x Contributors
Vishal Tyagi Department of Agronomy, Institute of Agricultural Sciences, Banaras

Hindu University, Varanasi, Uttar Pradesh, India
X. Q. Wang Pest Integrated Management Key Laboratory of China Tobacco,
China
C. S. Zhang Pest Integrated Management Key Laboratory of China Tobacco,
China
D. L. Zhao Pest Integrated Management Key Laboratory of China Tobacco,
China
About the Author
Dr. Vijay Singh Meena is currently working as a soil scientist in the ICAR-
Vivekananda Institute of Hill Agriculture, Almora, Uttarakhand. He obtained his
B.Sc. (AG.) from SKRAU, Bikaner, Rajasthan and M.Sc. (AG.) and Ph.D. (AG.)
with specialization in Soil Science and Agricultural Chemistry from Banaras Hindu
University (The Capital of Knowledge), Varanasi, Uttar Pradesh, India. He has com-
pleted vital work on potassium-solubilizing microbes, soil biological fertility, rhizo-
spheric chemistry, and conservation agriculture and has published more than 30
original research articles in national and international peer-reviewed journals. In
addition, he has published four books and eleven book chapters.
xi
Chapter 1
Rhizospheric Microbes for Sustainable
Agriculture: An Overview
Ashok Kumar, Jai Singh Patel, and Vijay Singh Meena
Abstract Agriculture is a complex network interaction among soil-plant-microbes.

There is an urgent need for an ecologically compatible, environment-friendly tech-
nique in agriculture system that might be able to provide adequate supply of essen-
tial nutrients for the alarming growing rate of human populations through qualitative
and quantitative improvement of agricultural products. Conventional agriculture
plays a crucial role to fulfill the increasing food demands of a growing human popu-
lation, which has also led to enhancing the use of pesticides and chemical fertilizers.
Improvement in agricultural sustainability requires optimal use and management of
soil fertility which rely on soil microbiological processes and soil biodiversity. An
understanding of microbial diversity perspectives in agriculture is important and
useful to arrive at measures that can act as indicators of soil quality, soil health, and
plant productivity. In this context, microorganisms present in soils have multiple
plant growth-promoting (PGP) activities such as IAA (indole-3-acetic acid), hydro-
gen cyanide (HCN) and siderophore production, ACC deaminase activity, and nitro-
gen fixation and nutrient solubilization (P, K, and Zn). Efficient plant
growth-promoting microorganisms (PGPMs) solubilize the nutrients in soil and
facilitate absorption by plants and consequently enhance the plant growth and yield.
PGPMs also sustain the soil fertility, soil health, and nutrient mobilization efficiency
under sustainable agriculture.
Keywords Growth · Nutrients · PGPMs · Phytohormones · Productivity
A. Kumar (*)
Department of Soil Science and Agricultural Chemistry, Institute of Agricultural Sciences,
Department of Botany, MMV, Banaras Hindu University, Varanasi, Uttar Pradesh, India
J. S. Patel
Department of Botany, MMV, Banaras Hindu University, Varanasi, Uttar Pradesh, India
V. S. Meena
ICAR-Vivekananda Institute of Hill Agriculture, Almora, Uttarakhand, India
© Springer Nature Singapore Pte Ltd. 2018 1

V. S. Meena (ed.), Role of Rhizospheric Microbes in Soil,
https://doi.org/10.1007/978-981-10-8402-7_1
2 A. Kumar et al.
1.1 Introduction
In the middle of the twentieth century, intensive agricultural technologies were used
for “green revolution,” but production was improved on the cost of ecological and
global pollution and loss of biodiversity under the changing climatic scenario
(Vance 1998). Due to invitation of such problems, peoples started paying attention
to develop sustainable agriculture, which increases the crop productivity without
disturbing the environment (Noble and Ruaysoongnern 2010; Meena et al. 2013a;
Bahadur et al. 2014; Zahedi 2016; Kumar et al. 2017). A developing country like
India is totally based on agriculture and needed to improve crop productivity for the
rapidly growing population.
The Food and Agriculture Organization (FAO) of the United Nations predicted
that the demand of agriculture-based products will be ~60% greater by 2030 com-
pared to present time; however, in developing countries, ~80% additional will be
needed. Several soil-improving activities are performed by efficient microbes such
as fixing, solubilizing, mobilizing, and nutrient recycling. These agriculturally
important microorganisms are present in soil naturally but may be lesser in amount
sometimes. To solve such problem for the increment of crop yield, desired efficient
microbes should be isolated from the rhizosphere and, after growing in laboratory
conditions, mixed in soil in adequate amount; sometimes a consortium of microor-
ganisms are more beneficial (Maurya et al. 2014; Jat et al. 2015; Verma et al. 2014,
2015b; Yadav and Sidhu 2016; Yasin et al. 2016).
The artificially cultured microbes are known as biofertilizers or microbial inocu-
lants. These efficient biofertilizers are formulation-based living beneficial bioag-
ents, which can improve soil fertility and sustain crop productivity. Nowadays, a
number of studies (Kumar et al. 2014; Meena et al. 2016a, b, c, d, e; Verma et al.
2015a) have reported some beneficial microorganisms such as Enterobacter,
Caulobacter, Arthrobacter, Azotobacter, Microbacterium, Pseudomonas, Erwinia,
Flavobacterium, Azospirillum, Bacillus, and Serratia. Meanwhile, the hazardous
agrochemical inputs such as chemical fertilizers, chemical pesticides, and minerals
can be substituted by using efficient consortia of these microorganisms, which is an
environment-friendly approach to improve nutrition of crops as well as help plants
to combat against different biotic and abiotic factors without disturbing the environ-
ment (Yang et al. 2009; Kumar et al. 2015a, b; Ahmad et al. 2016; Bahadur et al.
2016a, b; Teotia et al. 2016; Velazquez et al. 2016; Verma et al. 2015a).
Presently conventional agriculture is the major source of food to complete the
demands of human population and utilizes chemical pesticides and fertilizers
(Santos et al. 2012). Chemical fertilizers are composed of known quantities of phos-
phorus, nitrogen, and potassium, which are produced industrially, and the use of
chemicals causes environmental pollution (Youssef and Eissa 2014). To ensure bio-
safety, presently researchers are affording the production of nutrient-rich quality
food under the organic as well as sustainable agriculture (Das and Pradhan 2016;
Dominguez-Nunez et al. 2016; Dotaniya et al. 2016; Jaiswal et al. 2016; Jha and
1 Rhizospheric Microbes for Sustainable Agriculture: An Overview 3
Subramanian 2016; Kumar et al. 2016b; Singh et al. 2015). Researchers reported an
innovative idea of farm production by using biofertilizers as alternative of hazard-
ous chemicals. This alternate means of soil fertilization is useful for organic produc-
tion of crops, which not only improves nutrient supply but conserves soil fertility
also (Araujo et al. 2008; Megali et al. 2013).
Longer self-life of the biofertilizers has been an additional advantage to improve
soil quality with no adverse effect on ecosystem (Sahoo et al. 2014). Under the
organic farming includes the use of natural microflora which includes all kind of
beneficial fungi and plant growth-promoting rhizobacteria (PGPR). These biofertil-
izers improve soil fertility by P-solubilization, N-fixation, mineralization, and pro-
duction of PGP-regulating substances, production of antibiotics, and biodegradation
of organic matter (Sinha et al. 2014).
The presence of rhizobacteria in soil enhances plant growth and crop yield via
direct growth promotion mechanisms such as solubilization of phosphorus, nitrogen
fixation, sequestering of iron by production of siderophores, production of phyto-
hormones, and decrease in ethylene concentration (Idris et al. 2007; Verma et al.
2010, 2013). By increasing the availability of nutrients to plant, bioagents can
reduce the use of chemical fertilizers (Cakmakci et al. 2006, 2007; Ekin 2010).
Biofertilizers applied on seed or soil can multiply and participate in nutrient cycling
for the increment of crop productivity (Singh et al. 2011, 2016; Kumar et al. 2016c;
Masood and Bano 2016; Sindhu et al. 2016).
However, ~60–90% of chemical fertilizers are lost, and only ~10–40% remain-
ing are uptaken by the crops. However, biofertilizers are significant over such loss
and play an important role in integrated nutrient management (INM) without affect-
ing the healthy environmental conditions (Adesemoye and Kloepper 2009). Most of
the agricultural production system depends on the soil biodiversity. The soil system
is rich in biodiversity of these efficient microorganisms (Torsvik et al. 1990; Maurya
et al. 2012). A report by Morales and Holben (2011) reported the genetic potential
and importance of soil microbiome. Plants inhabiting in the particular soil have the
ability to modify the pool of microbial diversity present in the soil (Berg and Smalla
2009; Meena et al. 2015a, 2016a, b; Saha et al. 2016a, b; Sharma et al. 2016;
Shrivastava et al. 2016).
In the similar way plants are also affected by the type of microorganisms present
in soil; it may be due to a positive or negative association. The type of microbial
diversity present in the soil may act as an indicator of soil quality and plant produc-
tivity. Although a number of research groups are working on soil microorganisms
and their spatial activity in soil, efficient techniques yet are needed to develop such
study. A report by Doran and Zeiss (2000) suggested that it is important to be used
for sustainable agriculture. Microbes present in soil play an important role in nutri-
ent recycling (Kennedy 1999). Microbial culture-based techniques can tail only
about few of the microbial communities of soil (Colwell and Grimes 2000); further
to know about other communities and soil structure, molecular techniques are
required to determine the effect of microorganisms on soil quality (Kirk et al. 2004).
4 A. Kumar et al.
1.1.1 Plant and Soil Microbiome Root Exudation
The root exudation pattern of an actively growing plant in the rhizosphere plays an
important role to plant-microbe interactions (Badri and Vivanco 2009). Root exuda-
tion pattern is found to be different in different species of plant (Kuklinsky-Sobral
et al. 2004; Salles et al. 2004; Hogberg et al. 2006; Micallef et al. 2009). Plant spe-
cies showing variation in root exudation pattern in different cultivars suggests that
root exudation pattern can modify the rhizosphere microbiome. Root exudates are
composed of different biomolecules such as amino acids, flavonoids, sugars, fatty
acids, proteins, and phenolics (Badri and Vivanco 2009). Secretion of these biomol-
ecules may act as a signal for suitable microbial partners and may show an antimi-
crobial activity or a growth inhibitor for other microbes (Bais et al. 2006; Meena
et al. 2014a, 2015b, 2016c, d; Prakash and Verma 2016; Priyadharsini and
Muthukumar 2016; Raghavendra et al. 2016; Rawat et al. 2016).
A very convoluted interplay of chemical signaling occurs in plant-microbe inter-
action during symbiosis of microbes in plant roots. The examples of legumes can be
considered in which secretion of flavonoids from roots can modulate gene expres-
sion pattern of rhizobia and initiates a cascade of reaction for nitrogen fixation in the
root nodules (Oldroyd and Downie 2008). Several studies supported the theme that
interaction between two kingdoms may occur via chemical signaling in the similar
way as by acyl-homoserine lactone in cell-to-cell signaling in bacteria (Gao et al.
2003; Mathesius et al. 2003; Delalande et al. 2005) and causes gene expression
related to antifungal activity in the rhizosphere bacteria (Jousset et al. 2011; Meena
et al. 2013b, 2014b, 2015c; Parewa et al. 2014).
Plants are also modulated by chemical signaling by microbes. A report by Iavicoli
et al. (2003) suggested trigerance of systemic resistance in Arabidopsis thaliana due
to colonization of rhizobacterium Pseudomonas fluorescens CHA0 in the rhizo-
sphere by production of 2,4-diacetylphloroglucinol. Root-colonizing rhizobacteria
utilize the dominant component in root exudates compared to randomly selected
rhizobacteria (Kamilova et al. 2006). Some soil microbes showed better ability to
degrade their host plants compared to other plants (Ayres et al. 2009; Madritch and
Lindroth 2011). Exchange of agricultural plant species from country to country also
changes the pattern of microbiome. The origin or nearer place of a particular crop
will exhibit a long-term associated microbial partner.
The rhizosphere region may carry 1011 microbial cells per gram of root
(Egamberdieva et al. 2008) and more than 30,000 prokaryotes, which can improve
plant productivity (Mendes et al. 2013). So the rhizosphere region is a major micro-
bial “hotspot” (Lynch 1990; Pinton et al. 2001). Due to hazardous effect of chemi-
cals, development of safe and environment-friendly methods of plant protection and
fertilization will be a major focus of study in the upcoming days, i.e., the use of
beneficial microbes (Nina et al. 2014). The beneficial microorganisms are those
which improve soil physicochemical properties, soil health, crop productivity, soil
microbial biodiversity, and plant growth promotion (Sahoo et al. 2013). These ben-
eficial microbes are N2-fixing cyanobacteria, PGPR, plant disease suppressors,
mycorrhiza, and biodegrading and stress-tolerant endophytes (Singh et al. 2011;

Meena et al. 2013c, Meena et al. 2015d, e, f, 2016e).
Recommended crop management practices such as organic adjustments, soil fer-
tility, crop rotation, tillage maintenance, recycling of crop residue, and biocontrol of
phytopathogens and insect pests can be supplemented by the use of biofertilizers,
which is useful for sustainable crop management (Sahoo et al. 2013b). However,
these efficient PGPRs such as Azospirillum, Rhizobium, Azotobacter, Azospirillum,
potassium-solubilizing microorganisms (KSMs), and mycorrhizae were found to
involve in the increment of soil fertility (Dogan et al. 2011; Aziz et al. 2012). A
report by Dhanasekar and Dhandapani (2012) observed that strains of Azospirillum,
Azotobacter, Rhizobacter, and Phosphobacter can improve the nitrogen availability
and increased the number of leaves, stem length, stem diameter, seed dry weight,
and seed feeling. Similar report in rice was shown by Choudhury and Kennedy
(2004) for the improvement of plant health by the use of Azotobacter, Azospirillum,
and Rhizobium. Sahoo et al. (2013) reported the role of Azotobacter in nitrogen
cycle.
Azotobacter not only have a role in nitrogen fixation but also have the capacity to
produce vitamins such as thiamine and riboflavin (Revillas et al. 2000) and phyto-
hormones like gibberellins (GA), IAA, and cytokinin (CK) (Abd El-Fattah et al.
2013). A report by Gholami et al. (2009) suggested the role of A. chroococcum in
plant growth promotion by providing increment in seed germination and advance-
ment of root architecture. It can also inhibit pathogenic microorganisms around the
rhizosphere (Mali and Bodhankar 2009). The genus Azotobacter includes a number
of different species, namely, A. beijerinckii, A. nigricans, A. chroococcum,
A.vinelandii, A. paspali, and A. armeniacus. Azotobacter can be used as biofertil-
izers for a number of crops such as seasum, rice, linseeds, sunflower, sugar beet,
tobacco, tea, coffee, rubber, coconuts, oat, barley mustard, and wheat (Wani et al.
2013). Another free-living biofertilizer Azospirillum is a gram-variable, motile, and
aerobic bacterium, can flourish in flooded conditions also, and can promote plant
growth and development (Bhattacharyya and Jha 2012). Saikia et al. (2013) showed
that Azospirillum have a beneficial effect on plant growth both in field and green-
house condition. Different Azospirillum species such as A. brasilense, A. lipoferum,
A. halopraeferens, A. irakense, and A. amazonense have already been reported for
crop yield improvement (Sahoo et al. 2014).
An interesting report (Bashan et al. 2004) suggested that inoculation of
Azospirillum has ability to change root morphology by producing phytohormones.
Azospirillum also were reported to increase lateral root formation and root hair for-
mation to increase surface area for nutrient absorption (Mehdipour-Moghaddam
et al. 2012). Azospirillum have the ability to improve water status of the plant and
increase the nutrient uptake for plant growth improvement (Sarig et al. 1992; Ilyas
et al. 2012). Combined treatment of Azospirillum brasilense, Rhizobium meliloti,
and 2,4-D has increased NPK level, which ultimately increases crop yield of Tritium
aestivum. Rhizobium has been reported for its nitrogen-fixing ability for several
years and improves crop yield (Askary et al. 2009). Rhizobium has been reported
(Sharma et al. 2011) to be temperature tolerant and enter in plant root hairs and
6 A. Kumar et al.
enlarge the epithelial cells to form root nodules. Rhizobium species has been
reported to form nodule in different leguminous crops such as lentil (Rashid et al.
2012), berseem (Hussain et al. 2002), groundnut (Sharma et al. 2011), Bengal gram
(Patil and Medhane 1974), and soybean (Grossman et al. 2011). A report (Peng
et al. 2008) suggested the role of Rhizobium isolates to supply nitrogen in rice
plants. Some of the Rhizobium species like Sinorhizobium meliloti have been
reported to insert themselves in plants other than legumes and promote plant growth
by enhancing the indigenous level of phytohormones and improving photosynthetic
ability to provide stress tolerance to plants.
A strain of Rhizobium IRC-6 enhances the number of useful traits such as nitrate
reductase activity, increased number of pink color nodules, and production of leghe-
moglobin 50 days after inoculation in groundnut (Sharma et al. 2011). Symbiosis of
Rhizobium with plants augments host defense against different pathogens and her-
bivores like Mexican bean beetle (Thamer et al. 2011) and greenhouse whitefly
Trialeurodes vaporariorum (Menjivar et al. 2012). According to Orhan et al. (2006)
reported that PGPR stimulates plant growth promotion in raspberry; a similar report
was also found for apricot (Karlıdag et al. 2007), maize (Mehnaz et al. 2010;
Shankar et al. 2013), wheat (Kumar et al. 2015a, b), chili (Turan et al. 2012), chick-
pea (Akhtar and Siddiqui 2009), peanut (Taurian et al. 2010) soybean (Fernandez
et al. 2007).
1.2 Plant Growth-Promoting Character of Microbes
1.2.1 Indole-3-Acetic Acid Production
PGPRs can produce phytohormone indole-3-acetic acid (IAA) when its precursor
tryptophan or peptone is supplied (Fig. 1.1). Some of the physiological phenome-
non can be regulated by auxins such as cell division, root initiation, cell enlarge-
ment, increased growth rate, root growth inhibition, apical dominance, and
geotropism (Frankenberger and Arshad 1995). About 80% of PGPRs can produce
auxin and secondary metabolites (Kampert et al. 1975; Loper and Schroth 1986).
Different bacterial genera such as Enterobacter cloacae, Acetobacter diazotrophi-
cus, Serratia, Azospirillum, Pseudomonas, Xanthomonas, and Rhizobium as well as
Alcaligenes faecalis, Bacillus cereus, Bradyrhizobium sp., Mycobacterium sp.,
Burkholderia, and Azotobacter can stimulate plant growth via auxin production
(Idris et al. 2009; Ahmad et al. 2008; Tsavkelova et al. 2007; Patten and Glick 1996;
Halda-Alija 2003).
Different metabolic pathways such as tryptamine pathway, indole-3-acetamide
pathway, tryptophan side chain pathway, indole-3-pyruvic acid pathway, and indole-
3-acetonitrile pathways are engaged in IAA production. Several plant pathogens
like P. syringae, Agrobacterium tumefaciens, and A. rhizogenes can synthesize IAA
by indole-3-acetamide pathway (Liu et al. 1982; Offringa et al. 1986). Asghar et al.
(2002) suggested that PGPRs can produce ~25 μg mL−1 of auxins while in the
Fig. 1.1 An overview of the effect of efficient PGPMs on plant growth and development
p resence of its precursor tryptophan which has 184 times greater than in medium
not supplied with L-tryptophan. Certain PGPR isolates like Pseudomonas, Bacillus,
and Azotobacter can produce IAA. Another study (Xie et al. 1996) reported higher
level of IAA production by Pseudomonas.
1.2.2 Production of Hydrogen Cyanide (HCN)
Hydrogen cyanide is a volatile, secondary metabolite compound that suppresses the

development of microorganisms and negatively affects the growth and development
of plants (Siddiqui 2006). It is a powerful inhibitor of many metal enzymes, mainly
copper-containing cytochrome C oxidases (Fig. 1.1).
8 A. Kumar et al.
HCN is formed from glycine by the action of HCN synthetase enzyme, which is
associated with the plasma membrane of many rhizobacteria (Blumer and Haas
2000). These efficient PGPRs such as A. chlorophenolicus, Enterobacter sp.,
Serratia marcescens, Microbacterium arborescens, Alcaligenes, Pseudomonas,
Aeromonas, Bacillus, and Rhizobium have shown to be capable of producing HCN
(Kumar et al. 2015a, b; Kumar et al. 2014; Devi and Seth 2007; Ahmad et al. 2008).
Most of the Pseudomonas sp. have caused HCN production which present within
the rhizosphere; among these are potato and wheat rhizosphere species showing
~50% HCN production under in vitro condition (Bakker et al. 1987; Schippers et al.
1990).
HCN has a disease-protective effect, e.g., in the suppression of “root-knot” and
black rot in tomato and tobacco root caused by the nematodes Meloidogyne javan-
ica and Thielaviopsis basicola, respectively (Voisard et al. 1989; Siddiqui et al.
2006). HCN controls the subterranean termite Odontotermes obesus which is an
important pest in agricultural and forestry crops in India (Devi and Seth 2007).
However, HCN produced by Pseudomonas in the rhizosphere inhibits the primary
growth of roots in Arabidopsis due to the suppression of an auxin-responsive gene
(Rudrappa et al. 2008).
1.2.3 Production of Siderophores
Siderophores are small high-affinity iron-chelating compounds secreted by plant

and microorganisms such as bacteria and fungi and act as a strong soluble ferric
(Fe3+) binding chelating agent (Fig. 1.1). These compounds are produced by various
types of bacteria such as in response to iron (Fe) deficiency which normally occurs
in neutral to alkaline pH soils, due to low iron solubility at elevated pH (Sharma and
Johri 2003). Various studies have isolated siderophore-producing bacteria belong-
ing to the Rhizobium (Roy and Chakrabartty 2000), Bradyrhizobium (Khandelwal
et al. 2002), B. megaterium, Enterobacter sp. (Kumar et al. 2014), P. aeruginosa
((Verma et al. 2013), Pseudomonas (Boopathi and Rao 1999), and Serratia and
Streptomyces (Kuffner et al. 2008) genera from the rhizosphere.
Iron is essential for cellular growth and metabolism, such that Fe acquisition
through siderophore production plays an important role in determining the competi-
tive fitness of bacteria to colonize plant roots and to compete for iron with other
microorganisms in the rhizosphere (Crowley and Gries 1994; Crowley 2006).
Siderophore-producing PGPR can prevent the proliferation of pathogenic microor-
ganisms by sequestering Fe3+ in the area around the root zone (Siddiqui 2006). Fe
depletion in the rhizosphere does not affect the plant, as the low Fe concentrations
occur at microsites of high microbial activity during establishment of the pathogen.
Many plants can use various siderophore-producing bacteria as iron sources,
although the total concentrations are probably too low to contribute substantially to
plant iron uptake. Plants also utilize their own mechanisms to acquire iron, dicots
via a root membrane reductase protein that converts insoluble Fe3+ into the more
soluble Fe2+ ion or in the case of monocots by production of phytosiderophores
(Crowley 2006).
Iron is an important plant nutrient, but it is relatively insoluble in soil solutions.
Plant root microbes prefer to absorb iron as the more reduced ferrous (Fe2+) ion, but
the ferric (Fe3+) ion is more common in well-aerated soil although it is easily pre-
cipitated in iron oxide forms (Salisbury and Ross 1995). However, there is a contro-
versy as the significance of bacterial Fe3+ siderophore uptake to the iron nutrition of
plants. While some scientists believe that the contribution of these siderophores to
the overall iron requirements of plants is small (Glick 1995), others suggest an
important role (Duijff et al. 1994), even a vital role, especially in calcareous soils
(Masalha et al. 2000). Bar-Ness et al. (1992), who had earlier supported the concept
of bacterial siderophore uptake by plants, concluded that two bacterial siderophores
(pseudobactin and ferrioxamine B) were inefficient as iron sources for plants and
that rhizosphere siderophore-producing bacteria can be in competition with the
plant for iron. In fact, the vast majority of research on microbial siderophores in the
rhizosphere is associated with their biocontrol activities due to their competitive
effects with plant pathogens (Hiifte et al. 1994).
1.2.4 Other Phytohormones
Some of the studies reported production of plant growth hormones by diazotrophic

PGPRs, but production level is not at such extent as in bacteria. Another class of
phytohormones, i.e., cytokinins, is well known for regulation of cell division, tissue
expansion, and cell enlargement in certain plant parts (Salisbury 1994). Another
class of phytohormones, i.e., gibberellins, is commonly associated with modifica-
tion of morphology by the extension of plant tissue (Salisbury 1994). However,
production of GA by PGPR is rare; a report by Gutierrez-Manero et al. (2001) sug-
gested that Bacillus licheniformis and Bacillus pumilus can produce GA. The only
gaseous phytohormone known is ethylene. Ethylene production is induced by the
physical or chemical injury to plant tissue also known as “wounding hormone”
(Salisbury 1994). As per its known physiological effect, root growth inhibition can
be caused by ethylene production.
A report by Glick et al. (1998) suggested that PGPRs can produce enzyme like
1-aminocyclopropane-1-carboxylate (ACC) deaminase, which can cleave the one
precursor required for ethylene synthesis in the root of plant. Many other studies
(Holguin and Glick 2001; Saleh and Glick 2001) have also reported the ACC deami-
nase action produced from PGPRs on ethylene production. Grichko and Glick
(2001) reported that PGPR-based ACC deaminase activity expressed spatially in
stressful conditions such as flooded situation or heavy metal pollution (Burd et al.
1998).
10 A. Kumar et al.
1.2.5 Nitrogen Fixation
Nitrogen (N) is one of the principal plant nutrients for improved plant growth and
yield (Ayub et al. 2010). However, the global nitrogen cycle pollutes groundwater
and increases the risk of chemical spills, and its low availability due to the high
losses by emission or leaching makes it a limiting factor in agricultural ecosystems.
Hence, N2-fixing PGPR which can make atmospheric N2 available for plants plays
a critical role for reducing the need of chemical fertilizers and decreasing their
adverse environmental effects (Fig. 1.1). Biological nitrogen fixation (BNF)
accounts for ~60% of the earth’s available nitrogen and represents an economically
beneficial and environmentally sound alternative to chemical fertilizers (Ladha and
Kundu 1997).
A number of BNF bacterial species acting as biofertilizers, belonging to genera
Azospirillum, Alcaligenes, Arthrobacter, Acinetobacter, B. megaterium, Bacillus,
Burkholderia, Enterobacter, A. chlorophenolicus, Erwinia, Flavobacterium,
Pseudomonas, Rhizobium, and Serratia, are associated with the plant rhizosphere
and are able to exert a beneficial effect on plant growth (Kumar et al. 2014; Tilak
et al. 2005; Egamberdiyeva 2005; Esitken et al. 2010). Biofertilizer means the prod-
uct containing carrier-based (solid or liquid) living microorganisms which are agri-
culturally useful to increase the productivity of the soil and/or crop (Trivedi et al.
2011; Zahir et al. 2012).
N2-fixing biofertilizers have emerged as a new concept of plant growth-promoting
rhizobacteria (PGPR). Bacteria colonizing the hair and cortical cells and promoting
plant growth are referred as PGPR (Shishido et al. 1999). N2-fixers are soilborne
bacteria, isolated from the rhizosphere, and, when applied to seeds or crops, enhance
the growth of the plant through various mechanisms, e.g., suppression of plant dis-
ease (bioprotectants), improved nutrient acquisition (biofertilizers), or phytohor-
mone production (biostimulants) (Glick et al. 1999; Idris et al. 2007; Kumar et al.
2014). Isolation of microorganisms, screening for desirable characters, and selec-
tion of efficient strains are important steps to optimize high crop yields and improve
the sustainability of the ecosystem.
The nitrogen-fixing bacteria have the ability to produce antibiotics against patho-
genic microbes, synthesize fungal cell wall-lysis enzyme, reduce iron availability to
phytopathogens in the rhizosphere, and compete with detrimental microorganisms
for sites on plant root (Benizri et al. 2001). A study on the application of different
rates of composite mineral fertilizers and their combination with N2-fixing bacterial
inoculants (Klebsiella planticola and Enterobacter spp.) on chemical composition
and yield of the grain of maize and wheat showed increased contents of nitrogen,
phosphorus, potassium, and proteins in the grains of both crops (Stanojkovic et al.
2012). Inoculation of Enterobacter sp. promoted the germination and growth of
maize and rice (Frank and Okonkwo 2012). Effects of co-inoculation with
Pseudomonas chlororaphis and Arthrobacter pascens amendment with rock phos-
phate resulted in increased yield and uptake of walnut under shade house conditions
(Xuan et al. 2012).
1.2.6 Phosphate Solubilizers
Phosphorus (P) is needed for proper growth and development of plant. Solubilization
of P in soil decreases or becomes immobilized due to chemical precipitation,
absorption, or both at a time. In the macronutrients phosphorus becomes second
after nitrogen and acts as a limiting factor for growth of terrestrial plants (Fig. 1.1).
Phosphorus may present in soil in very high quantity, but the amount of available
phosphorus is very low compared to the total (Stevenson and Cole 1999). Generally
the amount of available P in soil is low, but in the bounded form its amount is found
to be abundant. Absorption or immobilization of P present in soil is quite a difficult
job (Gaind et al. 2000). The major reason for the low availability of P in soil is
because it is absorbed by plant only in two forms the monobasic (H2PO4−) and the
diabasic (HPO42−) ions (Glass 1989).
Some of the bacterial genera such as Burkholderia, Enterobacter, Erwinia,
Azospirillum, Azotobacter, Bacillus, Beijerinckia, Pseudomonas, Rhizobium,
Flavobacterium, Serratia, and Microbacterium are reported to act as major
phosphate-solubilizing agents (Mehnaz and Lazarovits 2006; Tripura et al. 2007;
Kumar et al. 2016a). Several organic acids have been secreted by P-solubilizers
such as oxalic acid, succinic acid, citric acid and glycolic acid, etc. to convert insol-
uble form of P to soluble P. Among the PGPRs Bacillus and Pseudomonas are found
to be the most efficient genera for phosphate solubilization, and among the fungi,
the best genera are Aspergillus and Penicillium.
Species related to Bacillus include B. megaterium, B. mesentericus, B. mycoides,
B. brevis, B. cereus, B. circulans, B. firmus, B. subtilis, B. licheniformis, B. poly-
myxa, and B. pumilus found to be associated with rhizosphere of legumes and cere-
als (Kole and Hajra 1997, 1998; Venkateshwarlu et al. 1984). Pseudomonas species
include P. syringae, P. aeruginosa, P. putrefaciens, P. cissicola, P. fluorescens, P.
pinophillum, Pseudomonas striata, and P. syringae isolated from rhizosphere of
maize, soybean, chickpea, and Brassica (Pal et al. 2000). Among the phosphate-
solubilizing fungi, Aspergillus niger, A. flavus, A. fumigatus, A. terreus, A. wentii,
A. nidulans, A. awamori, and A. carbonum are included (Prerna et al. 1997).
The PGPRs most commonly promoted plant growth by P-solubilization and
make other nutrients available also (Richardson 2001). As per the study of Kumar
and Narula (1999) reported the role of Azotobacter chroococcum for P solubiliza-
tion in wheat similarly by Cladosporium herbarum and Bacillus circulans by Singh
and Kapoor, (1999) in wheat, role of Enterobacter agglomerans on tomato (Kim
et al. 1998) and role of P. putida on soybean (Cattelan et al. 1999) for P solubiliza-
tion. The increment in available phosphorus by PGPRs can enhance plant growth
(Kucey et al. 1989). Several reports (Greenough and Batson, 1989; Ozturk et al.
2003) suggested the role of Bacillus species in the increment of crop yield.
A number of rhizosphere bacteria having phosphate-solubilizing activity (Narula
et al. 2000) are also reported to have a role in P uptake (Lifshitz et al. 1987). Another
report (Vazquez et al. 2000) suggested that P-solubilizing bacteria are mostly found
12 A. Kumar et al.
in the rhizosphere. However, a report by Cattelan et al. (1999) suggested that only
two of five rhizosphere bacteria have phosphate-solubilizing activity. Nevertheless,
phosphate solubilization is not the only mechanism adopted by P-solubilizing bac-
teria for plant growth promotion. A study (de Freitas et al. 1997) found a positive
role of Bacillus sp. isolates and Xanthomonas maltophilia in plant growth promo-
tion but not in phosphate solubilization. Bacteria related to P-solubilization are also
known for the increment in P uptake, responsible for higher plant growth and yield
(Gaur et al. 2004; Verma et al. 2010). Most soil bacteria (Bacillus, Enterobacter,
and Pseudomonas) and some soil fungi (Penicillium and Aspergillus) can solubilize
insoluble phosphates (Patgiri and Bezbaruah 1990; Rokade and Patil 1993; Yadav
et al. 2011).
Phosphate is present in soil in two forms organic and inorganic phosphates. Most
of the insoluble P mineral complexes occur in inorganic P in soil whose forms can-
not be absorbed by plants. Insoluble phosphates can be converted into accessible
form to the plants through PGPR to enhance plant yields. Sims and Pierzynski
(2005) reported the mechanism of P-solubilization through PSM in soil via soil P
cycle that affects soil solution P concentrations as (i) dissolution-precipitation
through mineral equilibrium, (ii) sorption-desorption via interactions between soil
solid surfaces and P in solution, and (iii) mineralization-immobilization via micro-
bial mediate the conversions of phosphate between inorganic and organic forms.
The important phosphate solubilization mechanisms involving the soil PGPMs
include (a) the release of complex or mineral dissolving many compounds, e.g.,
organic acid anions, siderophores, protons, hydroxyl ions, and CO2, (b) the libera-
tion of extracellular enzymes for mineralization of phosphate, and (c) the release of
P during substrate degradation by PGPMs (McGill and Cole 1981).
1.2.7 Potassium Solubilizers
Potassium (K) is one of the most important macronutrients required by all crops and
plays many physiological, metabolism, and biochemical processes. In addition,
potassium improves crop quality since it helps in strengthening straw and grain filling
and kernel weight, increases resistance against pest and other diseases, and also helps
the plant during different stresses. It activates plant enzymes, helps in transport of
sugars and starches, reduces respiration, enhances photosynthesis, maintains cell tur-
gor, facilitates in nitrogen uptake, and is also important for protein synthesis (Fig. 1.1).
Mineral K solubilization by a number of K-solubilizing microbes increases the plant
growth and yield when applied; the source of rock potassium may be agronomically
more useful and environmentally more suitable than soluble K (Rajan et al. 1996).
Potassium-solubilizing bacteria (KSB) are capable of solubilizing potassium
sources such as orthoclases, illite, and mica through production and excretion of
organic acids like carboxylic acids, oxalic acids, succinic acids, citric acids, tar-
taric acids, etc. (Sheng and He 2006). These efficient KSMs play an important role
in the natural K cycle. There are considerable populations of KSB near the root
rhizosphere and in soil (Sperberg 1958). Silicate bacteria were found in soil to
dissolve aluminum, potassium, and silicon from insoluble minerals (Aleksandrov
et al. 1967). According to the latest report, most of the potassium in soil present in
silicate mineral form.
In general conditions, black soils contain high amount of available K followed by
red soils and lowest by lateritic soils. A diverse range of bacteria, namely, Bacillus
mucilaginosus, B. edaphicus, Acidithiobacillus ferrooxidans, Paenibacillus spp.,
Burkholderia, B. circulans, and Pseudomonas, have been reported to release potas-
sium in available form from K-bearing minerals in soils (Meena et al. 2014a). The
KSMs were found to access potassium, silicon, and aluminum from insoluble
K-bearing minerals such as orthoclases, micas, and illite by excreting a number of
organic acids, through either directly dissolved rock K or via chelated silicon ions
to bring potassium into the solution (Zhang and Kong 2014; Meena et al. 2014b).
Singh et al. (2010) reported that inoculation of Rhizobium, Bacillus mucilaginosus,
and Azotobacter chroococcum with wheat and maize plants significantly resulted in
more mobilization of potassium from waste mica and increase in available potas-
sium and consequently enhanced the plant growth and yield.
There are few bacteria which are capable of decomposing the aluminosilicate
minerals and releasing a portion of the K contained which could be used in agricul-
ture (Basak and Biswas 2010; Kumar et al. 2016a). Generally K deficiency occurs
due to the cultivation of hybrids and high-yielding crop varieties because potassium
decreases very easily in soil due to crop uptake, leaching, soil erosion, and runoff
(Sheng and Huang 2002). Some important bacteria like Bacillus mucilaginosus,
Acidithiobacillus sp., Pseudomonas sp., Burkholderia sp., Bacillus sp., and Bacillus
edaphicus are reported to release K from different K-bearing minerals (Meena et al.
2014a, b). However, KSB and PSB have been widely used as biofertilizers in Korea
and China because these countries are deficient in soil-available K and P (Li et al.
2006). Their application slightly could reduce the use of chemical fertilizers and
pesticides and effectively enhance the crop production under an eco-friendly man-
ner (Sindhu et al. 2010).
1.2.8 Zinc Solubilizers
In India zinc (Zn) is an important micronutrient and widely used by farmers as zinc
sulfate. Generally soil has deficiency level of zinc, and it is expected to increase
from ~48% to 63% by the year 2025 (Singh 2009). In order to sequester zinc defi-
ciency in plants, farmers used synthetic fertilizer and estimated that up to 90,000 tons
of zinc sulfate was used by the agriculturalist to eradicate zinc deficiency in plants
per year (Singh 2009). The quantity of zinc present in soil is in unavailable state, but
Zn-solubilizing bacteria provide accessible form of Zn to the plants for their growth
and development. A group of bacteria have solubilized mineral zinc such as ZnO
and ZnCO3 and make them available to growing plants (Gadd 2007).
14 A. Kumar et al.
The Zn-solubilizing potential of Thiobacillus thiooxidans and Thiobacillus fer-

rooxidans has been identified from sulfide ore (Hutchins et al. 1986) and also
Pseudomonas, Bacillus, Acinetobacter, and Gluconacetobacter as zinc-solubilizing
bacterial genera (Sachdev et al. 2010). The Zn plays an important role in different
metabolic processes in plants, and its deficiency leads to the decrease in the growth
and development of plants (Cakmak 2008). Zn is present in many enzyme systems
as a cofactor and metal activator (Parisi and Vallee 1969). The available zinc content
of Indian soils varied from traces to 22 mg kg_1, and ~47% of Indian soils were
Zn-deficient (Katyal and Sharma 1991).
Generally 50% of the rice-growing soils are Zn-deficient, and such rice grown on
these soils produce low yield and poor nutritional quality. According to Wissuwa
et al. (2008), the Zn-sufficient rice had about 40 mg/kg of Zn in its grains, while less
than 10 mg/kg of grain Zn is present in Zn-deficient rice. Soil pH especially alkalin-
ity, low redox potential of wetland, low organic carbon, and high carbonates primar-
ily limit the Zn availability for rice. However, zinc deficiency in rice crop is
becoming one of the important public health problems through malnutrition in vari-
ous rice-based food-adopting countries of Asia (Cakmak 2008). Alternatively, zinc-
solubilizing bacteria such as Gluconacetobacter from sugarcane and Bacillus and
Pseudomonas from wheat, rice, and soybean were capable of solubilizing zinc com-
pounds like phosphate, carbonate, and oxide (Saravanan et al. 2011).
These ZSB strains produce many low molecular weight organic acids particularly
gluconic acid which dissolute the insoluble Zn and reduce the pH of the soil solution
and thereby enhance the availability of zinc to crops (Hafeez et al. 2013). Inoculation
of Zn solubilizers has increased the Zn uptake of rice (Vaid et al. 2014), green gram
(Sharma et al. 2012), maize (Goteti et al. 2013), and wheat (Rana et al. 2012). The
zinc (Zn2C) available in soil is taken up through the root membrane via phytosidero-
phore transport mechanisms in rice (Bashir et al. 2010) and iron (Fe)-regulated
transporter and Zn-regulated transporter-like protein (ZIP) family (Guerinot 2000).
1.3 ffect of Plant Growth-Promoting Microbes for Crop

E
Production
The PGPMs have the ability to increase the availability of nutrients in plants (Glick
1995; Rodriguez and Fraga 1999). The methods by which this enhances take place
through fixation of nitrogen; solubilization of unavailable forms of nutrients such as
K, P, and Zn; siderophore production; and ammonia production (Trivedi et al. 2011;
Verma et al. 2013; Cakmak 2008; Sheng and He 2006; Gururani et al. 2012). PGPMs
have synthesis of phytohormones and vitamins, inhibition of plant ethylene synthe-
sis, improvement of nutrient uptake and enhanced stress resistance (Dobbelaere
et al. 2003). In order to stimulate plant growth, attempts have been made to use
more than one bacterial biofertilizer at a time. Improvement or modification of plant
growth and development can be achieved by the direct application of nutrients or
PGPR to seeds. The PGPR have a great potential to improve plant nutrient uptake,
especially when they are applied in combination (Artursson et al. 2004) (Table 1.1).
Table 1.1 Effect of different plant growth-promoting rhizobacteria on crops growth and yield
Crops PGPRs References
Arachis P. fluorescens Dey et al. (2004)
hypogaea
Beta vulgaris Pseudomonas aeruginosa Mark et al. (2005)
Brassica Pseudomonas putida Ahemad and Khan (2012)
compestris
Brassica napus Bacillus licheniformis Siddikeeet al. (2010)
Brassica nigra Azotobacter, Azospirillum Chauhan et al. (1995)
Brassica Azospirillum sp. Kalyani et al. (1996)
oleracea
Cicer arietinum Mesorhizobium sp., P. aeruginosa Verma et al. (2013)
Cucurbita pepo P. putida, B. lentus Habibi et al. (2011)
Fragaria x Bacillus, Pseudomonas Esitken et al. (2010)
ananassa
Helianthus Bacillus sp. Ekin (2010)
annuus
Juglans regia Pseudomonas chlororaphis, Arthrobacter Xuan et al. (2012)
pascens
Lolium perenne Enterobacter ludwigii Shoebitz et al. (2009)
Malus domestica Bacillus sp., Microbacterium, Karlidag et al. (2007) and
Agrobacterium rubi, B. subtilis Karakurt and Aslantas (2010)
Musa Azospirillum, Azotobacter Wange and Patil (1994)
paradisiaca
Oryza sativa Herbaspirillum, Azospirillum Gyaneshwar et al. (2001)
Oryza sativa and PSB isolates Maurya et al. (2015)
Triticum
aestivum
Piper nigrum P. fluorescens Diby et al.(2005), Paul et al.
(2001)
Rubus idaeus Bacillus sp. Orhan et al. (2006)
Solanum B. polymyxa, P. striata Kundu and Gaur (1980)
tuberosum
Triticum Bacillus megaterium, Serratia, Kumar et al. (2014, 2015a, b) and
aestivum Enterobacter, B. megaterium, A. Vanessa and Franco (2004)
chlorophenolicus, A. diazotrophicus, Karnwal (2012), Selvakumar et al.
Microbacterium sp. (2008), Renato de Freitas (2000),
Zahir et al. (2009), and Rana et al.
(2012)
Zhang et al. (2012)
Zea mays P. fluorescens (Humphris et al. (2005)
Zea mays and Enterobacter sp. Frank and Okonkwo (2012)
Oryza sativa
16 A. Kumar et al.
Furthermore, they improve plant growth efficiently under poor growth conditions
(Al-Karaki et al. 2004). Significantly enhanced yields of various crops have been
reported (Artursson et al. 2004), especially from semiarid climates and in nutrient-
poor and P-absorbing soils.
Karlidag et al. (2007) reported the root inoculation of apple trees with Bacillus
M3 and Microbacterium FS01, resulting in significant tree growth and yield.
Inoculation of maize and wheat with Azotobacter and Azospirillum increased plant
growth, nutrient uptake, and yield (Dobbelaere et al. 2001). Inoculation of plants
with Azospirillum could result in significant changes in various growth parameters,
such as increase in plant biomass, nutrient uptake, tissue N content, plant height,
leaf size, and root length of cereals (Bashan et al. 2004). Azospirillum spp. have the
ability to fix nitrogen, freely living in the soil or in association with roots of eco-
nomically important grasses; the positive effects of inoculation with Azospirillum
are mainly derived from phytohormone production and from induced morphologi-
cal changes in plant roots, resulting in enhanced mineral and water uptake (Burdman
et al. 2000).
1.4 ffect of PGPR on Maintenance of Soil Fertility, Soil

E
Health, and Nutrient Uptake
PGPR can change the plant physiology and certain nutritional and physical proper-
ties of rhizosphere soil and indirectly influence the colonization patterns of soil
microorganisms in that particular region. Inoculation of rhizobacteria increased
uptake of nutrient elements like Ca, K, Fe, Cu, Mn, and Zn by plants through stimu-
lation of proton pump ATPase (Mantelin and Touraine 2004). Reports are available
on the combinations of Bacillus and Microbacterium inoculants to improve the
uptake of the mineral elements by crop plants (Karlidag et al. 2007). This increase
in nutrient uptake by plants might be explained through organic acid production by
the plants and PGPRs, decreasing the soil pH in the rhizosphere. Ample evidences
are there on the maintenance of soil fertility by the rhizobacteria isolates to increase
the availability of nutrients for plants (Phillips 1980; Glass 1989).
Solubilization of unavailable forms of nutrients is one of the essential criteria in
facilitating the transport of most of these nutrients (Glick 1995). In organic farming
we feed the soil micro- and macroorganisms, which deliver a smorgasbord of min-
erals, vitamins, and other nutrients to the crop at a metered pace.
Singh et al. (2007) reported that the organic farming enhanced soil organic car-
bon, available phosphorus content, and microbial population/enzymatic activity of
soil, thus making it sustainable for organic crop production. Soil microbial
population (Actinomycetes, bacteria, fungi, and BGA) enhanced due to the applica-
tion of organic amendments in comparison to absolute control as well as recom-
mended fertilizer application that in turn resulted in a notable enhancement in soil
dehydrogenase and phosphatase enzyme activity (Maurya et al. 2011, 2012).
Soil organic carbon and available phosphorus contents were also found to be
significantly increased due to organic farming practice over control as well as chem-
ical fertilizer application. Organic farming production system aims at promoting
and enhancing agroecosystem health, biodiversity, biological cycles, and soil bio-
logical activities. Crop plants remove varying amounts of different nutrients from
soil, and to compensate the loss from the soil, organic amendments rich in nutrients
must be added (Singh and Mandal 2000).
1.5 Future Prospectuses
Nowadays it is a major challenge to understand the rhizosphere zone modification

of PGPMs diversity, root colonization ability, mechanisms of action, and formula-
tion, and their application should facilitate their development as reliable compo-
nents for the management of eco-friendly environment and sustainable agricultural
systems. The various latest genetic modification tools applied in PGPMs which play
importation role and release nutrients from fixed form to available form in plant and
improved germplasm, breeding, and field testing should very fast move genetic
modification research and technology into future generation agriculture. The gene
modification through recombinant DNA technology is used to a feasible approach
for increasing the PGPMs’ strain efficiency.
Gene cloning approaches involved in mineral potassium solubilization, phos-
phate solubilization, and zinc solubilization such as those influencing the various
levels of efficiency for synthesis of different organic acids will be the first step in
such a gene modification program. Future work will be planned to test mixtures of
the selected various solubilizer PGPMs as biocontrol against multiple plant patho-
gens in bioassays. Sequencing of a large number of microbial genomes has pro-
vided a powerful tool for studying the biology of PGPMs.
Genomic-based approaches can facilitate better and direct research strategies to
express the mechanisms on microbial pathogenicity toward agriculture develop-
ment. Diverse types of stress factors, such as salinity, drought, water logged, nutri-
ent deficits, pests, diseases, and contamination, cause detrimental effects on the
functionality/productivity of agricultural systems that must be controlled through
PGPMs either directly or indirectly via a signaling network. The urgent need
requires to apply microorganisms for restoration of polluted soil through bioreme-
diation technology. The new molecular biology would be very helpful to develop
novel gene-based bio-industries to preserve and care for the rich microbial diversity
in the world. Farming community in the world struggling to adapt against the cli-
mate change with limited resources of land and water, an enhancement in plant
growth and yield with climate-smart farming techniques can create novel
opportunities that would further conserve water and soil fertility under sustainable
agricultural systems.
18 A. Kumar et al.
1.6 Conclusions
PGPMs reside near the rhizosphere/or plant root. These have multiple plant growth-
promoting characters like IAA production, siderophore production, HCN produc-
tion, and N2-fixing and solubilization of phosphate, potassium, and zinc in soil.
They are widely used as biofertilizers in a number of crops which increased the
plant growth promotion, yield, and nutrient status in grains and plants. They main-
tain soil health and fertility and also decrease the chemical and pesticide applica-
tion. They are environment-friendly and cost-effective technology at the farmer’s
field.
Acknowledgments The authors would like to thank three anonymous reviewers for providing
substantial critical comments which helped to improve the quality of our paper.
References
Abd El-Fattah DA, Ewedab WE, Zayed MS, Hassaneina MK (2013) Effect of carrier materi-
als, sterilization method, and storage temperature on survival and biological activities of
Azotobacter chroococcum inoculants. Ann Agric Sci 58:111–118
Adesemoye AO, Kloepper JW (2009) Plant-microbes interactions in enhanced fertilizer-use effi-
ciency. Appl Microbiol Biotechnol 85:1–12
Ahemad M, Khan MS (2012) Effect of fungicides on plant growth promoting activities of phos-
phate solubilizing Pseudomonas putida isolated from mustard (Brassica compestris) rhizo-
sphere. Chemosphere 86:945–950
Ahmad F, Ahmad I, Khan MS (2008) Screening of free-living rhizospheric bacteria for their mul-
tiple plant growth promoting activities. Microbiol Res 163:173–181
Ahmad M, Nadeem SM, Naveed M, Zahir ZA (2016) Potassium-solubilizing bacteria and their
application in agriculture. In: Meena VS, Maurya BR, Verma JP, Meena RS (eds) Potassium
solubilizing microorganisms for sustainable agriculture. Springer, New Delhi, pp 293–313.
https://doi.org/10.1007/978-81-322-2776-2_21
Akhtar MS, Siddiqui ZA (2009) Effects of phosphate solubilizing microorganisms and Rhizobium
sp. on the growth, nodulation, yield and root-rot disease complex of chickpea under field condi-
tion. Afr J Biotechnol 8:3489–3496
Aleksandrov VG, Blagodyr RN, Iiiev IP (1967) Liberation of phosphoric acid from apatite by
silicate bacteria. Mikrobiyol Zh (Kiev) 29:111–114
Al-Karaki G, Mc Michael B, Zak J (2004) Field response of wheat to arbuscular mycorrhizal fungi
and drought stress. Mycorrhiza 14:263–269
Araujo ASF, Santos VB, Monteiro RTR (2008) Responses of soil microbial biomassand activity
for practices of organic and conventional farming systemsin Piauistate, Brazil. Eur J Soil Biol
44:225–230
Artursson V, Finlay RD, Jansson JK (2004) Interactions between arbuscular mycorrhizal fungi and
bacteria and their potential for stimulating plant growth. Env Microbiol 8:1–10
Asghar H, Zahir ZA, Arshad M, Khaliq A (2002) Relationship between in vitro production of
auxins by rhizobacteria and their growth-promoting activities in Brassica juncea L. Biol Fertil
Soils 35:231–237
Askary M, Mostajeran A, Amooaghaei R, Mostajeran M (2009) Influence of theco-inoculation
Azospirillum brasilense and Rhizobium meliloti plus 2, 4-Don grain yield and N, P, K content
of Triticum aestivum (cv. Baccros and Mahdavi). Am Eurasian J Agri Environ Sci 5:296–307
Ayres E, Steltzer H, Berg S, Wall DH (2009) Soil biota acceleratedecomposition in high-elevation

forests by specializing in thebreakdown of litter produced by the plant species abovethem.
J Ecol 97:901–912
Ayub M, Tahir M, Nadeem MA, Zubair MA, Tariq M, Ibrahim M (2010) Effect of nitrogen appli-
cations on growth, forage yield and quality of three cluster bean varieties. Pak J Life Social
Sci 8:111–116
Aziz G, Bajsa N, Haghjou T, Taule C, Valverde A, Mariano J, Arias A (2012) Abundance, diversity
and prospecting of culturable phosphatesolubilizing bacteria on soils under crop–pasture rota-
tions in a no-tillageregime in Uruguay. Appl Soil Ecol 61:320–326
Badri DV, Vivanco JM (2009) Regulation and function of rootexudates. Plant Cell Environ
32:666–681
Bahadur I, Meena VS, Kumar S (2014) Importance and application of potassic biofertilizer in
Indian agriculture. Int Res J Biol Sci 3:80–85
Bahadur I, Maurya BR, Kumar A, Meena VS, Raghuwanshi R (2016a) Towards the soil sustain-
ability and potassium-solubilizing microorganisms. In: Meena VS, Maurya BR, Verma JP,
Meena RS (eds) Potassium solubilizing microorganisms for sustainable agriculture. Springer,
New Delhi, pp 225–266. https://doi.org/10.1007/978-81-322-2776-2_18
Bahadur I, Maurya BR, Meena VS, Saha M, Kumar A, Aeron A (2016b) Mineral release dynamics
of tricalcium phosphate and waste muscovite by mineral-solubilizing rhizobacteria isolated
from indo-gangetic plain of India. Geomicrobiol J. https://doi.org/10.1080/01490451.2016.1
219431
Bais HP, Weir TL, Perry LG, Gilroy S, Vivanco JM (2006) Therole of root exudates in rhizosphere
interactions with plantsand other organisms. Annu Rev Plant Biol 57:233–266
Bakker PAHM, Bakker AW, Marugg JD, Weisbeek PJ, Schippers B (1987) Bioassay for studying
the role of siderophores in potato growth stimulation by Pseudomonas spp. in short potato rota-
tions. Soil Biol Biochem 19:443–449
Bar-Ness E, Hadar Y, Chen Y, Romheld V, Marschner H (1992) Short-term effects of rhizosphere
microorganisms on Fe uptake from microbial siderophores by maize and oat. Plant Physiol
100:451–456
Basak BB, Biswas DR (2010) Co-inoculation of potassiumsolubilizing and nitrogen fixing bacte-
ria onsolubilization of waste mica and their effect on growthpromotion and nutrient acquisition
by a forage crop. Biol Fertil Soils 46:641–648
Bashan Y, Holguin G, Bashan LE (2004) Azospirillum-plant relationships: agricultural, physi-
ological, molecular and environmental advances (1997–2003). Can J Microbiol 50:521–577
Bashir K, Ishimaru Y, Nishizawa N (2010) Iron uptake and loading into rice grains. Rice 3:122–130
Benizri E, Baudoin E, Guckert A (2001) Root colonization by inoculated plant growth promoting
rhizobacteria. Biocon Sci Technol 11:557–574
Berg G, Smalla K (2009) Plant species and soil type cooperativelyshape the structure and function
of microbial communities inthe rhizosphere. FEMS Microbiol Ecol 68:1–13
Bhattacharyya PN, Jha DK (2012) Plant growth-promoting rhizobacteria (PGPR): emergence in
agriculture. World J Microbiol Biotechnol 28:1327–1350
Blumer C, Haas D (2000) Mechanism, regulation, and ecological role of bacterial cyanide biosyn-
thesis. Arch Microbiol 173:170–177
Boopathi E, Rao KS (1999) A siderophore from Pseudomonas putida type A1: structural and bio-
logical characterization. BBA-Protein Struc M 1435:30–40
Burd GI, Dixan DG, Glick BR (1998) A plant growth promoting bacterium that decreases nickel
toxicity in seedlings. App Env Microbiol 64:3663–3668
Burdman S, Jurkeviteh E, Okon Y (2000) Recent advances in the use Plant Growth Promoting
Rhizobacteria (PGPR) in agriculture. In: Subba Rao NS, Dommergues (eds) Microbial inter-
actions in agriculture and forestry, vol vol II. Science Publishers Inc., Plymouth, pp 229–250
Cakmak I (2008) Enrichment of cereal grains with zinc: agronomic or genetic biofortification?
Plant Soil 302:1–17
20 A. Kumar et al.
Cakmakci R, Dönmez F, Aydın A, Ahin FS (2006) Growth promotion of plants by plant growth-
promoting rhizobacteria under greenhouse and two different field soil conditions. Soil Biol
Biochem 38:1482–1487
Çakmakçi R, Erat M, Erdogan U, Dönmez MF (2007) The influence of plant growth–promoting
rhizobacteria on growth and enzyme activities in wheat and spinach plants. J Plant Nutr Soil
Sci 170:288–295
Cattelan AJ, Hartel PG, Fuhrmann JJ (1999) Screening of plant growth promoting rhizobacteria to
promote early soybean growth. Soil Sci Soc Am J 63:1670–1680
Chauhan DR, Paroda S, Kataria OP, Singh KP (1995) Response of Indian mustard (Brassicajuncea)
to biofertilizers and nitrogen. Indian JAgron 40:86–90
Choudhury MA, Kennedy IR (2004) Prospects and potentials for system ofbiological nitrogen
fixation in sustainable rice production. Biol Fertil Soils 39:219–227
Colwell RR, Grimes DJ (2000) Nonculturable microorganisms in the environment. ASM Press,
Washington, DC
Crowley DE (2006) Microbial siderophores in the plant rhizosphere. In: Barton LL, Abadía J (eds)
Iron nutrition in plants and rhizospheric microorganisms. Springer, Netherlands, pp 169–198
Crowley DE, Gries D (1994) Modeling of iron availability in the plant rhizosphere. In: Manthey
JA, Crowley DE, Luster DG (eds) Biochemistry of metal micronutrients in the rhizosphere.
Lewis Publishers, Boca Raton, pp 199–224
Das I, Pradhan M (2016) Potassium-solubilizing microorganisms and their role in enhancing soil
fertility and health. In: Meena VS, Maurya BR, Verma JP, Meena RS (eds) Potassium solubiliz-
ing microorganisms for sustainable agriculture. Springer, New Delhi, pp 281–291. https://doi.
org/10.1007/978-81-322-2776-2_20
De Freitas JR, Banerjee MR, Germida JJ (1997) Phosphate-solubilizing rhizobacteria enhance
the growth and yield but not phosphorus uptake of canola (Brassica napus L.) Biol Fert Soils
24:358–364
Delalande L, Faure D, Raffoux A, Uroz S, D’Angelo-Picard C, Elasri M (2005) N-hexanoyl-
L-homoserine lactone, amediator of bacterial quorum-sensing regulation, exhibits plant-
dependent stability and may be inactivated by germinating Lotus corniculatus seedlings.
FEMS Microbiol Ecol 52:13–20
Devi KK, Seth N (2007) Kothamasi S and Kothamasi D, Hydrogen cyanide producing rhizobac-
teria kill subterranean termite Odontotermes obesus (Rambur) by cyanide poisoning under
in vitro conditions. Cur Microbiol 54: 74–78
Dey R, Pal KK, Bhatt DM, Chauhan SM (2004) Growth promotion and yield enhancement of pea-
nut (Arachis hypogaea L.) by application of plant growth-promoting rhizobacteria. Microbiol
Res 159(4):371–394
Dhanasekar R, Dhandapani R (2012) Effect of biofertilizers on the growth of Helianthus annuus.
Int J plant Ani Environ Sci 2:143–147
Diby P, Sarma YR, Srinivasan V, Anandaraj M (2005) Pseudomonas fluorescence mediated
vigourin black pepper (Piper nigrum L.) under greenhouse cultivation. Annals Microbiol
55(3):171–174
Dobbelaere S, Croonenborghs A, Thys A, Ptacek D, Vanderleyden J, Dutto P, Labandera-Gonzalez
C, Caballero-Mellado J, Aguirre JF, Kapulnik Y, Brener S, Burdman S, Kadouri D, Sarig S,
Okon Y (2001) Responses of agronomically important crops to inoculation with Azospirillum.
Aust J Plant Physiol 28:871–879
Dobbelaere S, Vanderleyden J, Okon Y (2003) Plant growth-promoting effects of diazotrophs in
the rhizosphere. Crit Rev Plant Sci 22:107–149
Dogan K, Kamail Celik I, Mustafa Gok M, Ali C (2011) Effect of different soil tillage methods on
rhizobial nodulation, biomass and nitrogen content of second crop soybean. Afr J Microbiol
Res 5:3186–3194
Dominguez-Nunez JA, Benito B, Berrocal-Lobo M, Albanesi A (2016) Mycorrhizal fungi: role
in the solubilization of potassium. In: Meena VS, Maurya BR, Verma JP, Meena RS (eds)
Potassium solubilizing microorganisms for sustainable agriculture. Springer, New Delhi,

pp 77–98. https://doi.org/10.1007/978-81-322-2776-2_6
Doran JW, Zeiss MR (2000) Soil health and sustainability: managing the biotic component of soil
quality. Appl Soil Ecol 15:3–11
Dotaniya ML, Meena VD, Basak BB, Meena RS (2016) Potassium uptake by crops as well as
microorganisms. In: Meena VS, Maurya BR, Verma JP, Meena RS (eds) Potassium solubiliz-
org/10.1007/978-81-322-2776-2_19
Duijff BJ, de Kogel WJ, Bakker PAHM, Schippers B (1994) Influence of pseudobactin 358 on the
iron nutrition of barley. Soil Biol Biochem 26:1681–1688
Egamberdieva D, Kamilova F, Validov S, Gafurova L, Kucharova Z, Lugtenberg B (2008) High
incidence of plant growth stimulating bacteria associated with the rhizosphere of wheat grown
on salinated soil in Uzbekistan. Environ Microbiol 10:1–9
Egamberdiyeva D (2005) Plant-growth-promoting rhizobacteria isolated from a Calcisol in a semi-
arid region of Uzbekistan: biochemical characterization and effectiveness. J Plant Nutr Soil Sci
168:94–99
Ekin Z (2010) Performance of phosphate solubilizing bacteria for improving growth and yield of
sunflower (Helianthus annuus L.) in the presence of phosphorus fertilizer. Afr J Biotechnol
9:3794–3800
Esitken A, Yildiz HE, Ercisli S, Donmez MF, Turan M, Gunes A (2010) Effects of plant growth
promoting bacteria (PGPB) on yield, growth and nutrient contents of organically grown straw-
berry. Sci Hort 124:62–66
Fernandez LA, Zalba P, Gomez MA, Sagarday MA (2007) Phosphate solubilization activity of
bacterial strains in soil and their effect on soybean growth under greenhouse conditions. Biol
Fertil Soils 43:805–809
Frank O, Okonkwo J (2012) Some characteristics of a plant growth promoting Enterobacter sp.
isolated from the roots of maize. Adv Microbiol 2:368–374
Frankenberger WT Jr, Arshad M (1995) Phytohormones in soil: microbial production and func-
tion. Marcel Dekker, New York
Gadd GM (2007) Geomycology: biogeochemical transformations of rocks, minerals, metals and
radionuclides by fungi, bio-weathering and bioremediation. Mycol Res 111:3–49
Gaind S, Mathur RS, Tilak KVBR (2000) Phosphate solubilizing microorganisms. In: Yadav AK,
Motsara MR, Ray Chaudhury S (eds) Recent advances in biofertilizer technology. Society for
Promotion and Utilization Resources and Technology, New Delhi, pp 190–206
Gao MS, Teplitski M, Robinson JB, Bauer WD (2003) Production of substances by Medicago
truncatula thataffect bacterial quorum sensing. Mol Plant-Microbe Interact 16:827–834
Gaur R, Shani N, Kawaljeet Johri BN, Rossi P, Aragno M (2004) Diacetyl phloroglucinol-
producing Pseudomonas do not influence AM fungi in wheat rhizosphere. Cur Sci 86:453–457
Gholami A, Shahsavani S, Nezarat S (2009) The effect of Plant Growth Promoting Rhizobacteria
(PGPR) on germination seedling growth and yield of maize. Int J Biol Life Sci 5:1
Glass ADM (1989) Plant nutrition: an introduction to current concepts. Jones and Bartlett
Publishers, Boston, p 234
Glick BR (1995) The enhancement of plant growth by free living bacteria. Can J Microbiol
41:109–117
Glick BR, Penrose D, Li J (1998) A model for the lowering of plant ethylene concentrations by
plant growth-promoting bacteria. J Theo Biol 190:63–68
Glick BR, Patten CL, Holguin G, Penrose DM (1999) Biochemical and genetic mechanism used
by plant growth promoting bacteria. Imperial College Press, London
Goteti PK, Emmanuel LDA, Desai S, Shaik MHA (2013) Prospective zinc solubilizing bacteria for
enhanced nutrient uptake and growth promotion in maize (Zeamays L.) Int J Microbiol. https://
doi.org/10.1155/2013/869697
Greenough DR, Batson WE (1989) Potential for Bacillus subtilis as a bioprotectant of cotton seed-
lings in soil infested with Rhizoctonia solani. Phytopathology 79:373
22 A. Kumar et al.
Grichko VP, Glick BR (2001) Amelioration of flooding stress by ACC deaminase-containing plant
growth-promting bacteria. Plant Physiol Biochem 39:11–17
Grossman JM, Schipanski ME, Sooksanguan T, Drinkwater LE (2011) Diversity ofrhizobia nodu-
lating soybean Glycine max (Vinton) varies under organicand conventional management. Appl
Soil Ecol 50:14–20
Guerinot ML (2000) The ZIP family of metaltransporters. Biochem Biophys Acta 1465:190–198
Gururani MA, Upadhyaya CP, Baskar V, Venkatesh J, Nookaraju A, Park SW (2012) Plant growth-
promoting rhizobacteria enhance abiotic stress tolerance in Solanumtuberosum through induc-
ing changes in the expression of ROS-scavenging enzymes and improved photosynthetic
performance. J Plant Growth Regul. https://doi.org/10.1007/s00344-012-9292-6
Gutierrez-Manero FJ, Ramos-Solano B, Probanza A, Mehouachi J, Tadeo FR, Talon M (2001)
The plant-growth promoting rhizobacteria Bacillus pumilus and Bacillus licheniformis produce
high amounts of physiologically active gibberellins. Physiol Plant 111:206–211
Gyaneshwar P, James EK, Mathan N, Reddy PM, Reinhold-Hurek B, Ladha JK (2001) Endophytic
colonization of rice by a diazotrophic strain of Serratia marcescens. J Bacteriol 183:2634–2645
Habibi A, Heidari G, Sohrabi Y, Badakhshan H, Mohammadi K (2011) Influence of bio, organic
and chemical fertilizers on medicinal pumpkin traits. J Med Plant Res 5(23):5590–5597
Hafeez F, Abaid-Ullah M, Hassan M (2013) Plant growth-promoting rhizobacteria as zinc mobiliz-
ers: a promising approach for cereals biofortification. In: Maheshwari DK, Saraf M, Aeron A
(eds) Bacteria in agrobiology: crop productivity. Springer, Berlin, pp 217–235
Halda-Alija L (2003) Identification of indole-3-acetic acid producing freshwater wetland rhizo-
sphere bacteria associated with Juncus effusus L. Can J Microbiol 49:781–787
Hiifte M, Vande Woestyne M, Verstraete W (1994) Role of siderophores in plant growth promotion
and plant protection by fluorescent pseudomonads. In: Manthey JA, Crowley DE, Luster DG
(eds) Biochemistry of metal micronutrients in the rhizosphere. Lewis Publishers, Boca Raton,
pp 81–92
Högberg MN, Högberg P, Myrold DD (2006) Is microbial community composition in boreal forest
soils determined by pH,C-to-N ratio, the trees, or all three? Oecologia 150:590–601
Holguin G, Glick BR (2001) Expression of the ACC deaminase gene from Enterobacter cloacae
UW4 in Azospirillum brasilense. Microb Ecol 41:281–288
Humphris SN, Bengough AG, Griffiths BS, Kilham K, Rodger S, Stubbs V, Valentine TA, Young
IM (2005) Root cap influences root colonization by Pseudomonas fluorescens SBW25 on
maize. FEMS Microbiol Ecol 54:123–130
Hussain N, Mujeeb F, Tahir M, Khan GD, Hassan NM, Bari A (2002) Effectiveness of rhizobium
under salinity stress. Asian J Plant Sci 1:12–14
Hutchins SR, Davidson MS, Brierey JA, Brierley CL (1986) Microorganisms inreclamation of
metals. Annu Rev Microbiol 40:311–336
Iavicoli A, Boutet E, Buchala A, Métraux JP (2003) Induced systemic resistance in Arabidopsis
Thaliana in response toroot inoculation with pseudomonas fluorescens CHA0. Mol Plant-
Micro Int 16:851–858
Idris EE, Iglesias DJ, Talon M, Borriss R (2007) Tryptophan dependent production of indole-
3-acetic acid (IAA) affects level of plant growth promotion by Bacillus amyloliquefaciens
FZB42. Mol Plant-Microb Interact 20:619–626
Idris A, Labuschagne N, Korsten L (2009) Efficacy of rhizobacteria for growth promotion in sor-
ghum under greenhouse conditions and selected modes of action studies. J Agri Sci 147:17–30
Ilyas N, Bano A, Iqbal S, Raja NI (2012) Physiological, biochemical and molecular characteriza-
tion of Azospirillum spp. isolated from maize under water stress. Pak J Bot 44:71–80
Jaiswal DK, Verma JP, Prakash S, Meena VS, Meena RS (2016) Potassium as an important plant
nutrient in sustainable agriculture: a state of the art. In: Meena VS, Maurya BR, Verma JP,
Jat LK, Singh YV, Meena SK, Meena SK, Parihar M, Jatav HS, Meena RK, Meena VS (2015)
Does integrated nutrient management enhance agricultural productivity? J Pure Appl Microbiol
9(2):1211–1221
Jha Y, Subramanian RB (2016) Regulation of plant physiology and antioxidant enzymes for alle-
viating salinity stress by potassium-mobilizing bacteria. In: Meena VS, Maurya BR, Verma JP,
Jousset A, Rochat L, Lanoue A, Bonkowski M, Keel C, Scheu S (2011) Plants respond to pathogen
infection by enhancing the antifungal gene expression of root-associated bacteria. Mol Plant-
Microbe Interact 24:352–358
Kalyani DP, Ravishankar C, Manohar PD (1996) Studies on the effect of nitrogen and
Azospirillumon growth and yield of cauliflower. South India Horti 44(5–6):147–149
Kamilova F, Kravchenko LV, Shaposhnikov AI, Azarova T, Makarova N, Lugtenberg B (2006)
Organic acids, sugars, and L-tryptophane in exudates of vegetables growing onstonewool and
their effects on activities of rhizospherebacteria. Mol Plant-Microbe Interact 19:250–256
Kampert M, Strzelczyk E, Pokojska A (1975) Production of auxins by bacteria isolated from the
roots of pine seedlings (Pinus silvestris L.) and from soil. Acta Microbiol Polonica 7:135–143
Karakurt H, Aslantas R (2010) Effects of some plant growth promoting rhizobacteria treated twice
on flower thinning, fruit set and fruit properties on apple. Afri J of Agri Res 5(5):384–388
Karlidag H, Esitken A, Turan M, Sahin F (2007) Effects of root inoculation of plant growth pro-
moting rhizobacteria (PGPR) on yield, growth and nutrient element contents of leaves of apple.
Sci Hort 114:16–20
Karnwal A (2012) Screening of plant growth–promoting rhizobacteria from maize (Zea mays) and
wheat (Triticum aestivum). AJFAND 12:6170–6185
Katyal J, Sharma C (1991) DTPA extractable and total Zn, Cu, Mn and Fe in Indiansoils and their
association with soil properties. Geoderma 49:165–179
Kennedy AC (1999) Bacterial diversity in agroecosystems. Agric Ecosyst Environ 74:65–76
Khandelwal SR, Manwar AV, Chaudhari BL, Chincholkar SB (2002) Siderophoregenic bradyrhi-
zobia boost yield of soybean. Appl Biochem Biotechnol:155–168
Kim KY, Jordan D, McDonald GA (1998) Enterobacter agglomerans, phosphate solubilizing bac-
teria, and microbial activity in soil: effect of carbon sources. Soil Biol Biochem 30:995–1003
Kirk JL, Beaudette LA, Hart M, Moutoglis P, Khironomos JN, Lee H, Trevors JT (2004) Methods
of studying soil microbialdiversity. J Microbiol Methods 58:169–188
Kole SC, Hajra JN (1997) Isolation and evaluation of tricalciumand rock phosphate solubiliz-
ing microorganisms fromacidic terai and lateritic soils of West Bengal. J Inter academician
1(3):126–128
Kole SC, Hajra JN (1998) Occurrence and acidity of tricalciumphosphate and rock phosphatesolu-
bilizing microorganisms inmechanical compost plants of Calcutta and an alluvial soil of West
Bengal. Environ Ecol 16(2):344–349
Kucey RMN, Janzen HH, Legett ME (1989) Microbially mediated increases in plant available
phosphorus. Adv Agron 42:199–228
Kuffner M, Puschenreiter M, Wieshammer G, Gorfer M, Sessitsch A (2008) Rhizosphere bacteria
affect growth and metal uptake of heavy metal accumulating willows. Plant Soil 304:35–44
Kuklinsky-Sobral J, Araujo WL, Mendes R, Geraldi IO, Pizzirani-Kleiner AA, Azevedo JL (2004)
Isolation and characterization of soybean-associated bacteria and their potential for plant
growth promotion. Environ Microbiol 6:1244–1251
Kumar V, Narula N (1999) Solubilization of inorganic phosphates and growth emergence of wheat
as affected by Azotobacter chroococcum mutants. Biol Fertil Soils 28:301–305
Kumar A, Maurya BR, Raghuwanshi R (2014) Isolation and characterization of PGPR and their
effect on growth, yield and nutrient content in wheat (Triticum aestivum L.) Biocatal Agri
Biotechnol 3:121–128
24 A. Kumar et al.
Kumar A, Bahadur I, Maurya BR, Raghuwanshi R, Meena VS, Singh DK, Dixit J (2015a) Does
a plant growth-promoting rhizobacteria enhance agricultural sustainability? J Pure Appl
Microbiol 9:715–724
Kumar A, Maurya BR, Raghuwanshi R (2015b) Characterization of bacterial strains and their
impact on plant growth, yield of wheat and microbial populations of soil. Afri J Agri Res
10(12):1367–1375
Kumar A, Patel JS, Bahadur I, Meena VS (2016a) Molecular mechanisms of potassium solubiliz-
ing microorganisms and their effect for crop production under sustainable agriculture. Springer
book Potassium Solubilizing Microorganisms for Sustainable Agriculture pp 61-75ISBN No.
978-81322-2776-2
Kumar A, Meena R, Meena VS, Bisht JK, Pattanayak A (2016b) Towards the stress management
and environmental sustainability. J Clean Prod 137:821–822
Kumar A, Patel JS, Bahadur I, Meena VS (2016c) The molecular mechanisms of KSMs for
enhancement of crop production under organic farming. In: Meena VS, Maurya BR, Verma JP,
Kumar A, Maurya BR, Raghuwanshi R, Meena VS, Islam MT (2017) Co-inoculation with
Enterobacter and Rhizobacteria on yield and nutrient uptake by wheat (Triticum aestivum
L.) in the alluvial soil under indo-gangetic plain of India. J Plant Growth Regul. https://doi.
org/10.1007/s00344-016-9663-5
Kundu BS, Gaur AC (1980) Effect of phosphorbacteriaon the yield and phosphate uptake ofpotato
crop. Cur Sci 49:159–160
Ladha JK, Kundu DK (1997) Legumes for sustaining soil fertility in lowland rice. In: Rupela
OP, Johansen C, Henidge DF (eds) Extending nitrogen fixation research. International Crops
Research Institute for the Semi-Arid Tropics, Patancheru, pp 76–102
Li FC, Li S, Yang YZ, Cheng LJ (2006) Advances in thestudy of weathering products of primary
silicate minerals, exemplified by mica and feldspar. Acta Petrol Mineral 25:440–448
Lifshitz R, Kloepper JM, Kozlowski M, Simonson C, Carlso J, Tipping EM (1987) Growth pro-
motion of canola (rapeseed) seedlings by a strain of Pseudomonas putida under gnotobiotic
conditions. Can J Microbiol 33:390–397
Liu ST, Perry KL, Schardl CL, Kado CI (1982) Agrobacterium Ti plasmid indoleacetic acid gene
is required for crown gall oncogenesis. Proc Natl Acad Sci U S A 79:2812–2816
Loper JE, Schroth MN (1986) Influence of bacterial sources on indole-3 acetic acid on root elonga-
tion of sugarbeet. Phytopathology 76:386–389
Lynch JM (1990) Introduction: some consequences of microbialcompetence for plant and soil. In:
Lynch JM (ed) The rhizosphere. Wiley, Chichester, pp 1–10
Madritch MD, Lindroth RL (2011) Soil microbial communitiesadapt to genetic variation in leaf
litter inputs. Oikos 120:1696–1704
Mali GV, Bodhankar MG (2009) Antifungal and phytohormone productionpotential of Azotobacter
chroococcum isolates from groundnut (Arachis hypogea L.) rhizosphere. Asian J Exp Sci
23:293–297
Mantelin S, Touraine B (2004) Plant growth-promoting bacteria and nitrate availability: impacts
on root development and nitrate uptake. J Exp Bot 55:27–34
Mark GL, Dow JM, Kiely PD, Higgins H, Haynes J, Baysse C, Abbas A, Foley T, Franks A,
Morrissey J, O'Gara F (2005) Transcriptome profiling of bacterialresponses to root exu-
dates identifies genes involvedinmicrobe-plant interactions. Proc Natl Acad Sci USA
102:17454–17459
Masalha J, Kosegarten H, Elmaci Ö, Mengel K (2000) The central role of microbial activity for
iron acquisition in maize and sunflower. Biol Fertil Soils 30:433–439
Masood S, Bano A (2016) Mechanism of potassium solubilization in the agricultural soils by the
help of soil microorganisms. In: Meena VS, Maurya BR, Verma JP, Meena RS (eds) Potassium
https://doi.org/10.1007/978-81-322-2776-2_10
Mathesius U, Mulders S, Gao MS, Teplitski M, Caetano-Anolles G, Rolfe BG (2003) Extensive and
specific responses ofa eukaryote to bacterial quorum-sensing signals. PNAS 100:1444–1449
Maurya BR, Vimal S, Dhyani PP, Kumar A (2011) Influence of altitude on activities of soil health
bioindicator Β-glucosidase and urease in agricultural soils of Almora District of Central
Himalaya. Res J Soil Microbiol 4(1):1–9
Maurya BR, Kumar A, Raghuwanshi R, Vimal S (2012) Diversity of Azotobacter and Azospirillum
in rhizosphere of different crop rotations in eastern Uttar Pradesh of India. Res J Microbiol
7(2):123–130
Maurya BR, Meena VS, Meena OP (2014) Influence of Inceptisol and Alfisol’s potassium solubi-
lizing bacteria (KSB) isolates on release of K from waste mica. Vegetos 27:181–187
McGill WB, Cole CV (1981) Comparative aspects of cycling of organic C, N, S and P through soil
organic matter. Geoderma 26:267–268
Meena OP, Maurya BR, Meena VS (2013a) Influence of K-solubilizing bacteria on release of
potassium from waste mica. Agric Sust Dev 1:53–56
Meena VS, Maurya BR, Bohra JS, Verma R, Meena MD (2013b) Effect of concentrate manure
and nutrient levels on enzymatic activities and microbial population under submerged rice in
alluvium soil of Varanasi. Crop Res 45(1, 2 & 3):6–12
Meena VS, Maurya BR, Verma R, Meena RS, Jatav GK, Meena SK, Meena SK (2013c) Soil
microbial population and selected enzyme activities as influenced by concentrate manure and
inorganic fertilizer in alluvium soil of Varanasi. The Bioscan 8(3):931–935
Meena VS, Maurya BR, Bahadur I (2014a) Potassium solubilization by bacterial strain in waste
mica. Bang J Bot 43:235–237
Meena VS, Maurya BR, Verma JP (2014b) Does a rhizospheric microorganism enhance K+ avail-
ability in agricultural soils? Microbiol Res 169:337–347
Meena RS, Meena VS, Meena SK, Verma JP (2015a) The needs of healthy soils for a healthy
world. J Clean Prod 102:560–561
Meena RS, Meena VS, Meena SK, Verma JP (2015b) Towards the plant stress mitigate the agricul-
tural productivity: a book review. J Clean Prod 102:552–553
Meena VS, Maurya BR, Meena RS (2015c) Residual impact of wellgrow formulation and NPK on
growth and yield of wheat (Triticum aestivum L.) Bangladesh J Bot 44(1):143–146
Meena VS, Maurya BR, Verma JP, Aeron A, Kumar A, Kim K, Bajpai VK (2015d) Potassium
solubilizing rhizobacteria (KSR): isolation, identification, and K-release dynamics from waste
mica. Ecol Eng 81:340–347
Meena VS, Meena SK, Verma JP, Meena RS, Ghosh BN (2015e) The needs of nutrient use effi-
ciency for sustainable agriculture. J Clean Prod 102:562–563. https://doi.org/10.1016/j.
jclepro.2015.04.044
Meena VS, Verma JP, Meena SK (2015f) Towards the current scenario of nutrient use efficiency in
crop species. J Clean Prod 102:556–557. https://doi.org/10.1016/j.jclepro.2015.04.030
Meena RK, Singh RK, Singh NP, Meena SK, Meena VS (2016a) Isolation of low temperature sur-
viving plant growth-promoting rhizobacteria (PGPR) from pea (Pisum sativum L.) and docu-
mentation of their plant growth promoting traits. Biocatal Agric Biotechnol 4:806–811
Meena RS, Bohra JS, Singh SP, Meena VS, Verma JP, Verma SK, Sihag SK (2016b) Towards the
prime response of manure to enhance nutrient use efficiency and soil sustainability a current
need: a book review. J Clean Prod 112(1):1258–1260
Meena SK, Rakshit A, Meena VS (2016c) Effect of seed bio-priming and N doses under varied
soil type on nitrogen use efficiency (NUE) of wheat (Triticum aestivum L.) under greenhouse
conditions. Biocatal Agric Biotechnol 6:68–75
Meena VS, Bahadur I, Maurya BR, Kumar A, Meena RK, Meena SK, Verma JP (2016d) Potassium-
solubilizing microorganism in evergreen agriculture: an overview. In: Meena VS, Maurya BR,
Verma JP, Meena RS (eds) Potassium solubilizing microorganisms for sustainable agriculture.
Springer, New Delhi, pp 1–20. https://doi.org/10.1007/978-81-322-2776-2_1
Meena VS, Meena SK, Bisht JK, Pattanayak A (2016e) Conservation agricultural practices in
sustainable food production. J Clean Prod 137:690–691
26 A. Kumar et al.
Megali L, Glauser G, Rasmann S (2013) Fertilization with beneficialmicroorganisms

decreases tomato defenses against insect pests. Agron Sustain Dev. https://doi.org/10.1007/
s13593-013-0187-0
Mehdipour-Moghaddam MJ, Emtiazi G, Salehi Z (2012) Enhanced auxinproduction by
Azospirillum pure cultures from plant root exudates. J Agr Sci Tech 14:985–994
Mehnaz S, Lazarovits G (2006) Inoculation effects of Pseudomonas putida,
Gluconacetobacterazotocaptans and Azospirillum lipoferum on corn plant growth under green-
house conditions. Microb Ecol 51:326–335
Mehnaz S, Kowalik T, Reynolds B, Lazarovitz G (2010) Growth promoting effects of corn
(Zea mays) bacterial isolates under greenhouse and field conditions. Soil Biol Biochem
42:1848–1856
Mendes R, Garbeva P, Raaijmakers JM (2013) The rhizosphere microbiome: significance of plant
beneficial plant pathogenic and human pathogenicmicroorganisms. FEMS Microbiol Rev
37:634–663
Menjivar RD, Cabrera JA, Kranz J, Sikora RA (2012) Induction of metaboliteorganic compounds
by mutualistic endophytic fungi to reduce thegreenhouse whitefly Trialeurodes vaporariorum
(Westwood) infection ontomato. Plant Soil 352:233–241
Micallef SA, Shiaris MP, Colon-Carmona A (2009) Influence of Arabidopsis thaliana accessions
on rhizobacterial communities and natural variation in root exudates. J Exp Bot 60:1729–1742
Morales SE, Holben WE (2011) Linking bacterial identities andecosystem processes: can “omic”
analyses be more than thesum of their parts? FEMS Microbiol Ecol 75:2–16
Narula N, Kumar V, Behl RK, Deubel A, Gransee A, Merbach W (2000) Effect of P-solubilizing
Azotobactor chroococcum on NP,K uptake in P-responsive wheat genotypes grown under
greenhouse conditions. J Plant Nutr Soil Sci 163:393–398
Nina K, Thomas WK, Prem SB (2014) Beneficial organisms for nutrient uptake. VFRCreport
2014/1, virtual fertilizer research center. Wageningen Academic Publishers, Washington, DC,
p 63
Noble AD, Ruaysoongnern S (2010) The nature ofsustainable agriculture. In: Dixon R, Tilston E
(eds) Soil microbiology and sustainable crop production. Springer Science and Business Media
B.V, Berlin, pp 1–25
Offringa IA, Melchers LS, Regenburg-Tuink AJG, Costantino P, Schilperoert RA, Haoykaas PJJ
(1986) Complementation of Agrobacterium tumefaciens tumor-inducing aux mutant by genes
from the TR- region of the Ri plasmid of Agrobacterium rhizogenes. Proc Natl Acad Sci USA
83:6935–6939
Oldroyd GED, Downie JA (2008) Coordinating nodulemorphogenesis with rhizobial infection in
legumes. Annu Rev Plant Biol 59:519–546
Orhan E, Esitken A, Ercisli S, Turan M, Sahin F (2006) Effects of plant growth promotingrhizo-
bacteria (PGPR) on yield, growth andnutrient contents in organically growingraspberry. Sci
Horti 111(1):38–43
Ozturk A, Caglar O, Sahin F (2003) Yield response of wheat and barley to inoculation of plant
growth promoting rhizobacteria at various levels of nitrogen fertilization. J Plant Nutr Soil Sci
166:262–266
Pal KK, Tilak KVBR, Saxena AK, Dey R, Singh CS (2000) Enhancement of phosphate solu-
bilization and siderophore production by Tn5 mutagenesis of a biocontrol rhizobacterium
Pseudomonas spp. Em85. J Microb World 2:9–15
Parewa HP, Yadav J, Rakshit A, Meena VS, Karthikeyan N (2014) Plant growth promoting rhizo-
bacteria enhance growth and nutrient uptake of crops. Agriculture for Sustainable Development
2(2):101–116
Parisi B, Vallee BL (1969) Metal enzyme complexes activated by zinc. J Biol Chem 179:803–807
Patgiri I, Bezbaruah B (1990) Strains contributing to phosphorus mobilization in acid soils. Indian
J Agri Sci 60:197–200
Patil PL, Medhane NS (1974) Seed inoculation studies in gram (Cicer arietinum) with different
strains of Rhizobium sp. Plant Soil 40:221–223
Patten CL, Glick BR (1996) Bacterial biosynthesis of indole-3-acetic acid. Can J Microbiol
42:207–220
Paul D, Kumar A, Anandaraj M, Sarma YR (2001) Studies on the suppressive action of fluo-
rescent pseudomonas on Phytophthora capsici, the footrot pathogen of black pepper. Indian
Phytopathol 54:515
Peng G, Yuan Q, Li H, Zhang W, Tan Z (2008) Rhizobium oryzae sp. nov., isolatedfrom the wild
rice Oryza alta. Int J Syst Evol Microbiol 58:2158–2163
Phillips DA (1980) Efficiency of symbiotic nitrogen fixation in legumes. Annu Rev Plant Physiol
31:29–49
Pinton R, Varanini Z, Nannipieri P (2001) The rhizosphere: biodiversity and organic substances at
the soil–plant interface. Marcel Dekker, New York
Prakash S, Verma JP (2016) Global perspective of potash for fertilizer production. In: Meena VS,
Maurya BR, Verma JP, Meena RS (eds) Potassium solubilizing microorganisms for sustainable
agriculture. Springer, New Delhi, pp 327–331. https://doi.org/10.1007/978-81-322-2776-2_23
Prerna A, Kapoor KK, Akhaury P (1997) Solubilization of insolublephosphate by fungi isolated
from compost and soil. Environ Ecol 15(3):524–527
Priyadharsini P, Muthukumar T (2016) Interactions between arbuscular mycorrhizal fungi and
potassium-solubilizing microorganisms on agricultural productivity. In: Meena VS, Maurya
BR, Verma JP, Meena RS (eds) Potassium solubilizing microorganisms for sustainable agricul-
ture. Springer, New Delhi, pp 111–125. https://doi.org/10.1007/978-81-322-2776-2_8
Raghavendra MP, Nayaka NC, Nuthan BR (2016) Role of rhizosphere microflora in potassium
solubilization. In: Meena VS, Maurya BR, Verma JP, Meena RS (eds) Potassium solubiliz-
org/10.1007/978-81-322-2776-2_4
Rajan SSS, Watkinson JH, Sinclair AG (1996) Phosphate rock of for directapplication to soils. Adv
Agron 57:77–159
Rana A, Saharan B, Nain L, Prasanna R, Shivay YS (2012) Enhancing micronutrient uptake and
yield of wheat through bacterial PGPR consortia. Soil Sci Plant Nutr 58:573–582
Rashid MH, Schafer H, Gonzalez J, Wink M (2012) Genetic diversity of rhizobia nodulatinglentil
(Lens culinaris) in Bangladesh. Syst Appl Microbiol 35:98–109
Rawat J, Sanwal P, Saxena J (2016) Potassium and its role in sustainable agriculture. In: Meena VS,
Renato de Freitas J (2000) Yield and N assimilation of winter wheat (Triticumaestivum L., var.
Norstar) inoculated with rhizobacteria. Pedobiology 44:97–104
Revillas JJ, Rodelas B, Pozo C, Martinez-Toledo MV, Gonzalez LJ (2000) Productionof B-group
vitamins by two Azotobacter strainswith phenolic compoundsas sole carbon source under diaz-
otrophicand adiazotrophic conditions. J Appl Microbiol 89:486–493
Richardson AE (2001) Prospects for using soil microorganism to improve the acquisition of phos-
phate by plant. Aust J Plant Physiol 28:897–906
Rodriguez H, Fraga R (1999) Phosphate solubilizing bacteria and their role in plant growth promo-
tion. Adv Biotechnol 17:319–339
Rokade SM, Patil P (1993) Phosphate solubilizing microorganisms: a review. J Maharashtra Agri
Uni 18:93–101
Roy N, Chakrabartty PK (2000) Effect of aluminum on the production of siderophore by Rhizobium
sp. (Cicer arietinum). Cur Microbiol 41:5–10
Rudrappa T, Splaine RE, Biedrzycki ML, Bais HP (2008) Cyanogenic pseudomonads influence
multitrophic interactions in the rhizosphere. PLoS One 3:2073
Sachdev DP, Nema P, Dhakephalkar P, Zinjarde S, Chopade B (2010) Assessment of 16S rRNA
gene-based phylogenetic diversity and promising plant growth promoting traits of Acinetobacter
community from the rhizosphere of wheat. Microbiol Res 165:627–638
Saha M, Maurya BR, Bahadur I, Kumar A, Meena VS (2016a) Can potassium-solubilising bacteria
mitigate the potassium problems in India? In: Meena VS, Maurya BR, Verma JP, Meena RS
28 A. Kumar et al.
(eds) Potassium solubilizing microorganisms for sustainable agriculture. Springer, New Delhi,
pp 127–136. https://doi.org/10.1007/978-81-322-2776-2_9
Saha M, Maurya BR, Meena VS, Bahadur I, Kumar A (2016b) Identification and characterization
of potassium solubilizing bacteria (KSB) from Indo-Gangetic Plains of India. Biocatal Agric
Sahoo RK, Ansari MW, Dangar TK, Mohanty S, Tuteja N (2013) Phenotypic and molecular
characterization of efficient nitrogen fixing Azotobacterstrains of the rice fields. Protoplasma.
https://doi.org/10.1007/s00709-013-0547-2
Sahoo RK, Bhardwaj D, Tuteja N (2013b) Biofertilizers: a sustainable eco-friendlyagricultural
approach to crop improvement. In: Tuteja N, Gill SS (eds) Plant acclimation to environmental
stress. Springer, New York, pp 403–432
Sahoo RK, Ansari MW, Pradhan M, Dangar TK, Mohanty S, Tuteja N (2014) Phenotypic and
molecular characterization of efficient native Azospirillum strains from rice fields for crop
improvement. Protoplasma. https://doi.org/10.1007/s00709-013-0607-7
Saikia SP, Bora D, Goswami A, Mudoi KD, Gogoi A (2013) A review on the role of Azospirillum
in the yield improvement of non leguminous crops. Afr J Microbiol Res 6:1085–1102
Saleh SS, Glick BR (2001) Involvement of gac S and rpo S in enhancement of the plant growth-
promoting capabilities of Enterobacter cloacae CAL2 and UW4. Can J Microbiol 47:698–705
Salisbury FB (1994) The role of plant hormones. In: Wilkinson RE (ed) Plant evironment interac-
tions. Marcel Dekker, New York, pp 39–81
Salisbury FB, Ross CW (1995) Plant physiology. Wadsworth, Belmont, pp 451–497
Salles JF, Van Veen JA, van Elsas JD (2004) Multivariate analysesof Burkholderiaspecies in soil:
effect of crop and land usehistory. Appl Environ Microbiol 70:4012–4020
Santos VB, Araujo SF, Leite LF, Nunes LA, Melo JW (2012) Soil microbial biomass and organic
matter fractions during transition from conventional toorganic farming systems. Geoderma
170:227–231
Saravanan VS, Kumar MR, Sa TM (2011) Microbial zinc solubilization and their role on plants.
In: Maheshwari DK (ed) Bacteria in agrobiology: plant nutrient management. Springer, Berlin,
pp 47–63
Sarig S, Blum A, Okon Y (1992) Improvement of the water status and yield offield-grown grain sor-
ghum (Sorghum bicolor) by inoculation with Azospirillum brasilense. J Agri Sci 110:271–277
Schippers B, Bakker AW, Bakker PAHM, Van Peer R (1990) Beneficial and deleterious effects of
HCN-producing pseudomonads on rhizosphere interactions. Plant Soil 129:75–83
Selvakumar G, Kundu S, Gupta AD, Shouche YS, Gupta HS (2008) Isolation and characterization
of nonrhizobial plant growth promoting bacteria from nodules of Kudzu (Pueraria thunber-
giana) and their effect on wheat seedling growth. Cur Microbiol 56:134–139
Shankar T, Sivakumar T, Asha G, Sankaralingam S, Sundaram VM (2013) Effect of PSB on growth
and development of Chilli and maize plants. World Applied Sci J 26:610–617
Sharma A, Johri BN (2003) Growth promoting influence of siderophore-producing Pseudomonas
strains GRP3A and PRS9 in maize (Zea mays L.) under iron limiting conditions. Microbiol
Res 158:243–248
Sharma P, Sardana V, Kandola SS (2011) Response of groundnut (Arachishypogaea L.)to
Rhizobium inoculation. Libyan Agric Res Centre J Int 2:101–104
Sharma SK, Sharma MP, Ramesh A, Joshi OP (2012) Characterization of zinc-solubilizing
Bacillus isolates and their potential to influence zinc assimilation in soybean seeds. J Microbiol
Sharma A, Shankhdhar D, Shankhdhar SC (2016) Potassium-solubilizing microorganisms:
mechanism and their role in potassium solubilization and uptake. In: Meena VS, Maurya BR,
Sheng XF, He LY (2006) Solubilization of potassium-bearing minerals by a wild-type strain of
Bacillus edaphicusand its mutants and increased potassium uptake by wheat. Can J Microbiol
52:66–72
Sheng XF, Huang WY (2002) Mechanism of potassiumrelease from feldspar affected by the strain
NBT ofsilicate bacterium. Acta Pedol Sin 39(6):863–871
Shishido M, Breuil C, Chanway CP (1999) Endophytic colonization of spruce by plant growth
promoting rhizobacteria. FEMS Microbiol Ecol 29:191–196
Shoebitz M, Ribaudo CM, Pardo MA, Cantore ML, Ciampi L, Cura JA (2009) Plant growth pro-
moting properties of a strain of Enterobacter ludwigii isolated from Lolium perenne rhizo-
sphere. Soil Biol Biochem 41:1768–1774
Shrivastava M, Srivastava PC, D’Souza SF (2016) KSM soil diversity and mineral solubilization,
in relation to crop production and molecular mechanism. In: Meena VS, Maurya BR, Verma JP,
Siddikee MA, Chauhan PS, Anandham R, Han G, Sa T (2010) Isolation, characterization, and use
for plant growth promotion under salt stress, of ACC deaminase-producing halotolerant bacte-
ria derived from coastal soil. J Microbiol Biotechnol 20:1577–1584
Siddiqui ZA (2006) PGPR: prospective biocontrol agents of plant pathogens. In: Siddiqui ZA (ed)
PGPR: biocontrol and biocontrol. Springer, Dordrecht, pp 112–142
Sims JT, Pierzynski GM (2005) Chemistry of phosphorus in soil. In: Tabatabai AM, Sparks DL
(eds) Chemical processes in soil, SSSA book series 8. SSSA, Madison, pp 151–192
Sindhu SS, Dua S, Verma MK, Khandelwal A (2010) Growth promotion of legumes by inoculation
of rhizospherebacteria. In: Khan MS, Zaidi A, Musarrat J (eds) Microbes for legume improve-
ment. Springer, New York, pp 195–235
Sindhu SS, Parmar P, Phour M, Sehrawat A (2016) Potassium-solubilizing microorganisms
(KSMs) and its effect on plant growth improvement. In: Meena VS, Maurya BR, Verma JP,
Singh MV (2009) Micro nutritional problem in soils of India and improvement for human and
animal health. Indian J Fert 5(4):11–16
Singh S, Kapoor KK (1999) Inoculation with phosphate solubilizing microorganisms and a vesicu-
lar arbuscular mycorrhizal fungus improves dry matter yield and nutrient uptake by wheat
grown in a sandy soil. Biol Fertil Soils 28:139–144
Singh YV, Mandal BK (2000) Rate of mineralization of Azolla, other organic materials and urea in
water logged soils. Trop Agri (Trinidad) 77:119–122
Singh M, Reddy SR, Singh VP, Rupa TR (2007) Phosphorus availability to rice (Oriza sativa
L.)–wheat (Triticum estivum L.) in a vertisol after eight years of inorganic and organic fertilizer
additions. Bioresour Technol 98:1474–1481
Singh G, Biswas DR, Marwah TS (2010) Mobilization ofpotassium from waste mica by plant
growth promotingrhizobacteria and its assimilation by maize (Zea mays) and wheat (Triticum
aestivum L.) J Plant Nutr 33:1236–1251
Singh JS, Pandey VC, Singh DP (2011) Efficient soil microorganisms: a newdimension for sustain-
able agriculture andenvironmental development. Agric Ecosyst Environ 140:339–353
Singh NP, Singh RK, Meena VS, Meena RK (2015) Can we use maize (Zea mays) rhizobacteria as
plant growth promoter? Vegetos 28(1):86–99. https://doi.org/10.5958/2229-4473.2015.00012.9
Singh M, Dotaniya ML, Mishra A, Dotaniya CK, Regar KL, Lata M (2016) Role of biofertil-
izers in conservation agriculture. In: Bisht JK, Meena VS, Mishra PK, Pattanayak A (eds)
Conservation agriculture: an approach to combat climate change in Indian Himalaya. Springer,
Singapore, pp 113–134. https://doi.org/10.1007/978-981-10-2558-7_4
Sinha RK, Valani D, Chauhan K, Agarwal S (2014) Embarking on a second greenrevolution for
sustainable agriculture by vermin culture biotechnologyusing earthworms: reviving the dreams
of Sir Charles Darwin. Int J Agric Health Saf 1:50–64
Sperberg JI (1958) The incidence of apatite solubilizing organisms in the rhizosphere and soil.
Aust J Agril Resou Econ 9:778
30 A. Kumar et al.
Stanojković A, Dragutin AÐ, Mandić L, Pivić R, Stanojković A, Jošić D (2012) Evaluation of the
chemical composition and yield of crops as influenced by bacterial and mineral fertilization.
Rom Biotechnol Letters 17:7136–7144
Stevenson FJ, Cole MA (1999) Cycles of soil: carbon, nitrogen, phosphorus, sulfur, micronutri-
ents, 2nd edn. Wiley, New York, p 427
Taurian T, Anzuay MS, Angelini JG, Tonelli ML, Luduena L, Pena D, Inanez F, Fabra A (2010)
Phosphate-solubilizing peanut associated bacteria: screening for plant growth-promoting activ-
ities. Plant Soil 329:421–431
Teotia P, Kumar V, Kumar M, Shrivastava N, Varma A (2016) Rhizosphere microbes: potassium
solubilization and crop productivity-present and future aspects. In: Meena VS, Maurya BR,
Thamer S, Schädler M, Bonte D, Ballhorn DJ (2011) Dual benefit from abelowground symbiosis:
nitrogen fixing rhizobia promote growth anddefense against a specialist herbivore in a cyano-
genic plant. Plant Soil 34:1209–1219
Tilak KVBR, Ranganayaki N, Pal KK, De R, Saxena AK, Nautiyal CS, Mittal S, Tripathi AK, Johri
BN (2005) Diversity of plant growth and soil health supporting bacteria. Cur Sci 89:136–150
Torsvik V, Goksoyr J, Daae F (1990) High diversity in DNA ofsoil bacteria. Appl Environ
Tripura C, Sashidhar B, Podile AR (2007) Ethyl methanesulfonate mutagenesis enhanced mineral
phosphate solubilization by groundnut-associated Serratia marcescens GPS-5. Cur Microbiol
54:79–84
Trivedi P, Timothy S, Nian W (2011) Isolation and characterization of beneficial bacteria associ-
ated with citrus roots in Florida. Microb Ecol 62:324–336
Tsavkelova EA, Cherdyntseva TA, Klimova SY, Shestakov AI, Botina SG, Netrusov AI (2007)
Orchid-associated bacteria produce indole-3-acetic acid, promote seed germination, and
increase their microbial yield in response to exogenous auxin. Arch Microbiol 188:655–664
Turan M, Gulluce M, Wirén NV, Sahin F (2012) Yield promotion and phosphorus solubilization
by plant growth–promoting rhizobacteria in extensive wheat production in Turkey. J Plant Nutr
Soil Sci 175:818–826
Vaid S, Kumar B, Sharma A, Shukla A, Srivastava P (2014) Effect of Zn solubilizing bacteria on
growth promotion and Zn nutrition of rice. J Soil Sci Plant Nutr 14:889–910
Vance CP (1998) Legume symbiotic nitrogen fixation: agronomic aspects. In: Spaink HP, Kondorosi
A, Hooykaas PJJ (eds) The rhizobiaceae. Molecular biology of model plant-associated bacte-
ria. Kluwer Academic Publishers, Dordrecht, pp 509–530
Vanessa MC, Franco CMM (2004) Analysis of the endophytic actinobacterial population in the
roots of wheat (Triticum aestivum L.) by terminal restriction fragment length polymorphism
and sequencing of 16S rRNA clones. Appl Env Microbiol 70:1787–1794
Vazquez P, Holguin G, Puente ME, Lopez-Cortez A, Bashan Y (2000) Phosphate solubilizing
microorganisms associated with the rhizosphere of mangroves in a semiarid coastal lagoon.
Biol Fertil Soils 30:460–468
Velazquez E, Silva LR, Ramírez-Bahena MH, Peix A (2016) Diversity of potassium-solubilizing
microorganisms and their interactions with plants. In: Meena VS, Maurya BR, Verma JP,
Venkateshwarlu B, Rao AV, Raina P (1984) Evaluation of phosphorus solubilization by microor-
ganisms isolated from aridsoil. J Indian Soc Soil Sci 32:273–277
Verma JP, Yadav J, Tiwari KN, Lavakush SV (2010) Impact of plant growth promoting rhizobac-
teria on crop production. Int J Agri Res 5:954–983
Verma JP, Yadav J, Tiwari KN, Kumar A (2013) Effect of indigenous Mesorhizobium spp. and
plant growth promoting rhizobacteria on yields and nutrients uptake of chickpea (Cicer arieti-
num L.) under sustainable agriculture. Ecol Engineer 51:282–286
Verma R, Maurya BR, Meena VS (2014) Integrated effect of bio-organics with chemical fertilizer
on growth, yield and quality of cabbage (Brassica oleracea var capitata). Indian J Agric Sci
84(8):914–919
Verma JP, Jaiswa DK, Meena VS, Meena RS (2015a) Current need of organic farming for enhanc-
ing sustainable agriculture. J Clean Prod 102:545–547
Verma JP, Jaiswal DK, Meena VS, Kumar A, Meena RS (2015b) Issues and challenges about sus-
tainable agriculture production for management of natural resources to sustain soil fertility and
health. J Clean Prod 107:793–794
Voisard C, Keel C, Haas D, Défago G (1989) Cyanide production by Pseudomonas fluorescens
helps suppress black root rot of tobacco under gnotobiotic conditions. EMBO J 8:351–358
Wange SS, Patil PI (1994) Effect of combined inoculation of Azotobacter, Azospirillum with-
chemical nitrogen on Basarai banana. Madras Agric J81:163–165
Wani SA, Chand S, Ali T (2013) Potential use of Azotobacter chroococcum in crop production: an
overview. Curr Agric Res J 1:35–38
Wissuwa M, Ismail AM, Graham RD (2008) Rice grain zinc concentrations as affected by geno-
type, native soil-zinc availability, and zinc fertilization. Plant Soil 306:37–48
Xie H, Pasternak JJ, Glick BR (1996) Isolation and characterization of mutants of plant growth
promoting rhizobacterium Pseudomonas putida GR 12-2 that over produce indoleacetic acid.
Cur Microbiol 32:67–71
Xuan Y, Liu X, Zhu TH, Liu GH, Mao C (2012) Co-inoculation with phosphate-solubilzing and
nitrogen-fixing bacteria on solubilization of rock phosphate and their effect on growth promo-
tion and nutrient uptake by walnut. Eur J Soil Biol 50:112–117
Yadav BK, Sidhu AS (2016) Dynamics of potassium and their bioavailability for plant nutri-
tion. In: Meena VS, Maurya BR, Verma JP, Meena RS (eds) Potassium solubilizing micro-
organisms for sustainable agriculture. Springer, New Delhi, pp 187–201. https://doi.
org/10.1007/978-81-322-2776-2_14
Yadav J, Verma JP, Tiwari KN (2011) Plant growth promoting activities of fungi and their effect on
chickpea plant growth. Asian J Biol Sci 4:291–299
Yang J, Kloepper JW, Ryu CM (2009) Rhizospherebacteria help plants tolerate abiotic stress.
Trends Plant Sci 14:1–4
Yasin M, Munir I, Faisal M (2016) Can Bacillus spp. enhance K+ uptake in crop species.
In: Meena VS, Maurya BR, Verma JP, Meena RS (eds) Potassium solubilizing micro-
org/10.1007/978-81-322-2776-2_12
Youssef MMA, Eissa MFM (2014) Biofertilizers and their role in management of plant parasitic
nematodes. A review E3. J Biotechnol Pharm Res 5:1–6
Zahedi H (2016) Growth-promoting effect of potassium-solubilizing microorganisms on some
crop species. In: Meena VS, Maurya BR, Verma JP, Meena RS (eds) Potassium solubiliz-
org/10.1007/978-81-322-2776-2_3
Zahir AZ, Ghani U, Naveed M, Nadeem SM, Asghar HN (2009) Comparative effectiveness of
Pseudomonas and Serratia sp. containing ACC-deaminase for improving growth and yield
of wheat (Triticum aestivum L.) under salt-stressed conditions. Arch Microbiol 191:415–424
Zahir ZA, Akhtar SS, Ahmad M, Saifullah NSM (2012) Comparative effectiveness of Enterobacter
aerogenes and Pseudomonas fluorescens for mitigating the depressing effect of brackish water
on maize. Int J Agri Biol 14:337–344
Zhang C, Kong F (2014) Isolation and identification ofpotassium-solubilizing bacteria from
tobacco rhizosphericsoil and their effect on tobacco plants. Appl Soil Ecol 82:18–25
Zhang J, Liu J, Meng L, Ma Z, Tang X, Cao Y, Sun L (2012) Isolation and characterization of
plant growth-promoting rhizobacteria from wheat roots by wheat germ agglutinin labeled with
fluorescein isothiocyanate. J Microbiol 50:191–198
Chapter 2
Current Perspectives on Rhizobacterial-
EPS interactions in Alleviation of Stress
Responses: Novel Strategies
for Sustainable Agricultural Productivity
P. V. Bramhachari, Ganji Purnachandra Nagaraju, and E. Kariali
Abstract Rhizobacterial exopolysaccharides (EPSs) are the active constituents of

soil organic matter which possess numerous biological functions, viz., biofilm
development and survival, host colonization, and bacterial autoaggregation, includ-
ing host specificity, quorum sensing, participation in early stages of host plant infec-
tion, signaling molecule during plant development, and most importantly protection
from environmental stresses. These adverse conditions lead to negative environ-
mental impacts and socioeconomic consequences such as reduction of crop produc-
tivity and soil fertility. However, environmental concerns related to these stresses
motivate the scientists to find out environment-friendly approaches for sustainable
agriculture. Interestingly the plant growth-promoting rhizobacteria (PGPR) have
evolved with several biochemical mechanisms to cope with the environmental biotic
and abiotic stressors, viz., plant pathogen defenses, metal, salt, and drought. This
review presents the recent advances and applications made hitherto in understand-
ing the biochemical mechanisms of rhizobacterial-EPS interactions alleviate stress
responses and their role in major processes involved in phytoremediation, such as
heavy metal detoxification, biocomplexation, bioaggregation, biosorption, and
biosequestration. Interestingly these EPSs have rapidly emerged as a new and
industrially important source of polymeric materials, which are gradually becoming
economically competitive for crop productivity. Nevertheless future progress in
understanding of PGPR, mechanisms of plant-microbe-EPS interactions, could
facilitate their development as the reliable components in management of sustain-
able agricultural systems.
P. V. Bramhachari (*)
Department of Biotechnology, Krishna University, Machilipatnam, Andhra Pradesh, India
G. P. Nagaraju
Department of Hematology and Medical Oncology, Winship Cancer Institute, Emory
University, Atlanta, GA, USA
E. Kariali
School of Life Sciences, Sambalpur University, Sambalpur, Odisha, India

https://doi.org/10.1007/978-981-10-8402-7_2
34 P. V. Bramhachari et al.
Keywords Exopolysaccharides (EPS) · Plant growth-promoting rhizobacteria

(PGPR) · Crop productivity · Sustainable agriculture and phytoremediation
2.1 Introduction
Soil is a complex and dynamic system that supports plant growth. In the soil envi-
ronment, plant growth and development is influenced by a variety of environmental
stresses that are key constraints for sustainable agricultural productivity (Nadeem
et al. 2014). These stresses are biotic, for instance, phytopathogens and pests, viz.,
viruses, bacteria, fungi, insects, nematodes, etc., and abiotic stressors including
salinity, drought, flooding, heavy metals, temperature, gases, and nutrient deficiency
or excess (Glick et al. 2007). Abiotic stresses are considered to be the main source
of yield reduction; however, the intensity of these stresses varies with a number of
soil and plant factors. Some of the general impacts of these stresses on plant growth
include hormonal and nutritional and physiological imbalances and propensity to
plant diseases (Ashraf and Wu 1994; El-Iklil et al. 2000; Nadeem et al. 2014).
Though plants employ some specific mechanisms to combat these stresses, benefi-
cial microbes such as PGPR in the rhizosphere play a noteworthy role in reducing
the intensity of a stress (Yang et al. 2009). However, adapting to these adverse con-
ditions, PGPR has evolved mechanisms to monitor the environment and to alter
gene expression patterns, enzyme activity, and transport proteins that enable them
to cope with the new environmental conditions (Meena et al. 2013a; Bahadur et al.
2014; Maurya et al. 2014; Jat et al. 2015; Kumar et al. 2015).
The complex and dynamic interactions among microbes, roots, soil, and water in
the rhizosphere induce changes in physicochemical and structural properties of soil
(Barea et al. 2004). It affects the plant-microbe symbiosis by reducing the survival
of rhizobia, inhibiting the infection process, and thereby affecting nodule develop-
ment and function, as a consequence, ultimately reducing the plant growth.
Environmental stress poses an increased microbial competition for available nutri-
ents, and as a result these bacteria revert from planktonic stage to sessile assem-
blages at various biotic and abiotic surfaces to protect them in rhizosphere (Fujishige
et al. 2006; Ahmad et al. 2016; Meena et al. 2016a, b; Parewa et al. 2014; Prakash
and Verma 2016; Priyadharsini and Muthukumar 2016; Kumar et al. 2016b).
Nevertheless the exudates of bacteria in the plant rhizosphere play an important role
in plant-microbial interactions.
Exopolysaccharides (EPSs) are the active constituents of soil organic matter
(Gouzou et al. 1993). EPS are the most important part of extracellular matrix that
often represents 40–95% of bacterial weight (Flemming and Wingender 2001).
Bacteria produce EPS in two forms: (a) slime EPS and (b) capsular EPS (Vanhooren
and Vandamme 1998). EPSs are found in a wide variety of complex structures
(Kumon et al. 1994). The important roles exhibited by EPS are (a) protection, (b)
surface attachment, (c) biofilm formation, (d) microbial aggregation, (e)
plant-microbe interaction, and (f) bioremediation (Manca de Nadra et al. 1985). The
2 Current Perspectives on Rhizobacterial-EPS interactions in Alleviation of Stress… 35
production of EPSs by plant-associated microbes can also play an imperative role in

complexing toxic metals and in decreasing their mobility in the soils. This implies
a complex chemical dialogue between partners and drastic changes on both plant
roots and bacteria. Several researchers pointed out the importance of rhizobial sur-
face polysaccharides in establishing highly specific symbiosis. It has been reported
that the heavy metals often interfere with the root uptake of nutrients such as Fe, P,
Mg, Ca, and Zn and with metabolic functions of essential nutrients, leading to plant
growth retardation (Ouzounidou et al. 2006). Under such conditions the plant-
associated microbes enhance the plant nutrient acquisition by mobilizing nutrients
and making it available to plant roots. EPSs are a complex mixture of high molecu-
lar weight polymers (MW ≥10,000) secreted by microbes into the environment in
response to some physiological stresses such as heavy metals and osmotic salts such
as Na+ (Upadhyay et al. 2011).
A multifarious role is played by microbial polysaccharides and proteinaceous
structures, which can either inhibit mineral dissolution under some conditions by
forming biofilms or promote chemical weathering by producing EPSs of an acidic
nature and increase metal bioavailability and phytoavailability and thus affecting
the fertility of soils (Geddie and Sutherland 1993). These polysaccharides appear to
be essential for the early infection process, but the exact mechanisms of symbiotic
development still remain ambiguous. The symbiotic nitrogen-fixing rhizobacterial
genera, such as Rhizobium, Bradyrhizobium, Mesorhizobium, etc., were reported to
enhance the growth of legumes in metal-contaminated soils by providing N to the
plants through N2 fixation (Wani et al. 2008; Kumar et al. 2016a, 2017; Meena et al.
2015a, b; Raghavendra et al. 2016; Zahedi 2016; Jha and Subramanian 2016). It is
noteworthy that previous reports demonstrated that EPS production by bacterial
strains significantly contributes to soil fertility and improves plant growth (Ashraf
et al. 2005). It is also in line with many previous studies showing that EPSs facilitate
cell adhesion, cell-cell signaling, and protection of individual cells from stress
(Ashraf et al. 2004; Dimkpa et al. 2009).
However, bacteria show a number of responses to metal ions that include metal
biosorption, metal precipitation, and enzymatic metal transformation that permit
their use for environmental restoration (Valls and de Lorenzo 2002). Moreover,
increased production of EPSs against stressors also favors biofilm formation and
protects this mini-assembly by retaining a water layer around the cells (Dimkpa
et al. 2009). Hence, biosynthesis of EPSs by Rhizobium is essential for the formation
of nitrogen-fixing nodules on legumes, for example, Leucaena, Medicago, Pisum,
Vicia, Trifolium, and Vigna (Wilbert et al. 1998). EPSs produced by Rhizobium spe-
cies are macromolecular complexes crucial for the establishment of symbiotic rela-
tionship between Rhizobium and leguminous plants. Rhizobial EPSs have been
studied extensively for their dynamic role in plant host specificity (Reichman 2007)
but only of late their metal sorption capacity in Rhizobium has been investigated
from the coastal region of Andhra Pradesh (Deepika et al. 2016). However, the num-
ber of microorganisms has been shown to produce biopolymers that exhibit metal-
binding properties (Gutnick and Bach 2000). This is attributed to the fact that
bacterial EPSs are chemically diverse and are mostly acidic heteropolysaccharides
with ionizable functional groups such as hydroxyl, carboxyl, amide, sulfate, and
phosphoryl which interestingly exhibit very high affinity to heavy metals
(Bramhachari et al. 2007). EPSs are therefore recommended as promising biosor-
bents for removal of heavy metals due to their widespread capacities and diverse
functions (Wang et al. 2013).
Notably these EPSs have rapidly emerged as a new and industrially important
source of polymeric materials, which are steadily becoming cost-effective and com-
petitive. Thus, it is most likely that these rhizobacterial biopolymers are chemically
diversified, are well defined, and have attracted worldwide attention due to their
novel and unique physical and chemical properties as bioadhesives, bioflocculants,
biosorbents, gelling agents, probiotics, stabilizers, and thickeners, making them
appropriate for numerous commercial applications (Sutherland 2001). Fascinatingly,
they also have several advantages of being eco-friendly, nontoxic, and biodegrad-
able (Rawat et al. 2016; Yasin et al. 2016; Meena et al. 2014a, 2015f, 2016c, d; Saha
et al. 2016a, b; Yadav and Sidhu 2016; Verma et al. 2014, 2015b; Sharma et al. 2016;
Dotaniya et al. 2016 Jaiswal et al. 2016). As a result, understanding the bacterial
EPS structure and function in relation to environmental factors and ecosystem func-
tion is of absolute importance. However, relatively little is known about the influ-
ence of EPS-producing rhizobacteria and their interactions. The present review
concerns as how to improve the ability of soil microbes for alleviating the negative
impacts of stress factors on crop productivity. Therefore, understanding the bacterial
diversity in relation to environmental stressors and its ecosystem functions is of
absolute importance. This review highlights the recent advances and applications
made hitherto in understanding the biochemical mechanisms of rhizobacterial-EPSs
interactions and their role in major processes involved in phytoremediation, such as
heavy metal detoxification, bioaggregation, biosorption, and biosequestration. The
review also focused on the current knowledge of plant-microbe-EPS-mediated inter-
actions and the impact of improved technologies on our ability to understand how
these relationships impact plant performance, potentially allowing us to sustainably
improve plant productivity (Verma et al. 2015a; Meena et al. 2013b, 2014b, 2015c;
Shrivastava et al. 2016; Velazquez et al. 2016; Sindhu et al. 2016Das and Pradhan
2016; Dominguez-Nunez et al. 2016). Future progress in understanding of PGPR,
mechanisms of plant-microbe-EPS interactions, could facilitate their development
as the reliable components in management of sustainable agricultural systems.
2.2 I mportance of PGPR-EPSs in Sustainable Agricultural

Production
An intensive agricultural production is indispensable to satisfy food requirements

for the growing world population. The rhizospheric soils contain diverse type of
efficient microbes with beneficial effects on crop productivity. Perhaps the soil
microbes inhabiting the rhizosphere can cause remarkable changes in plant growth
and development by producing biologically active substances. Recently, there has
been a great upsurge in eco-friendly and sustainable agriculture with emphasis on

the use of beneficial microorganisms. Certainly, recent studies demonstrated that
local adaptation of plants to their environment is driven by genetic differentiation in
closely associated microbes (Rodriguez and Redman 2008). PGPRs protect plants
from the deleterious effects of numerous environmental stresses, including metals
(Burd et al. 2000), drought (Mayak et al. 2004a), and salts (Mayak et al. 2004b).
These adverse conditions lead to negative environmental impacts and socioeco-
nomic consequences such as reduction of field productivity and soil fertility.
However, environmental concerns related to these stresses motivate the scientists to
find out environment-friendly approaches for sustainable agriculture. The recent
interest in eco-friendly and sustainable agricultural practices (Kavino et al. 2010;
Saravanakumar and Samiyappan 2007) is a broad concept rather than a specific
methodology. It encompasses advances in agricultural management practices and
technology (Harish et al. 2009).
As an alternative approach to physical and chemical methods, the use of hyper-
accumulating plants and beneficial microbes has been a promising approach to
clean up metal-contaminated soils (Glick 2010). Here, emphasis is given on the role
of EPSs in sustainable agriculture system and also to the survival in adverse envi-
ronments. However, the utilization of PGPR in agriculture represents only an under-
sized fraction of agricultural practices worldwide (Bashan et al. 2014). Nonetheless
this is attributable to incoherent properties of inoculated PGPR, which could further
influence the crop productivity. The triumphant utilization of PGPR is merely reli-
ant on its survival in soil, the compatibility with the crops on which it is inoculated,
and the interaction ability with native microbes in soil and environmental factors
(Martinez-Viveros et al. 2010). PGPRs have been extensively used as inoculants for
enhancement of plant growth under various conditions of stress (Yang et al. 2009).
One of the most important characteristics of either PGPR is their ability to secrete
EPSs that form biofilms or assist adhesion to surfaces of plant roots. Perhaps some
PGPRs also possess more environment-specific traits such as heavy metal-
detoxifying activity (Ma et al. 2011), salinity tolerance (Tank and Saraf 2010), and
biological control of phytopathogens and insects (Hynes et al. 2008). PGPRs have
become of interest as inoculants for phytoremediation because of their diverse plant
growth-promoting capabilities (Liu et al. 2012).
Nonetheless the greatest challenge for survival of the living beings is to improve
plant productivity for an agroecosystem in a sustainable manner. The global climatic
changes are the major constraints affecting agricultural practices worldwide, as they
lead to soil degradation. Because of current public concerns about the side effects of
agrochemicals, there is an increasing interest in improving the understanding of
microbial interaction activities among rhizospheric microbes and how these can be
efficiently used for the benefit of agriculture and environment (Barea et al. 2004).
These plant-microbe interactions may be essential for sustainable agriculture since
they primarily depend on biological processes rather than on agrochemicals to pre-
serve plant growth and development as well as proper soil health under stress condi-
tions (Nadeem et al. 2014). Certain microbial interaction activities can be exploited
as a low-input biotechnology and form a base for a strategy to facilitate sustainable,
environmentally friendly practices that are fundamental to the stability and produc-
tivity of both agricultural systems and natural ecosystems (Kennedy and Smith
1995). Notwithstanding, it is well accepted that diverse soil microflora and micro-
fauna affect plant growth and food webs (Scheu et al. 2005; Meena et al. 2017),
future progress in our understanding of PGPR, colonization ability, and mechanisms
of plant-metal-microbe interactions, formulation, and application could facilitate
their development as the reliable components in management of sustainable agricul-
tural systems (Bonkowski 2004). Lastly the systematic analysis of whole genome
data and the identification of metal resistance genes that contribute to the beneficial
activity of PGPR will aid our perception of the molecular mechanisms of many
bacterial species and also help in the development of PGPR-assisted phytoremedia-
tion technology. The research challenges are yet to meet several sustainable environ-
mental and economical issues without compromising yields. In this context,
exploiting the agroecosystem services of soil microbial communities appears as a
promising effective approach in the years to come (Singh et al. 2015, 2016; Meena
et al. 2013c, 2015d, e; Teotia et al. 2016; Bahadur et al. 2016b).
2.3 hizobacterial Exopolysaccharides (EPSs) in Crop

R
Productivity
Bacterial EPS that constitutes homo- or heteropolysaccharides attached to the cell

surface as a capsule is responsible for architectural structure of biofilms. EPSs are a
complex mixture of biomolecules, e.g., proteins, humic-like substances, polysac-
charides, neutral sugars, uronic acids, amino sugars, organic ester-linked substitu-
ents and pyruvate ketals, nucleic acid, lipids, and glycoproteins, surrounding the
bacterial cells (Sheng et al. 2010). The acyl group in EPSs depicts an anionic nature,
as a consequence of increasing its lipophilic nature eventually affecting its molecu-
lar interactions with divalent cations (Davey and O’Toole 2000). EPS composition
and production is influenced by bacterial growth phase, medium composition (C/N
ratio), and environmental conditions (De Vuyst and Degeest 1999). It has been
reported that stress conditions trigger formation of guanine cyclases in cells subse-
quently leading to the production of EPS (Borlee et al. 2010). In A. brasilense Sp7,
noeJ and noeL genes encoding mannose-6-phosphate isomerase and GDP-mannose
4,6-dehydratase, respectively, are involved in EPS synthesis (Lerner et al. 2009).
The enzymes encoded by these genes are involved in the synthesis of mannose and
fucose, constituents of EPS in A. brasilense (Vanbleu et al. 2005). In P. aeruginosa,
water deficit conditions induce synthesis of alg genes in the alginate biosynthesis
gene cluster having intricate role in alleviating drought stress (Chang et al. 2007).
EPS production by PGPR strains plays a significant role in supporting plant growth
underwater (Bensalim et al. 1998) and saline stress conditions, as it forms hydro-
philic biofilms colonizing plant roots imparting protection against desiccation
(Rossi et al. 2012). Water retention ability of PGPR strains varies according to poly-
saccharide constituents of EPS, and it may exceed 70 g water per g polysaccharide
(Vu et al. 2009). Interestingly, the EPS-producing bacteria Azospirillum enhanced
resistance to water stress in plants due to amendments in the soil structure and
aggregation properties (Bashan et al. 2004). It is notable that sunflower plants inoc-
ulated with Rhizobium spp. strain YAS34 (EPS-producing rhizobacteria) displayed
improved dry biomass, nitrogen nutrition, and water uptake of plants which was
attributed to increased RAS/RT (root-adhering soil/root tissue) ratio and RAS mac-
roporosity (Alami et al. 2000). Improved soil aggregation in rhizosphere of wheat
seedlings was observed due to EPS production by rhizobia, thus ameliorating plant
growth under stress (Kaci et al. 2005). Conversely the EPS synthesis in Rhizobium
sp. YAS34 is not essential for biofilm formation on roots but is critical to coloniza-
tion of the basal part of the root system and increasing the stability of root-adhering
soil (Santaella et al. 2008).
It could be envisaged, therefore, that EPS production by drought-tolerant
Pseudomonas and Bacillus sp. increased RAS/RT ratio and macroaggregate stability
which enhanced water and nutrient uptake from soil reserve (Vardharajula et al.
2011). EPS production by PGPR strains during water deficit conditions results in
development of extensive root system, increased shoot growth, and total dry weight
in plants (Awad et al. 2012). Thus soil aggregation and water regulation affected in
rhizosphere is a function of EPS. Production of EPS by Pseudomonas spp. and
Acinetobacter spp. promoted plant growth during water stress by formation of a
hydrophilic biofilm around the roots that acted as an additional sheath to protect the
root system from soil hardness (Rolli et al. 2014). EPS can act as emulsifiers impart-
ing protection to biomembranes and in quenching ROS, hence conferring resistance
to plant against water stress (Dimitrova et al. 2013). However alginate production
induced drought tolerance in wheat plants inoculated by B. thuringiensis (Timmusk
et al. 2014). Wheat plants inoculated with EPS-producing rhizobacteria were shown
to combat saline stress as rhizosheaths formed around plant roots due to EPS
restricted Na+ influx into the stele (Ashraf et al. 2004). Binding of Na+ ions to EPS
produced by PGPR alleviates salt toxicity as the content of Na+ available for plant
uptake is reduced (Upadhyay et al. 2011), therefore resulting in improved plant
nutrition and growth. EPS production by P. aeruginosa PF23 ameliorated salt stress
in sunflower plants. Moreover the variation in saccharide composition of EPS was
observed during low saline levels of EPS constituted mainly of glucose and galac-
tose; however, during salinity EPS constituted glucose, rhamnose, mannose, and
trehalose. Interestingly, the protective role of these sugars in stress amelioration has
been explained earlier (Tewari and Arora 2014; Bahadur et al. 2016a; Masood and
Bano 2016; Meena et al. 2016e). There has been considerable research done hitherto
implicating the role of elevated levels of EPS produced by PGPR in alleviating stress
conditions in plants, but more detailed investigations need to be investigated vis-à-
vis variations in EPS composition under different stresses as structure- and water-
retaining capacity of each constituent polysaccharide differs considerably. It has
been reported that plant polysaccharides act both as an environmental cue and build-
ing blocks for matrix synthesis in B. subtilis. These polysaccharides induced matrix
gene expression and were converted to UDP-galactose, which was utilized as a sugar
source for EPS synthesis (Beauregard et al. 2013). It could be envisaged, therefore,
that during drought and salinity, plants increase secretion of polysaccharides for EPS
production in rhizosphere to protect themselves from stressed conditions.
2.4 unctions of PGPR-Exopolysaccharides in Sustainable

F
Agriculture
There are numerous potential biological functions of rhizobacterial EPSs which

also includes the role in protecting bacteria against environmental stresses.
Environmental stresses are the most limiting factors for crop productivity. Both
biotic and abiotic stresses including salinity, drought, heavy metals, and insect and
pathogen attack are the most detrimental and common stresses plants face in the
natural environments. It is evident from the literature that stress environment can
also make physicochemical and biological properties of soil unsuitable for micro-
bial and plant growth. Conversely, particular characteristics of certain bacteria
enable them to survive under such harsh environments. Nevertheless PGPRs such as
Bacillus, Pseudomonas, and Rhizobium synthesize a wide spectrum of multifunc-
tional polysaccharides including intracellular polysaccharides and extracellular
polysaccharides from desiccation, phagocytosis, predation by protozoa, phage
attack, antibiotics or toxic compounds (Ali et al. 2014), protection against stress
(Upadhyay et al. 2011; Qurashi and Sabri 2012), attachment to surfaces (Tsuneda
et al. 2003), plant invasion, and plant defense response in plant-microbe interactions
(Fraysse et al. 2003; Kyungseok et al. 2008). Interestingly EPSs also have a role in
cell recognition, in adhesion to surfaces, and in formation of biofilms, facilitating
the colonization of soil ecosystem (Fig. 2.1).
2.4.1 lleviation of Plant Pathogen Stress

A
by Rhizobacterial EPSs
Besides, there are several ways that plant pathogenic and symbiotic bacteria avoid
plant defense system and to protect themselves. The rhizobial surface polysaccha-
rides and glucan play important roles in protection against the host defense (D’Haeze
and Holsters 2004). It is suggested that EPSs might act by suppressing bacterial
antigens at the stage of nodule cell infection (Wielbo et al. 2004). For example,
EPSs produced by the alfalfa-symbiotic bacterium Sinorhizobium meliloti function
as a signaling molecule that triggers a developmental response in the plant or sup-
presses host defense responses (Mendrygal and González 2000). It is notable that
EPSs produced by the root-associated saprophytic rhizobacterium P. agglomerans
YAS34 were associated with plant growth promotion of sunflower (Alami et al.
2000). EPSs from a plant pathogenic P. agglomerans elicited a rapid production of
active oxygen species in tobacco, parsley, wheat, and rice cell culture (Ortmann
et al. 2006). Additionally, rhizobial polysaccharides are highly important in promot-
ing plant growth, as an active signal molecule during beneficial interactions, and
provide defense response during infection process (Parada et al. 2006). The most
important among the suggested EPS functions is its role as a signaling molecule.
Temperature
Metal stress
stress
Desiccation
Drought stress Soil stress
Environment Pathogen stress
Salinity stress
Alleviate stress
responses
Exopolysaccharides PGPR
Biofilm formation, Quorum Nitrogen fixation, IAA, Siderophore

sensing,Avoid plant defense production,ACC, Phytohormones,
responses,Attachment to root Antioxidants, Induced systemic
hair,Host specificity, Biocontrol, resistance, Enzymatic activity,
Structural recognition, Avoid Bioremediation, nutrient cycling,
desiccation, stress tolerance EPSs production–Stress tolerance
Fig. 2.1 Rhizobacterial-exopolymeric substances (EPS) interactions and alleviation of stress

responses
EPSs produced by rhizobacteria are known to have antagonist properties

(Nihorimbere et al. 2011). Remarkably the agricultural application of these com-
pounds also facilitates biocontrol mechanism of plant growth-promoting microbes
such as parasitism, antibiosis, competition, induced systemic resistance, and hypo-
virulence (Singh et al. 2007) (Fig. 2.1). Nevertheless the EPSs produced by specific
rhizobacteria can also elicit plant-induced resistance against biotic stress. For exam-
ple, inoculation with the EPS-producing P. polymyxa on peanut seeds significantly
suppressed crown rot disease caused by A. niger, and the purified EPS from the
PGPR B. gladioli induced resistance against C. orbiculare on cucumber (Kyungseok
et al. 2008). Strikingly, EPSs released by the Rhizobium assist in biofilm formation,
further enhance plant growth, and provide protection from pathogens. Rhizobial
lipochitin oligosaccharides (Nod factors), bacterial cell-surface components, and
low molecular weight metabolites were shown to engage in the cell signaling. In a
recent report, EPSs of Mesorhizobium loti played a signaling role in symbiosis with
Lotus plants forming determinate type of nodules (Kelly et al. 2013). Regardless of
several studies with reference to rhizobial EPS, its specific function as a signal mol-
ecule in symbiosis is not clearly established (Jaszek et al. 2014).
2.4.2 Alleviation of Salt Stress by Rhizobacterial EPSs
Considering the literature, it might be appropriate to convey that EPS helps in bind-
ing cations, including Na+, and thus decreases the content of Na+ available for plant
uptake (Geddie and Sutherland 1993). Adhesive nature of EPS depends on struc-
tural components present in it, i.e., sugars, proteins, and lipids (Danhorn and Fuqua
2007). This specific nature of EPS makes soil particles bind and strengthen aggre-
gate formation (Ashraf and Foolad 2007) and favors plant growth under salt stress.
Soil bacteria growing in saline conditions are able to produce EPS which can be
helpful in tolerating osmotic stress. Furthermore, EPS production in elevated salt
stress promotes biofilm formation and guards the cells by forming a water layer
around the cells (Dimkpa et al. 2009), cell adhesion, cell-cell signaling, and protec-
tion of individual cells under stress conditions (Kawarai et al. 2009). Some PGPR-
EPS can also bind cations, including Na+, suggesting a role in mitigation of salinity
stress by reducing the content of Na+ available for plant uptake (Upadhyay et al.
2011). Previous studies reported the production of EPS by various bacteria H. vari-
abilis (HT1) and P. rifietoensis (RT4) in response to salt stress (Qurashi and Sabri
2012). Some PGPR-producing EPS can also bind cations, including Na+, suggest-
ing a role in mitigation of salinity stress by reducing the content of Na+ available for
plant uptake (Arora et al. 2013).
2.4.3 lleviation of EPS-Drought Stress by Rhizobacterial

A
EPSs
Drought stress is one of the major agricultural problems limiting crop productivity.
Drought stress can make physicochemical and biological properties of soil unsuit-
able for soil microbial activity and crop yield. Apart from this, drought stress affects
cell wall elasticity and cell redox balances (Sgherri et al. 2007). Alami et al. (2000)
observed a significant increase in root-adhering soil per root tissue ratio in sun-
flower rhizosphere inoculated with the EPS-producing rhizobial strain YAS34 under
drought conditions. Inoculating EPS-producing bacteria have recently been reported
to alleviate drought stress in plants (Vanhaverbeke et al. 2003).
2.4.4 Alleviation of Other Stressors by Rhizobacterial EPSs
Other innumerable functions performed by EPS-producing microbes constitute

shielding from desiccation, protection against stress (Qurashi and Sabri 2012),
attachment to surface plant invasion, and plant defense response in plant-microbe
interactions (Tewari and Arora 2014). PGPR-producing EPSs are highly important
in promoting plant growth due to work as an active signal molecule during benefi-
cial interactions and provide defense response during infection process (Parada
et al. 2006). Chang et al. (2007) provided direct evidence that EPS are essential
molecules to maintain cellular hydration and biofilm formation under desiccating
conditions. Moreover, EPS production increases root colonization of microbes
(Santaella et al. 2008), improves soil aggregation (Sandhya et al. 2009), channelizes
water and nutrients to plant roots (Roberson and Firestone 1992), and forms biofilm
(Seneviratne et al. 2011) which is beneficial to plant growth and development. Wang
et al. (2011) produced a bioflocculant by growing mixed culture of two R. radio-
bacter and B. sphaericus and observed that the EPS obtained exhibited higher floc-
culation ability as compared to the pure culture of these strains. Interestingly soil
modification using the EPS from R. tropici has introduced the concept of bio-
geocivil engineering (Ivanov and Chu 2008) which could improve the soil strength
and soil erosion control and slope stability.
2.5 hizobial EPS-Metal Interactions for Sustained Crop

R
Productivity
Extracellular polymeric substances (EPSs) of microbial origin are complex bio-

polymers and vary greatly in their chemical composition. They have a great poten-
tial in chelation of metal ions. In general the regular composition and pattern of
EPSs make them good models for the detailed study of interactions between metals
and organic substrates (Flemming and Wingender 2001). Many studies have
reported that these polymers exhibit a great potential to chelate heavy metals
(Ozturk et al. 2012) owing to the presence of functional groups such as carboxyl,
phosphoryl, sulfhydryl, phenolic, and hydroxyl (Joshi and Juwarkar 2009; Ha et al.
2010). Interestingly various research aspects were carried out with regard to the
characterization of EPSs in Rhizobium strains for crop improvement. However R.
leguminosarum biovar trifolii from soil-contaminated sewage sludge depicted mul-
tiple metal tolerances that enabled them to survive in metal-contaminated soil, but
they have lost their ability to fix nitrogen with Trifolium repens (Chaudri et al.
1992). It is interesting to note that a variety of microbial mechanisms exist for metal
resistance, including physicochemical interactions, viz., efflux, intracellular seques-
tration, and/or extracellular precipitation by the excreted metabolites (Ledin 2000).
In view of that, the interaction between microbial anionic polymers and heavy met-
als has an imperative ecological and practical implication. Among the molecules
able to bind heavy metals are bacterial EPSs, linked to the cell surface and secreted
to the medium.
Moreover, biosorption and desorption studies of chromium (iii) with free cell
biomass (cells+EPSs) of Rhizobium BJVr 12 showed that amount of Cr3+ ion bio-
sorbed is influenced by the amount of biomass to Cr3+ concentration ratio and time
of contact (Mamaril et al. 1997). Attributable to the predominant anionic nature, the
EPSs have the capacity to strongly interact with metal cations and play an important
role in sequestration or immobilization of these ions in the environment (De philipps
et al.1998). However the microorganisms are known to regulate EPS synthesis and
modify EPS properties as a microbial response against the effects of toxic and del-
eterious chemicals (Jiang et al. 2004). In a previous study, EPSs produced by
Rhizobium etli were shown to bind to Mn2+ and Pb2+, Cu2+, Ni2+, and Co2+ (Foster
et al. 2000). Notwithstanding the increase of EPS production in response to heavy
metals studied in other bacterial species, very few studies on rhizobia have been
investigated (Santamaria et al. 2003). Different Rhizobium species from polluted
mine site were isolated with tolerance for various metal especially As up to 300 mg.
L−1. Conversely symbiotically effective Rhizobium resistant to arsenic and heavy
metals was characterized at the toxic spill at the Aznalcollar pyrite mine (Carrasco
et al. 2005). In another study, Reichman (2007) reported the beneficial role of
Rhizobium in biomass production under elevated heavy metal concentration. Wani
et al. (2007) reported that the inoculation of Vigna radiata L. with the NFB
Bradyrhizobium sp. RM8 conferred tolerance to plants grown under metal stress by
enhancing N concentration in roots and shoots. In another study, when pea plants
inoculated with Ni- and Zn-tolerant plant growth-promoting Rhizobium sp. RP5
grown in Ni and Zn polluted soils, the bioinoculant considerably improved glutathi-
one reductase (GR) activity in the roots and nodules which detoxifies the H2O2 via
the ascorbate-glutathione cycle (Wani et al. 2008). In another study heavy metal
arsenate interfered with the regulation of Rhizobium sp. VMA301 cell wall biosyn-
thesis, which resulted in arsenic binding to cell walls (Mandal et al. 2008). In a
recent report, complexation of Cd2+ by S. meliloti resulted in the attachment of this
ion to EPSs, and the amount of Cd2+ bound to the EPSs was shown to enhance at
high Cd2+ concentrations (Slaveykova et al. 2010), signifying a potential application
of this biopolymer in bioremediation. Modulation of metabolism and switching to
biofilm prevail over EPS production in the response of Rhizobium alamii to cad-
mium (Schue et al. 2011).
Recently some of the rhizobacteria were extensively studied for their ability to
facilitate the phytoremediation of soils contaminated with heavy metals (Ma et al.
2011). Nonetheless, zinc-tolerant and zinc-sensitive strains were also screened for
cell-surface component of Rhizobium sp. isolated from root nodules of T. alexandri-
num and found better adapted to stressful environmental conditions (Gauri et al.
2012). Apparently a small alteration in the physicochemical-biological properties of
rhizosphere soils caused by biotic/abiotic stress may have a dramatic effect on
plant-microbe interactions. However the metal-resistant plant-associated microbes
have been reported for potential to stimulate the acquisition of plant nutrients,
reduce metal toxicity, immobilize/mobilize heavy metals in the soil, recycle the
nutrients, improve plant health, and control plant pathogens (Glick 2010; Hayat
et al. 2010; Rajkumar et al. 2010; Ma et al. 2011). Recent studies investigating the
role of plant-associated microbes in protection against heavy metal stress have dem-
onstrated that the bacterial colonization often results in increased nutrient uptake
and an increase in plant biomass (Dimkpa et al. 2008; Maria et al. 2011). In a recent
study by Abd-Alla et al. (2012), R. leguminosarum bv. viciae STDF-Egypt19 was
depicted as an effective biosorbent for removal of Cd2+ and Co2+. Additionally, a
native Rhizobium sp. from Zn-mining soil was shown to promote the growth of
L. leucocephala on contaminated soil (Rangel et al. 2017); one of the most impor-
tant characteristics of PGPR is their ability to secrete EPSs that form biofilms or
facilitate adhesion to the surfaces of plant roots.
Although EPS production in response to heavy metals has been studied in other
bacterial species (González-Teuber et al. 2010), extremely few studies on rhizobia
have been documented. Among them may be mentioned the precipitation of metal-
lic cations by the acidic EPS from Bradyrhizobium strains (Corzo et al. 1994), the
capacity of the EPSs of R. etli to bind to metal ions (Foster et al. 2000), the com-
plexation of Cd2+ by the extracellular polymeric substances in S. meliloti (Slaveykova
et al. 2010), and the tolerance to acidity and aluminum mediated by EPSs produc-
tion in Rhizobium strains (Avelar Ferreira et al. 2012). Recently, it has been sug-
gested that EPS produced from R. radiobacter was explored as a biosorbent for the
removal of Pb(II) and Zn(II) from aqueous solution (Wang et al. 2013).
Coincidentally, the role of EPS production as a mechanism for metal resistance has
been demonstrated for other rhizobia, rhizobacteria and extremophiles. Recent lit-
erature reports encouraging results about the EPSs production in B. japonicum E109
and A. brasilense Az39 increased significantly under As(III) exposure, respectively
(Armendariz et al. 2015). We observed a great amount of rhizobial EPS production
in the presence of arsenate (Deepika et al. 2016), which could be envisaged that
more amounts of arsenate were biosorbed to EPS, as this concept has been widely
reported in other bacteria (Huang et al. 2010). Interestingly, versatile properties of
an EPS R-PS18 produced by Rhizobium sp. PRIM-18 showed high viscosity (shear
rate 75 s−1), pseudoplastic and thixotropic behavior, high emulsification, iron chela-
tion, and superoxide scavenging abilities (Priyanka et al. 2015). Notably in a recent
report, characterization of multipotential Rhizobium strain ND2 and its plant
growth-promoting activities under Cr(VI) stress was exploited for bioremediation
of Cr(VI)-contaminated sites as well as potential biofertilizer for enhancing the
agricultural productivity (Karthik et al. 2017). Studies of the S. meliloti/alfalfa sym-
biosis model system revealed numerous biological functions of EPSs, including
host specificity, participation in early stages of host plant infection, signaling mol-
ecule during plant development, and most importantly protection from environmen-
tal stresses (Nocelli et al. 2016). Nevertheless, in a latest study, the overproducing
EPS II/non-producing EPS I Rm8530 exoY strain showed a better survival during
the exposure to As or Hg compared to the non-producing EPS II/producing of EPS
I Rm8530 expA strain or the non-producing EPS Rm8530 exoY expA strain. These
results support that the EPS II would be more relevant than the EPS I in dealing with
the toxicity of heavy metals/metalloids (Nocelli et al. 2016).
2.6 Future Perspectives and Conclusions
Research focused on elucidating the biochemical mechanisms of metal tolerance of

rhizobacteria and screening tolerant strains is of great importance for development
and crop improvement of agricultural production as the metal resistances in
agriculture is alarmingly increasing across the globe. Understanding the mechanism

of adaptation in rhizobacteria will contribute to the long-term goal of enhancing
plant-microbe interaction for the improvement of leguminous crops grown in coastal
agricultural niche. The pragmatic changes in structure of plant-associated bacterial
communities in the root zone toward the selection of assemblages that are adapted
to abiotic stress, improve the resistance against stressors to promote stress tolerance
of leguminous plants in the agriculture soils. Therefore, the increase in population
of EPS-producing bacteria in root zones should possibly mitigate metal stress for
plants growing in contaminated environments. Further studies in this regard would
significantly contribute to better understanding of plant-metal-microbe interactions,
cellular-metabolic changes, and enhanced EPSs and hence can be used as a criterion
for the isolation of stress-tolerant microorganisms from metal-contaminated
agro-geo-ecosystems.
Acknowledgments The authors acknowledge the kind support and encouragement extended by
Krishna University, Machilipatnam, and Sambalpur University, Odisha. This research work is car-
ried out as a part of Dr. P. V. Bramhachari’s Doctoral of Science (D.Sc.) study.
References
Abd-Alla MH, Morsy FM, El-Enany AWE, Ohyama T (2012) Isolation and characterization of a
heavy-metal-resistant isolate of Rhizobium leguminosarum bv. viciae potentially applicable for
biosorption of Cd 2+ and Co 2+. Int Biodeterior Biodegrad 67:48–55
https://doi.org/10.1007/978-81-322-2776-2_21
Alami Y, Achouak W, Marol C, Heulin T (2000) Rhizosphere soil aggregation and plant growth
promotion of sunflowers by an exopolysaccharide-producing Rhizobium sp. strain isolated
from sunflower roots. Appl Environ Microbiol 66:3393–3398
Ali SZ, Sandhya V, Venkateswar Rao L (2014) Isolation and characterization of drought toler-
ant ACC deaminase and exopolysaccharide producing fluorescent Pseudomonas spp. Ann
Armendariz AL, Talano MA, Wevar Oller AL, Medina MI, Agostini E (2015) Effect of arsenic on
tolerance mechanisms of two plant growth-promoting bacteria used as biological inoculants.
J Environ Sci 33:203–210
Arora NK, Tewari S, Singh R (2013) Multifaceted plant-associated microbes and their mecha-
nisms diminish the concept of direct and indirect PGPRs. In: Arora NK (ed) Plant microbe
symbiosis: fundamentals and advances. Springer, New Delhi, pp 411–449
Ashraf M, Foolad MR (2007) Roles of glycine betaine and proline in improving plant abiotic stress
resistance. Environ Exp Bot 59:206–216
Ashraf MY, Wu L (1994) Breeding for salinity tolerance in plants. Crit Rev Plant Sci 13(1):17–42
Ashraf M, Berge SH, Mahmood OT (2004) Inoculating wheat seedling with exopolysaccharide-
producing bacteria restricts sodium uptake and stimulates plant growth under salt stress. Biol
Ashraf M, Hasnain S, Hussain F (2005) Exo-polysaccharides (eps) producing biofilm bacteria in
improving physicochemical characteristics of the salt-affected soils. In: Proceedings of the first
international conference on environmentally sustainable development v. 1–3
Avelar Ferreira PA, Bomfeti CA, Lima Soares B, de Souza Moreira FM (2012) Efficient nitrogen-
fixing Rhizobium strains isolated from amazonian soils are highly tolerant to acidity and alu-
minium. World J Microbiol Biotechnol 28:1947–1959
Awad NM, Turky AS, Abdelhamid MT, Attia M (2012) Ameliorate of environmental salt stress on
the growth of Zea mays L. plants by exopolysaccharides producing bacteria. J Appl Sci Res
8:2033–2044
from Indo-Gangetic Plain of India. Geomicrobiology J. https://doi.org/10.1080/01490451.20
16.1219431
Barea JM, Azcon R, Azcon Aguilar C (2004) Mycorrhizal fungi and plant growth promoting
rhizobacteria. In: Varma A, Abbott L, Werner D, Hampp R (eds) Plant surface microbiology.
Springer, Heidelberg, pp 351–371
Bashan Y, Holguin G, De-Bashan LE (2004) Azospirillum-plant relationships: physiologi-
cal, molecular, agricultural, and environmental advances (1997–2003). Can J Microbiol
50(8):521–577
Bashan Y, de Bashan LE, Prabhu SR, Hernandez JP (2014) Advances in plant growth-promoting
bacterial inoculant technology: formulations and practical perspectives (1998–2013). Plant
Soil 378(1–2):1–33
Beauregard PB, Chai Y, Vlamakis H, Losick R, Kolter R (2013) Bacillus subtilis biofilm induction
by plant polysaccharides. PNAS Plus Microbiol 110:E1621–E1630
Bensalim S, Nowak J, Asiedu SK (1998) A plant growth promoting rhizobacterium and tempera-
ture effects on performance of 18 clones of potato. Am J Potato Res 75(3):145–152
Bonkowski M (2004) Protozoa and plant growth: the microbial loop in soil revisited. New Phytol
162(3):617–631
Bramhachari PV, Kavi Kishor PB, Ramadevi R, Kumar R, Rao BR, Dubey SK (2007) Isolation
and characterization of mucous exopolysaccharide produced by Vibrio furnissii VB0S3.
J Microbiol Biotechnol 17:44–51
Borlee BR, Goldman AD, Murakami K, Samudrala R, Wozniak DJ, Parsek MR (2010)
Pseudomonas aeruginosa uses a cyclic‐di‐GMP‐regulated adhesin to reinforce the biofilm
extracellular matrix. Mol Microbiol 75(4):827–842
Burd GI, Dixon DG, Glick BR (2000) Plant growth-promoting bacteria that decrease heavy metal
toxicity in plants. Can J Microbiol 46(3):237–245
Carrasco JA, Armario P, Pajuelo E, Burgos A, Caviedes MA, López R, Palomares AJ (2005) Isolation
and characterization of symbiotically effective Rhizobium resistant to arsenic and heavy metals
after the toxic spill at the Aznalcollar pyrite mine. Soil Biol Biochem 37(6):1131–1140
Chang WS, Van de Mortel M, Nielsen L, de Guzman GN, Li X, Halverson LJ (2007) Alginate pro-
duction by Pseudomonas putida creates a hydrated microenvironment and contributes to biofilm
architecture and stress tolerance under water-limiting conditions. J Bacteriol 189:8290–8299
Chaudri AM, McGrath SP, Giller KE (1992) Metal tolerance of isolates of Rhizobium legumino-
sarum biovar trifolii from soil contaminated by past applications of sewage sludge. Soil Biol
Biochem 24(2):83–88
Corzo J, León-Barrios M, Hernando-Rico V, Gutierrez-Navarro AM (1994) Precipitation of
metallic cations by the acidic exopolysaccharides from Bradyrhizobium japonicum and
Bradyrhizobium (Chamaecytisus) strain BGA-1. Appl Environ Microbiol 12:4531–4536
D’Haeze W, Holsters M (2004) Surface polysaccharides enable bacteria to evade plant immunity.
Trends Microbiol 12(12):555–561
Danhorn T, Fuqua C (2007) Biofilm formation by plant-associated bacteria. Annu Rev Microbiol
61:401–422
org/10.1007/978-81-322-2776-2_20
Davey ME, O’Toole GA (2000) Molecular biofilms: from ecology to molecular genetics. Microbiol
Mol Biol Rev 64:847–867
De Vuyst L, Degeest B (1999) Heteropolysaccharides from lactic acid bacteria. FEMS Microbiol
Rev 23:153–177
Deepika KV, Raghuram M, Kariali E, Bramhachari PV (2016) Biological responses of symbi-
otic Rhizobium radiobacter strain VBCK1062 to the arsenic contaminated rhizosphere soils of
mung bean. Ecotoxicol Environ Saf 134:1–10
Dimitrova S, Pavlova K, Lukanov L, Korotkova E, Petrova E, Zagorchev P, Kuncheva M (2013)
Production of metabolites with antioxidant and emulsifying properties by Antarctic strain
Sporobolomyces salmonicolor AL(1). Appl Biochem Biotechnol 169:301–311
Dimkpa CO, Svatos A, Merten D, Büchel G, Kothe E (2008) Hydroxamate siderophores produced
by S. acidiscabies E13 bind nickel and promote growth in cowpea (Vigna unguiculata L.) under
nickel stress. Can J Microbiol 54:163–172
Dimkpa C, Weinand T, Asch F (2009) Plant–rhizobacteria interactions alleviate abiotic stress con-
ditions. Plant Cell Environ 32(12):1682–1694
pp 77–98. https://doi.org/10.1007/978-81-322-2776-2_6
org/10.1007/978-81-322-2776-2_19
El-Iklil Y, Karrou M, Benichou M (2000) Salt stress effect on epinasty in relation to ethylene pro-
duction and water relations in tomato. Agronomie 20(4):399–406
Flemming HC, Wingender J (2001) Relevance of microbial extracellular polymeric substances
(EPSs) – part I: structural and ecological aspects. Water Sci Technol J Int Assoc Water Pollut
Res 43(6):1–8
Foster LJR, Moy YP, Rogers PL (2000) Metal binding capabilities of rhizobium etli and its extra-
cellular polymeric substances. Biotechnol Lett 22:1757–1760
Fraysse N, Couderc F, Poinsot V (2003) Surface polysaccharide involvement in establishing the
rhizobium–legume symbiosis. Eur J Biochem 270(7):1365–1380
Fujishige NA, Kapadia NN, De Hoff PL, Hirsch AM (2006) Investigations of Rhizobium biofilm
formation. FEMS Microbiol Ecol 56:195–206
Gauri AKS, Bhatt RP, Pant S (2012) Effects of zinc on cell viability and cell surface compo-
nents of rhizobium sp isolated from root nodules of Trifolium alexandrinum. J Agric Technol
8(3):941–959
Geddie JL, Sutherland IW (1993) Uptake of metals by bacterial polysaccharides. J Appl Bacteriol
74(4):467–472. https://doi.org/10.1111/j.1365-2672.1993.tb05155.x
Glick BR (2010) Using soil bacteria to facilitate phytoremediation. Biotechnol Adv 28(3):367–374
Glick BR, Cheng Z, Czarny J, Duan J (2007) Promotion of plant growth by ACC deaminase-
producing soil bacteria. Eur J Plant Pathol 119(3):329–339
González-Teuber M, Pozo MJ, Muck A, Svatos A, Adame-Alvarez RM, Heil M (2010) Glucanases
and chitinases as causal agents in the protection of Acacia extrafloral nectar from infestation by
phytopathogens. Plant Physiol 152:1705–1715
Gouzou L, Burtin G, Philippy R, Bartoli F, Heulin T (1993) Effect of inoculation with Bacillus
polymyxa on soil agregation in the wheat rhizosphere: preliminary examination. Geoderma
56:479–490
Gutnick DL, Bach H (2000) Engineering bacterial biopolymers for the biosorption of heavy met-
als; new products and novel formulations. Appl Microbiol Biotechnol 54:451–460
Ha J, Gélabert A, Spormann AM, Brown GE (2010) Role of extracellular polymeric substances
in metal ion complexation on Shewanella oneidensis: batch uptake, thermodynamic modeling,
ATR-FTIR, and EXAFS study. Geochim Cosmochim Acta 74:1–15
Harish S, Kavino M, Kumar N, Balasubramanian P, Samiyappan R (2009) Induction of defense-
related proteins by mixtures of plant growth promoting endophytic bacteria against banana
bunchy top virus. Biol Control 51:16–25
Hynes RK, Leung GC, Hirkala DL, Nelson LM (2008) Isolation, selection, and characteriza-
tion of beneficial rhizobacteria from pea, lentil, and chickpea grown in western Canada. Can
J Microbiol 54(4):248–258
Hayat R, Ali S, Amara U, Khalid R, Ahmed I (2010) Soil beneficial bacteria and their role in plant
growth promotion: a review. Ann Microbiol 60(4):579–598
Huang A, Teplitski M, Rathinasabapathi B, Ma L (2010) Characterization of arsenic-resistant
bacteria from the rhizosphere of arsenic hyperaccumulator Pteris vittata. Can J Microbiol
56(3):236–246
Ivanov V, Chu J (2008) Applications of microorganisms to geotechnical engineering for bioclog-
ging and biocementation of soil in situ. Rev Environ Sci Bio/Technol 7:139–153
Jaszek M, Janczarek M, Kuczyński K, Piersiak T, Grzywnowicz K (2014) The response of the
Rhizobium leguminosarum bv. trifolii wild-type and exopolysaccharide-deficient mutants to
oxidative stress. Plant Soil 376(1–2):75–94
9(2):1211–1221
Jiang HL, Tay JH, Tay STL (2004) Changes in structure, activity and metabolism of aerobic gran-
ules as a microbial response to high phenol loading. Appl Microbiol Biotechnol 63:602–608
Joshi PM, Juwarkar AA (2009) In vivo studies to elucidate the role of extracellular polymeric
substances from Azotobacter in immobilization of heavy metals. Environ Sci Technol
43:5884–5889
Kaci Y, Heyraud A, Barakat M, Heulin T (2005) Isolation and identification of an EPS-producing
rhizobium strain from arid soil (Algeria): characterization of its EPS and the effect of inocula-
tion on wheat rhizosphere soil structure. Res Microbiol 156(4):522–531
Karthik C, Oves M, Sathya K, Sri Ramkumar V, Arulselvi PI (2017) Isolation and characterization
of multi-potential Rhizobium strain ND2 and its plant growth promoting activities under Cr
(VI) stress. Arch Agron Soil Sci 63(8):1058–1069
Kavino M, Harish S, Kumar N, Saravanakumar D, Samiyappan R (2010) Effect of chitinolytic
PGPR on growth, yield and physiological attributes of banana (Musa spp.) under field condi-
tions. Appl. Soil Ecol 45:71–77
Kawarai T, Furukawa S, Narisawa N, Hagiwara C, Ogihara H, Yamasaki M (2009) Biofilm forma-
tion by Escherichia coli in hypertonic sucrose media. J Bio Sci Bioeng 107(6):630
Kelly SJ, Muszynski A, Kawaharada Y, Hubber AM, Sullivan, JT, Sandal N, ..., Ronson CW (2013)
Conditional requirement for exopolysaccharide in the Mesorhizobium-Lotus symbiosis. Mol
Plant-Microbe Interact 26(3):319–329
Kennedy AC, Smith KL (1995) Soil microbial diversity and the sustainability of agricultural soils.
Kumar A, Bahadur I, Maurya BR, Raghuwanshi R, Meena VS, Singh DK, Dixit J (2015) Does
Kumar A, Meena R, Meena VS, Bisht JK, Pattanayak A (2016a) Towards the stress management
Kumar A, Patel JS, Bahadur I, Meena VS (2016b) The molecular mechanisms of KSMs for
Kumar A, Maurya BR, Raghuwanshi R, Meena VS, Islam MT (2017) Co-inoculation with entero-
bacter and rhizobacteria on yield and nutrient uptake by wheat (Triticum aestivum L.) in the
alluvial soil under indo-gangetic plain of India. J Plant Growth Regul. https://doi.org/10.1007/
s00344-016-9663-5
Kumon H, Tomochika KI, Matunaga T, Ogawa M, Ohmori H (1994) A sandwich cup method
for the penetration assay of antimicrobial agents through Pseudomonas exopolysaccharides.
Microbiol Immunol 38(8):615–619
Kyungseok P, Kloepper JW, Ryu CM (2008) Rhizobacterial exopolysaccharides elicit induced
resistance on cucumber. J Microbiol Biotechnol 18:1095–1100
Ledin M (2000) Accumulation of metals by microorganisms-processes and importance for soil
systems. Earth Sci Rev 51((1)):1–31
Liu D, Lian B, Dong H (2012) Isolation of Paenibacillus sp. and assessment of its potential for
enhancing mineral weathering. Geomicrobiol J 29(5):413–421
Lerner A, Castro-Sowinski S, Lerner H, Okon Y, Burdman S (2009) Glycogen phosphorylase is
involved in stress endurance and biofilm formation in Azospirillum brasilense Sp7. FEMS
Microbiol Lett 300(1):75–82
Ma Y, Prasad MNV, Rajkumar M, Freitas H (2011) Plant growth promoting rhizobacteria and
endophytes accelerate phytoremediation of metalliferous soils. Biotechnol Adv 29(2):248–258
Mamaril JC, Paner ET, Alpante BM (1997) Biosorption and desorption studies of chromium (iii)
by free and immobilized Rhizobium (BJVr 12) cell biomass. Biodegradation 8(4):275–285
Manca de Nadra MC, Strasser de Saad AM, Pesce de Ruiz Holgado AA, Oliver G (1985) Extracellular
polysaccharide production by Lactobacillus bulgaricus CRL 420. Milchwissenschaft
40(7):409–411
Mandal SM, Pati BR, Das AK, Ghosh AK (2008) Characterization of arsenic tolerant and nodula-
tion effective Rhizobium isolate of V. mungo. J Gen Appl Microbiol 54:93–99
Maria SD, Rivelli AR, Kuffner M, Sessitsch A, Wenzel WW, Gorfer M et al (2011) Interactions
between accumulation of trace elements and macronutrients in Salix caprea after inoculation
with rhizosphere microorganisms. Chemosphere 84:1256–1261
Martinez-Viveros O, Jorquera MA, Crowley DE, Gajardo GMLM, Mora ML (2010) Mechanisms
and practical considerations involved in plant growth promotion by rhizobacteria. J Soil Sci
Plant Nutr 10(3):293–319
https://doi.org/10.1007/978-81-322-2776-2_10
Maurya BR, Meena VS, Meena OP (2014) Influence of inceptisol and alfisol’s potassium solubiliz-
ing bacteria (KSB) isolates on release of K from waste mica. Vegetos 27:181–187
Mayak S, Tirosh T, Glick BR (2004a) Plant growth-promoting bacteria that confer resistance to
water stress in tomato and pepper. Plant Sci 166:525–530
Mayak S, Tirosh T, Glick BR (2004b) Plant growth-promoting bacteria that confer resistance in
tomato and pepper to salt stress. Plant Physiol Biochem 42:565–572
alluvium soil of Varanasi. Crop Res 45(1,2 & 3):6–12
inorganic fertilizer in alluvium soil of Varanasi. Bioscan 8(3):931–935
jclepro.2015.04.044
Meena VS, Maurya BR, Meena SK, Meena RK, Kumar A, Verma JP, Singh NP (2017) Can
Bacillus species enhance nutrient availability in agricultural soils? In: Islam MT, Rahman M,
Pandey P, Jha CK, Aeron A (eds) Bacilli and agrobiotechnology. Springer, Cham, pp 367–395.
https://doi.org/10.1007/978-3-319-44409-3_16
Mendrygal KE, González JE (2000) Environmental regulation of exopolysaccharide production in
Sinorhizobium meliloti. J Bacteriol 182(3):599–606
Nadeem SM, Ahmad M, Zahir ZA, Javaid A, Ashraf M (2014) The role of mycorrhizae and plant
growth promoting rhizobacteria (PGPR) in improving crop productivity under stressful envi-
ronments. Biotechnol Adv 32(2):429–448
Nihorimbere V, Marc Ongena M, Smargiassi M, Thonart P (2011) Beneficial effect of the rhi-
zosphere microbial community for plant growth and health. Biotechnol Agron Soc Environ
15:327–337
Nocelli N, Bogino PC, Banchio E, Giordano W (2016) Roles of extracellular polysaccharides and
biofilm formation in heavy metal resistance of Rhizobia. Materials 9(6):418
Ortmann I, Conrath U, Moerschbacher BM (2006) Exopolysaccharides of Pantoea agglomerans

have different priming and eliciting activities in suspension-cultured cells of monocots and
dicots. FEBS Lett 580(18):4491–4494
Ouzounidou G, Moustakas M, Symeonidis L, Karataglis S (2006) Response of wheat seedlings to
Ni stress: effects of supplemental calcium. Arch Environ Contam Toxicol 50:346–352
Ozturk S, Kaya T, Aslim B, Tan S (2012) Removal and reduction of chromium by pseudomonas
spp. and their correlation to rhamnolipid production. J Hazard Mater 231:64–69
Parada M, Vinardell JM, Ollero FJ, Hidalgo Á, Gutiérrez R, Buendía-Clavería AM, Rodríguez-
Carvajal MA (2006) Sinorhizobium fredii HH103 mutants affected in capsular polysaccha-
ride (KPS) are impaired for nodulation with soybean and Cajanus cajan. Mol Plant-Microbe
Interact 19(1):43–52
bacteria enhance growth and nutrient uptake of crops. Agric Sustain Dev 2(2):101–116
Priyanka P, Arun AB, Ashwini P, Rekha PD (2015) Versatile properties of an exopolysaccharide
R-PS18 produced by Rhizobium sp. PRIM-18. Carbohydr Polym 126:215–221
Qurashi AW, Sabri AN (2012) Bacterial exopolysaccharide and biofilm formation stimulate chick-
pea growth and soil aggregation under salt stress. Braz J Microbiol 43(3):1183–1191
org/10.1007/978-81-322-2776-2_4
Rajkumar M, Ae N, Prasad MNV, Freitas H (2010) Potential of siderophore-producing bacteria for
improving heavy metal phytoextraction. Trends Biotechnol 28:142–149
Rangel WM, Thijs S, Janssen J, Oliveira Longatti SM, Bonaldi DS, Ribeiro PR, Moreira FM
(2017) Native rhizobium from Zn-mining soil promotes the growth of Leucaena leucocephala
on contaminated soil. Int J Phytoremed 19(2):142–156
Reichman SMA (2007) The potential use of the legume–Rhizobium symbiosis for the remediation
of arsenic contaminated sites. Soil Biol 39:2587–2593
Roberson EB, Firestone MK (1992) Relationship between desiccation and exopolysaccharide pro-
duction in a soil Pseudomonas sp. Appl Environ Microbiol 58(4):1284–1291
Rodriguez R, Redman R (2008) More than 400 million years of evolution and some plants still can’t
make it on their own: plant stress tolerance via fungal symbiosis. J Exp Bot 59(5):1109–1114
Rolli E, Marasco R, Vigani G, Ettoumi B, Mapelli F, Deangelis ML, Gandolfi C, Casati E et al
(2014) Improved plant resistance to drought is promoted by the root-associated microbiome as
a water stress-dependent trait. Environ Microbiol 17:316–331
Rossi F, Micheletti E, Bruno L, Adhikary SP, Albertano P, De Philippis R (2012) Characteristics
and role of the exocellular polysaccharides produced by five cyanobacteria isolated from pho-
totrophic biofilms growing on stone monuments. Biofouling 28(2):215–224
pp 127–136. https://doi.org/10.1007/978-81-322-2776-2_9
Sandhya V, Ali SZ, Minakshi G, Reddy G, Venkateswarlu B (2009) Alleviation of drought stress
effects in sunflower seedlings by the exopolysaccharides producing Pseudomonas putida strain
GAP P45. Biol Fertil Soils 46:17–26
Santaella C, Schue M, Berge O, Heulin T, Achouak W (2008) The exopolysaccharide of Rhizobium
sp. YAS34 is not necessary for biofilm formation on Arabidopsis thaliana and Brassica napus
roots but contributes to root colonization. Environ Microbiol 10(8):2150–2163
Santamaria M, Díaz-Marrero A, Hernández J, Gutiérrez-Navarro AM, Corzo J (2003) Effect of tho-
rium on the growth and capsule morphology of Bradyrhizobium. Environ Microbiol 5:916–924
Saravanakumar D, Samiyappan R (2007) ACC deaminase from Pseudomonas fluorescens medi-
ated saline resistance in groundnut (Arachis hypogea) plants. J Appl Microbiol 102:1283–1292
Scheu S, Ruess L, Bonkowski M (2005) Interactions between microorganisms and soil micro- and
mesofauna. In: Buscot F, Varma S (eds) Micro-organisms in soils: roles in genesis and func-
tions. Springer, Heidelberg, pp 195–212
Schue M, Fekete A, Ortet P, Brutesco C, Heulin T, Schmitt-Kopplin P, ..., Santaella C (2011)
Modulation of metabolism and switching to biofilm prevail over exopolysaccharide production
in the response of R. alamii to cadmium. PloS One 6(11):e26771
Seneviratne G, Weerasekara MLMAW, Seneviratne KACN, Zavahir JS, Lecskes ML, Kennedy
IR (2011) Importance of biofilm formation in plant growth promoting rhizobacterial action.
Microbiol Monogr 18:81–95
Sgherri C, Quartacci MF, Navarri-Izzo F (2007) Early production of activated oxygen species in
root apoplast of wheat following copper excess. J Plant Physiol 164:1152–1160
Sheng GP, Yu HQ, Li XY (2010) Extracellular polymeric substances (EPS) of microbial aggre-
gates in biological wastewater treatment systems: a review. Biotechnol Adv 28(6):882–894
Singh A, Van Hamme JD, Ward OP (2007) Surfactants in microbiology and biotechnology: part 2:
application aspects. Biotechnol Adv 25:99–121
Slaveykova VI, Parthasarathy N, Dedieu K, Toescher D (2010) Role of extracellular compounds
in Cd-sequestration relative to Cd uptake by bacterium Sinorhizobium meliloti. Environ Pollut
158:2561–2565
Sutherland I (2001) Biofilm exopolysaccharides: a strong and sticky framework. Microbiology
147:3–9
Tank N, Saraf M (2010) Salinity-resistant plant growth promoting rhizobacteria ameliorates
sodium chloride stress on tomato plants. J Plant Interact 5(1):51–58

Tewari S, Arora NK (2014) Multifunctional exopolysaccharides from Pseudomonas aeruginosa
PF23 involved in plant growth stimulation, biocontrol and stress amelioration in sunflower
under saline conditions. Curr Microbiol 69:484–494
Tsuneda S, Aikawa H, Hayashi H, Yuasa A, Hirata A (2003) Extracellular polymeric substances
responsible for bacterial adhesion onto solid surface. FEMS Microbiol Lett 223(2):287–292
Upadhyay DN, Vyas RK, Sharma ML, Soni Y, Rajnee (2011) Comparison in serum profile of per-
oxidants (MDA) and nonenzymatic antioxidants (vitamins E and C) among patients suffering
from plasmodium falciparum and vivax malaria. J Postgrad Med Inst 25:96–100
Valls M, De Lorenzo V (2002) Exploiting the genetic and biochemical capacities of bacteria for the
remediation of heavy metal pollution. FEMS Microbiol Rev 26(4):327–338
Vanbleu E, Choudhury BP, Carlson RW, Vanderleyden J (2005) The nodPQ genes in Azospirillum
brasilense Sp7 are involved in sulfation of lipopolysaccharides. Environ Microbiol
7(11):1769–1774
Vanhaverbeke C, Heyraud A, Mazeau K (2003) Conformational analysis of the exopolysac-
charide from Burkholderia caribensis strain MWAP71: impact on the interaction with soils.
Biopolymers 69:480–497
Vanhooren P, Vandamme EJ (1998) Biosynthesis, physiological role, use and fermentation process
characteristics of bacterial exopolysaccharides. Recent Res Dev Ferment Bioeng 1:253–300
Vardharajula S, Zulfikar Ali S, Grover M, Reddy G, Bandi V (2011) Drought-tolerant plant growth
promoting Bacillus spp.: effect on growth, osmolytes, and antioxidant status of maize under
drought stress. J Plant Interact 6(1):1–14
84(8):914–919
Vu B, Chen M, Crawford RJ, Ivanova EP (2009) Bacterial extracellular polysaccharides involved
in biofilm formation. Molecules 14(7):2535–2554
Wang L, Ma F, Qu Y, Sun D, Li A, Guo J, Yu B (2011) Characterization of a compound biofloc-
culant produced by mixed culture of Rhizobium radiobacter and Bacillus sphaericus F6. World
Wang L, Yang J, Chen Z, Liu X, Fang M (2013) Biosorption of Pb(II) and Zn(II) by extracellular
polymeric substance (EPS) of Rhizobium radiobacter: equilibrium, kinetics and reuse studies.
Arch Environ Protec 39(2):129–140
Wani PA, Khan MS, Zaidi A (2007) Effect of metal tolerant plant growth promoting
Bradyrhizobium sp.(vigna) on growth, symbiosis, seed yield and metal uptake by green gram
plants. Chemosphere 70(1):36–45
Wani PA, Khan MS, Zaidi A (2008) Effect of heavy metal toxicity on growth, symbiosis, seed yield
and metal uptake in pea grown in metal amended soil. Bull Environ Contam Toxicol 55:33–42
Wielbo J, Mazur A, Krol J, Marczak M, Kutkowska J, Skorupska A (2004) Complexity of pheno-
types and symbiotic behaviour of Rhizobium leguminosarum biovar trifolii exopolysaccharide
mutants. Arch Microbiol 182(4):331–336
Wilbert AT, Slagren SV, Brussel AAN, Kijne JW (1998) Role of exopolysaccharides of Rhizobium
leguminosarum bv viciae as host plant-specific molecules required for infection thread forma-
tion during nodulation of Vicia sativa. J Am Phytopathol Soc 2:1233–1241
org/10.1007/978-81-322-2776-2_14
Yang J, Kloepper JW, Ryu CM (2009) Rhizosphere bacteria help plants tolerate abiotic stress.
Trends Plant Sci 14(1):1–4
org/10.1007/978-81-322-2776-2_12
org/10.1007/978-81-322-2776-2_3
Chapter 3
Role of ACC Deaminase as a Stress
Ameliorating Enzyme of Plant Growth-
Promoting Rhizobacteria Useful in Stress
Agriculture: A Review
Pallab Kumar Ghosh, Tarun Kumar De, and Tushar Kanti Maiti
Abstract The crop production is inhibited by a large number of both biotic and
abiotic stresses. These stresses include presence of toxic heavy metals, high salt,
flood, drought, temperature, wounding, various pathogens, etc. The agricultural
production was intensified by management of these stresses with increased use of
chemicals, and it needs more attention for incoming population explosion. These
chemical inputs caused several harmful effects on the environment and sustainable
agriculture. It is ne3cessary to decrease dependence of chemical input for sustain-
able agriculture with a holistic approach and also essential for environmental pro-
tection. One such possible approach is the use of 1-aminocyclopropane-1-carboxylate
(ACC) deaminase-producing plant growth-promoting rhizobacteria (PGPR) to pro-
tect the crop plants from the harmful effects of both biotic and abiotic stresses. The
enzyme ACC deaminase (EC 4.1.99.4) regulates stress ethylene production by cata-
lysing ACC into α-ketobutyrate and ammonia. Various research works have docu-
mented the application of ACC deaminase-producing PGPR under both normal and
stressed conditions responsible for the increased growth, health and productivity of
crop plant. These beneficial rhizobacteria may decrease the dependence on agro-
chemicals (fertilizer and pesticides) to stabilize the agroecosystems and maintained
sustainable agriculture. Different biochemical and biophysical properties of this
enzyme and its regulation have been briefly described. This review also describes
the role of ACC deaminase enzyme in plant growth and production by ameliorating
different stress conditions including heavy metal, salinity, drought, flood, tempera-
ture, etc. Finally, the latest paradigms for useful application of ACC deaminase-
containing plant growth-promoting rhizobacteria in different agroecosystems have
been discussed comprehensively under stress conditions to highlight the recent
scenario with the aim to develop future insights.
P. K. Ghosh · T. K. De
Department of Marine Science, Ballygunge Science College Campus, Calcutta University,
Kolkata, India
T. K. Maiti (*)
Microbiology Laboratory, CAS, Department of Botany, Burdwan University,
Burdwan, WB, India

https://doi.org/10.1007/978-981-10-8402-7_3
58 P. K. Ghosh et al.
Keywords ACC deaminase · Biotic and abiotic stress · Ethylene · Phylogeny ·

Signalling
Abbreviation
ACC 1-Aminocyclopropane-1-carboxylate
ACCD 1-Aminocyclopropane-1-carboxylate deaminase
ARF Auxin response factor
IAA Indole-3-acetic acid
ISR Induce systemic resistance
PGPR Plant growth-promoting rhizobacteria
3.1 Introduction
Due to population explosion, gradual increase of industrialization, global warming,

increase salinity and uneven distribution of precipitation, the soil environment in
agricultural land gradually becomes unproductive for crop yield. In soil environ-
ment, plant faces different stresses (biotic and abiotic) which have a negative impact
on growth and development. The important abiotic stresses include heavy metals,
salinity, drought, flooding and temperature (Saleem et al. 2007). The biotic stresses
like pathogens and symbiosis by microorganism also affects plant growth. During
such stress conditions, various developmental, morphological, physiological and
biochemical disorders occur in plants that affect metabolisms and normal life cycle
of plants (Meena et al. 2013a; Bahadur et al. 2014; Maurya et al. 2014; Jat et al.
2015; Kumar et al. 2015, 2016b; Ahmad et al. 2016). One such disorder is the
enhancement of ethylene production which leads to inhibition of root growth and
correspondingly growth of the plant as a whole (Sairam and Tyagi 2004).
The low concentration of ethylene is essential for normal plant growth; however,
enhanced ethylene production under stress conditions is a major cause of reduction
of plant growth and development (Bernardo et al. 2000; Arshad and Frankenberger
2002; Saleem et al. 2007). So reduction of stress ethylene is essential for improving
plant growth under stress condition (Mayak et al. 2004a; Glick et al. 2007). This can
be achieved by treating the plants with chemical substances inhibiting ethylene bio-
synthesis or ACC deaminase enzyme produced by rhizobacteria as biological inhib-
itor (Mayak et al. 1999). The chemical inhibitors are effective in regulating the
ethylene level (Sisler and Serek 1997), but the toxicity and longevity of these chem-
icals are environmental concerns (Ahmadi et al. 2009). Thus ACC deaminase-
producing rhizobacteria protect the plants from harmful effect of environmental
stresses including heavy metal, salinity, drought, flooding, temperature and patho-
gens (Mayak et al. 2004b; Nadeem et al. 2007).
3 Role of ACC Deaminase as a Stress Ameliorating Enzyme of Plant… 59
The soil’s bacteria which are beneficial free-living microorganisms present in the
rhizospheric soil in association with the roots of different plants are called plant
growth-promoting rhizobacteria (PGPR) (Kloepper et al. 1989). The PGPR may act
as biofertilizer, phytostimulator, biocontrolling agents and rhizoremediator by pos-
sessing some important traits. There are several ways in which PGPR can directly
enhance plant growth and development (Glick et al. 1995). These are (i) able to fix
atmospheric nitrogen, (ii) produce siderophores that chelate iron and make it avail-
able to the plant root, (iii) solubilize minerals such as phosphorus and (iv) produce
phytohormones that can modulate plant growth and development (Glick et al. 1995;
Glick 2005).
Moreover another direct effect of PGPR is the biosynthesis of important enzyme
ACC deaminase (EC 4.1.99.4), which controls ethylene production by catalysing
ACC (precursor of ethylene biosynthesis) into α-ketobutyrate and ammonia. This
enzyme was first reported by Honma and Shimomura (1978) from Hansenula satur-
nus (a yeast cell); since then, it has been detected in different microorganisms. The
ACC deaminase-producing PGPR are bound to root or seed and act as a sink for
ACC and reduced the levels of ethylene. So ACC deaminase-producing PGPR pro-
mote plant growth particularly under stress conditions by the regulation of acceler-
ated ethylene production in response to various stress. This review mainly
emphasizes on biochemical characterization, distribution and mechanism of action
of ACC deaminase enzyme found in PGPR and particularly its significant role on
different stress ameliorating capabilities under various stress-related agricultural
fields (Meena et al. 2016a, b; Parewa et al. 2014; Prakash and Verma 2016;
Priyadharsini and Muthukumar 2016; Kumar et al. 2016a, 2017).
3.2 Biochemical Characteristics of ACC Deaminase Enzyme
The biochemical properties of ACC deaminase are carried out by different scientists
(Honma and Shimomura 1978; Minami et al. 1998; Jia et al. 1999; Hontzeas et al.
2004a; Singh et al. 2015a, b). The biochemical and thermodynamic properties of the
ACC deaminase were recorded in some bacterial or rhizobacterial strains by differ-
ent workers (Table 3.1). Basically, it is a sulfhydryl multimeric enzyme with one
PLP cofactor tightly bound to each subunit (Jacobson et al. 1994). The crystal struc-
tures along with site-specific mutagenesis studies revealed that the ACC deaminase
enzyme is folded to form two domains that are similar to β-subunit of the PLP-
dependent enzyme tryptophan synthetase. The comparison of amino acid sequence
alignment of these enzymes suggested that most of the conserved and active sites of
ACC deaminase are virtually identical in H. saturnus and Pseudomonas sp. (Meena
et al. 2015a, f; Raghavendra et al. 2016; Zahedi 2016; Dominguez-Nunez et al.
2016; Dotaniya et al. 2016; Jaiswal et al. 2016; Jha and Subramanian 2016).
Table 3.1 Biochemical characteristics of ACC deaminase enzymes from some pioneer
microorganism
Pseudomonas Pseudomonas Hansenula Penicillium Pseudomonas
Enzyme source sp. strain ACP putida GR 12–2 saturnus citrinum putida UW4
Native enzyme 104–112,000 105,000 69,000 68,000 n.d.
molecular mass
(dalton)
Subunit 36,500 35,000 40,000 41,000 41,800
molecular mass
(dalton)
Estimated 3 3 2 2 n.d.
number of
subunits
Optimum pH 8.0–0.5.0 8.5 8.5 8.5 8.0
Temperature n.d. 30 °C n.d. 35 °C n.d.
optimum
Km for ACC 1.5–9.2 n.d. 2.6 4.6 3.4
(mM)
Kcat (min-1) 290 n.d. n.d. n.d. 146
Melting n.d. n.d. n.d. n.d. 58-60 °C
temperature
ΔG# at 298 K n.d. n.d. n.d. n.d. 69.6 kJ/mol
ΔH# n.d. n.d. n.d. n.d. 46.8 kJ/mol
ΔS# n.d. n.d. n.d. n.d. −78 J/mol K
Crystal Yes No Yes No No
structure
References Karthikeyan Jacobson et al. Minami Jia et al. Hontzeas et al.
et al. (2004) (1994) et al. (1998) (1999) (2004b)
n.d. Not detected
3.3 ACC Deaminase Gene Distribution
Earlier workers found that the ACC deaminase enzyme was mainly found in free-
living soil bacteria (Honma and Shimomura 1978; Glick et al. 1994; Tarabily 2008)
and fungi (Minami et al. 1998; Viterbo et al. 2010; Sing and Kashyap 2012).
The ACC deaminase has been found in very wide range of bacteria described by
different workers (Table 3.2). Similarly the enzyme also found in Pyrococcus hor-
ikoshii OT3 (an archaea) (Fujino et al. 2004). In addition, based on sequence simi-
larity, the presence of putative ACC deaminase genes in the genomes of several
plants (Arabidopsis, poplar and tomato) was revealed, but its expression remains to
be demonstrated (McDonnell et al. 2009; Plett et al. 2009; Singh et al. 2015a, b) and
the distribution of ACC deaminase enzyme was described in domain Eukarya
(Table 3.3).
The transfer of ACC deaminase genes from one bacterium to another is not
uncommon (Bertolla and Simonet 1999). Several genes were observed in different
species of rhizobium (Kaneko et al. 2002; Ma et al. 2003), and its consistent position
Table 3.2 List of different bacterial strains producing ACC deaminase

ACC deaminase activity
Organisms (nM of αKB mg−1 h−1) References
Achromobacter xylosoxidans A551 400 ± 4 Belimov et al. (2001,
A. xylosoxidans Bm1 90 ± 4 2005)
Achromobacter sp. CM1 130 ± 3
Acidovorax facilis 4P6 3080 ± 120
Pseudomonas brassicacearum Am3 5660 ± 12
P. marginalis DP3 4054 ± 27
P. putida BM3 3780 ± 32
P. syringae GR12–2 3470 ± 30
P. brassicacearum AY007428 972
P. oryzihabitans 890
Variovorax paradoxus AF288727 209
Alcaligenes sp. AF288728 1172
A. xylosoxidans AF302096 555
A. xylosoxidans AF302097 151
P. marginalis AF311387 1073
V. paradoxus sp. 1805
Bacillus pumilus AF288735 760
Rhodococcus sp. AF 288731 833
Rhizobium leguminosarum 128C53K 5±1
Rhodococcus sp. 4 N-4 12,970 ± 440
Rhodococcus sp. Fp2 7320 ± 400
Serratia quinivorans SUD165 12 ± 15
Variovorax paradoxus 3P-3 3700 ± 90
V. paradoxus 5C-1 4322 ± 100
V. paradoxus 2C-1 3588 ± 26
Acidovorax facilis 0.0007
Enterobacter cloacae UW4 476 Nie et al. (2002)
Escherichia coli DH5α/p4U2 285 Shah et al. (1998)
E. aerogenes CAL3 16 ± 12
P. putida UW4 3030 ± 60 Hontzeas et al. (2006)
Rhodococcus sp. strain Fp2 7320 ± 400 Hontzeas et al. (2005)
Rhodococcus sp. strain 4N-4 12,970 ± 440
Serratia quinivorans SUD165 12 ± 15
V. paradoxus 3P-3 3700 ± 90
V. paradoxus 5C-2 4322 ± 100
V. paradoxus 2C-1 3588 ± 26
P. fluorescens TDK1 349 Zahir et al. (2009)
Pseudomonas sp. 4MKS8 955 Babalola et al.(2003)
Pseudomonas sp. ACP 537 Dey et al. (2004)
A. xylosoxidans AF288734 305 Dell’Amico et al. (2008)
Pseudomonas tolaasii 1.16
Mycobacterium sp. 1.14
Methylobacterium fujisawaense 24.74 Madhaiyan et al.(2006)
M. oryzae 94.48
(continued)
Table 3.2 (continued)

Burkholderia caryophylli 598 Shaharoona et al. (2007)
Serratia proteamaculans 276 Zahir et al.(2009)
P. aeruginosa 153
P. syringae 440 Nadeem et al. (2007,
P. chlororaphis 456 2010)
P. bathycetes 501
E. aerogenes 341
Flavobacterium ferrugineum 405
P. putida 364
E. cloacae 295
S. ficaria 326
P. fluorescens 421
Rhizobium leguminosarum 99A1 8±3 Ma et al. (2003)
R. hedysari ATCC 43676 20 ± 0.1
R. gallicum PB2 82 Duan et al. (2009)
R. leguminosarum PB45 143
R. leguminosarum bv. viciae 128Sm 177
R. hedysari ATCC43676 200
Methylobacterium oryzae CBMB20 94.48 ± 6.83 Yim et al. (2010)
M. oryzae CBMB110 24.74 ± 4.12
(continued)

M. oryzae CBMB20 12.95 ± 2.86 Madhaiyan et al. (2007)
Methylobacterium sp. CBMB120 24.58 ± 1.73
Burkholderia sp. CZ1525 7556 ± 273 Li et al. (2011)
Burkholderia sp. DN248-14 9037 ± 394
Burkholderia sp. SZ6–1 8462 ± 287
Burkholderia sp. SZ6–3 11,139 ± 250
Burkholderia sp. Os8 16,575 ± 280
Burkholderia sp. Os9 7362 ± 441
Burkholderia sp. Os33 12,122 ± 541
Pseudomonas sp. Os18 1003 ± 49
Pseudomonas sp. Os52 11,827 ± 72
Herbaspirillum sp.Os23 694 ± 40
Herbaspirillum sp. Os38 1534 ± 177
(continued)

E. coli DH5a/pTZACC 13063.07 Farajzadeh et al. (2010)
E. coli DH5a/pFY32 163.26
P. fluorescens FY32 793.88
R. leguminosarum bv. viciae 128C53K 1060 Ma et al. (2003)
R. leguminosarum bv. viciae 128C53 780
R. leguminosarum bv. viciae 128C53G 930
R. leguminosarum bv. viciae 99A1 430
R. hedysari 1780
R. leguminosarum bv. viciae 128C53K 1060
Streptomyces sp. strain 4 spp. 221.43 Tarabily (2008)
Streptomyces sp. strain 12 85.72
Burkholderia unamae 3.78 ± 0.66 Lemus et al. (2009)
B. xenovorans 8.62 ± 2.26
B. silvatlantica 12.40 ± 2.34
B. phymatum STM815 3.55 ± 0.78
B. tuberum STM678 4.63 ± 0.59
B. vietnamiensis 5.10 ± 1.62
B. caribensis MWAP64 3.91 ± 1.03
B. phenoliruptrix LMG 22037 2.13 ± 0.71
B. fungorum LMG 16225 2.46 ± 0.13
B. graminis C4D1 M 10.19 ± 0.51
B. caledonica LMG 19076 12.11 ± 3.25
B. terricola LMG 20594 12.59 ± 0.46
B. phytofirmans PsJN 12.03 ± 0.43
B. stabilis LMG 14294 11.85 ± 1.58
B. cenocepacia J2315 2.63 ± 0.23
B. cepacia ATCC 25416 4.85 ± 0.41
B. caryophylli LMG 2155 5.53 ± 1.05
B. kururiensis 5.17 ± 0.31
Achromobacter sp. GKA-1 3.891 ± 0.250 Govindasamy et al.
P. stutzeri GKA-13 3.677 ± 0.187 (2008a, b)
B. phytofirmans PsJN 4032 ± 108 Sun et al. (2009)
(continued)

Pseudomonas sp. strain CPBR6 77.2 ± 7.04 Poonguzhali et al. (2008)
Pseudomonas sp. strain CPBR7 108.3 ± 7.70
Pseudomonas sp. strain CPBR16 56.8 ± 3.92
Pseudomonas sp. strain CPBE30 61.4 ± 3.67
P. putida BN-St1 147 ± 13 Samina et al. (2010)
E. cloacae BN-St2 138 ± 27
P. putida LH-S1 88 ± 1
Citrobacter freundii LH-S2 296 ± 42
S. maltophilia LH-S3 75 ± 17
P. putida LH-R1 87 ± 6
E. cloacae LH-R2 842 ± 61
C. freundii LH-R4 261 ± 58
E. cloacae LH-St1 75 ± 19
E. cloacae PB-S1 65 ± 8
E. cloacae PB-S2 65 ± 12
Rahnella aquatilis PB-Rt2 108 ± 27
C. freundii PB-SRSt 146 ± 34
P. fluorescens PB-St1 88 ± 16
E. cloacae PB-St4 110 ± 34
C. freundii PB-St5 123 ± 17
S. maltophilia QS3 85 ± 13
P. putida QR2 106 ± 25
E. cloacae QSt1 182 ± 31
S. maltophilia QSt2 185 ± 9
P. putida QSt3 90 ± 15
P. putida OK-St 105 ± 7
Providencia sp. strain AW5 3.13 Rana et al. (2011)
Alcaligenes sp. strain AW10 9.5
Bacillus pumilus Sol-1 430 Akhtar and Ali (2011)
Alcaligenes sp. Mal-4 390
Providencia vermicola Ama-2 377
Rhizobium sp. strain P2 110 ± 1.201 Ghosh et al. (2013)
(continued)

Bacillus sp. strain MBPSB5 85 ± 0.5 Kumar et al. (2014)
Bacillus sp. strain MBPSB12 8.1 ± 0.8
Pseudomonas sp. strain SorP4 1.42 ± 0.039 Ali et al. (2014a, b)
Enterobacter sp. A3CK 3795.07 ± 4.04 Ghosh et al. (2015a)
Enterobacter sp. A7CK 1750.7 ± 3.46
R. undicola strain N37 2334.2 ± 2.90 Ghosh et al. (2015b)
Bacillus subtilis IIPR-ACC-3 863.41 Senthilkumar et al.
Pseudomonas stutzeri IPR-ACC-79 417.32 (2016)
Table 3.3 Distribution of ACC deaminase in domain Eukarya

Kingdom Phylum Species
Animalia Porifera Amphimedon queenslandica
Chordata Branchiostoma floridae, Ciona intestinalis, Oikopleura dioica
Annelida Capitella teleta
Cnidaria Nematostella vectensis
Placozoa Trichoplax adhaerens Grell-BS-1999
Chromal Haptophyta Emiliania huxleyi
veolata Stramenopile Saprolegnia parasitica, Phytophthora ramorum, P. sojae
Apicomplexa Theileria annulata
Fungi Ascomycota Hansenula saturnus, Arthroderma benhamiaea, Aspergillus
clavatusa, A. flavusa, A. fumigatus, Beauveria bassiana,
Cercospora sojina, Coccidioides posadasiia, Fusarium
oxysporum, Neosartorya fischeria, Penicillium marneffeia, P.
citrinum, Trichoderma asperellum, Talaromyces stipitatusa,
Trichophyton verrucosuma, Issatchenkia occidentalis
Basidiomycota Cryptococcus neoformans, Gymnopus luxurians, Schizophyllum
commune
Plantae Lycopodiophyta Selaginella moellendorffii
Magnoliophyta Ricinus communisa, Zea mays, Glycine max, Solanum tuberosum
Chlorophyta Volvox carteri, Arabidopsisa, poplara, tomatoa
Modified after Singh et al. (2015a, b)
a
Putative proteins have been found
supports that ACC deaminase genes were acquired by lateral gene transfer. The
phylogenetic tree of 16S rDNA sequence and ACC gene sequences of several bac-
teria (having ACC deaminase activity) were prepared by maximum likelihood
method based on MEGA software (Figs. 3.1 and 3.2).
A discrete gamma distribution was used in this model for evolutionary rate dif-
ferences among sites. Both the phylogenetic trees were best fitted model, but no
concluding remarks have been made in relation to evolutionary relationship of the
entire bacterial group included in this phylogram. This result suggested that the
phylogenetic tree of ACC deaminase was not similar to the phylogenetic tree of 16S
rDNA sequences of bacteria (Hontzeas et al. 2005). The bacterial ACC deaminase
genes may be not inherited vertically; rather some bacterial ACC deaminase genes
possibly evolved through horizontal gene transfer. However the horizontal gene
transfer may be found in some plants (McDonnell et al. 2009). These plants may
have acquired the gene from soil bacteria with which they normally associated in
rhizospheric region (Meena et al. 2015b, c, d, e; Rawat et al. 2016; Yasin et al. 2016;
Saha et al. 2016a; Yadav and Sidhu 2016; Teotia et al. 2016; Bahadur et al. 2016b;
Das and Pradhan 2016).
Fig. 3.1 Phylogram based on 16S rDNA sequences of ACC deaminase-producing PGPR. The
evolutionary history was inferred by using the maximum likelihood method based on the Kimura
2-parameter model. A discrete gamma distribution was used to model evolutionary rate differences
among sites (5 categories). Branch support was evaluated using bootstrap analysis (1000 repli-
cates). The analysis involved 127 nucleotide sequences and 73 positions in the final dataset
Fig. 3.2 Phylogram based on the acdS gene sequences of PGPR. The evolutionary history was
inferred by using the maximum likelihood method based on Kimura 2-parameter model. A discrete
gamma distribution was used to model evolutionary rate differences among sites (5 categories).
Branch support was evaluated using bootstrap analysis (1000 replicates). The analysis involved
153 nucleotide sequences
3.4 Mechanism of Action
The ethylene is synthesized in higher plants from S-adenosylmethionine (SAM) and

it converted to ACC by enzyme ACC synthase. This ACC is oxidized with molecu-
lar oxygen by the enzyme ACC oxidase to yield HCN and CO2 as well as to ethylene
(Ose et al. 2003).This gaseous plant hormone produced by all higher plants, which
mediates a range of beneficial plant responses in low concentration (as low as
~10 μg L−1), viz. breaking seed dormancy, promotes ripening and primary signal
induction of epinasty and changes the growth and development of seedlings
(Fig. 3.3). But from many reports, it is established that higher levels of ethylene (as
high as ~25 μg L−1) could inhibit the root-shoot elongation (Glick 2005), suppress
_
OOC
O
Promotes ethylene
+
H3N synthesis: Inhibits
AdoMet +
H3N
Synthetase Fruit ripening ethylene
O
_
Inhibits Flower senescence Promotes
S synthesis: ethylene
ethylene IAA
O ATP PPi + Pi
synthesis: Wounding Co2+ synthesis:
H3C S+
Methionine(Met) AOA Chilling injury Anaerobiosis Ripening
AVG Drought Stress Temp. > 35 OC
H2C
_ Flooding
R CO COO O
Adenine
H _ +
HO OH
H 2C NH3
R C COO ACC oxidase H H
S-Adenosyl-methionine ACC synthase
C C C
NH3 (AdoMet) _
+ O
H H
H2C COO
YANG CYCLE Ethylene
_
O 1/2 O2 CO2
C 1-Aminocyclopropane- +
S
1-carboxylic acid (ACC) HCN
_ H3C S CH2
O
HCOO Adenine
a-Keto-g-methyl- O Malonyl-CoA
_
2-HPO4 thiobutyric acid
O2 H3C S CH2 HO OH H2 _
_ C COO
5'-Methylthioadenosine OC
OPO3H
O H3C S CH2 +
NH3
OH H 2C
O
HO OH C
Adenine _
5'-Methylthio- H2C COO
HO OH
ribose-1-P ADP ATP
5'-Methylthioribose N-malonyl ACC
Fig. 3.3 Ethylene biosynthetic pathway and the Yang cycle in higher plants. AOA aminooxyacetic
acid, AVG aminoethoxyvinyl glycine. (After McKeon et al. 1995)
Table 3.4 Inhibitors of ethylene biosynthesis

Mode of actions References
Chemical inhibitors
Silver ion (Ag+), CuSO4, Co2+, Inhibited the conversion of Guinel and Sloetjes (2000) and
silver thiosulfate ACC in to ethylene Achilea et al. (1985). Suttle and
2-Aminoethoxyvinyl glycine Used to check the synthesis Kende (1978) and Kim and
(AVG) of ethylene under stress Mulkey (1997)
Aminooxyacetic acid (AOA) conditions
1-Methylcyclopropen (MCP)
Biological inhibitors
ACC deaminase-producing Ability to hydrolyse ACC Shah et al. (1998) and Glick
PGPR into ammonia and et al. (1999)
α-ketobutyrate by the
activity of ACC deaminase
leaf expansion (Peterson et al. 1991) and promote epinasty (Abeles et al. 1992). It is
now an established fact that the higher level of ethylene in higher plant is mainly
observed under stressed condition. Thus the ethylene concentration increases above
threshold level become harmful for plant which is reflected in crop yield (Saha et al.
2016b; Verma et al. 2014, 2015a, b; Meena et al. 2014a; Sharma et al. 2016).
The ethylene biosynthesis can be inhibited by chemical inhibitor (Table 3.4).
However, biological inhibitor was first suggested by Glick et al. (1998), and a model
Fig. 3.4a Schematic representation by which ACC deaminase-producing bacteria attached to

developing plant roots lower ethylene biosynthesis. IAA indole acetic acid, ACC
1-aminocyclopropane-1-carboxylic acid, AdoMet S-adenosylmethionine (Modified from Glick
et al. 1998; Husen et al. 2008)
has described how ACC deaminase-containing PGPR can lower plant ethylene lev-
els which in turn stimulate plant growth especially under stress conditions
(Fig. 3.4a). These PGPR bind to the surface of the seed or root of a developing plant
in response to seed or root exudates containing tryptophan and other small mole-
cules (Kumar et al. 2014). The root exudates of some plants contain ACC along with
other small molecules like amino acid sugars and organic acids. The ACC deami-
nase-producing PGPR convert ACC to α-ketobutyrate and ammonium (Honma and
Shimomura 1978). Bacterial-produced IAA and endogenous plant IAA can stimu-
late root cell proliferation and elongation. Moreover, this IAA also can induce the
activity of ACC synthase to produce more ACC (Penrose and Glick 2001). It has
also been noted that to compete with ACC, oxidase for ACC and ACC deaminase
must be present in greater amounts as 100- to 1000-fold with higher affinity (Glick
et al. 1998). It was also suggested that ACC levels in plant are in the micromolar
range and every increase in its level is proportional to the rate of ACC cleavage
(Glick 2005; Meena et al. 2013b, 2015c, 2016c; Shrivastava et al. 2016; Velazquez
et al. 2016; Sindhu et al. 2016; Masood and Bano 2016).
The presence of the bacteria in rhizosphere induces the plant to synthesize more
ACC than it would otherwise need and stimulates the more exudation of ACC from
the root. Thus, plants are supplied ACC as unique source of nitrogen that enables
PGPR to proliferate/survive under any unfavourable conditions (Hontzeas et al. 2006).

The ACC deaminase-producing PGPR are acted as a sink for ACC and reduced the
level of ACC in plant. Thus, the ethylene (in stress condition)-induced inhibition of
plant growth was decreased, and these plants generally have longer roots and shoots
and greater biomass that help to adapt in environment at early stage of life.
In conclusion, the responses of plant to IAA exuded from ACC deaminase-
producing PGPR vary with plant species, root growth rates and its balance with
ACC deaminase activity. The reduction of ethylene levels by ACC deaminase
reduces plant stress responses and relieves the ethylene-repressed auxin response
factor (ARF) synthesis (Glick 2014) (Fig. 3.4b), leading to plant growth promotion
with other PGPR traits resulting from both stress alleviation and growth stimula-
tion. Moreover, the equilibrium between the endogenous and the external exudate
ACC levels of plant root is maintained by this IAA through exudation of more ACC
into the rhizosphere. The rhizospheric bacteria containing ACC deaminase activity
cause plants to biosynthesize more ACC than their need, stimulate ACC exudation
from roots and provide ACC to PGPR as a source of nitrogen which in turn
accelerated the growth of PGPR containing ACC deaminase in near plant roots as
compared to the other soil bacteria or rhizobacteria.
Stress
Plant Growth
Plant IAA synthesis
IAA
ARFS IAA
Tryptophan
SAM
Stress ACC
ACC
ACC deaminase
Ethylene Ammonia +
α-ketobutyrate
Retards plant growth

/ Stress response
ACC deaminase
producing PGPR
Young Plant Root
Fig. 3.4b A schematic model of how PGPR produce ACC deaminase and synthesize IAA may
facilitate plant growth. ARFs, auxin response factors. (From Glick 2014)
3.5 ole of Bacterial ACC Deaminase in Agriculture

R
Under Abiotic Stress Conditions
The response of stress (abiotic and biotic) leads to inhibition of root growth and
growth of the plant as a whole due to overproduction of ethylene. PGPR containing
ACC deaminase regulates the levels of ethylene by metabolizing ACC. The ACC
deaminase PGPR boosts plant growth particularly under stressed conditions by the
regulation of accelerated ethylene production in response to a multitude of abiotic
contaminants in soil. Apart from these abiotic stresses, it also protects plants against
phytopathogens and maintains ethylene regulation (Glick et al. 2007).
The roles of PGPR containing ACC deaminase reduce the different stress condi-
tions in agricultural fields leading to increased yield. The application of different
PGPR strains as inoculants in in vitro condition under stress condition has been
tabulated below.
3.5.1 Heavy Metal Stress
Due to industrialization and population explosion, heavy metal contamination in

soil and water leads to serious effect on plants, humans and other organisms (Boyd
2010). Heavy metals are not biodegradable and remain in environment for long
time. High concentration level of metals in soils caused adverse effect of plant in
growth and yields of the crops by disrupting membrane, disintegrating cell organ-
elles, acting as genotoxic substance and disrupting metabolic process such as pho-
tosynthesis, respiration and protein synthesis (Wani et al. 2007, 2008).
The remediation of heavy metal contamination in soil is an important aspect for
sustainable agriculture particularly in metal-contaminated soils. Compared with
physical and chemical remediation process, phytoremediation and bioremediation
have several advantages, viz. preserved natural properties of soil, beneficial micro-
bial biomass in the rhizosphere can be achieved, low in cost and potential to be fast
(Huang et al. 2004). Under metal stress, some bacteria tolerate the uptake of heavy
metal ions by (i) pumping the metal ions outside the cell, (ii) accumulation and
sequestration of metal ions in cell interior and (iii) transformation of toxic metals to
less toxic forms (Wani et al. 2008). Besides their role in protection of plants from
metal toxicity, rhizobacteria have also some important properties to promote plant
growth. These rhizobacteria enhanced plant growth by secreting metal chelating
agent called siderophores (Hu and Boyer 1996).
The siderophores have important role in acquisition of heavy metals (Leong
1986). Moreover a number of PGPR stimulated or enhanced plant growth by
removing the stress-induced ethylene by synthesizing ACC deaminase (Belimove
et al. 2005; Uchiumi et al. 2004). Thus these soil rhizobacteria have multimetal-
resistant properties and the ability to enhance plant growth by different direct and
indirect PGPR traits in metal-contaminated soils. PGPR with ACC deaminase
activity protet crops from the deleterious effects by lowering stress ethylene con-
centration and facilitated better root formation (Arshad et al. 2008; Meena et al.
2013c, 2014b, 2015d; Singh et al. 2015a, b, 2016; Bahadur et al. 2016a). Many
such reports are given in Table 3.5, where ACC deaminase-containing bacteria
enhanced plant growth by reducing the negative impact of plant growth in metal-
contaminated soils (Table 3.5).
3.5.2 Salinity Stress
Salinity is one of the most severe environmental stresses on plants (White and
Broadley 2001; Tester and Davenport 2003; Munns and Tester 2008). The ~20% of
the world’s cultivated lands and ~50% of the world’s irrigated lands are affected by
salinization (Sairam and Tyagi 2004). It causes global annual economical loss in
crop production is ~US$ 27.3 billion (Qadir et al. 2014). Soil salinity has a profound
effect on seed germination, which is the most vital aspect of successful crop produc-
tion. Under such situations, it is essential to stimulate seed germination and seedling
growth (Lambers 2003). Salt primarily limits plant growth (Tester and Davenport
2003) and symptoms of damage to plants includes growth inhibition, leaf discolor-
ation, anatomical and morphological changes such as changes in cell wall structure
(Tester and Davenport 2003) and early flowering or decreased production of florets
(Munns 2002). Salinity stress enhances endogenous ethylene production in plants,
which acts as a stress hormone (Blumwald 2000). Thus the reduction of salinity-
induced ethylene by any mechanism could decrease the negative effect of salinity
on to plant growth (Pourbabaee et al. 2016).
The most proper solution in such situation is to use salt-tolerant ACC deaminase-
producing PGPR as inoculants that produce phytohormone like gibberellins and
auxin under saline soil (Mayak et al. 2004b). ACC deaminase-producing bacteria
can also reduce salinity stress by reducing stress ethylene levels (Glick et al. 1998).
Tank and Saraf (2010) have reported that increase in the salinity is directly propor-
tional to the ACC deaminase activity and that leads to increased survival rate in
saline soils. Several halotolerant ACC deaminase-producing PGPR reduces the
negative impact of salinity stress are given in Table 3.6.
3.5.3 Drought Stress
Drought is an important environmental stress that limits the growth of plants and
production of crops. The environmental changes particularly in decreasing annual
rain fall cause drought condition. Water is the most important factor for the growth
of plants (Brown 1977). Water stress is perceived as water deficit leads to drought.
Like other environmental stresses, the drought stress accelerated stress ethylene and
plays a significant role in plant growth retardation. ACC deaminase-containing
Table 3.5 Alleviation of heavy metal stress on plants by PGPR containing ACC deaminase
PGPR containing ACC Response to heavy metal
Crops deaminase stresses References
Brassica Kluyvera ascorbata SUD165 Plant demonstrated normal Burd et al.
napus growth under high levels of (1998)
Ni2+, Pb2+, Zn2+ and CrO42−
Brassica Kluyvera ascorbata SUD165 Toxic effects of heavy metals Burd et al.
juncea L. Kluyvera ascorbata (Ni2+, Pb2+ and Zn2+) were not (2000)
SUD165/26 pronounced in inoculated
plants
Variovorax paradoxus, Plant growth was improved in Belimov et al.
Rhodococcus sp. Cd2+ supplemented media in (2005)
response to inoculation
Pseudomonas The bacteria were tolerant to Belimov et al.
brassicacearum, P. Cd2+ toxicity and stimulated (2001)
marginalis, P. oryzihabitans, root elongation of rape
P. putida, Pseudomonas sp., seedlings
Alcaligenes xylosoxidans,
Alcaligenes sp.
Variovorax paradoxus,
Bacillus pumilus and
Rhodococcus sp.
Variovorax paradoxus 5C-2 Enhanced tolerance against Belimov and
Cd-contaminated soil Wenzel (2009)
Pseudomonas sp. strain Enhanced growth and Tak (2015)
NMW71 and Bacillus sp. chlorophyll content and
strain NMW103 enhanced the photosynthetic
capacity of the plants during
nickel stress
Indian Enterobacter sp. Inoculation, stimulated plant Kumar et al.
mustard biomass and enhanced (2008a, b)
phytoextraction of Ni, Zn and
Cr
Bacillus sp. JH 2-2 Inoculation, stimulated plant Shim et al.
growth and phytoremediation (2015)
of chromium
Pseudomonas sp. Ps29C and Promoted plant growth and Rajkumar and
Bacillus megaterium Bm4C protected the plant from Ni Freitas (2008)
toxicity
Common reed P. asplenii Plant showed normal growth Reed et al.
under high level of Cu+2 (2005)
Tomato Methylobacterium oryzae Inoculation reduced the Madhaiyan et al.
CCBMB20, Burkholderia sp. ethylene emission and (2007)
CBMB40 increased the tolerance
against Ni and Cd
Bacillus subtilis Improved plant growth due to Woitke et al.
more production of growth (2004)
hormones
(comtinued)

Canola Kluyvera ascorbata SUD165 Plant showed normal growth Burd et al.
under heavy metals (Ni, Pb, (1998)
Zn and Cr) stress
Pseudomonas tolaasii Improved plant growth. Dell’Amico et al.
ACC23, Pseudomonas Increased the plant biomass (2008)
fluorescens ACC9 and consequently the total
Alcaligenes sp. ZN4 cadmium accumulation
Mycobacterium sp. ACC14
Lycopersicum Kluyvera ascorbata SUD165 Toxic effects of the heavy Burd et al.
esculentum Kluyvera ascorbata metals (Ni2+, Pb2+ and Zn2+) (2000)
Mill SUD165/26 were not pronounced in
inoculated plants
Phragmites Pseudomonas asplenii ACa Inoculation resulted in normal Reed et al.
australis plant growth under high levels (2005)
of Cu2+
Pisum sativum Pseudomonas Inoculation with bacteria Safronova et al.
L. brassicacearum Am3, counteracted the Cd-induced (2006)
Pseudomonas marginalis inhibition of nutrient uptake
Dp1 by roots
Vigna mungo Pseudomonas aeruginosa Plants showed less wcadmium Ganesan (2008)
MKRh3 accumulation, extensive
rooting and enhanced plant
growth
Cirsium Ancylobacter Able to reduce arsenate and to Cavalca et al.
arvense (L.) dichloromethanicus strain oxidize arsenite and (2010)
As3-1b possessing potential plant
growth promotion
Maize and Burkholderia sp. J62 Increase biomass and metal Jiang et al.
tomato plants accumulation (2008)
Rape A. tumefaciens strain Q2BJ3; Increase dry weight and PB Zhang et al.
Bacillus sp. strains accumulation compared to (2011)
Q2BJ1,Q2CJ3 and Q2BG1; uninoculated plants
Acinetobacter sp. strain
Q2BJ2; B. subtilis Q2CJ5; B.
megaterium Q2BG4
Rice Ochrobactrum sp. strain Reduce metal toxicity, Pandey et al.
CdSP9, Bacillus sp. strain increased germination, overall (2013)
PbSP6, Bacillus sp. strain biomass, amylase and
AsSP9 protease activity. Reduce
stress-induced enzyme
activity
Burkholderia sp., Enhanced plant growth, Souza et al.
Chryseobacterium sp. and nutrient uptake of the rice (2015)
Ochrobactrum sp. plants in iron stress soil
(continued)

Wheat Pseudomonas fluorescens Significantly increased the Shahzadi et al.
(Q14), Bacillus thuringiensis accumulation of Cr in (2013)
(KAP5) root-shoots compared to
uninoculated plants
Pseudomonas sp. and Enhanced root elongation Govindasamy
Pseudomonas fluorescens significantly and reduced et al. (2015)
ethylene synthesis in
seedlings under induced
cadmium stress condition
Rhizobacterial strains PGPR significantly decreased Hassan et al.
SACC1, SACC2, SAN1 and the deleterious effects of (2016)
SAN2 cadmium pollution by
chelating and influencing its
bioavailability. Increased the
growth of plant
Helianthus Serratia K120 Promoted plant growth in the Carlos et al.
annuus L. presence of heavy metal and (2016)
showed a potential use in
phytoremediation systems
Eruca sativa Pseudomonas putida (ATCC Inoculation enhanced the Cd Kamran et al.
39213) uptake potential by E. sativa (2015)
and favoured the healthy
growth under Cd stress
Lolium Bradyrhizobium sp. Increased dry weights of Guo and Chi
multiflorum shoot and Cd accumulation in (2014)
root of L. multiflorum Lam.
compared to untreated plant
G. max (L.) Merr
Maize plant Proteus mirabilis strain T2Cr Inoculation enhanced Cr Islam et al.
and P. mirabilis strain tolerance in maize seedlings (2016)
CrP450
Ralstonia eutropha and Effect on growth and metal Moreira et al.
Chryseobacterium humi uptake by plants in soils (2014)
contaminated with up to
30 mg Cd kg−1 was evaluated
PGPR strains ACC5, ACC8, More effective and resistive Hassan et al.
AN8 and AN12 against Pb pollution. Increase (2014)
in physical, chemical and
enzymatic growth of maize
plant
Maize and Klebsiella sp. CIK-502; Promoting maize and wheat Ahmad et al.
wheat plant Bacillus spp. CIK- growth and lowering Cd (2014)
512,CIK-515, CIK516; uptake under Cd stress
Stenotrophomonas sp.CIK- condition
517Y; and Serratia sp.
CIK-524
(continued)

Medicago Sinorhizobium meliloti Improve plant growth as well Kong et al.
lupulina as copper tolerance. Enhance (2015)
the antioxidant defence
system
Trifolium Rhodococcus erythropolis Increase plant growth in Pereira et al.
repens EC 34 zinc- and cadmium- (2015)
contaminated soils
Transgenic Gene from E. cloacae Inoculation enhanced plant Grichko et al.
tomatob growth under the stress of (2000)
heavy metal like Cd+2, Co+2,
Cu+2, Ni+2, Pb+2 and Zn+2
Transgenic Enterobacter cloacae CAL2 Plant showed a great tolerance Nie et al. (2002)
canolab against arsenate
ACC deaminase gene from Significantly increased Stearns et al.
Agrobacterium rhizogenes tolerance to nickel (Ni) (2005)
compared to non-transformed
plant
Transgenic bacteria
a
Transgenic plants
b
PGPR strain Achromobacter piechaudii promoted plant growth under water stress
condition by reducing the stress ethylene (Mayak et al. 2004a, b). It has been observed
that application of PGPR containing ACC deaminase as inoculant reduced or elimi-
nated the “drought stress-imposed effects” on pea plant. This might be due to sup-
pression of the stress ethylene by the ACC deaminase activity of these PGPR in the
inoculated roots (Apelbaum and Yang 1981). Inoculation with rhizobacteria produc-
ing ACC deaminase could be helpful in reducing the inhibitory effects of drought
stress on the growth of plants by different workers have been tabulated (Table 3.7).
3.5.4 Waterlogging or Flood Stress
Waterlogging is a common abiotic stress that affects many plants, often observed in
rainy season particularly those in same growing season. Plant roots suffer a lack of
oxygen under waterlogged condition, and this in turn causes deleterious effects such
as reduction of root permeability, absorption of water, uptake of minerals which
leads to closing of stomata, reduction of photosynthesis and growth inhibition of
root and stem (Grichko and Glick 2001a, b). As a result, epinasty, leaf chlorosis,
necrosis and reduced fruit yield are commonly observed during flood. Moreover,
under anaerobic condition of root environment during flood, ACC oxidase could not
function in root which requires oxygen for the catalysis. However ACC is accumu-
lated for the expression of the ACC synthase inducted in the anaerobic environment
Table 3.6 Amelioration of salinity stress on plant by ACC deaminase-containing PGPR

Bacteria/transgenic
plants with ACC Plant response (PGPR
Crops deaminase inoculation under salt stress) References
Tomato Achromobacter Increased dry weights, water Mayak et al. (2004a)
piechaudii ARV8 use efficiency and reduced
ethylene production by
tomato seedlings
Burkholderia unamae Promoted growth of seedling. Lemus et al. (2009)
strain MTl-641T Increase dry weight of
root-shoot of the plant
P. fluorescens Inoculation, enhanced Tank and Saraf
P. aeruginosa, P. root-shoot growth under (2010)
stutzeri saline condition
Pseudomonas Improve salinity resistance of Sadrnia et al. (2011)
mendocina inoculated plant
Bacillus licheniformis Significant increase in the Chooketwattana and
B2r germination percentage, Maneewan (2012)
germination index, root length
and dry weight of seedling at
saline condition
Pseudomonas putida Significantly increased length, Yan et al. (2014)
UW4 dry mass and the chlorophyll
contents of seedlings under
saline condition
Pseudomonas Potential to facilitate plant Ali et al. (2014a, b)
fluorescens YsS6, growth under salt condition
Pseudomonas migulae
8R6
Streptomyces sp. strain Significant increase in plant Palaniyandi et al.
PGPA39 biomass and number of lateral (2014)
roots
Cotton Klebsiella oxytoca Height and dry weight of Yue et al. (2007)
cotton increased. Enhanced
N, P, K and Ca absorption and
decreased the absorption of
Na under salinity stress
Raoultella planticola Potential for promoting cotton Wu et al. (2012)
strain Rs-2 growth and alleviating salinity
stress
Groundnut P. fluorescens PF1 Salt tolerance was increased Saravanakumar and
P. fluorescens PF2 and showed greater Samiyappan (2007)
P. fluorescens RMD1 performance for improving
growth of groundnut
(continued)

Bacteria/transgenic
Maize P. syringae, P. Growth, relative water Nadeem et al. (2007,
chlororaphis content, chlorophyll content 2009)
P. bathycetes, E. and K+/Na+ ratio enhanced by
aerogenes inoculation over control. In
F. ferrugineum, P. another study improved
fluorescence growth, yield and nutrition of
maize plants under saline
conditions
PGPR having ACC Significant increase in Nadeem et al.
deaminase root-shoot length, root-shoot (2007)
fresh and dry weight and
chlorophyll content
P. putida biotype A Plants demonstrated good Kausar and Shahzad
P. fluorescens biotype A root-shoot length against (2006)
salinity under gnotobiotic
conditions
Brevibacterium Increased height, dry biomass KiYoon and
iodinum RS16, and nutrient uptake TongMin (2013)
Methylobacterium
oryza CBMB20
P. syringae, P. Improved the maize Zafar-ul-Hye et al.
fluorescens productivity due to notable (2014)
expansion in yield related
traits and nutrient uptake
under dual stress conditions
Wheat P. putida, P. Increased plant height, root Zahir et al. (2009)
aeruginosa and S. length, grain yield, grain
proteamacula weight and straw yield under
high salinity. Enhanced
chlorophyll content and K+/
Na+ ratio compared to control
P. putida, Enterobacter Growth and yield of wheat Nadeem et al.
cloacae, Serratia improved under salinity stress (2013)
ficaria and P. due to inoculation along with
fluorescens low proline and Na+ content
over control
Pseudomonas Increased root, shoot growth Abbaspoor et al.
fluorescens 153, 169 and grain yield (2009)
PGPR strain KP5, Conserve losses, in wheat Pande et al. (2015)
KP6, KP11, KP14, growth and total agro
KP22 and KP31 productivity in saline stress
condition
Bacillus mojavensis Mitigates salinity stress Pourbabaee et al.
effects on growth of wheat (2016)
plants by reducing stress
ethylene production
Serratia sp. SL-12 Enhanced the growth of Singh et al. (2016)
wheat and other crops under
salt stress conditions
(continued)

Bacteria/transgenic
Rice P. fluorescens The bacteria maintained root Paul and Nair (2008)
MSP-393 colonization potential by
osmotolerance mechanisms
Alcaligenes sp. SB1. Enhancing salt tolerance and Bal et al. (2013)
ACC2, Bacillus sp. consequently improving the
SB1.ACC3 and growth of rice plants under
Ochrobactrum sp. salt stress conditions
SB2.ACC2
B. licheniformis B2r Coinoculation with salt- Vivekanandan et al.
tolerant PSB, could increase (2015)
the growth of rice and yield
components
Pseudomonas stutzeri Promote the growth of rice Han et al.(2015)
A1501 plants
Canola P. fluorescens, P. Enhanced germination and Jalili et al. (2009)
putida growth of seeds
Pseudomonas sp. Alleviate salinity stress on Miransari et al.
canola (2009)
Brevibacterium Increase root elongation and Siddikee et al.
epidermidis RS15, dry weight of salt-stressed (2010)
Micrococcus canola seedlings
yunnanensis RS222,
Bacillus aryabhattai
RS341
Pseudomonas sp. Promote plant growth in Akhgar et al. (2014)
saline habitats
Cucumber P. putida Root-shoot weight and leaf Gamalero et al.
number were more in (2009)
inoculated plants over control
Rye grass Pseudomonas sp., Promoted seedlings growth in Ji and Huang (2008)
Citrobacter sp., gnotobiotic condition.
Enterobacter sp., Significantly increased dry
Klebsiella sp. weight of root-shoot of plant
during pot trial
Capsicum Brevibacterium Mitigate the salt stress by Siddikee et al.
annuum L. iodinum, Bacillus reducing salt stress-induced (2011)
licheniformis and ethylene production on
Zhihengliuela alba growth of red pepper plants
Catharanthus Achromobacter Increase plant height, shoot Karthikeyan et al.
roseus xylosoxidans dry weight, root dry weight (2012)
and reduce ethylene level
Vigna radiata L. PGPR strain A1 and Inoculation enhanced the Aamir et al. (2013)
A2 grain weight and grain yield
up to 14 and 30%
Galega Pseudomonas trivialis Increased salt tolerance and Egamberdieva et al.
officinalis L. 3Re27 stimulating shoot and root (2013)
(continued)

Bacteria/transgenic
Pisum sativum Arthrobacter Induces salinity stress Barnawal et al.
protophormiae (SA3) tolerance through reduced (2014)
ACC oxidase activity and
ethylene production resulting
in improved nodulation
V. paradoxus 5C-2 Mitigates salt stress by Wang et al. (2016)
improving water relations, ion
homeostasis, photosynthesis
and promoting growth of
plants exposed to salt stress
Okra Bacillus megaterium Okra plants showed higher Habib et al. (2015)
and Enterobacter sp. root-shoot biomass than
noninoculated plants
Hordeum Curtobacterium Increased barley growth up to Cardinale et al.
vulgare L. flaccumfaciens E108 300% (2015)
Helianthus KS and KS28 Increase plant height, shoot Kiani et al. (2015)
annuus L. dry weight and root dry
weight at saline condition
Cicer arietinum Mesorhizobium Inoculation improved Chaudhary and
L. MBD26 nodulation and plant growth Sindhu (2015)
Cowpea Enterobacter cloacae, Significant increase in shoot Trung et al. (2016)
Pseudomonas sp. length and fresh weight under
salinity
Triticum Bacillus sp. EN2 Significantly increased the Orhan (2016)
aestivum Z. halotolerans EN3 root, shoot length and total
B. gibsonii EN6, EN10 fresh weight of the plants
under salt stress condition.
E. aurantiacum EN9
Increased growth rates of the
B. atrophaeus EN11, plants inoculated with
Zhihengliuella sp. bacterial strains
EN12, Halomonas sp.
IA
V. picturae IB,
Oceanobacillus sp. IC,
Thalassobacillus sp. ID,
Halobacillus sp. IF
Planococcus Enhanced growth and yield of Rajput et al. (2013)
rifietoensis strain wheat under salt stress
SAL-15 condition
Transgenic ACC deaminase gene Increased salt tolerance in Sergeeva et al.
canolaa from Agrobacterium plants. Increase fresh and dry (2006)
rhizogenes weights, leaf protein and
chlorophyll contents over
control
Gene from P. putida Plants show vigorous growth Cheng et al. (2007)
UW4 than non-transgenic plants
under salinity stress
a
Transgenic plants
Table 3.7 PGPR containing ACC deaminase exerts their roles on plant in response to drought
stress
PGPR containing ACC
Plant species deaminase Results References
Solanum Achromobacter piechaudii Alleviate water stress and may Mayak et al.
lycopersicum ARV8 provide facilitate plant growth in (2004a, b)
arid environments
Pisum Variovorax paradoxus Controlled moisture stress Dodd et al.
sativum 5C-2 condition, improves growth, yield (2005)
and water use efficiency of plants
Pseudomonas fluorescens Increase in fresh weight, dry Zahir et al.
biotype G (ACC-5) weight, root-shoot length and water (2008)
use efficiency of plant
P. fluorescens (ACC-14) Increase in fresh weight, dry
weight, root-shoot length and water
use efficiency
Pseudomonas spp. Increased root weight, shoot length, Arshad et al.
number of pods, chlorophyll (2008)
contents and total grain yield
Variovorax paradoxus Decreased root ABA concentrations Jiang et al.
5C-2 and maintain plant growth (2012)
Cowpea Enterobacter sakazakii Increase dry weight, fresh biomass, Babalola
8MR5, Pseudomonas sp. pod length and thickness (2010)
44MS8, Pseudomonas sp.
10MS
Triticum Rhizobacteria spp. Inoculation increased root-shoot Shakir et al.
aestivum L. length, root-shoot mass and lateral (2012)
root number of plants
Capsicum Bacillus licheniformis Alleviate drought stress in pepper Lim and Kim
annuum strain K11 plants via the regulation of (2013)
different stress proteins and genes
Mung bean Enterobacter sp. ACC2, Coinoculation of plants by Tittabutr et al.
Chryseobacterium sp. rhizobium and ACC2 or ACC3 (2013)
ACC3 provided higher plant dry weights
over noninoculated plants
Cicer Bacillus isolate 23-B and Increase proline concentration, Sharma et al.
arietinum Pseudomonas 6-P improved germination, root-shoot (2013)
length and fresh weight of the
seedlings
Wheat Bacillus thuringiensis Reduction of volatile emissions and Timmusk
AZP2 higher photosynthesis et al. (2014)
Serratia sp. 1–9 and Auxin production increased Wang et al.
Pseudomonas sp. 5–23 significantly when cultured under (2014)
simulated drought conditions
Grapevines Acinetobacter sp. and Enhanced shoot, leaf biomass and Rolli et al.
Pseudomonas sp. photosynthetic activity of drought (2014)
condition
(Glick et al. 2007). Hypoxic roots showed high activity of ACC synthase and higher
level of ACC are found compare to aerated roots (Morgan and Drew 1997) due to
different ACC synthase genes such as LE-ACS7 and LE-ACS2, which are rapidly
induced in the roots of flooded plants (Shiu et al. 1998). Therefore it (ACC) is trans-
ported into the aerobic shoots where is converted to ethylene under waterlogged
condition (Bradford and Yang 1980) caused harmful effect on crop plants.
The ethylene production can be reduced by the PGPR containing ACC deami-
nase in roots which break down ACC and also decreased the transport of ACC into
shoot thereby lowering the level of ethylene formed in the shoots (Chao et al. 1997).
The deleterious effect ethylene produce under flood in root-shoot can be reduced by
inoculating PGPR containing ACC deaminase (Grichko and Glick 2001a, b).
Several workers used ACC deaminase-containing PGPR inoculants under waterlog-
ging stress condition to reduce the damage of elevated ethylene concentration
(Table 3.8).
3.5.5 Temperature Stress
The high temperature is a serious threat to world agriculture which rises mainly due
to global warming and uneven distribution of precipitation (Mendelsohn and
Rosenberg 1994). A variation in temperature leads to hormonal imbalances in plants
and thus their growth is significantly affected (Cheikh and Jones 1994). The PGPR
Bacillus globisporus was inoculated to analyse the effect of diurnal temperature
regime on root-shoot length; fresh and dry weight were significantly increased in
comparison to B. subtilis and magnesium sulphate controls (Ghosh et al. 2003).
Effect of cold temperature is evident in phonological stages of plant growth. The
first effect of cold is impaired seed germination. The major effect of cold stress is
reduction of photosynthesis and premature leaf senescence. Low temperature and
frost can cause severe yield losses. Cold-tolerant PGPR have important agronomic
important as they are metabolically functional and produced phytohormones and
enhanced plant growth by some other PGPR traits. A cold-tolerant ACC deaminase-
producing Pseudomonas putida was found to promote canola plant growth at low
temperature under salts stress (Cheng et al. 2007). Some ACC deaminase-producing
cold-tolerant PGPR is given in Table 3.9.
3.6 ole of Bacterial ACC Deaminase in Agriculture

R
Under Biotic Stress Conditions
Apart from abiotic stresses, in general, biotic stresses are observed due to pathogenic
attack. This may be either by colonies’ living plant tissues as biotroph or by rapidly
killing plant cells to get nutrients as necrotrophs. Both biotrophs and necrotrophs
may trigger plants to produce stress hormone ethylene as a signal to reduce the
Table 3.8 PGPR containing ACC deaminase exerts their roles on plants in response to flooding
Bacteria/transgenic plants with
Crops ACC deaminase Plant response References
Tomato, pepper P. putida GR12-2, Achromobacter Inoculation Mayak et al.
piechaudii ARV8 significantly increased (2004b)
fresh and dry weight of
tomato and pepper
seedlings. Reduced
ethylene production
Pea V. paradoxus 5C-2 Inoculation improved Belimov et al.
growth, yield and (2009)
water use efficiency of
pea’s plant
P. fluorescens biotype G, P. Plant showed an Zahir et al.
fluorescens, P. putida biotype A increased tolerance and (2008)
improved fresh dry
weight, root-shoot
length and water use
efficiency
P. putida, P. fluorescens Significantly increased Arshad et al.
the growth and yield of (2008)
inoculated pea plants
Catharanthus P. fluorescens Enhanced growth and Jaleel et al.
roseus ameliorated the (2007)
drought induced
growth inhibition by
increasing fresh and
dry weight
Potato Variovorax paradoxus 5C-2, Inoculation increased Belimov et al.
Achromobacter xylosoxidans Cm4 tuber yield and number (2009)
and improved water
use efficiency of potato
Ocimum sanctum Achromobacter xylosoxidans Fd2, Induced maximum Barnawala
Serratia ureilytica Bac5, waterlogging tolerance et al. (2012)
Herbaspirillum seropedicae Oci9 and recorded
and Ochrobactrum rhizosphaerae maximum growth and
Oci13 yield
Wheat Serratia odorifera strain CC7 and Increased root length, Bangash et al.
Aerococcus viridans strain CK3 shoot length, dry (2013)
root-shoot weight of
wheat seedlings grown
at different water levels
Transgenic ACC deaminase gene from Transgenic plants or Farwell et al.
canolaa Agrobacterium rhizogenes/ plant treated with P. (2007)
inoculation with P. Putida UW4 putida showed more
prolific growth
Transgenic Heinz 902 expressing the bacterial Inoculation increased Grichko and
tomatoa gene growth against Glick (2001a,
flooding stress b)
a
Transgenic plants
Table 3.9 PGPR containing ACC deaminase exerts their roles on plants in response to temperature
stress
Bacteria/transgenic plants
Crops with ACC deaminase Plant response References
Soybean Serratia proteamaculans Enhanced nodulation and yield Dashti et al.
(2000)
Grapevine Burkholderia phytofirmans Enhanced chilling resistance by Barka et al.
plantlets improving plant growth and (2006)
physiological activity
Canola Pseudomonas putida Promoted plant growth at low Cheng et al.
temperature in the presence of (2007)
salinity
severity of the stress (Wang et al. 2000; Glick et al. 2007). It has been observed that
several plant pathogenic microbes have the ability to modulate signalling processes
by plant hormones which manipulate host physiology and plant growth (Lund et al.
1998). Three kinds of plant hormones are important in mediating plant defences
against pathogen attack. These are salicylic acid (SA), jasmonic acid (JA) and eth-
ylene (Kunkel and Brooks 2002; Glazebrook 2005). Ethylene signalling, however,
plays a pivotal role in various types of stresses including those caused by various
environmental factors (Glick et al. 2007).
In soil environment, plants are also subject to pathogen attack, which is a major
threat to crop production. This also results in enhanced ethylene concentration
that causes disease symptoms and reduces plant resistance against diseases
(Frankenberger and Arshad 1995). Since ethylene is required for the induction in
plants of systemic resistance elicited by pathogens, it might be assumed that treat-
ing plants with ethylene-lowering bacteria would prevent this induction. However,
some bacterial strains possessing ACC deaminase also induce systemic resistance
(Dobbelaere et al. 2003; Van Loon and Glick 2004). Research on rhizobacteria-
mediated induced systemic resistance (ISR) signalling has demonstrated by dif-
ferent workers that expression of ISR relies not only on a different type of
biological induction but also occurs through different defence-related activities
(Domenech et al. 2006). This may say that there is an initial small peak of ethyl-
ene at the beginning time to the onset of a stress and then a second very larger
peak some time later (Glick et al. 2007). The first peak is considered as defensive
response by the plant (systemic resistance), while the second larger ethylene peak
is thought to be as inhibitory to plant growth. In the presence of ACC deaminase-
producing bacteria, the ACC will be cleared by this bacterial enzyme and gradu-
ally the ethylene production diminished which restored plant growth promotion
and elicited defence-related protein for ISR. Rasche et al. (2006a, b) reported that
ACC deaminase-producing bacteria were capable of antagonizing potato
pathogens. The role in response to pathogen by different PGPR containing ACC
deaminases is listed here (Table 3.10).
Table 3.10 PGPR containing ACC deaminase exerts their roles in response to pathogens
PGPR containing ACC
Crops deaminase Response to pathogens References
Cucumber Pseudomonas putida Induced systemic resistance against Liu et al.
strain 89B-27 Fusarium wilt (1995a)
Serratia marcescens
strain 90–166
Pseudomonas putida Induced systemic resistance against Liu et al.
strain 89B-27 bacterial angular leaf spot (1995b)
Serratia marcescens
strain 90–166
Pseudomonas putida Induced systemic resistance against Liu et al.
strain 89B-27 Fusarium wilt and bacterial angular leaf (1995c)
Serratia marcescens spot
strain 90–166
Cucumber P. putida, S. Inoculation induced systemic resistance Raupach et al.
and tomato marcescens against mosaic of cucumovirus (1996)
Canola P. fluorescens CHA0 Protected the cucumber against Pythium Wang et al.
damping off and potato tuber against (2000)
Erwinia soft rot compared to control
Maize Klebsiella oxytoca Enhanced the growth by protect against Babalola et al.
MKR7 parasitic infestation of Striga (2003)
Pseudomonas sp. hermonthica
4MKS8
Tomato Pseudomonas Inoculation increased the root elongation Belimov et al.
brassicacearum AM3 and biomass of plant by masking the (2007)
phytopathogenic properties of bacteria
P. fluorescens CHA0 Increased survival rate of plants against Wang et al.
Fusarium crown and root rot of tomato (2000)
P. putida UW4, High resistance to crown gall formation Toklikishvili
Burkholderia relative to the parental, non-transformed et al. (2010)
phytofirmans PsJN, A. tomato plants
brasilense Cd1843
ACC deaminase gene Inoculation reduced the symptoms of Robinson et al.
from E. cloacae UW4 Verticillium wilt and increased disease (2001)
tolerance in plant
Methylobacterium sp. Inoculation with Ralstonia Yim et al.
solanacearum in tomato plant showed (2013)
reduced disease symptoms and lowered
ethylene emission
Pseudomonas putida Inoculation with tomato seeds has Pastor et al.
strain PCI2 potential biocontrol activity against (2016)
Fusarium oxysporum MR193
P. aeruginosa strain Strain NR6 was antagonistic to Vaikuntapu
NR6, E. hormaechei Fusarium solani and Fusarium et al. (2014)
strain PP1 and E. moniliforme, and both PP1 and RP6
cancerogenus strain isolates were antagonistic to F.
RP6 moniliforme
(continued)

PGPR containing ACC
Crops deaminase Response to pathogens References
Arachis Pseudomonas Suppressed the soil-borne fungal Dey et al.
hypogaea L. fluorescens PGPR1, diseases like collar rot of peanut caused (2004)
PGPR2, PGPR3 and by A. niger and PGPR4 also suppressed
PGPR4 stem rot caused by S. rolfsii
Tomato and P. putida UW4 was Inhibited tumour development Hao et al.
castor bean introduced into (2007)
Agrobacterium
tumefaciens C58
Chamae- Pseudomonas Inhibit the growth of F. oxysporum and Donate-Correa
cytisus fluorescens F. proliferatum on TSA plates and et al. (2004)
proliferus enhances nodulation by Bradyrhizobium
BTA-1
Potato plantKlebsiella Antagonize two potato pathogens Rasche et al.
pneumoniae, Pantoea Ralstonia solanacearum and (2006a, b)
sp., Pseudomonas Rhizoctonia solani
fluorescens
Glycine max Pseudomonas sp. Strains showed antibiosis against the test Jain et al.
L. strain VS1 fungal pathogen Fusarium oxysporum (2013)
Wheat Pseudomonas Biocontrol activity against Rhizoctonia Wang et al.
protegens Pf-5, P. root rot and take-all of wheat plant (2015)
chlororaphis subsp.
aureofaciens 30-84, P.
brassicacearum
Q8r1-96, P. protegens,
P. chlororaphis
3.7 Role of ACC Deaminase in Legume-Rhizobia Symbiosis
Symbiotic N-fixation in legume plant is an important process for the production of

protein-rich seed and to improve the soil fertility. Nodulation is one of the very
important processes of legume plants as it is the initiating event of fixing nitrogen.
The formation of root nodule is the result of different signal interactions of rhizobia
and host legume plant. The gaseous hormone ethylene has inhibitory effects on
rhizobial infection, formation of the infection thread, maintenance of calcium
spiking after induction by Nod factor (Oldroyd et al. 2001) and the formation of
nodule primordia which limit nodule numbers (Sugawara et al. 2006). However,
when ethylene pressure is reduced from plants, a substantial increase in nodule
formation is observed in different legume plants (Nukui et al. 2000; Lorteau et al.
2001). Thus ethylene acts as a negative factor in the nodulation process and nodula-
tion can be promoted when plants are treated with ethylene inhibitors or antagonists
(Yuhashi et al. 2000).
It has been described that ACC deaminase has positive role in legume-rhizobium
symbiosis (Musarrat et al. 2009). Rhizobial ACC deaminase has the potentiality to
Table 3.11 Effect of ACC deaminase-containing Rhizobium sp. in legume symbiosis

Legume Host-specific rhizobia Effect on nodulation References
Phaseolus vulgaris Rhizobium sp. Decrease nodule number Grobbelaar et al.
var. pencil podded and N2 fixation (1971)
black wax
Trifolium repens cv. R. trifolii Decrease nodule number Goodlass and
Huia and N2 fixation Smith (1979)
Pisum sativum cv. R. leguminosarum bv. Inhibition of root extension,
Feltham First viciae decrease nodule numbers
and nitrogen fixation
Pisum sativum cv. R. leguminosarum bv. Decrease in nodule number Lee and LaRue
Rondo viciae (1992)
Melilotus alba U389 S. meliloti Decrease in nodule number
Pisum sativum cv. R. leguminosarum bv. Decrease nodule number
Sparkle viciae and blockage infection
thread elongation in cortex
Glycine max cv. Bradyrhizobium Decrease in nodule number Xie et al. (1996)
Gong jiao 6301-1 japonicum
Medicago truncatula Sinorhizobium meliloti Initiates of infection Oldroyd et al.
threads, inhibits the Nod (2001)
factor signal transduction
and maintenance of calcium
spiking
Pea plants P. putida strain PSE3 Synergism improves Ahmad et al.
and R. leguminosarum growth and nodulation (2013)
strain RP2
R. leguminosarum bv. Enhances the nodulation Ma et al. (2003)
viciae 128C53K
Cyamopsis Pseudomonas sp. Enhancing nodulation and Khandelwal and
tetragonoloba CPA152, Pseudomonas plant growth of cluster bean Sindhu (2013)
L. Taub. sp. CPA123 under field conditions
Mung bean Sinorhizobium sp. BL3 Senescence in determinate Tittabutr et al.
nodules (2015)
reduce the adverse effects of ethylene, thereby triggering the nodulation process.
Application of exogenous ethylene or ethylene precursor inhibits nodule formation
in many legumes. The endogenous ethylene also exerts positions on nodule
meristem morphogenesis. Different experimental result supports the role of
ethylene in nodulation process (Table 3.11). The ACC deaminase of rhizobia was
tested to enhance nodulation and competitiveness to the host legume by using a
mutant lacking or disrupting the gene acdS(mlr5932) of ACC deaminase (Uchiumi
et al. (2004)). Different genes in rhizobium species that regulate the ethylene level
by ACC deaminase activity are listed in Table 3.12.
Table 3.12 Rhizobial strategy for lowering ethylene in host plants

Plant showing
nodulation
Rhizobia Gene Expression Activity enhancement Reference
Rhizobium acdS σ 70/LRP Free/symbiosis – Trott et al.
radiobacter d3 (2001)
Mesorhizobium accD σ 54/UAS Symbiosis – Sullivan
loti R7A et al. (2002)
Bradyrhizobium acdS σ 70/LRP Free/Symbiosis – Kaneko et al.
japonicum (blr0241) (2002)
USD110
R. acdS σ 70/LRP Symbiosis Pisum sativum Ma et al.
leguminosarum cv. sparkle (2003)
bv. viciae
1128C53K
Mesorhizobium acdS σ 54/UAS Symbiosis Lotus Kaneko et al.
loti AFF303099 (mlr5932) japonicum (2000) and
MG20 Uchiumi
et al. (2004)
3.8 ole of ACC Deaminase-Producing PGPR in Sustainable

R
Agriculture
Conventional method of agriculture has significant role to meet the demand of

food in incoming population explosion which leads to increasing dependence of
chemical fertilizers, pesticides and fungicides (Santos et al. 2012). But production
of nutrient-rich high-quality food leads to increased use of these chemical inputs
which has lot of impact against sustainable agriculture. Chemical fertilizers are
industrial manipulated product and cause air, soil and water pollution (Youssef and
Eissa 2014). The innovative view for crop production is to use bio-based organic
fertilizer as an alternative of chemical fertilizers (Raja 2013). The application of
bio-based organic fertilizers is one of the important strategies for organic farming
which ensure food safety and maintain soil quality for sustainable agriculture.
Considering the beneficial effect of ACC deaminase-producing PGPR in terms
of stress (biotic and abiotic) amelioration, biofertilization, biocontrol, phytostimu-
lation and bioremediation, all of which exert positive impact on crop productivity
and normal functioning of ecosystem, encouragement should be given to its appli-
cation in agriculture (Fig. 3.5).
These PGPR acted a beneficial role in plant-microbe’s interaction. Different
types of interactions have played important role for benefiting plant growth and
health in sustainable agriculture. These are (i) the application of ACC deaminase-
producing PGPR for stress amelioration, (ii) application of PGPR as biofertilizer
particularly improving N2-fixation and phosphate solubilization, (iii) microbial
antagonism and production of chemicals for the biocontrol of plant pathogens,
Fig. 3.5 Potential use of PGPR in sustainable agriculture
(iv) production of phytohormones like IAA, cytokinin and gibberellins and (v)
interactions between rhizosphere microbes and AM fungi to establish a functional
mycorrhizosphere (Barea et al. 2005).
Thus rhizospheric microbial communities act as an alternative source for
chemical fertilizers and have a subject of important interest in sustainable agricul-
ture and biosafety. So in the incoming decades, the major focus would be on safe
and eco-friendly methods for sustainable agricultural production by exploiting these
beneficial plant growths promoting rhizobacteria.
3.9 Conclusions
The increasing global warming and environmental pollution in the present scenario
have seriously affected the agricultural production which induced both biotic and
abiotic stresses. In respect to agricultural and ecological viewpoints, the main
objective will be to improve plant productivity for incoming population explosion,
to increase food quality and to maintain environmental quality for sustainable
agriculture. However, to achieve this, mechanistic studies must be undertaken to
improve our understanding of microbial interactions in the rhizosphere soil. In this

regard, the application of PGPR in agriculture is an attractive technology to discuss
this problem. The ACC deaminase-producing PGPR not only protect the plant from
the negative impact of high ethylene concentration under stress but also enhance
plant growth and development by a number of other mechanisms, such as facili-
tating nutrient uptake, production of phytohormones, solubilization of nutrients,
etc. Therefore, deciphering the role of bacterial species with ACC deaminase
activity and their application in the alleviation of stresses caused by atmospheric
pollutants is an important aspect of research in increasing crop production for
incoming population explosion. Microorganisms containing the ACC deaminase
genes act as weapon in promoting early root development from either seeds or
cuttings, protecting plants against a wide range of environmental stresses. Thus
application of ACC deaminase-containing PGPR along with native rhizospheric
microflora might eliminate the negative impact of stress-imposed effect on crop
plant and also promote the plant growth and crop yield.
Acknowledgements The financial support for the first author provided by DST (SERB), New
Delhi, India (NPDF/2016/00323 dt.05.07.2016) as providing National Post-Doctoral Fellowship,
through the Department of Marine Science, Ballygunge Science College Campus, Calcutta
University, WB, India, is gratefully acknowledged.
References
Aamir M, Aslam A, Khan YM, Jamshaid MU, Ahmad M, Asghar HN, Zahir ZA (2013)
Co-inoculation with Rhizobium and plant growth promoting rhizobacteria (PGPR) for induc-
ing salinity tolerance in mung bean under field condition of semi-arid climate. Asian J Agri
Biol 1(1):17–22
Abbaspoor A, Zabihi HR, Movafegh S, Asl MHA (2009) The efficiency of plant growth promot-
ing Rhizobacteria (PGPR) on yield and yield components of two varieties of wheat in salinity
condition. Am Eurasian J Sustain Agric 3(4):824–828
Abeles FB, Morgan PW, Saltveit ME (1992) Regulation of ethylene production by internal, envi-
ronmental and stress factors. In: Ethylene in plant biology, 2nd edn. Academic, San Diego,
pp 56–119
Achilea O, Fuchs Y, Chalutz E, Rot I (1985) The contribution of host and pathogen to ethylene
biosynthesis in Penicillium digitatum-infected citrus fruit. Physiol. Plant Pathol 27:55–63
Ahmad E, Khan Md S, Almas Z (2013) ACC deaminase producing Pseudomonas putida strain
PSE3 and Rhizobium leguminosarum strain RP2 in synergism improves growth, nodulation
and yield of pea grown in alluvial soils. Symbiosis 61:93–104
Ahmad I, Akhtar MJ, Zahir ZA, Naveed M, Mitter B, Sessitsch A (2014) Cadmium-tolerant bacte-
ria induce metal stress tolerance in cereals. Environ Sci Pollut Res 21:11054–11065
https://doi.org/10.1007/978-81-322-2776-2_21
Ahmadi N, Mibus H, Serek M (2009) Characterization of ethylene-induced organ abscission in
F1 breeding lines of miniature roses (Rosa hybrida L.) Post Harvest Biol Technol 52:260–266
Akhgar R, Arzanlou M, Bakker PAHM, Hamidpour M (2014) Characterization of

1-Aminocyclopropane-1-Carboxylate (ACC) deaminase-containing Pseudomonas spp. in the
rhizosphere of salt-stressed canola. Pedosphere 24(4):461–468
Akhtar S, Ali B (2011) Evaluation of rhizobacteria as non-rhizobial inoculants for mung beans.
Aust J Crop Sci 5(13):1723–1729
Ali S, Charles TC, Glick BR (2014a) Amelioration of high salinity stress damage by plant growth
promoting bacterial endophytes that contain ACC deaminase. Plant Physio Bioche 80:160–167
Ali SZ, Sandhya V, Rao LV (2014b) Isolation and characterization of drought-tolerant ACC
deaminase and exopolysaccharide-producing fluorescent Pseudomonas sp. Ann Microbiol
64:493–502
Apelbaum A, Yang SF (1981) Biosynthesis of stress ethylene induced by water deficit. Plant
Physiol 68(3):594–596
Arshad M, Frankenberger WT (2002) Ethylene: agricultural sources and applications. Kluwer
Academic, New York. ISBN 0-306-46666-X, EUR 158/USD 145.0/GBP 98.00.plant sci
162(6), pp1020
Arshad M, Shaharoona B, Mahmood T (2008) Inoculation with Pseudomonas spp. containing
ACC-deaminase partially eliminates the effects of drought stress on growth, yield, and ripening
of pea (Pisum sativum L.) Pedosphere 18(5):611–620
Babalola OO (2010) Beneficial bacteria of agricultural importance. Biotechnol Lett 32:1559–1570
Babalola OO, Osir EO, Sanni AI, Odhiambo GD, Bulimo WD (2003) Amplification of 1-amino-
cyclopropane-1-carboxylic acid (ACC) deaminase from plant growth promoting rhizobacteria
in Striga-infested soil. Afri J Biotechnol 2:157–160
219431
Bal HB, Nayak L, Das S, Adhya TK (2013) Isolation of ACC deaminase producing PGPR from
rice rhizosphere and evaluating their plant growth promoting activity under salt stress. Plant
Soil 366:93–105
Bangash N, Khalidi A, Mahmood T, Siddique TM (2013) Screening rhizobacteria containing ACC
deaminase for growth promotion of wheat under water stress. Pak J Bot 45(SI):91–96
Barea JM, Pozo MJ, Azcon R, Azcon-Aguilar C (2005) Microbial co-operation in the rhizosphere.
J Exp Bot 56(417):1761–1778
Barka EA, Nowak J, Clement C (2006) Enhancement of chilling resistance of inoculated grape-
vine plantlets with a plant growth-promoting rhizobacterium Burkholderia phytofirmans strain
PsJN. Appl Env Microbiol 72:7246–7252
Barnawal D, Bharti N, Maji D, Chanotiya CS, Kalra A (2014) ACC deaminase containing
Arthrobacter protophormiae induces NaCl stress tolerance through reduced ACC oxidase
activity and ethylene production resulting in improved nodulation and mycorrhization in Pisum
sativum. J Plant Physiol 171(11):884–894
Barnawala D, Bhartia N, Majia D, Chanotiy CS, Kalra A (2012) 1-Aminocyclopropane1carboxylic
acid (ACC) deaminase containing rhizobacteria protect Ocimum sanctum plants during water-
logging stress via reduced ethylene generation. Plant Physiol Biochem 58:227–235
Belimov AA, Wenzel WW (2009) The role of rhizosphere microorganisms in heavy metal toler-
ance of higher plants. Asp Appl Biol 98:81–90
Belimov AA, Safronova VI, Sergeyeva TA, Egorova TN, Matveyeva VA, Tsyganov VE, Borisov
AY, Tikhonovich IA, Kluge C, Preisfeld A, Dietz KJ, Stepanok VV (2001) Characterization of
plant growth promoting rhizobacteria isolated from polluted soils and containing 1-aminocycl
opropane-1-carboxylate deaminase. Can J Microbiol 47:642–652
Belimov AA, Hontzeas N, Safronova VI, Demchinskaya SV, Piluzza G, Bullitta S, Glick BR
(2005) Cadmium-tolerant plant growth-promoting bacteria associated with the roots of Indian
mustard (Brassica juncea L. Czern.) Soil Biol Biochem 37:241–250
Belimov AA, Dodd IC, Safronova VI, Hontzeas N, Davies WJ (2007) Pseudomonas brassi-
cacearum strain Am3 containing 1-aminocyclopropane-1-carboxylate deaminase can show
both pathogenic and growth-promoting properties in its interaction with tomato. J Exp Bot
58:1485–1495
Belimov AA, Dodd IC, Safronova VI, Davies WJ (2009) ACC-deaminase-containing rhizobacteria
improve vegetative development and yield of potato plants grown under water limited condi-
tions. Asp Appl Biol 98:163–169
Bernardo MA, Dieguez ET, Jones HG, Chairez FA, Ojanguren CLT, Cortes AL (2000) Screening
and classification of cowpea genotypes for salt tolerance during germination. Int J Exp Bot
67:71–84
Bertolla F, Simonet P (1999) Horizontal gene transfer in the environment: natural transformation
as a potential process for gene transfer between transgenic plants and microorganisms. Res
Blumwald E (2000) Sodium transport and salt tolerance in plants. Curr Opin Cell Biol 12:431–434
Boyd RS (2010) Heavy metal pollutants and chemical ecology: exploring new frontiers. J Chem
Ecol 36:46–58
Bradford KJ, Yang SF (1980) Xylem transport of 1-aminocyclopropane-1-carboxylic acid, an eth-
ylene precursor in waterlogged tomato plants. Plant Physiol 65:322–326
Brown RW (1977) Water relations of rane plants. In: Sosebee RE (ed) Rangeland plant physiology.
Rane Sc. Ser.4.Soc for rane Manage, Denver, Colo, pp 7–140
Burd GI, Dixon DG, Glick BR (1998) A plant growth-promoting bacterium that decreases nickel
toxicity in seedlings. Appl Env Microbiol 64:3663–3668
Burd GI, Dixon DG, Glick BR (2000) Plant growth-promoting bacteria that decrease heavy metal
toxicity in plants. Can J Microbiol 46:237–245
Cardinale M, Ratering S, Suarez C, Montoya AMZ, Plaum RG, Schnell S (2015) Paradox of plant
growth promotion potential of rhizobacteria and their actual promotion effect on growth of
barley (Hordeum vulgare L.) under salt stress. Microbiol Res 181:22–32
Carlos MHJ, Stefani PVY, Janette AM, Melani MSS, Gabriela PO (2016) Assessing the effects
of heavy metals in ACC deaminase and IAA production on plant growth promoting bacteria.
Microbiol Res 188(189):53–61
Cavalca L, Zanchi R, Corsini A, Colombo M, Romagnoli C, Canzi E, Andreoni V (2010) Arsenic-
resistant bacteria associated with roots of the wild Cirsium arvense (L.) plant from anarsenic
polluted soil, and screening of potential plant growth-promoting characteristics. Syst Appl
Chao Q, Rothenberg M, Solano R, Roman G, Terzaghi W, Ecker JR (1997) Activation of the
ethylene gas response pathway in Arabidopsis by the nuclear protein and related proteins. Cell
89:1133–1144
Chaudhary D, Sindhu SS (2015) Inducing salinity tolerance in chickpea (Cicer arietinum L.) by
inoculation of 1-aminocyclopropen-1-carboxylic acid deaminase-containing Mesorhizobium
strains. Afri J Microbiol Res 9(2):117–124
Cheikh N, Jones RJ (1994) Disruption of maize kernel growth and development by heat stress (role
of cytokinin/abscisic acid balance). Plant Physiol 106:45–51
Cheng Z, Park E, Glick BR (2007) 1-Aminocyclopropane-1-carboxylate deaminase from
Pseudomonas putida UW4 facilitates the growth of canola in the presence of salt. Can
J Microbiol 53:912–918
Chookietwattana K, Maneewan K (2012) Selection of efficient salt-tolerant bacteria containing
ACC deaminase for promotion of tomato growth under salinity stress. Soil Environ 31(1):30–36
org/10.1007/978-81-322-2776-2_20
Dashti N, Prithiviraj B, Zhou X, Hynes RK, Smith DL (2000) Combined effects of plant growth
promoting biotypes of stellaria media. Ann Bot 68:167–172
de Souza R, Meyer J, Schoenfeld R, Costa PB, Passaglia LMP (2015) Characterization of plant
growth-promoting bacteria associated with rice cropped in iron-stressed soils. Ann Microbiol
65:951–964
Dell’Amico A, Cavalca L, Andreoni V (2008) Improvement of Brassica napus growth under
cadmium stress by cadmium-resistant rhizobacteria. Soil Biol Biochem 40:74–84
Dey R, Pal KK, Bhatt DM, Chauhan SM (2004) Growth promotion and yield enhancement
of peanut (Arachis hypogaea L.) by application of plant growth-promoting rhizobacteria.
Microbiol Res 159:371–394
the rhizosphere. Crit Rev Plant Sci 22:107–149
Dodd IC, Belimov AA, Sobeih WY, Safronova VI, Grierson D, Davies WJ (2005) Will modify-
ing plant ethylene status improve plant productivity in water-limited environments? In: 4th
International Crop Science Congress, Brisbane
Domenech J, Reddy MS, Kloepper JW, Ramos B, Gutierrez-Manero J (2006) Combined
application of the biological product LS213 with Bacillus, Pseudomonas or Chryseobacterium
for growth promotion and biological control of soil borne diseases in pepper and tomato.
BioControl 51:245
pp 77–98. https://doi.org/10.1007/978-81-322-2776-2_6
Donate-Correa J, Leon-Barrios M, Perez-Galdona R (2004) Screening for plant growth-promoting
rhizobacteria in Chamaecytisus proliferus (tagasaste), a forage tree-shrub legume endemic to
the Canary Islands. Plant Soil 266:261–272
microorganisms. In: Meena VS, Maurya BR, Verma JP, Meena RS (eds) Potassium solubilizing
microorganisms for sustainable agriculture. Springer, New Delhi, pp 267–280. https://doi.
org/10.1007/978-81-322-2776-2_19
Duan J, Kirsten MM, Trevor C, Vesely C, Vesely S, Glick BR (2009) 1-Aminocyclopropane-1-
Carboxylate (ACC) deaminase genes in Rhizobia from Southern Saskatchewan. Microb Ecol
57:423–436
Egamberdieva D, Berg G, Lindstrom K, Rasanen LA (2013) Alleviation of salt stress of symbi-
otic Galega offi cinalis L. (Goat’s Rue) by co-inoculation of Rhizobium with root colonising
Pseudomonas. Plant Soil 369:453–465
Farajzadeh D, Aliasgharzad N, Bashir NS, Yakhchali B (2010) Cloning and characterization of a
plasmid encoded ACC deaminase from an indigenous Pseudomonas fluorescens FY32. Curr
Farwell AJ, Vesely S, Nero V, Rodriguez H, McCormack K, Shah S, Dixon DG, Glick BR (2007)
Tolerance of transgenic canola plants (Brassica napus) amended with plant growth-promoting
bacteria to flooding stress at a metal-contaminated field site. Environ Pollut 147:540–545
Frankenberger WT, Arshad M (1995) Phytohormones in soils: microbial production and function.
Marcel Dekker, New York, p 503
Fujino A, Ose T, Yao M, Tokiwano T, Honma M, Watanabe N, Tanaka I (2004) Structural and
enzymatic properties of 1-aminocyclopropane-1-carboxylate deaminase homologue from
Pyrococcus horikoshii. J Mol Biol 341:999–1013
Gamalero E, Berta G, Glick BR (2009) The use of microorganisms to facilitate the growth of plants
in saline soils. In: Microbial strategies for crop improvement. Springer, Berlin, pp 1–22
Ganesan V (2008) Rhizoremediation of cadmium soil using a cadmium-resistant plant growth-

promoting Rhizopseudomonad. Curr Microbiol 56:403–407
Ghosh S, Penterman JN, Little RD, Chavez R, Glick BR (2003) Three newly isolated plant growth
promoting bacilli facilitates the seedling growth of canola, Brassica campestris. Plant Physiol
Biochem 41:277–281
Ghosh PK, Saha P, Mayilraj S, Maiti TK (2013) Role of IAA metabolizing enzymes on
production of IAA in root, nodule of Cajanus cajan and its PGP Rhizobium sp. Biocata Agri
Biotech 2:234–239
Ghosh PK, Sen SK, Maiti TK (2015a) Characterization of IAA producing Enterobacter spp.
(Gammaproteobacteria) isolated from root nodules of a legume Abrus precatorius L. Biocata
Agri Biotech 4:296–303
Ghosh PK, De TK, Maiti TK (2015b) Production and metabolism of indole acetic acid in root
nodules and symbiont (Rhizobium undicola) isolated from root nodule of aquatic medicinal
legume Neptunia oleracea Lour. J Bot :1–11. https://doi.org/10.1155/2015/575067
Glazebrook J (2005) Contrasting mechanisms of defense against biotrophic and necrotrophic
pathogens. Annu Rev Phytopathol 43:205–227
Glick BR (2005) Modulation of plant ethylene levels by the bacterial enzyme ACC deaminase.
FEMS Microbiol Lett 251:1–7
Glick BR (2014) Bacteria with ACC deaminase can promote plant growth and help to feed the
world. Microbiol Res 169:30–39
Glick BR, Jacobson CB, Schwarze MMK, Pasternak JJ (1994) 1-Aminocyclopropane-1-carboxylic
acid deaminase mutants of the plant growth promoting rhizobacteria Pseudomonas putida
GR12-2 do not stimulate canola root elongation. Can J Microbiol 40:911–915
Glick BR, Karaturovic DM, Newell PC (1995) A novel procedure for rapid isolation of plant
growth promoting pseudomonads. Can J Microbiol 41:533–536
Glick BR, Penrose DM, Li J (1998) A model for the lowering of plant ethylene concentrations by
plant growth promoting bacteria. J Theor Biol 190:63–68
Glick BR, Patten CL, Holgiun G, Penrose DM (1999) Biochemical and genetic mechanisms used
by plant growth promoting bacteria. Imperial College Press, London, p 276
Glick BR, Cheng ZY, Czarny J, Duan J (2007) Promotion of plant growth by ACC deaminase
producing soil bacteria. Eur J Plant Pathol 119(3):329–339
Goodlass G, Smith KA (1979) Effects of ethylene on root extension and nodulation of pea (Pisum
sativum L.) and white clover (Trifolium repens L.) Plant Soil 51:387–395
Govindasamy V, Senthil KM, Gaikwad K, Annapurna K (2008a) Isolation and characterization
of ACC deaminase gene from two plant growth promoting rhizobacteria. Curr Microbiol
57:312–317
Govindasamy V, Senthil KM, Upendra K, Annapurna K (2008b) PGPR-biotechnology for man-
agement of abiotic and biotic stresses in crop plants. In: Maheshwari DK, Dubey RC (eds)
Potential microorganisms for sustainable agriculture. IK International, New Delhi, pp 26–48
Govindasamy V, Senthilkumar M, Annapurna K (2015) Effect of mustard rhizobacteria on wheat
growth promotion under cadmium stress: characterization of acdS gene coding ACC deami-
nase. Ann Microbiol 65:1679–1687
Grichko VP, Glick BR (2001a) Amelioration of flooding stress by ACC deaminase-containing
plant growth-promoting bacteria. Plant Physiol Biochem 39:11–17
Grichko VP, Glick BR (2001b) Flooding tolerance of transgenic tomato plants expressing the bac-
terial enzyme ACC deaminase controlled by the 35S, rolD or PRB-1b promoter. Plant Physiol
Biochem 39:19–25
Grichko VP, Filby B, Glick BR (2000) Increased ability of transgenic plants expressing the bacte-
rial enzyme ACC deaminase to accumulate Cd, Co, Cu, Ni, Pb, and Zn. J Biotechnol 81:45–53
Grobbelaar N, Clarke B, Hough MC, Grobbelaar N, Clarke B, Hough MC (1971) The nodulation
and nitrogen fixation of isolated roots of Phaseolus vulgaris L. III. The effect of carbon dioxide
and ethylene. Plant Soil:216–223
Guinel FC, Sloetjes LL (2000) Ethylene is involved in the nodulation phenotype of Pisum sativum
R50 (sym 16), a pleiotropic mutant that nodulates poorly and has pale green leaves. J Exp Bot
51:885–894
Guo J, Chi J (2014) Effect of Cd-tolerant plant growth-promoting rhizobium on plant growth and
Cd uptake by Lolium multiflorum Lam. and Glycine max (L.) Merr.in Cd-contaminated soil.
Habib SH, Kausar H, Saud HM (2015) Plant growth-promoting rhizobacteria enhance salinity stress
tolerance in okra through ROS-scavenging enzymes. BioMed Res Int (Hindawi Publishing
Corporation) https://doi.org/10.1155/2016/6284547
Han Y, Wang R, Yang Z, Zhan Y, Ma Y, Ping S, Zhang L, Lin M, Yan Y (2015)
1-Aminocyclopropane-1-carboxylate deaminase from Pseudomonas stutzeri A1501 facili-
tates the growth of Rice in the presence of salt or heavy metals. J Microbiol Biotechnol
25(7):1119–1128
Hao Y, Charles TC, Glick BR (2007) ACC deaminase from plant growth-promoting bacteria
affects crown gall development. Can J Microbiol 53:1291–1299
Hassan W, Bano R, Bashir F, David J (2014) Comparative effectiveness of ACC-deaminase and/or
nitrogen fixing rhizobacteria in promotion of maize (Zea mays L.) growth under lead pollution.
Environ Sci Pollut Res 21:10983–10996
Hassan W, Bashir S, Ali F, Ijaz M, Hussain M, David J (2016) Role of ACC-deaminase and/or
nitrogen fixing rhizobacteria in growth promotion of wheat (Triticum aestivum L.) under cad-
mium pollution. Environ Earth Sci 75:267
Honma M, Shimomura T (1978) Metabolism of l-aminocyclopropane-1-carboxylic acid. Agri Biol
Chem 42:1825–1831
Hontzeas N, Saleh S, Glick BR (2004a) Changes in gene expression in canola roots induced by
ACC-deaminase-containing plant-growth-promoting bacteria. Mol Plant-Microbe Interact
12:951–959
Hontzeas N, Zoidakis J, Glick BR, Abu-Omar MM (2004b) Expression and characterization of
1-aminocyclopropane-1-carboxylate deaminase from the rhizobacterium Pseudomonas putida
UW4: a key enzyme in bacterial plant growth promotion. Biochem Biophys Acta 1703:11–19
Hontzeas N, Richardson AO, Belimov A, Safronova V, Abu-Omar MM, Glick BR (2005) Evidence
for horizontal transfer of 1-aminocyclopropane-1-carboxylate deaminase genes. Appl Env
Hontzeas N, Hontzeas CE, Glick BR (2006) Reaction mechanisms of bacterial enzyme 1-aminoc
yclopropane-1-carboxylate deaminase. Biotechnol Adv 24:420–426
Hu X, Boyer GL (1996) Siderophore-mediated aluminium uptake by Bacillus megaterium ATCC
19213. Appl Environ Microbiol 62:4044–4048
Huang XD, El-Alawi Y, Penrose DM, Glick BR, Greenberg BM (2004) Multi-process phytore-
mediation system for removal of polycyclic aromatic hydrocarbons from contaminated soils.
Environ Pollut 130:465–476
Husen E, Wahyudi AT, Suwanto A, Saraswati R (2008) Prospective use of 1-Aminocyclopropane-
1-carboxylate deaminase-producing bacteria for plant growth promotion and defense against
biotic and abiotic stresses in peat-soil-agriculture. Microbiology 2(3):107–111
Islam F, Yasmeen T, Arif SM, Riaz M, Shahzad MS, Imran Q, Ali I (2016) Combined ability of
chromium (Cr) tolerant plant growth promoting bacteria (PGPB) and salicylic acid (SA) in
attenuation of chromium stress in maize plants. Plant Physiol Biochem 108:456–467
Jacobson CB, Pasternak JJ, Glick BR (1994) Partial purification and characterization of ACC
deaminase from the plant growth-promoting rhizobacterium Pseudomonas putida GR12-2.
Can J Microbiol 40:1019–1025
Jain S, Vaishnav A, Kasotia A, Kumari S, Gaur RK, Choudhary DK (2013) Bacteria-induced sys-
temic resistance and growth promotion in Glycine max L. Merrill upon challenge inoculation
with Fusarium oxysporum. Proc Natl Acad Sci, India Sect B Biol Sci 83(4):561–567

Jaleel CA, Manivannan P, Sankar B, Kishore KA, Gopi R, Somasundaram R, Panneerselvam
R (2007) Pseudomonas fluorescens enhances biomass yield and ajmalicine production in
Catharanthus roseus under water deficit stress. Colloids Surf B Biointer 60:7–11
Jalili F, Khavazi K, Pazira E, Nejati A, Rahmani HA, Sadaghiani HR, Miransari M (2009) Isolation
and characterization of ACC deaminase-producing fluorescent pseudomonads, to alleviate
salinity stress on canola (Brassica napus L.) growth. J Plant Physiol 166:667–674
9(2):1211–1221
Ji Y, Huang X (2008) Amelioration of salt stress on annual rye grass by ACC deaminase containing
plant growth-promoting rhizobacteria. In: 2nd international conference on bioinformatics and
biomedical engineering (ICBBE), Shanghai, pp 16–18
Jia YJ, Kakuta Y, Sugawara M, Igarashi T, Oki N, Kisaki M, Shoji T, Kanetuna Y, Horita T, Matsui
H, Honma M (1999) Synthesis and degradation of 1-aminocyclopropane-1-carboxylic acid by
Penicillium citrinum. Biosci Biotechnol Biochem 63:542–549
Jiang C, Xia-fang S, Meng Q, Wang Q (2008) Isolation and characterization of a heavy metal-
resistant Burkholderia sp. from heavy metal-contaminated paddy field soil and its potential in
promoting plant growth and heavy metal accumulation in metal-polluted soil. Chemosphere
72(2):157–164
Jiang F, Chen L, Belimov AA, Shaposhnikov AI, Gong F, Meng X, Hartung W, Jeschke DW,
Davies WJ, Dodd IC (2012) Multiple impacts of the plant growth-promoting rhizobacte-
rium Variovorax paradoxus 5C-2 on nutrient and ABA relations of Pisum sativum. J Exp Bot
63(18):6421–6430
Kamran MA, Syed JH, Eqani SAMAS, Munis MFH, Chaudhary HJ (2015) Effect of plant growth-
promoting rhizobacteria inoculation on cadmium (Cd) uptake by Eruca sativa. Environ Sci
Pollut Res 22:9275–9283
Kaneko T, Nakamura Y, Sato S, Minamisawa K, Uchiumi T, Sasamoto S, Watanabe A, Idesawa
K, Iriguchi M, Kawashima K, Kimura T, Mochizuki Y, Nakayama S, Nakazaki N, Shimpo S,
Sugimoto M, Takeuchi C, Yamada M, Tabata S (2000) Complete genome sequence of the nitro-
gen- fixing symbiotic bacterium Mesorhizobium loti. DNA Res 7:331–338
Kaneko T, Nakamura Y, Sato S, Minamisawa K, Uchiumi T, Sasamoto S, Watanabe A, Idesawa
IKM, Kawashima K, Kohara M, Matsumoto M, Shimpo S, Tsuruoka H, Wada T, Yamada
M, Tabata S (2002) Complete genome sequence of nitrogen – fixing symbiotic bacterium
Bradyrhizobium japonicum USD 110. DNA Res 31:189–197
Karthikeyan S, Zhou Q, Zhao Z, Kao C, Tao Z, Robinson H (2004) Structural analysis of
Pseudomonas 1-aminocyclopropane-1-carboxylate deaminase complexes: insight into the
mechanism of a unique pyridoxal-5-phosphate dependent cyclopropane ring opening reaction.
Bioche 43:13328–13339
Karthikeyan B, Joe MM, Islam Md R, Sa T (2012) ACC deaminase containing diazotrophic endo-
phytic bacteria ameliorate salt stress in Catharanthus roseus through reduced ethylene levels
and induction of antioxidative defense systems. Symbiosis 56:77–86
Kausar R, Shahzad SM (2006) Effect of ACC-deaminase containing rhizobacteria on growth pro-
motion of maize under salinity stress. J Agri Soc Sci 2:216–218
Khandelwal A, Sindhu SS (2013) ACC deaminase containing Rhizobacteria enhance nodulation
and plant growth in cluster bean (Cyamopsis tetragonoloba L.) J Microbiol Res 3(3):117–123
Kiani MZ, Ali A, Sultan T, Ahmad R, Hydar SI (2015) Plant growth promoting Rhizobacteria hav-
ing 1-Aminocyclopropane-1-carboxylic acid deaminase to induce salt tolerance in sunflower
(Helianthus annuus L.) Nat Res 6:391–397
Kim SY, Mulkey TJ (1997) Effect of ethylene antagonists on auxin-induced inhibition of intact
primary root elongation in maize (Zea mays L.) J Plant Biol 40:256–260
KiYoon K, TongMin S (2013) Effect of ACC deaminase producing PGPR strains inoculation on the
early growth and nutrient uptake of crop plants in saemangeum reclaimed soil. Proceedings of
3rd Asian Conference on Plant Growth Promoting Rhizobacteria (PGPR) and other Microbials,
Manila, Philippines
Kloepper JW, Lifshitz R, Zablotowicz RM (1989) Free-living bacterial inocula for enhancing crop
productivity. Trends Biotechnol 7:39–43
Kong Z, Glick BR, Duan J, Ding S, Tian J, McConkey BJ, Wei G (2015) Effects of 1-aminocyclopr
opane-1-carboxylate (ACC) deaminase-over producing Sinorhizobium meliloti on plant growth
and copper tolerance of Medicago lupulina. Plant Soil 391:383–398
Kumar MD, Patel A, Ravindranath R, Singh OP (2008a) Chasing a mirage: water harvesting and
artificial recharge in naturally water-scarce regions. Econ Polit Wkly 43:61–71
Kumar KV, Singh N, Behl HM, Srivastava S (2008b) Influence of plant growth promoting
bacteria and its mutant on heavy metal toxicity in Brassica juncea grown in fly ash amended
soil. Chemosphere 72:678–683
Kumar A, Kumar A, Pratush A (2014) Molecular diversity and functional variability of environ-
mental isolates of Bacillus species. Springer Plus 3:312
org/10.1007/s00344-016-9663-5
Kunkel BN, Brooks DM (2002) Cross talk between signaling pathways in pathogen defense. Curr
Opin Plant Biol 5:325–331
Lambers H (2003) Dry land salinity: a key environmental issue in southern Australia. Plant Soil
218:5–7
Lee KH, LaRue TA (1992) Exogenous ethylene inhibits nodulation of Pisum sativum L. cv.
Sparkle. Plant Physiol 100:1759–1763
Lemus JO, Lucas IH, Girard L, Caballero-Mellado J (2009) ACC (1-Aminocyclopropane-1-
carboxylate) deaminase Activity,a widespread trait in Burkholderia species, and its growth-
promoting effect on tomato plants. Appl Environ Microbiol 75(20):6581–6590
Leong J (1986) Siderophores: their biochemistry and possible role in control of plant pathogens.
Annu Rev Phytopathol 24(1):187–209
Li Z, Chang S, Lin L, Li Y, An Q (2011) A colorimetric assay of 1-aminocyclopropane-1-
carboxylate (ACC) based on ninhydrin reaction for rapid screening of bacteria containing ACC
deaminase. Lett Appl Microbiol 53:178–185
Lim JH, Kim SD (2013) Induction of drought stress resistance by multi-functional PGPR Bacillus
licheniformis K11 in pepper. Plant Pathol 29:201–208
Liu L, Kloepper JW, Tuzun S (1995a) Induction of systemic resistance in cucumber against
Fusarium wilt by plant growth promoting rhizobacteria. Phytopathology 85:695–698
Liu L, Kloepper JW, Tuzun S (1995b) Induction of systemic resistance in cucumber against bacte-
rial angular leaf spot by plant growth-promoting rhizobacteria. Phytopathology 85:843–847
Liu L, Kloepper JW, Tuzun S (1995c) Induction of systemic resistance in cucumber by plant
growth-promoting rhizobacteria: duration of protection and effect of host resistance on protec-
tion and root colonization. Phytopathology 85:1064–1068
Lorteau MA, Ferguson BJ, Guinel FC (2001) Effects of cytokinin on ethylene production and
nodulation in pea (Pisum sativum) cv. Sparkle. Physiol Plant 112:421–428
Lund ST, Stall RE, Klee HJ (1998) Ethylene regulates the susceptible response to pathogen
infection in tomato. Plant Cell 10:371–382
Ma W, Guinel FC, Glick BR (2003) Rhizobium leguminosarum biovar viciae 1-aminocyclop
ropane-1-carboxylate deaminase promotes nodulation of pea plants. Appl Env Microbiol
69:4396–4402
Madhaiyan M, Poonguzhali S, Ryu J, Sa T (2006) Regulation of ethylene levels in canola (Brassica
campestris) by 1-aminocyclopropane-1-carboxylate deaminase-containing Methylobacterium
fujisawaense. Planta 224:268–278
Madhaiyan M, Kim BY, Poonguzhali S, Kwon SW, Song MH, Ryu JH, Go SJ, Koo BS, Sa TM
(2007) Methylobacterium oryzae sp. nov., an aerobic, pink-pigmented, facultatively methy-
lotrophic, 1-aminocyclopropane-1-carboxylate deaminase-producing bacterium isolated from
rice. Int J Syst Evol Microbiol 57:326–331
https://doi.org/10.1007/978-81-322-2776-2_10
Maurya BR, Meena VS, Meena OP (2014) Influence of Inceptisol and Alfisol’s potassium solu-
bilizing bacteria (KSB) isolates on release of K from waste mica. Vegetos 27:181–187
Mayak S, Tirosh T, Glick BR (1999) Effect of wild-type and mutant plant growth-promoting rhizo-
bacteria on the rooting of mung bean cuttings. J Plant Growth Regul 18:49–53
Mayak S, Tirosh T, Glick BR (2004a) Plant growth-promoting bacteria confer resistance in tomato
plants to salt stress. Plant Physiol Biochem 42:565–572
Mayak S, Tirosh T, Glick BR (2004b) Plant growth-promoting bacteria that confer resistance to
water stress in tomatoes and peppers. Plant Sci 166:525–530
McDonnell L, Plett JM, Andersson GS, Kozela C, Dugardeyn J, Van Der SD, Glick BR, Sundberg
B, Regan S (2009) Ethylene levels are regulated by a plant encoded 1-aminocyclopropane-1-
carboxylic acid deaminase. Physiol Plant 136:94–109
McKeon TA, Fernández-Maculet JC, Yang SF (1995) Biosynthesis and metabolism of ethylene.
In plant hormones: physiology, biochemistry and molecular biology, 2nd edn. P.J. Davies,
Kluwer, Dordrecht, pp 118–139
Meena VS, Maurya BR, Verma JP (2014b) Does a rhizospheric microorganism enhance K+
availability in agricultural soils? Microbiol Res 169:337–347
world. J Cleaner Prod 102:560–561
Meena VS, Meena SK, Verma JP, Meena RS, Ghosh BN (2015e) The needs of nutrient use
efficiency for sustainable agriculture. J Clean Prod 102:562–563. https://doi.org/10.1016/j.
jclepro.2015.04.044
Meena RK, Singh RK, Singh NP, Meena SK, Meena VS (2016a) Isolation of low temperature
surviving plant growth-promoting rhizobacteria (PGPR) from pea (Pisum sativum L.) and doc-
umentation of their plant growth promoting traits. Biocatalysis and agricultural. Biotechnology
4:806–811
Meena VS, Meena SK, Bisht JK, Pattanayak A (2016c) Conservation agricultural practices in
Mendelsohn R, Rosenberg NJ (1994) Framework for integrated assessments of global warming
impacts. Clim Chang 28:15–44
Minami R, Uchiyama K, Murakami T, Kawai J, Mikami K, Yamada T (1998) Properties, sequence,
and synthesis in Escherichia coli of 1-aminocyclopropane-1-carboxylate deaminase from
Hansenula saturnus. J Biochem (Tokyo) 123:1112–1118
Miransari M, Jalili F, Khavazi K, Pazira E, Nejati A, Rahmani HA, Sadaghiani HR (2009) Isolation
and characterization of ACC deaminase producing fluorescent pseudomonads to alleviate
salinity stress on canola (Brassica napus L.) growth. J Plant Physiol 166:667–674
Moreira H, Marques APGC, Franco AR, Rangel AOSS, Castro PML (2014) Phytomanagement of
Cd-contaminated soils using maize (Zea mays L.) assisted by plant growth-promoting rhizo-
bacteria. Environ Sci Pollut Res 21:9742–9753
Morgan W, Drew MC (1997) Ethylene and plant responses to stress. Physiol Plant 100:620–630
Munns R (2002) Comparative physiology of salt and water stress. Plant Cell Environ 25(2):239–250
Munns R, Tester M (2008) Mechanisms of salinity tolerance. Annu Rev Plant Biol 59:651–681
Musarrat J, Khedhairy AA, Al-Arifi S, Khan MS (2009) Role of 1-aminocyclopropane-1-427
carboxylate deaminase in rhizobium-legume symbiosis. In: Khan MS, Zaidi A, Musarat J (eds)
428 microbial strategies for crop improvement. Springer, Berlin, pp 63–83
Nadeem SM, Zahir ZA, Naveed M, Arshad M (2007) Preliminary investigations on inducing salt
tolerance in maize through inoculation with rhizobacteria containing ACC deaminase activity.
Can J Microbiol 53:1141–1149
Nadeem SM, Zahir ZA, Naveed M, Arshad M (2009) Rhizobacteria containing ACC-deaminase
confers salt tolerance in maize grown on salt affected fields. Can J Microbiol 55:1302–1309
Nadeem SM, Zahir ZA, Naveed M, Asghar HN, Arshad M (2010) Rhizobacteria capable of
producing ACC-deaminase may mitigate salt stress in wheat. Soil Sci Soc Am J 74:533–542
Nadeem SM, Zahir ZA, Naveed M, Nawaz S (2013) Mitigation of salinity-induced negative impact
on the growth and yield of wheat by plant growth-promoting rhizobacteria in naturally saline
conditions. Ann Microbiol 63:225–232
Nie L, Shah S, Burd GI, Dixon DG, Glick BR (2002) Phytoremediation of arsenate contaminated
soil by transgenic canola and the plant growth-promoting bacterium Enterobacter cloacae
CAL2. Plant Physiol Biochem 40:355–361
Nukui N, Ezura H, Yuhashi K, Yasuta T, Minamisawa K (2000) Effects of ethylene precursor
and inhibitors for ethylene biosynthesis and perception on nodulation in Lotus japonicus and
Macroptilium atropurpureum. Plant Cell Physiol 41:893–897
Oldroyd GE, Engstrom EM, Long SR (2001) Ethylene inhibits the Nod factor signal transduction
pathway of Medicago truncatula. Plant Cell 13:1835–1849
Orhan F (2016) Alleviation of salt stress by halotolerant and halophilic plant growth-promoting
bacteria in wheat (Triticum aestivum). Braz J Microbial 47:621–627
Ose T, Fujino A, Yao M, Watanabe N, Honma M, Tanaka I (2003) Reaction intermediate structures
of 1-aminocyclopropane-1-carboxylate deaminase. J Biol Chem 278:41069–41076
Palaniyandi SA, Damodharan K, Yang SH, Suh JW (2014) Streptomyces sp. strain PGPA39
alleviates salt stress and promotes growth of ‘Micro Tom’ tomato plants. J Appl Microbiol
117:766–773
Pande AM, Kulkarni NS, Bodhankar MG (2015) Effect of PGPR with ACC- deaminase activity on
growth performance of wheat cultivated under stress conditions. Int J Appl Res 2(1):723–726
Pandey S, Ghosh PK, Ghosh S, De TK, Maiti TK (2013) Role of heavy metal resistant Ochrobactrum
sp. and Bacillus spp. strains in bioremediation of a Rice cultivar and their PGPR like activities.
Pastor N, Masciarelli O, Fischer S, Luna V, Rovera M (2016) Potential of Pseudomonas putida
PCI2 for the protection of tomato plants against fungal pathogens. Curr Microbiol 73:346–353
Paul D, Nair S (2008) Stress adaptations in a plant growth promoting Rhizobacterium (PGPR) with
increasing salinity in the coastal agricultural soils. J Basic Microbiol 48:378–384
Penrose DM, Glick BR (2001) Levels of 1-aminocyclopropane-1-carboxylic acid (ACC) in
exudates and extracts of canola seeds treated with plant growth-promoting bacteria. Can
J Microbial 47:368–372
Pereira SIA, Barbosa L, Castro PML (2015) Rhizobacteria isolated from a metal-polluted area
enhance plant growth in zinc and cadmium-contaminated soil. Int J Environ Sci Technol
12:2127–2142
Peterson TA, Rensel MD, Krizek DT (1991) Tomato (Lycopersicon esculentum Mill.cv. Better
Bush) plant response to root restriction. I. Alteration of plant morphology. J Expt Bot
42:1233–1240
Plett JM, McDonnell L, Regan S (2009) Plant encoded 1-aminocyclopropane-1-carboxylic acid
deaminase activity rhizobacteria and genistein on nitrogen fixation in soybean at suboptimal
root zone temperatures. J Plant Nutri 23:593–604
Poonguzhali S, Madhaiyan M, Sa T (2008) Isolation and identification of phosphate solubilizing
bacteria from chinese cabbage and their effect on growth and phosphorus utilization of plants.
Pourbabaee AA, Bahmani E, Alikhani HA, Emami S (2016) Promotion of wheat growth under salt
stress by halotolerant bacteria containing ACC deaminase. J Agr Sci Tech 18:855–864
Qadir M, Quillérou E, Nangia V, Murtaza G, Singh M, Thomas RJ, Drechsel P, Noble AD (2014)
Economics of salt-induced land degradation and restoration. Nat Resour Forum UN Sustain
Dev J 38(4):282–295. DOI: 10.1111/1477-8947.12054
org/10.1007/978-81-322-2776-2_4
Raja N (2013) Biopesticides and biofertilizers: ecofriendly sources for sustainable agriculture.
J Biofertil Biopestici 1000e112:1000e112
Rajkumar M, Freitas H (2008) Effects of inoculation of plant growth promoting bacteria on Ni
uptake by Indian mustard. Bioresour Technol 99:3491–3498
Rajput L, Imran A, Mubeen F, Hafeez F (2013) Salt tolerant PGPR strain Planococcus rifietoensis
promotes the growth and yield of wheat (Triticum aestivum L.) cultivated in saline soil. Pak
J Bot 45(6):1955–1962
Rana A, Saharan B, Joshi M, Prasanna R, Kumar K, Nain L (2011) Identification of multi-trait

PGPR isolates and evaluating their potential as inoculants for wheat. Ann Microbiol 61:893–900
Rasche F, Marco-Noales E, Velvis H, Overbeek LSV, Lopez MM, van Elsas JD, Sessitsch A
(2006a) Structural characteristics and plant-beneficial effects of bacteria colonizing the shoots
of field grown conventional and genetically modified T4-lysozyme producing potatoes. Plant
Soil 289:123–140
Rasche F, Velvis H, Zachow C, Berg G, Van Elsas JD, Sessitsch A (2006b) Impact of transgenic
potatoes expressing anti-bacterial agents on bacterial endophytes is comparable with the effects
of plant genotype, soil type and pathogen infection. J Appl Ecol 43:555–566
Raupach GS, Liu L, Murphy JF, Tuzun S, Kloepper JW (1996) Induced systemic resistance in
cucumber and tomato against cucumber mosaic cucumovirus using plant growth-promoting
rhizobacteria (PGPR). Plant Dis 80:891–894
Reed MLE, Warner BG, Glick BR (2005) Plant growth-promoting bacteria facilitate the growth
of the common reed Phragmites australis in the presence of copper or polycyclic aromatic
hydrocarbons. Curr Microbiol 51:425–429
Robinson MM, Shah S, Tamot B, Pauls KP, Moffatt BA, Glick BR (2001) Reduced symptoms of
Verticillium wilt in transgenic tomato expressing a bacterial ACC deaminase. Mol Plant Pathol
2:135–145
Rolli E, Marasco R, Vigani G, Ettoumi B, Mapelli F, Deangelis ML, Gandolfi C, Casati E, Previtali
F, Gerbino R, Cei FP, Borin S, Sorlini C, Zocchi G, Daffonchio D (2014) Improved plant resis-
tance to drought is promoted by the root-associated microbiome as a water stress-dependent
trait. Env Microbiol 17:316–331
Sadrnia M, Maksimava N, Khromsova E, Stanislavich S, Owlia P, Arjomandzadegan M (2011)
Study the effect of bacterial 1-Aminocyclopropane-1-Carboxylate deaminase (ACC deami-
nase) on resistance to salt stress in tomato plant. Fasci Biol 2:120–123
Safronova VI, Stepanok VV, Engqvist GL, Alekseyev YV, Belimov AA (2006) Root-associated
bacteria containing 1-aminocyclopropane-1-carboxylate deaminase improve growth and
nutrient uptake by pea genotypes cultivated in cadmium supplemented soil. Biol Fert Soils
42:267–272
pp 127–136. https://doi.org/10.1007/978-81-322-2776-2_9
Sairam RK, Tyagi A (2004) Physiology and molecular biology of salinity stress tolerance in plants.
Curr Sci 86:407–421
Saleem M, Arshad M, Hussain S, Bhatti AS (2007) Perspective of plant growth promoting rhizo-
bacteria (PGPR) containing ACC deaminase in stress agriculture. J Ind Microbiol Biotechnol
34:635–648
Samina M, Baig DN, Lazarovits G (2010) Genetic and phenotypic diversity of plant growth
promoting Rhizobacteria isolated from sugarcane plants growing in Pakistan. J Microbiol
Biotechnol 20(12):1614–1623
Santos VB, Araujo SF, Leite LF, Nunes LA, Melo JW (2012) Soil microbial biomass and organic
matter fractions during transition from conventional to organic farming systems. Geoderma
170:227–231
Saravanakumar D, Samiyappan R (2007) ACC deaminase from Pseudomonas fluorescens medi-
ated saline resistance in groundnut (Arachis hypogea) plants. J Appl Microbiol 102:1283–1292
Senthilkumar M, Paulraj S, Alagupalamuthirsolai M, Singh M, Singh J (2016) Synergistic effect of

Mesorhizobium ciceri and 1-amino cyclopropane 1-carboxylate (ACC) deaminase producing
rhizobacteria on chickpea growth and yield. J Food Legumes 29(1):37–42
Sergeeva E, Shah S, Glick BR (2006) Growth of transgenic canola (Brassica napus cv. Westar)
expressing a bacterial 1-aminocyclopropane-1-carboxylate (ACC) deaminase gene on high
concentrations of salt. World J Microbiol Biotechnol 22:277–282
Shah S, Li J, Moffatt BA, Glick BR (1998) Isolation and characterization of ACC deaminase genes
from two different plant growth-promoting rhizobacteria. Can J Microbiol 44:833–843
Shaharoona B, Jamro GM, Zahir ZA, Arshad M, Memon KS (2007) Effectiveness of various
Pseudomonas spp. and Burkholderia caryophylli containing ACC-deaminase for improving
growth and yield of wheat (Triticum aestivum L.) J Microbiol Biotechnol 17:1300–1307
Shahzadi I, Khalidi A, Mahmood S, Arshad M, Mahmood T, Aziz I (2013) Effect of bacteria
containing ACC deaminase on growth of wheat seedlings grown with chromium contaminated
water. Pak J Bot 45:487–494
Shakir MA, Bano A, Arshad M (2012) Rhizosphere bacteria containing ACC-deaminase conferred
drought tolerance in wheat grown under semi-arid climate. Soil Environ 31(1):108–112
Sharma P, Khanna V, Kumar P (2013) Efficacy of aminocyclopropane-1-carboxylic acid (ACC)-
deaminase-producing rhizobacteria in ameliorating water stress in chickpea under axenic con-
ditions. Afr J Microbiol Res 7:5749–5757
Shim J, Kim JW, Shea PJ, Oh BT (2015) IAA production by Bacillus sp. JH 2-2 promotes Indian
mustard growth in the presence of hexavalent chromium. J Basic Microbiol 55:652–658
Shiu OY, Oetiker JH, Yip WK, Yang SF (1998) The promoter of LE-ACS7, an early flooding-
induced 1-aminocyclopropane -1-carboxylate synthase gene of the tomato, is tagged by a Sol3
transposon. Proc Natl Acad Sci U S A 95:10334–10339
Siddikee MA, Chauhan PS, Anandham R, Han GH, Sa T (2010) Isolation, characterization, and
use for plant growth promotion under salt stress, of ACC deaminase-producing halotolerant
bacteria derived from coastal soil. J Microbiol Biotechnol 20(11):1577–1584
Siddikee MA, Glick BR, Chauhan PS, Yim WJ, Sa T (2011) Enhancement of growth and salt tol-
erance of red pepper seedlings (Capsicum annuum L.) by regulating stress ethylene synthesis
with halotolerant bacteria containing 1-aminocyclopropane1-carboxylic acid deaminase activ-
ity. Plant Physiol Biochem 49(4):427–434
Singh N, Kashyap S (2012) In-silico identification and characterization of 1-aminocyclopropane-
1-carboxylate deaminase from Phytophthora sojae. J Mol Model 18:4101–4111
Singh NP, Singh RK, Meena VS, Meena RK (2015a) Can we use maize (Zea mays) rhizobacteria as
Singh RP, Shelke GM, Kumar A, Jha PN (2015b) Biochemistry and genetics of ACC deaminase: a
weapon to “stress ethylene” produced in plants. Front Microbiol 6:937. https://doi.org/10.3389/
fmicb.2015.00937

Sisler EC, Serek M (1997) Inhibitors of ethylene responses in plants at the receptor level: recent
developments. Physiol Plant 100:577–582
Stearns JC, Shah S, Greenberg BM, Dixon DG, Glick BR (2005) Tolerance of transgenic canola
expressing 1-aminocyclopropane-1-carboxylic acid deaminase to growth inhibition by nickel.
Plant Physiol Biochem 43:701–708
Sugawara M, Okazaki S, Nukui N, Ezura H, Mitsui H, Minamisawa K (2006) Rhizobitoxine mod-
ulates plant-microbe interactions by ethylene inhibition. Biotechnol Adv 24:382–388
Sullivan JT, Trzebiatowski JR, Cruickshank RW, Gouzy J, Brown SD, Elliot RM, Fleetwood
DJ, Mc Callum NG, Rossbach U, Stuart GS, Weaver JE, Webby RJ, De Bruijn FJ, Ronson
CW (2002) Complete sequence analysis of the symbiosis island of Mesorhizobium loti strain
R7A. J Bacteriol 184:3086–3095
Sun Y, Cheng Z, Glick BR (2009) The presence of a 1-aminocyclopropane-1-carboxylate (ACC)
deaminase deletion mutation alters the physiology of the endophytic plant growth-promoting
bacterium Burkholderia phyto¢rmans PsJN. FEMS Microbiol Lett 296:131–136
Suttle JC, Kende H (1978) Ethylene and senescence in petals of Tradescantia. Plant Physiol
62:267–271
Tak HI (2015) Modulation of growth, antioxidant system in seedling of mustard under different
levels of nickel in adaptive response to metal resistant bacteria. Front Biol 10(3):272–278
Tank N, Saraf M (2010) Salinity-resistant plant growth promoting rhizobacteria ameliorates
sodium chloride stress on tomato plants. J Plant Interact 5:51–58
Tarabily EKA (2008) Promotion of tomato (Lycopersicon esculentum Mill.) plant growth by rhi-
zosphere competent 1-aminocyclopropane-1-carboxylic acid deaminase-producing streptomy-
cete actinomycetes. Plant Soil 308:161–174
Tester M, Davenport R (2003) Na+ tolerance and Na+ transport in higher plants. Ann Bot
91(5):503–527
Timmusk S, Islam A, Abd ED, Lucian C, Tanilas T, Kannaste A (2014) Drought-tolerance of wheat
improved by rhizosphere bacteria from harsh environments: enhanced biomass production and
reduced emissions of stress volatiles. PLoS One 9:1–13
Tittabutr P, Piromyou P, Longtonglang A, Noisa-ngiam R, Boonkerd N, Teaumroong N (2013)
Alleviation of the effect of environmental stresses using co-inoculation of mungbean by
Bradyrhizobium and rhizobacteria containing stress-induced ACC deaminase enzyme. Soil Sci
Plant Nutr 59:559–571
Tittabutr P, Sripakdi S, Boonkerd N, Tanthanuch W, Minamisawa K, Teaumroong N (2015) Possible
role of 1-Aminocyclopropane-1-carboxylate (ACC) deaminase activity of Sinorhizobium sp.
BL3 on Symbiosis with Mung Bean and determinate nodule senescence. Microbes Environ
30(4):310–320
Toklikishvili N, Dandurishvili N, Vainstein A, Tediashvili M, Giorgobiani N, Luried S, Szegedi E,
Glick BR, Chernin L (2010) Inhibitory effect of ACC deaminase-producing bacteria on crown
gall formation in tomato plants infected by Agrobacterium tumefaciens or A. vitis. Plant Pathol
59:1023–1030
Trott S, Bauer R, Knackmuss HJ, Stolz A (2001) Genetic and biochemical characterization of
an enantio selective amidase from Agrobacterium tumefaciens strain d3. Microbiology
147:1815–1824
Trung NT, Hieu HV, Thuan NH (2016) Screening of strong 1-Aminocyclopropane-1-carboxylate
deaminase producing bacteria for improving the salinity tolerance of cowpea. Appl Micro
2(1):1–6
Uchiumi T, Ohwada T, Itakura M, Mitsui H, Nukui N, Dawadi P, Kaneko T, Tabata S, Yokoyama
T, Tejima K, Saeki K, Omori H, Hayashi M, Maekawa T, Sriprang R, Murooka Y, Tajima
S, Simomura K, Nomura M, Suzuki A, Shimoda Y, Sioya K, Abe M, Minamisawa K (2004)

Expression islands clustered on the symbiosis island of the Mesorhizobium loti genome.
J Bacteriol 186:2439–2448
Vaikuntapu PR, Dutta S, Samudrala RB, Rao VRVN, Kalam S, Podile AR (2014) Preferential
promotion of Lycopersicon esculentum (tomato) growth by plant growth promoting bacteria
associated with tomato. Indian J Microbiol 54(4):403–412
VanLoon LC, Glick BR (2004) Increased plant fitness by rhizobacteria. In: Sandermann H (ed)
Molecular ecotoxicology of plants. Springer, Berlin, pp 177–207
84(8):914–919
Viterbo A, Landau U, Kim S, Chernin L, Chet I (2010) Characterization of ACC deaminase
from the biocontrol and plant growth-promoting agent Trichoderma asperellum T203. FEMS
Microbiol Lett 305:42–48
Vivekanandan M, Karthik R, Leela A (2015) Improvement of crop productivity in saline soils
through application of saline-tolerant rhizosphere bacteria – current perspective. Int J Adv Res
3(7):1273–1283
Wang C, Knill E, Glick BR, Defago G (2000) Effect of transferring 1-aminocyclopropane-1-
carboxylic acid (ACC) deaminase genes into Pseudomonas fluorescens strain CHA0 and its
gacA derivative CHA96 on their growth-promoting and disease-suppressive capacities. Can
Wang S, Ouyang L, Ju X, Zhang L, Zhang Q, Li Y (2014) Survey of plant drought-resistance
promoting bacteria from Populus euphratica tree living in arid area. Indian J Microbiol
54(4):419–426
Wang X, Mavrodi DV, Ke L, Mavrodi OV, Yang M, Thomashow LS, Zheng N, Weller DM, Zhang
J (2015) Biocontrol and plant growth-promoting activity of rhizobacteria from Chinese fields
with contaminated soils. Microb Biotechnol 8(3):404–418
Wang Q, Dodd IC, Belimov AA, Jiang F (2016) Rhizosphere bacteria containing
1-aminocyclopropane-1- carboxylate deaminase increase growth and photosynthesis of pea
plants under salt stress by limiting Na+ accumulation. Funct Plant Boil 43:161–172
Wani PA, Khan MS, Zaidi A (2007) Impact of heavy metal toxicity on plant growth, symbiosis,
seed yield and nitrogen and metal uptake in chickpea. Aust J Expt Agric 47:712–720
Wani PA, Khan MS, Zaidi A (2008) Effect of heavy metal toxicity on growth, symbiosis, seed
yield and metal uptake in pea grown in metal amended soil. Bull Environ Contam Toxicol
81(2):152–158
White PJ, Broadley MR (2001) Chloride in soils and its uptake and movement within the plant: a
review. Ann Bot 88:967–988
Woitke M, Junge H, Schnitzler WH (2004) Bacillus subtilis as growth promotor in hydrophoni-
cally grown tomatoes under saline conditions. Acta Hort 659:363–369
Wu Z, Yue H, Lu J, Li C (2012) Characterization of rhizobacterial strain Rs-2 with ACC deam-
inase activity and its performance in promoting cotton growth under salinity stress. World
Xie ZP, Staehelin C, Wiemken A, Boller T (1996) Ethylene responsiveness of soybean cultivars char-
acterized by leaf senescence, chitinase induction and nodulation. J Plant Physiol 149:690–694
org/10.1007/978-81-322-2776-2_14
Yan J, Smith MD, Glick BR, Liang Y (2014) Effects of ACC deaminase containing rhizobacteria
on plant growth and expression of Toc GTPases in tomato (Solanum lycopersicum) under salt
stress. Botany 92(11):775–781
org/10.1007/978-81-322-2776-2_12
Yim WJ, Chauhan PS, Madhaiyan M, Tipayno SC, Sa TM (2010) Plant growth promontory attri-
butes by 1-aminocyclopropane-1-carboxylate (ACC) deaminase producing Methylobacterium
oryzae strains isolated from rice. In: Gilkes RJ, Prakongkep N (eds) 19th World Congress of
Soil Science, International Union of Soil Sciences, Brisbane
Yim W, Seshadri S, Kim K, Lee G, Sa T (2013) Ethylene emission and PR protein synthesis
in ACC deaminase producing Methylobacterium spp. inoculated tomato plants (Lycopersicon
esculentum Mill.) challenged with Ralstonia solanacearum under greenhouse conditions. Plant
Physiol Biochem 67:95–104
Youssef MMA, Eissa MFM (2014) Biofertilizers and their role in management of plant parasitic
nematodes. A review E3. J Biotechnol Pharm Res 5:1–6
Yue H, Mo W, Li C, Zheng Y, Li H (2007) The salt stress relief and growth promotion effect of
RS-5 on cotton. Plant Soil 297:139–145
Yuhashi K, Ichikawa N, Ezura H, Akao S, Minakawa Y, Nukui N, Yasuta T, Minamisawa K (2000)
Rhizobitoxine production by Bradyrhizobium elkanii enhances nodulation and competitiveness
on Macroptilium atropurpureum. Appl Environ Microbiol 66:2658–2663
Zafar-ul-Hye M, Farooq HM, Zahir ZA, Hussain M, Hussain A (2014) Application of ACC-
deaminase containing Rhizobacteria with fertilizer improves maize production under drought
and salinity stress. Int J Agric Biol 16(3):591–596
org/10.1007/978-81-322-2776-2_3
Zahir ZA, Munir A, Asghar HN, Shahroona B, Arshad M (2008) Effectiveness of rhizobacteria
containing ACC-deaminase for growth promotion of peas (Pisum sativum) under drought
conditions. J Microbiol Biotechnol 18:958–963
Zahir ZA, Ghani U, Naveed M, Nadeem SM, Asghar HN (2009) Comparative effectiveness of
Pseudomonas and Serratia sp. containing ACC deaminase for improving growth and yield
of wheat (Triticum aestivum L.) under salt-stressed conditions. Arch Microbiol 191:415–424
Zhang YF, He LY, Chen ZJ, Zhang WH, Wang QY, Qian M, Sheng XF (2011) Characterization of
lead-resistant and ACC deaminase-producing endophytic bacteria and their potential in pro-
moting lead accumulation of rape. J Hazard Mater 186:1720–1725
Chapter 4
Toward the Unculturable Microbes
for Sustainable Agricultural Production
Reeta Goel, Vinay Kumar, Deep Chandra Suyal, Narayan, and Ravindra Soni
Abstract The microbes are elemental to maintain the life on the Earth, yet we have
very little understanding about the majority of microbial forms present in various
environments like soils. As per the information available from published researches,
a big portion of microbial wealth is unculturable which may contain several benefi-
cial traits, including the plant growth-promoting activities for sustainable agricultural
production. Exploitation of these unculturable microbes can enhance our understand-
ing of present practices of organic agriculture. The only way to exploit this uncultur-
able wealth is the “metagenomics,” the culture-independent approach where we are
analyzing microbial DNA extracted directly from an environmental sample.
Keywords Metagenomics · Rhizosphere · Agriculture · Organic agriculture
4.1 Introduction
“Sustainable development” has been defined in many ways but definition given by
Altieri (2004) seems more appropriate. According to him it is the result of the inter-
sections among environment, society, and economy, which in turn interact between
each two of them. Agriculture plays a vital role in sustainable development and in
hunger and poverty eradication. Now, sufficient attention has been paid to the devel-
opment of sustainable agriculture in which the good productivities of plants are
ensured using their natural adaptive potentials, with a minimal commotion of the
environment (Noble and Ruaysoongnern 2010). Here, agricultural microbiology is
R. Goel · D. C. Suyal
Department of Microbiology, CBSH, G.B. Pant University of Agriculture and Technology,
Pantnagar, Uttarakhand, India
V. Kumar
ICAR-National Institute of Biotic Stress Management, Raipur, Chhattisgarh, India
Narayan · R. Soni (*)
Department of Agricultural Microbiology, College of Agriculture, Indira Gandhi Krishi
Vishva Vidyalaya, Raipur, Chhattisgarh, India

https://doi.org/10.1007/978-981-10-8402-7_4
108 R. Goel et al.
presented as an important research field mainly responsible for the transfer of

knowledge from microbial ecology to the agricultural scientists (Tikhonovich and
Provorov 2011).
Further, microbes harbor a big portion of Earth’s biomass and are responsible for
a lot of critical functions including those that generally affect the atmosphere
(Falkowski et al. 2000; Finzi et al. 2011), agricultural production (Morel et al.
2012), biodegradation, bioremediation (Boubakri et al. 2006), and other industrial
applications (Daniel 2004; Jacquiod et al. 2013). However, microorganisms known
to involve in the promotion of plant growth are also enhancing soil fertility. They
can increase crop yields and improve quality as well as accelerate the breakdown of
organic matter from crop residues (Alagukannan and Kumar 2015).
4.1.1 The Limitations of Pure Culture
Nowadays a big portion of microbiology is entirely based on culturing process, and

due to this most of the time, microbiologists ignored the challenge to identify and
characterize uncultured organisms. The traditional cultivation techniques for isola-
tion of microorganisms involve samples of as little as 1% of soil bacteria (Torsvik
et al. 2002), and the rest are the unculturable. Here, the term “unculturable” is gen-
erally used for the bacteria that are not able to grow on artificial culture media. As
per the available reports, many of these unculturable cells were shown to be meta-
bolically active, even though they were not able to grow on laboratory media
(Harwani 2013). Abundance and diversity of unculturable bacteria in almost all eco-
logical niches have led to the understanding that the “unculturable” bacteria actually
multiply in their native environment and if favorable culture conditions were pro-
vided it should be possible to cultivate them in the laboratory conditions (Sharma
et al. 2005; Meena et al. 2013a; Bahadur et al. 2014; Maurya et al. 2014; Kumar
et al. 2016b).
The possible reasons behind the unculturability were discussed by various scien-
tists or groups (Wade 2002; Stewart 2012; Pham and Kim 2012; Vartoukian et al.
2016), but still the real cause is not reported. Probably some bacteria have specific
growth requirements, including the need for particular nutrients, pH, temperatures,
or availability of oxygen in the atmosphere (Kopke et al. 2005; Tamaki et al. 2005).
In addition, in the absence of beneficial interactions and signals, some bacteria may
struggle to grow (Vartoukian et al. 2010).
4.2 Metagenomics
For global analyses, simultaneous assessment and comparison of microbial popula-

tions across all domains of life, metagenomics, metatranscriptomics, and metapro-
teomics are the techniques of choice which facilitate the identification of unculturable
4 Toward the Unculturable Microbes for Sustainable Agricultural Production 109
Fig. 4.1 The basic strategies for metagenomic study of plant rhizosphere
microbes (Turner et al. 2013). Out of these three, metagenomics has been generally
used to cover research ranging from analyzing environmental DNA in functional
screenings (Schmeisser et al. 2007) to randomly sample the genomes from a small
subsamples of organisms present in an environment (Tringe et al. 2005).
The main objectives of metagenomics are to characterize the microorganisms in
environment(s), identify the microorganisms based on 16S ribosomal gene (16S
rDNA), understand the different biological pathway by functional characterization
of genes, and compile the 16S rDNA and functional information to understand the
impact of metagenome on environment using a systems biology approach.
Metagenome samples are found almost all over the places, including extreme envi-
ronments such as in high-temperature oil wells and ocean floor and also in microen-
vironments like skin gut and soil alveoli. Here, metagenome (the term was first
coined by Jo Handelsman in 1998) refers to the thought that a set of genes sequenced
from any targeted environment could be analyzed in a way similar to the study of a
single genome (Jat et al. 2015; Kumar et al. 2015, 2016a; Ahmad et al. 2016; Meena
et al. 2016a; Parewa et al. 2014; Jaiswal et al. 2016; Jha and Subramanian 2016).
However, metagenomics involves a variety of modern techniques and approaches;
it is likely that many more new methodologies will arise as the field progresses
(Fig. 4.1). Nonetheless, it is a simple approach usually consists of cloning and anal-
ysis of microbial DNA extracted directly from environmental samples (Patrick and
Handelsman 2005; Susannah and Edward 2005). Generally two main approaches
were adopted under metagenomics, i.e., sequenced-based and functional metage-
nomics. The former focuses on quantifying DNA molecules in a given sample as
opposed to functional metagenomics which focuses on clonal expression (Lakhdari
et al. 2010). Furthermore, this approach can involve complete sequencing of clones
110 R. Goel et al.
having phylogenetic prop that indicate the taxonomic group that might be a possible
source of the DNA fragment. Despite the potential for mining of genetic novelty, the
yields from functional metagenomic studies are often not enough for yielding prod-
ucts with sufficient novelty for biotechnological practices (Hill and Fenical 2010;
Singh and Macdonald 2010).
4.2.1 Metagenomics and Plant Growth Promotion
Members of a microbial community interact with each other and the host plant
(Barea et al. 2005); hence, it is essential to detain as much of the diversity of a
microbial as possible. In recent years, sequencing of the rhizosphere soil metage-
nome provided new insights into the ecology of agriculturally important microor-
ganisms (AIM) and proved to be a powerful tool for recovery of novel genes and
biomolecules (Daniel 2005). Further, the rhizosphere-associated microorganisms
have diverse metabolic properties and play an important role in plant health, knowl-
edge of their community structure is crucial for the proper understanding of their
individual roles, and metagenomics holds the promise to reveal several important
questions regarding the unculturable fraction of the rhizosphere community. As
suggested by J. M. Barea, culture-independent, molecular tools increase under-
standing of rhizosphere microbiome, improvement in the ability of soil microbes for
alleviating the negative impacts of stress factors on crop production, and the poten-
tial of the plants to structure their root-associated microbial communities and, lead-
ing on from this, whether the rhizosphere can be manipulated to encourage beneficial
organisms while preventing the presence of pathogens (Barea 2015).
Metagenomics of the plant microbiome also explored greater insights beyond the
genomic information of individual bacterial strains into functional information. The
main obstacle in the construction of a metagenomic library of soil DNA from plant
rhizosphere is the relative low availability of starting material (Johan and Leveau
2007). In spite of problems, this approach showed the strong potential to contribute
to the study of microbial communities of the rhizosphere, in particular plant growth-
promoting rhizobacteria (PGPR). As far as community structure is concerned,
Rocha et al. (2009) show that among the groups of bacteria highest in density in the
rhizosphere environment, the Acidobacteria, Verrucomicrobia, and Planctomycetes
are the ones whose functions remain to be unveiled (Prakash and Verma 2016;
Meena et al. 2015a, f, 2016b; Priyadharsini and Muthukumar 2016; Kumar et al.
2017; Dotaniya et al. 2016).
In addition to phylogenetic analysis, metagenomic sequencing is useful in the
characterization of putative protein sequences related to colonization competence
and PGPR activities (Barret et al. 2011; Sessitsch et al. 2012). Furthermore, high-
throughput sequencing-based metagenomic analysis has further allowed scientists
to obtain a global view about community structure and diversity of endophytic
microbiome residing inside the plant. Recently a functional metagenomic analysis
indicated that the enriched bacterial populations in root gall harbored plenty of
genes related to biodegradation of plant polysaccharides, carbohydrate and protein,

and biological nitrogen fixation (Tian et al. 2015). Not only bacterial population,
this approach is widely used for the characterization of microbes in diverse areas;
recently some plant viruses have also been studied through metagenomics as well
(Stobbe and Roossinck 2014).
4.2.2 Microbiology of Crops Explored by Metagenomics
4.2.2.1 Rice
Rice is considered one of the most important crops in the world, and approximately
half of the world’s populations rely on rice as a daily staple food. Rice rhizosphere
is also the comparatively most explored than any other through metagenomics. The
whole genome metagenomic sequence data of lowland rice showed the dominance
of bacterial communities, namely, Proteobacteria, Firmicutes, Acidobacteria,
Actinobacteria, and Planctomycetes (Bhattacharya et al. 2016).
The majority of the uncultured strains belong to the phylotype Proteobacteria
and clones showing 100% similarity with a sequence database of phyla
Proteobacteria and Firmicutes (Arjun and Harikrishnan 2011). In order to gain bet-
ter understanding of the microbial diversity and composition of rice rhizospheric
soil, Bais and coworkers used a metagenomic approach to examine the phyla and
genera that naturally inhabit (Spence et al. 2014).
Furthermore, this approach again helpful in exploration of bacterial populations
associated with the rhizosphere of wild rice species showed differences with those
associated with captives, suggesting that root traits selected in domestication could
have significant influence on the rhizosphere microbiota composition (Shenton
et al. 2016). Recently Hernández et al. (2015) reported that in rice roots and rhizo-
sphere, the proportion of the active microbial community on the roots, greater than
that in the rhizosphere, incorporated plant-derived carbon within the time frame of
the experiment.
Results obtained from a culture-independent study on rice endophytes by
Sessitsch and coworkers (2012), surprisingly, indicate that endophytes might be
involved in the entire nitrogen cycle, as protein domains involved in N2-fixation,
denitrification, and nitrification were detected and selected genes expressed
(Hernández et al. 2015). A sequence-based metagenomic study of actinomycetes in
the soil and roots of four rice cultivars using 16S rRNA and bacterial nif H genes
clearly demonstrated the presence of genetic diversity of rice endophytic actinomy-
cetes (Mahyarudin et al. 2015).
As far as the functional approach is concerned, two novels thermostable and
thermoresistant esterases were also isolated from rice rhizosphere by functional
metagenomic screening approach (Algar et al. 2015). Watanabe and coworkers sug-
gested that G. psychrophilus and its related species preferentially grow on the
112 R. Goel et al.
anodes of rice rhizosphere and generate electricity through scientific interactions

with organisms that excrete electron donors (Kouzuma et al. 2014).
4.2.2.2 Wheat
Reports are available, which suggest that the rhizosphere of wheat plants is highly
diverse and as a result an excellent candidate for metagenomic analysis (Velazquez-
Sepulveda et al. 2012). Microbial analysis in an intensive wheat cropping system
revealed that rhizosphere bacteria changed much more than the bulk soil commu-
nity. Dominant factors influencing populations included binding to roots, plant age,
site, and planting sequence (Donn et al.2014). The identified sequences from wheat
rhizospheres showed that affiliation with Chloroflexi and Planctomycetes phyla was
100% uncultured (Naz et al. 2014).
In addition a field study was conducted by Tahir et al. (2015) to compare the
formation and bacterial communities of rhizosheaths of wheat grown under the
wheat-cotton and wheat-rice rotation. They revealed that the most predominant bac-
terial genera found, namely, Arthrobacter, Azoarcus, Azospirillum, Bacillus,
Cyanobacterium, Paenibacillus, Pseudomonas, and Rhizobium. The cloning of
metagenomic DNA from rhizospheric soil of wheat plants codes mainly for metabo-
lism and catalytic functions (~40%), including amidohydrolase, endonuclease exo-
nuclease, hydrolase, peptides, and serine protease. A total of ~17% of the clones
revealed genomic sequences with hypothetical, and ~9% were unknown function
(Hernández-León et al. 2012).
4.2.2.3 Soybean
Soybean is an important grain and oilseed crop (Qin et al. 2014). Studies conducted
to explore the microbial diversity in soybean using metagenomic approach revealed
that the composition of microbial communities changed during the developmental
stages of the plant in filing conditions (Sugiyama et al. 2014; Velazquez et al. 2016;
Meena et al. 2013c, 2014b, 2015c, d; Sindhu et al. 2016; Singh et al. 2015, 2016;
Bahadur et al. 2016a). In addition, it was reported that the composition of bacterial
communities in the rhizosphere is largely affected by soil factors (pH and salinity)
as well as soybean cultivar (Wang et al. 2014). Based on qPCR measurements,
Acidobacteria accounted for ~14% in soybean rhizosphere of the total bacterial
signals and ~17% from the 16S rRNA gene sequences (Navarrete et al. 2013).
However, Bresolin et al. (2010) reported the predominance of actinobacteria,
γ-proteobacteria, and ascomycetous divisions.
In another study, significant differences were found in the composition of bacte-
rial and fungal community structures in soybean rhizospheric soil. Ascomycota is
the most important phylum of fungi in the bulk and the rhizosphere soybean soils
(Li et al. 2010). Funneliformis mosseae and Glomus sp. were reported as the domi-
nant AM fungi in the experimental fields of soybean (Jie et al. 2013), and the
p redominant root rot pathogenic fungi in rhizosphere soil were Pythium ultimum
and Fusarium species (Cui et al. 2016).
4.2.2.4 Maize
The maize rhizosphere is a hotspot of genes, mostly originating from dominant soil
microbial groups such as Proteobacteria, providing functional capacity for the
transformation of labile and recalcitrant organic C, N, P, and S compounds (Li et al.
2014). The rhizospheres from maize exhibited both a small but significant propor-
tion of genetic variation in total bacterial population across fields and substantially
more heritable variation between replicates of the inbred within each field (Peiffer
et al. 2013; Verma et al. 2014, 2015a, b; Meena et al. 2013b, 2014a; Sharma et al.
2016; Shrivastava et al. 2016; Masood and Bano 2016).
Phylum Verrucomicrobia, Gp6 and Rhodoferax, and Gammaproteobacteria of
the genera Pseudomonas and Lysobacter were reported as the predominant genera
in the rhizosphere of maize plants (Correa-Galeote et al. 2016; Garcia-Salamanca
et al. 2013). Baudoin et al. (2009) used metagenomics based on automated ribo-
somal intergenic spacer analysis (ARISA) to determine the effect of plant growth-
promoting rhizobacterium (PGPR) Azospirillum lipoferum CRT1 on the structure of
rhizobacterial communities in field-grown maize (Rincon-Florez et al. 2013;
Raghavendra et al. 2016; Zahedi 2016; Meena et al. 2015b; Rawat et al. 2016; Yasin
et al. 2016; Bahadur et al. 2016b; Das and Pradhan 2016; Dominguez-Nunez et al.
2016).
4.2.2.5 Chickpea
Metagenomic DNA sequences from 95 root nodules from chickpea species, i.e.,
C. reticulatum, C. echinospermum, and C. arietinum, grown in India revealed that
the domestication of chickpea has led to parallel shifts in bacterial genome structure
(Prakash et al. 2007). Recently a tomato mottle mosaic virus and hop stunt viroid on
chickpea were first time reported in Europe using bioinformatics approaches for
viral metagenomics (Pirovano et al. 2014).
4.2.2.6 Vegetables
Several studies were conducted to know the microbial populations of both benefi-
cial and pathogenic on various vegetable crops. In another study conducted by Yu
and coworkers, it was suggested that infection by Cryptosporidium, a zoonotic pro-
tozoan parasite that causes cryptosporidial enteritis, can be mediated via farm soil
and vegetables (Hong et al. 2014). Metagenomic analysis using pyrosequencing
indicated that the majority of leaf vegetable-associated bacteria were members of
the Proteobacteria and Bacteroidetes (Jackson et al. 2013). The metagenomic
114 R. Goel et al.
approach used to detect of Shiga toxin-producing Escherichia coli on fresh bagged

spinach was very informative for the dynamics of microbial communities during the
enrichment process. The key genera found in this case are Pseudomonas, Pantoea,
and Exiguobacterium (Leonard et al. 2015). Several other studies were also con-
ducted to reveal the microbial diversity associated with vegetables like tomato (Val-
Moraes et al. 2013), lettuce (Debode et al. 2016; Li et al. 2016; Jackson et al. 2013),
peppers, strawberries (Leff and Fierer 2013), and tomato (Ottesen et al. 2013;
Meena et al. 2015e, 2016c, d, e; Saha et al. 2016a, b; Yadav and Sidhu 2016; Teotia
et al. 2016). Besides the above-discussed agriculturally important crops, interesting
metagenomic studies were also carried out different scientific groups which are
summarized in Table 4.1.
Table 4.1 List of some important metagenomic studies (not included in the text) reported in
different crops and their rhizospheres
Plant/crop Aim of the study References
Aloe vera Study of endophytic bacteria Akinsanya et al.
(2015)
Apple orchard soil Novel bifunctional enzymes involved in antibiotic Donato et al.
resistance (2010)
Artemisia Bacterial community study El-Badry (2016)
herba-alba
Banana (Musa Study of rhizosphere microbiome for biological Xue et al. (2015)
species) control of Panama disease
Capparis spinosa Bacterial community study El-Badry (2016)
Chiliadenus Bacterial community study El-Badry (2016)
iphionoides
Cowpea Characterization of cowpea-infecting viruses Palanga et al.
(2016)
Cucumber roots Soil-root gene catalogue and phylogenetic analysis Ofek-Lalzar et al.
(2014)
Grapevine (Vitis Grapevine-associated microbiota Zarraonaindia et al.
species) (2015)
Red kidney beans Diazotroph diversity Suyal et al. (2014)
Rumex patientia Rhizosphere and non-rhizosphere bacterial Qi et al. (2012)
community composition
Sugarcane Unique and conserved biomass-degrading enzymes Mhuantong, et al.
among lignocellulolytic microbial communities (2015)
Strawberry Pathogen identifications Xu et al. (2015)
Thymus zygis Bacterial diversity Pascual et al.
(2016)
Transgenic Analyses of root-associated soil Chauhan et al.
switchgrass (2014)
Wild and Structure and function of the bacterial root Bulgarel et al.
domesticated barley microbiota (2015)
Wild mustard Leaf and root microbiomes Wagner et al.
(2016)
4.3 Our Leads
Our group has previously highlighted the prevalence of csp (Premalatha et al. 2009)
and nif H genes (Soni and Goel 2010; Soni et al. 2016) from cold Himalayan envi-
ronments. In silico study of sequenced shotgun clones reveals nif H homology with
several other genes which are not directly involved in nitrogen fixation but belong
to bacterial genera which are known for nitrogen-fixing ability. A hypothesis was
proposed that genes like nif H may evolve from their nearest genes or adjacent
regions and in due course become specific in their functions (Soni and Goel 2010).
To the best of our knowledge, the first major metagenomic effort that revealed the
presence of diverse nitrogen-fixing microbial assemblages in indigenous red kidney
bean (RKB) rhizospheric soil, which can further be explored for improved crop
yield/productivity (Suyal et al. 2014).
4.4 Conclusions
We all believe that microbes are very precious and, if explored judiciously, can
contribute to the sustainable agricultural development. Advance approaches like
metagenomics are revealing interactions between plant and their microbial partner
in exceptionally detail. However, without a suitable methodology for confirming the
reliability of metagenomic analyses, assessing whether the presence and activity of
microorganisms are correctly evaluated is not possible.
Acknowledgment The work mentioned in this chapter from author group was supported by the
National Bureau of Agriculturally Important Microorganisms; India (NBAIM/ICAR) grant to
R. G.
References
solubilizing microorganisms for sustainable agriculture. Springer, India, pp 293–313. https://
doi.org/10.1007/978-81-322-2776-2_21
Akinsanya MA, Goh JK, Lim SP, Ting AY (2015) Metagenomics study of endophytic bacteria in
Aloe vera using next-generation technology. Genom Data 6:159–163
Alagukannan, Kumar A (2015) Role of effective microorganisms (em) in sustainable agriculture –
a review and recommendations. Int J Scient Res 4:9
Algar E, Ribitsch D, Antonio LJ, Ramos-Solano B, Schwab H, Gutierrez-Mañero FJ, Garcia-
Villaraco A (2015) Identification and characterization of two novel thermostable and thermo-
resistant esterases isolated from rice rhizosphere by activity- based on metagenomic screening.
Int J Curr Microbiol App Sci 4(12):413–433
Altieri MA (2004) Linking ecologists and traditional farmers in the search for sustainable agricul-
ture. Front Ecol Environ 2:35–42
116 R. Goel et al.
Arjun JK, Harikrishnan K (2011) Metagenomic analysis of bacterial diversity in the rice rhizo-
sphere soil microbiome research article. Biotechnol Bioinformatics Bioeng 1(3):361–367
India, pp 225–266. https://doi.org/10.1007/978-81-322-2776-2_18
219431
Barea JM (2015) Future challenges and perspectives for applying microbial biotechnology in sus-
tainable agriculture based on a better understanding of plant-microbiome interactions. J Soil
Sci Plant Nutr 15(2):261–282
Barea JM, Pozo MJ, Azcon R, Azcon-Aguilar C (2005) Microbial co-operation in the rhizosphere.
J Exp Bot 56:1761–1778
Barret M, Morrissey JP, Gara FO (2011) Functional genomics analysis of plant growth-promoting
rhizobacterial traits involved in rhizosphere competence. Biol Fertil Soils 47:729–743
Baudoin E, Couillerot O, Spaepen S, Moënne-Loccoz Y, Nazaret S (2009) Applicability of the
16S-23S rDNA internal spacer for PCR detection of the phytostimulatory PGPR inoculant
Azospirillum lipoferum CRT1 in field soil. J Appl Microbiol 108:25–38
Bhattacharyya P, Roy KS, Dasa M, Raya S, Balachandar D, Karthikeyan S, Nayak AK, Mohapatra
T (2016) Elucidation of rice rhizosphere metagenome in relation to methane and nitrogen
metabolism under elevated carbon dioxide and temperature using whole genome metagenomic
approach. Sci Total Environ 542:886–898
Boubakri H, Beuf M, Simonet P, Vogel TM (2006) Development of metagenomic DNA shuffling
for the construction of a xenobiotic gene. Gene 375:87–94
Bresolin JD, Bustamante MMC, Krüger RH, Silva MRSS, Perez KS (2010) Structure and compo-
sition of bacterial and fungal community in soil under soybean monoculture in the Brazilian
Cerrado. Braz J Microbiol 41:391–403
Bulgarel D, Garrido-Oter R, Philipp CM, Weiman A, Dröge J, Pan Y, McHardy AC, Schulze-Lefert
P (2015) Structure and function of the bacterial root microbiota in wild and domesticated bar-
ley. Cell Host Microbe 17:392–403
Chauhan A, Smartt A, Wang J, Utturkar S, Frank A, Bi M, Liu J, Williams D, Xu T, Eldridge M,
Arreaza A, Rogers A, Gonzalez HC, Layton AC, Baxter HL, Mazarei M, De Bruyn JM, Stewart
CN Jr, Brown SD, Hauser LJ, Sayler GS (2014) Integrated metagenomics and metatran-
scriptomics analyses of root-associated soil from transgenic switchgrass. Genome Announc
2:e00777–e00714
Correa-Galeote D, Bedmar EJ, Fernández-González AJ, Arone GJ (2016) Bacterial communities
in the rhizosphere of Amilaceous maize (Zea mays L.) as assessed by pyrosequencing. Front
Plant Sci 7:1016
Cui J, Wang Y, Han J, Cai B (2016) Analyses of the community compositions of root rot patho-
genic fungi in the soybean rhizosphere soil. Chil J Agric Res 76(2):179–187
da Rocha UN, van Overbeek L, van Elsas JD (2009) Exploration of hitherto-uncultured bacteria
from the rhizosphere. FEMS Microbiol Ecol 69:313–328
Daniel R (2004) The soil metagenome – a rich resource for the discovery of novel natural products.
Curr Opin Biotechnol 15:199
Daniel R (2005) The metagenomics of soil. Nat Rev Microbiol 3:470–478
fertility and health. In: Meena VS, Maurya BR, Verma JP, Meena RS (eds) Potassium solu-
bilizing microorganisms for sustainable agriculture. Springer, India, pp 281–291. https://doi.
org/10.1007/978-81-322-2776-2_20
Debode J, De Tender C, Soltaninejad S, Van Malderghem C, Haegeman A, Van der Linden I,

Cottyn B, Heyndrickx M, Maes M (2016) Chitin mixed in potting soil alters lettuce growth,
the survival of zoonotic bacteria on the leaves and associated rhizosphere microbiology. Front
Microbiol 7:565
Potassium solubilizing microorganisms for sustainable agriculture. Springer, India, pp 77–98.
https://doi.org/10.1007/978-81-322-2776-2_6
Donato JJ, Moe LA, Converse BJ, Smart KD, Berklein PS, McManus, Handelsman J (2010)
Metagenomic analysis of apple orchard soil reveals antibiotic resistance genes encoding pre-
dicted bifunctional proteins. Appl Environ Microbiol 76(13):4396–4401
Donn S, Kirkegaard JA, Perera G, Richardson AE, Watt M (2015) Evolution of bacterial communi-
ties in the wheat crop rhizosphere. Environ Microbiol 17(3):610–621
microorganisms. In: Meena VS, Maurya BR, Verma JP, Meena RS (eds) Potassium solubi-
lizing microorganisms for sustainable agriculture. Springer, India, pp 267–280. https://doi.
org/10.1007/978-81-322-2776-2_19
El-Badry MA (2016) Bacterial community metagenomic and variation of some medicinal plant
rhizosphere collected form Sinai. SCIREA J Agric 1(1):16
Falkowski P, Scholes R, Boyle E, Canadell J, Canfield D, Elser J, Gruber N, Hibbard K, Högberg
P, Linder S, Mackenzie FT, Moore B, Pedersen T, Rosenthal Y, Seitzinger S, Smetacek V,
Steffen W (2000) The global carbon cycle: a test of our knowledge of earth as a system. Science
290:291–296
Finzi AC, Austin AT, Cleland EE, Frey S, Houlton BZ, Wallenstein MD (2011) Responses and
feedbacks of coupled biogeochemical cycles to climate change: examples from terrestrial eco-
systems. Front Ecol Environ 9:61–67
García-Salamanca A, Molina-Henares MA, van Dillewijn P, Solano J, Pizarro-Tobías P, Roca A,
Duque E, Ramos JL (2013) Bacterial diversity in the rhizosphere of maize and the surrounding
carbonate-rich bulk soil. Microb Biotechnol 6:36–44
Harwani D (2013) Bacteria eating pollution and generating electricity. Int J Pharm Bio Sci Oct
4(4):(B) 996–1002
Hernández-León R, Martínez-Trujillo M, Valencia-Cantero E et al (2012) Construction and char-
acterization of a metagenomic DNA library from the rhizosphere of wheat (Triticum aestivum).
Phyton Int J Exp Bot 81:133–137
Hernández M, Marc GD, Yuan Q et al (2015) Different bacterial populations associated with
the roots and rhizosphere of Rice incorporate plant-derived carbon. Appl Environ Microbiol
81(6):2244–2253
Hill RT, Fenical W (2010) Pharmaceuticals from marine natural products: surge or ebb. Curr Opin
Biotechnol 21(6):777–779
Hong S, Kim K, Yoon S, Park WY, Sim S, Yu JR (2014) Detection of Cryptosporidium parvum in
environmental soil and vegetables. J Korean Med Sci 29:1367–1371
Jackson CR, Randolph KC, Osborn SL, Tyler HL (2013) Culture dependent and independent
analysis of bacterial communities associated with commercial salad leaf vegetables. BMC
Microbiol 13:274
Jacquiod S, Franqueville L, Cécillon S, Vogel TM, Simonet P (2013) Soil bacterial community
shifts after chitin enrichment: an integrative metagenomic approach. PLoS One 8:e79699
9(2):1211–1221
118 R. Goel et al.
Jie W, Liu X, Cai B (2013) Diversity of rhizosphere soil arbuscular mycorrhizal fungi in various
soybean cultivars under different continuous cropping regimes. PLoS One 8(8):e72898
Johan HJ, Leveau (2007) The magic and menace of metagenomics: prospects for the study of plant
growth-promoting rhizobacteria. Eur J Plant Pathol. (2007 119:279–300
Kopke B, Wilms R, Engelen B, Cypionka H, Sass H (2005) Microbial diversity in coastal subsur-
face sediments: a cultivation approach using various electron acceptors and substrate gradients.
Appl Environ Microb 71:7819–7830
Kouzuma A, Kaku N, Watanabe K (2014) Microbial electricity generation in rice paddy fields:
recent advances and perspectives in rhizosphere microbial fuel cells. Appl Microbiol Biotechnol
98:9521–9526
org/10.1007/s00344-016-9663-5
Lakhdari O, Cultrone A, Tap J, Gloux K, Bernard F, Ehrlich SD, Lefèvre F, Doré J, Blottière HM
(2010) Functional metagenomics: a high throughput screening method to decipher microbiota-
driven NF-kappaB modulation in the human gut. PLoS One 5(9):e13092
Leff JW, Fierer N (2013) Bacterial communities associated with the surfaces of fresh fruits and
vegetables. PLoS One 8(3):e59310
Leonard SR, Mammel MK, Lacher DW et al (2015) Application of metagenomic sequencing to
food safety: detection of Shiga toxin-producing Escherichia coli on fresh bagged spinach. Appl
Environ Microbiol 81(23):8183–8191
Li C, WeidongXL YK, Wang WJ (2010) Effect of monoculture soybean on soil microbial com-
munity in the Northeast China. Plant Soil 330:423
Li X, Rui J, Xiong J, Li J, He Z, Zhou J, Yannarell AC, Mackie RI, Wang S (2014) Functional
Potential of Soil Microbial Communities in the Maize Rhizosphere. PLoS ONE 9(11):e112609
Li K, Li Z, Yang Q (2016) Improving light distribution by zoom lens for electricity savings in a
plant factory with light-emitting diodes. Front Plant Sci 7:92
Mahyarudin, Rusmana I, Yulin L (2015) Metagenomic of Actinomycetes based on 16S rRNA
and nifH genes in soil and roots of four Indonesian rice cultivars using PCR-DGGE. H J Bios
22:113e121
doi.org/10.1007/978-81-322-2776-2_10
jclepro.2015.04.044
Springer, India, pp 1–20. https://doi.org/10.1007/978-81-322-2776-2_1
Mhuantong W, Charoensawan V, Kanokratana P, Tangphatsornruang S, Champreda V (2015)
Comparative analysis of sugarcane bagasse metagenome reveals unique and conserved
biomass- degrading enzymes among lignocellulolytic microbial communities. Biotechnol
Biofuels 8:16
Morel MA, Braña V, Castro-Sowinski S (2012) In: Aakash G (ed) Legume crops, importance and
use of bacterial inoculation to increase production. Plant Crop. Intech, Rijeka, pp 217–240
Navarrete AA, Kuramae EE, de Hollander M, Pijl AS, van Veen JA, Tsai SM (2013) Acidobacterial
community responses to agricultural management of soybean in Amazon forest soils. FEMS
Microbiol Ecol 83:607–621
Naz I, Mirza MS, Bano A (2014) Molecular characterization of rhizosphere bacterial commu-
nities associated with wheat (triticum aestivum l.) cultivars at flowering stage. J Ani Pl Sci
24(4):1123–1134
120 R. Goel et al.
Noble AD, Ruaysoongnern S (2010) The nature of sustainable agriculture. In: Dixon R, Tilston E
(eds) Soil microbiology and sustainable crop production. Springer Science and Business Media
B.V, Berlin, pp 1–25
Ofek-Lalzar M, Sela N, Goldman-Voronov M, Green SJ, Hadar Y, Minz D (2014) Niche and host-
associated functional signatures of the root surface microbiome. Nat Commun 5:4950
Ottesen AR, González Peña A, White JR, Pettengill JB, Li C, Allard S, Hill T, Evans P, Strain E,
Musser S, Knight R, Brown E (2013) Baseline survey of the anatomical microbial ecology of
an important food plant: Solanum lycopersicum (tomato). BMC Microbiol 13:114
Palanga E, Filloux D, Martin DP, Fernandez E, Gargani D, Ferdinand R, Zabré J, Bouda Z, Neya
JB, Sawadogo M, Traore O, Peterschmitt M, Roumagnac P (2016) Metagenomic-based screen-
ing and molecular characterization of cowpea-infecting viruses in Burkina Faso. PLoS One
11(10):e0165188
Pascual J, Blanco S, García-López M, García-Salamanca A, Bursakov SA, Genilloud O et al
(2016) Assessing bacterial diversity in the rhizosphere of thymus zygis growing in the sierra
Nevada National Park (Spain) through culture-dependent and independent approaches. PLoS
One 11(1):e0146558
Patrick DS, Handelsman J (2005) Metagenomics for studying unculturable microorganisms: cut-
ting the Gordian knot. Genome Biol 6:229
Peiffer JA, Spor A, Koren O, Jinb Z, Tringed SG, Dangle JL, Bucklera ES, Ley RE (2013)
Diversity and heritability of the maize rhizosphere microbiome under field conditions. PNAS
110(16):6548–6553
Pham VHT, Kim J (2012) Cultivation of unculturable soil bacteria. Trends Biotechnol
30(9):475–484
Pirovano W, Miozzi L, Boetzer M, Pantaleo V (2014) Bioinformatics approaches for viral metage-
nomics in plants using short RNAs: model case of study and application to a Cicer arietinum
population. Front Microbiol 5:790
agriculture. Springer, India, pp 327–331. https://doi.org/10.1007/978-81-322-2776-2_23
Prakash O, Verma M, Sharma P, Kumar M, Kumari K, Singh A, Kumari H, Jit S, Gupta SK,
Khanna M, Lal R (2007) Polyphasic approach of bacterial classification- an overview of recent
advances. Ind J Microbiol 47:98–108
Premalatha K, Soni R, Khan M, Marla SS, Goel R (2009) Exploration of csp gene(s) from tem-
perate and glacier soils of Indian Himalaya and in silico analysis of encoding proteins. Curr
Microbiol 58(4):343–348
ture. Springer, India, pp 111–125. https://doi.org/10.1007/978-81-322-2776-2_8
Qi X, Wang E, Xing M, Zhao W, Chen X (2012) Rhizosphere and non-rhizosphere bacterial com-
munity composition of the wild medicinal plant Rumex patientia. World J Microbiol Biotechnol
28:2257–2265
Qin N, Yang F, Li A, Prifti E, Chen Y, Shao L, Guo J, Le Chatelier E, Yao J, Wu L, Zhou J, Ni S, Lin
L, Pons N, Batto JM, Kennedy SP, Leonard P, Yuan C, Ding W, Chen Y, Hu X, Zheng B, Qian
G, Xu W, Dusko Ehrlich S, Zheng S, Li L (2014) Alterations of the human gut microbiome in
liver cirrhosis. Nature 513(7516):59–64
Raghavendra MP, Nayaka NC, Nuthan BR (2016) Role of rhizosphere microflora in potas-
sium solubilization. In: Meena VS, Maurya BR, Verma JP, Meena RS (eds) Potassium sol-
ubilizing microorganisms for sustainable agriculture. Springer, India, pp 43–59. https://doi.
org/10.1007/978-81-322-2776-2_4
Rincon-Florez VA, Lilia CC, Peer MS (2013) Culture-independent molecular tools for soil and
rhizosphere microbiology. Diversity 5:581–612
Saha M, Maurya BR, Bahadur I, Kumar A, Meena VS (2016a) Can potassium-solubilising bac-
teria mitigate the potassium problems in India? In: Meena VS, Maurya BR, Verma JP, Meena
RS (eds) Potassium solubilizing microorganisms for sustainable agriculture. Springer, India,
pp 127–136. https://doi.org/10.1007/978-81-322-2776-2_9
of potassium solubilizing bacteria (KSB) from indo-gangetic plains of India. Biocatal Agric
Schmeisser C, Steele H, Streit WR (2007) Metagenomics, biotechnology with non-culturable
microbes. Appl Microb Biotechnol 75:955–962
Sessitsch A, Hardoim P, Döring J, Weilharter A, Krause A, Woyke T, Mitter B, Hauberg-Lotte L,
Friedrich F, Rahalkar M, Hurek T, Sarkar A, Bodrossy L, van Overbeek L, Brar D, van Elsas
JD, Reinhold-Hurek B (2012) Functional characteristics of an endophyte community coloniz-
ing rice roots as revealed by metagenomic analysis. Mol Plant-Microbe Interact 25:28–36
Sharma R, Grover A, Kapardar RK, Sharma R (2005) Unculturable’ bacterial diversity: an
untapped resource. Curr Sci 89(1):72–77
Shenton M, Iwamoto C, Kurata N, Ikeo K (2016) Effect of wild and cultivated rice genotypes on
rhizosphere bacterial community composition. Rice 9:42
Singh BK & Macdonald CA (2010) Drug discovery from uncultivable microorganisms. Drug.
Discov. Today 15, 792–799
Soni R, Goel R (2010) Triphasic approach for assessment of bacterial population in different soil
systems. Ekologija 56(3–4):99–104
Soni R, Suyal DC, Sai S, Goel R (2016) Exploration of nifH gene through soil metagenomes of the
western Indian Himalayas. 3 Biotech 6(1)
Spence C, Alff E, Johnson C, Ramos C, Donofrio N, Sundaresan V, Bais H (2014) Natural rice
rhizospheric microbes suppress rice blast infections. BMC Plant Biol 14:130
Stewart EJ (2012) Growing Unculturable bacteria. J Bacteriol 194(16):4151–4160
Stobbe AH, Roossinck MJ (2014) Plant virus metagenomics: what we know and why we need to
know more. Front Plant Sci 5
Sugiyama A, Ueda Y, Zushi T, Takase H, Yazaki K (2014) Changes in the bacterial Community of
Soybean Rhizospheres during growth in the field. PLoS One 9(6):e100709
122 R. Goel et al.
Susannah GT, Edward MR (2005) Metagenomics: DNA sequencing of environmental samples.

Nat Rev Gen 6:805–814
Suyal DC, Yadav A, Shouche Y, Goel R (2014) Diversified diazotrophs associated with the rhi-
zosphere of Western Indian Himalayan native red kidney beans (Phaseolus vulgaris L.). 3.
Biotech 5(4):433–441
Tahir M, Mirza MS, Hameed S, Dimitrov MR, Smidt H (2015) Cultivation-based and molecular
assessment of bacterial diversity in the Rhizosheath of wheat under different crop rotations.
PLoS One 10(6):e0130030
Tamaki H, Sekiguchi Y, Hanada S, Nakamura K, Nomura N, Matsumura M, Kamagata Y (2005)
Comparative analysis of bacterial diversity in freshwater sediment of a shallow eutrophic lake
by molecular and improved cultivation-based techniques. Appl Environ Microb 71:2162–2169
Tian BY, Yi C, Zhang KQ (2015) Metagenomic insights into communities, functions of endo-
phytes, and their associates with infection by root-knot nematode, Meloidogyne incognita, in
tomato roots. Sci Rep 5:17087
Tikhonovich, Provorov (2011) Microbiology is the basis of sustainable agriculture: an opinion.
Ann Appl Biol 159:155–168
Torsvik V, Daae FL, Sandaa RA, Øvreås L (2002) Microbial diversity and function in soil: from
genes to ecosystems. Curr Opin Microbiol 5:240–245
Tringe SG, von Mering C, Kobayashi A, Salamov AA, Chen K, Chang HW, Podar M, Short JM,
Mathur EJ, Detter JC, Bork P, Hugenholtz P, Rubin EM (2005) Comparative metagenomics of
microbial communities. Science 308:554–557
Turner TR, Ramakrishnan K, Walshaw J, Heavens D, Alston M, Swarbreck D, Osbourn A, Grant
A, Poole PS (2013) Comparative metatranscriptomics reveals kingdom level changes in the
rhizosphere microbiome of plants. ISME J 7:2248–2258
Val-Moraes SP, Pedrinho EAN, Lemos EGM, Carareto-Alves LM (2013) Molecular identifica-
tion of fungal communities in a soil cultivated with vegetables and soil suppressiveness to
Rhizoctonia solani. Appl Environ Soil Sci 2013:1–7
Vartoukian SR, Palmer RM, Wade WG (2010) Strategies for culture of ‘unculturable’ bacteria.
FEMS Microbiol Lett 309:1–7
Vartoukian SR, Adamowska A, Lawlor M, Moazzez R, Dewhirst FE, Wade WG (2016) In vitro
cultivation of “Unculturable” oral bacteria, facilitated by Community Culture and Media
Supplementation with siderophores. In: Wen Z (ed) PLoS ONE. 11(1):e0146926
Velazquez-Sepulveda I, Orozco-Mosqueda MC, PrietoBarajas CM, Santoyo G (2012) Bacterial
diversity associated with the rhizosphere of wheat plants (Triticum aestivum): toward a metage-
nomic analysis. Phyton Int J Exp Bot 81:81–87
84(8):914–919
Wade W (2002) Unculturable bacteria—the uncharacterized organisms that cause oral infections.
J R Soc Med 95(2):81–83
Wagner MR, Lundberg DS, del Rio TG, Tringe SG, Dangl JL, Mitchell-Olds T (2016) Host geno-
type and age shape the leaf and root microbiomes of a wild perennial plant. Nat Commun
7:12151
Wang H, Wang SD, Jiang Y, Zhao SJ, Chen WX (2014) Diversity of rhizosphere bacteria associ-
ated with different soybean cultivars in two soil conditions. Soil Sci Plant Nutr 60(5):630–639
Xu X, Passey T, Wei F, Saville R, Harrison RJ (2015) Amplicon-based metagenomics identified
candidate organisms in soils that caused yield decline in strawberry. Hortic Res 2:15022
Xue C, Ryan Penton C, Zongzhuan S, Zhang R, Huang Q, Li R, Ruan Y, Shen Q (2015)
Manipulating the banana rhizosphere microbiome for biological control of Panama disease.
Sci Rep 5:11124
Yadav BK, Sidhu AS (2016) Dynamics of potassium and their bioavailability for plant
nutrition. In: Meena VS, Maurya BR, Verma JP, Meena RS (eds) Potassium solubiliz-
ing microorganisms for sustainable agriculture. Springer, India, pp 187–201. https://doi.
org/10.1007/978-81-322-2776-2_14
Yasin M, Munir I, Faisal M (2016) Can Bacillus spp. enhance K+ uptake in crop species. In: Meena
VS, Maurya BR, Verma JP, Meena RS (eds) Potassium solubilizing microorganisms for sustain-
able agriculture. Springer, India, pp 163–170. https://doi.org/10.1007/978-81-322-2776-2_12
crop species. In: Meena VS, Maurya BR, Verma JP, Meena RS (eds) Potassium solubi-
org/10.1007/978-81-322-2776-2_3
Zarraonaindia I, Owens SM, Weisenhorn P, West K, Hampton-Marcell J, Lax S, Bokulich NA,
Mills DA, Martin G, Taghavi S, van der Lelie D, Gilbert JA (2015) The soil microbiome influ-
ences grapevine-associated microbiota. MBio 6(2):e02527–e02514. https://doi.org/10.1128/
mBio.02527-14
Chapter 5
Induction of Anatomical, Enzymatic,
and Molecular Events in Maize by PGPR
Under Biotic Stress
Yachana Jha
Abstract The rhizospheric Bacillus megaterium and endophytic Pseudomonas

aeruginosa are isolated from rhizosphere soil and root of Suaeda nudiflora wild
mosque plant, respectively, and have been inoculated in maize plant. The associa-
tion of these isolates within maize root has been ensured by 2,3,5-triphenyl tetrazo-
lium chloride (TTC) staining of root sections. The study has been conducted to
analyse the effect of these bacteria alone or in combination on maize for the induc-
tion of defense related enzymes like phenylalanine ammonia lyase (PAL) and β-1,
1, 3-glucanase in the presence of pathogen Aspergillus niger. These isolates are also
analyzed for its influence on the plant cell wall component as lignin, lignin mono-
mers, and xylem. The results show that these isolates not only induce cell wall
component but also enhance defense-related enzymes but do not have any effect on
xylem-like tissue. The isolates also cause differential induction of defense-related
gene in infected maize plants during RNA profiling. On the basis of all above
results, it indicates that the ecofriendly PGPR can serve as a simple and cheap tool
for combating infection in crops as well as for increasing productivity by its growth-
promoting ability.
Keywords PGPR · Phenylalanine ammonia lyase · β-1 · 3-Glucanase · Lignin ·

Lignin monomers · RNA profiling · Differential gene induction
5.1 Introduction
Plants have to deal with numerous multifaceted types of interactions involving sev-
eral environmental factors. So during evolution, plants have developed specific
mechanisms permitting them to adapt and survive in a stressful environment. Biotic
and abiotic stresses induce a disturbance in plant metabolism by inferring physio-
logical events (Massad et al. 2012) and altering its physiology and finally the
Y. Jha (*)
N. V. Patel College of Pure and Applied Sciences, S. P. University,
V V Nagar, Anand, Gujarat, India

https://doi.org/10.1007/978-981-10-8402-7_5
126 Y. Jha
Fig. 5.1 The effects of

biotic stress on plant Biotic stress
survival
Biotic Stress Response
Resistance Susceptibility
Acclimation Senescence
Growth Death
Survival
productivity (Shao et al. 2008). The sudden change in ideal environmental condition
causes stress in plant and disturbs the initial homeostatic state of the plant and its
physiology. Plant stress can be divided into two primary categories, i.e., abiotic
stress is a physical (e.g., light, temperature) or chemical insult that the environment
may impose on a plant and biotic stress is a biological insult (e.g., insects, disease)
to which a plant may be exposed during its lifetime. For sustainable agriculture,
crop production needs to be equipped with disease resistance, drought tolerance,
heavy metal stress tolerance, salinity tolerance, and better nutritional value (Meena
et al. 2013a; Bahadur et al. 2014; Maurya et al. 2014; Jat et al. 2015; Kumar et al.
2015, 2016b; Ahmad et al. 2016).
To achieve these desired properties in crop continuously, one possible way is to
use soil microorganisms (bacteria, fungi, algae, etc.) that enhance the nutrient uptake
ability (Jha and Subramanian 2014a) and improve health and water use efficacy
(Armada et al. 2014) as well as resistance against many pathogens (Patel et al. 2011).
The increasing concern arising in the public working on plant stress is the continu-
ous variation in environment induced by worldwide climate change. In the next eras,
the climate could probably be dry and warm in some areas of the world, while it
could be more humid in other parts. This change will lead to shifts in biomes result-
ing in increased stress that will affect the relationship between pests, diseases, and
crops. Several examples can be considered: (i) the microbial communities living on
the surface of the plant, a natural barrier to withstand external attacks, may be
affected by variations in temperature and humidity and therefore not able to counter-
act pathogens; (ii) new pathogens migrating could develop faster than the ability of
plants to generate new defense reactions toward them, thereby leading to dramatic
yield losses (Meena et al. 2015f, 2016a; Parewa et al. 2014; Dotaniya et al. 2016;
Jaiswal et al. 2016; Jha and Subramanian 2016a; Kumar et al. 2016a) (Fig. 5.1).
5 Induction of Anatomical, Enzymatic, and Molecular Events in Maize by PGPR… 127
Plants depend on the close interaction with their natural environment and respond
to a multitude of factors, ranging from changes in climatic conditions to the interac-
tions with a range of potential pathogens, by adjusting their metabolism. Among
these potential soil microorganisms, the soil bacteria with some advantageous
effects on plant growth, environmental health, and soil properties is known as plant
growth-promoting rhizobacteria (Jha and Subramanian 2016b). Plant growth-
promoting rhizobacteria colonize in/on plant roots, improve plant growth promotion
activity, and help plants resist the harsh external environment by various mecha-
nisms without contaminating the environment (Prakash and Verma 2016; Meena
et al. 2015e, 2016b; Priyadharsini and Muthukumar 2016; Kumar et al. 2017;
Bahadur et al. 2016b; Das and Pradhan 2016; Dominguez-Nunez et al. 2016).
5.2 Isolation and Identification of Bacterial Isolates
The rhizosphere is the most active ecological niche where inter- and intraspecies
communications of microorganisms, such as fungi, bacteria, and protozoa, persist
due to the occurrence of a rich and diverse microbial food source (Bais et al. 2006).
PGPR influence the induction of genes in plants under various stresses and can also
modulate the population of rhizobacteria around the root of the plant. The rhizo-
sphere bacterial inhabitants play a significant role in maintaining healthy roots by
enhancing nutrient uptake and developing a tolerance for environmental stress. The
use of PGPR as biofertilizer can increase plant nutrient status by associative nitro-
gen fixation, phosphorus and potassium solubilization, and siderophore production.
It can enhance the bioavailability of such nutrients by changing the absorptivity and
converting nutrients in the rhizosphere (Jha and Subramanian 2014b; Meena et al.
2015a, b, 2016c, 2016e; Raghavendra et al. 2016; Zahedi 2016; Rawat et al. 2016;
Yasin et al. 2016; Masood and Bano 2016; Teotia et al. 2016).
Two bacterial strains are isolated from rhizosphere soil and root of Suaeda nudi-
flora wild mosque plant from Khambhat near seashore of Gujarat having high levels
of salt concentration as our previously published method (Jha et al. 2011a), and the
soil sample is tested in SICART (Sophisticated Instrumentation Centre for Applied
Research and Testing) laboratory by extracted water sample method. The soil pos-
sesses the following physiochemical properties: pH 6.58, electrical conductivity
1480 μS/cm, salinity 8.6%, nitrate 112.5 mg kg−1, chloride 128 mg kg−1, sulfate
155 mg kg−1, ammonia nitrogen 23.3 mg kg−1, CEC:3 cmol, and organic carbon
5500 mg kg−1. Initially, the bacteria have been isolated in the semisolid NFb
medium, and the white veil-like pellicle formed below the surface of semisolid NFb
medium has been transferred to NFb agar plates. The pure culture that has been
maintained on the NFb agar plate indicates that isolates have the ability for nitrogen
fixation. In NFb agar plates containing bromothymol blue, a pH indicator dye is
used for isolation of bacteria. The change in plate color from green to blue indicates
that the medium pH shifts toward alkalinity due to the growth of bacteria that have
the ability for nitrogen fixation (Saha et al. 2016a, b; Yadav and Sidhu 2016; Meena
128 Y. Jha
1.5Kb (1500bp) 16S amplified fragment
1000bp band
100bp ladder
Fig. 5.2 Agarose gel showing the amplified 16S rDNA of isolates: first lane is of 16S rDNA of
Pseudomonas aeruginosa, second lane is 100 bp marker, and third lane is of 16S rDNA of Bacillus
megaterium having molecular weight of ~ 1500 bp each from the right-hand side
et al. 2013c, 2015d, 2016d; Verma et al. 2015b; Singh et al. 2015, 2016; Bahadur
et al. 2016a).
Molecular identification of bacterial isolates has been done by isolation of total
genomic DNA from the isolates and PCR amplification of the DNA with 16S rDNA-
specific primers 16S F: 5′AGAGTTTGATCCTGGCTCAG3′ and 16S R:
5′AGGTTACCTTGTTACGACTT3′ followed by sequencing as our published
method (Jha and Subramanian 2013a). PCR amplicons of 16S rDNA of ~ 1500 bp
are obtained for both the isolates as discrete bands in agarose gel (Fig. 5.2).
The phylogenetic trees have been constructed using BLAST software by com-
paring the 16S rDNA sequence of isolates and related genera from a database using
the neighbor-joining (NJ) algorithm and maximum likelihood (ML) method. The
isolate has been identified by nucleotides homology and phylogenetic analysis as
Pseudomonas aeruginosa (GenBank Accession Number: JQ790515) and Bacillus
megaterium (GeneBank Accession Number: JQ790514). These isolates are non-
symbiotic bacteria, one of which is Gram-positive endospore-forming bacteria,
noncapsulated and motile with peritrichous flagella (~ 2.6 × 1.2 μm), and the other
is Gram-negative bacteria, with non-sporulating short rods and motile with polar
flagella.
5.3 PGPR As a Biocontrol Agent
5.3.1 In Vitro Effect
Plants possess a group of chemical and physical barriers to avoid nearly all unfavor-
able plant biotic stress or interactions. The chemical constituent of the constitutive
defense is to inhibit enzymatic functions of pathogens or rapid accumulation of
secondary metabolites or protein which inhibits the growth of the pathogen or toxic
metabolite which kills the pathogen. Plants also construct physical obstacles like
cuticle and cell walls to avoid harmful biotic interactions, and depending on the
species and the environment in which plants grow, there are different levels and
forms of barriers (Verma et al. 2014, 2015a; Meena et al. 2013b, 2014a, b, 2015c;
Sharma et al. 2016; Shrivastava et al. 2016; Velazquez et al. 2016; Sindhu et al.
2016).
So for efficient response to biotic stress, plants have developed a system that
permits rapid and targeted responses. PGPR are native to soil as well as root can
play important role as biocontrol agent for plant protection. PGPR which reduces
the frequency or severity of plant diseases is regularly mentioned to as biocontrol
agents. The antagonistic activities of rhizospheric bacteria are as follows: (i) synthe-
sis of hydrolytic enzymes, as glucanases, chitinases, proteases, and lipases, that can
hydrolyze cells of pathogenic microorganisms (Maksimov et al. 2011), (ii) competi-
tion for proper colonization of niches at the surface of plant root and nutrients
(Kamilova et al. 2006), (iii) regulation of plant stress hormone in response to stress
imposed by the infection (Van Loon 2007), and (iv) production of antibiotics and
siderophores which antagonized the growth of plant pathogens.
Antibiotics are generally low molecular weight organic compounds produced by
microbes that inhibit the growth of other microbes. Antibiosis plays an active role in
the biocontrol of plant diseases and often acts in concert with competition and para-
sitism. The in vitro antibiotic activity of isolated PGPR strain is assessed by extract-
ing and testing the toxicity of metabolites produced by them. The result shows
antibiotic production by both isolates (Table 5.1), and the percent inhibition of indi-
vidual antibiotic produced by each PGPR strain is also calculated, which show a
Table 5.1 Antibiotic(s) production of PGPR strains by TLC and their efficacy against A. niger
PGPR strain Antibiotic Rf values Zone of inhibition, ZOI (mm)
B. megaterium (soil) S1 Absent Absent
P. aeruginosa (root) R1 0.20 12
P. aeruginosa (root) R3 0.656 Absent
130 Y. Jha
strong antifungal activity (Verma et al. 2014; Shrivastava et al. 2016; Velazquez
et al. 2016; Meena et al. 2014b, 2015c; Sindhu et al. 2016).
5.3.2 In Vivo Effect
Induced systemic resistance (ISR) in plants by PGPR resembles pathogen-induced

systemic acquired resistance (SAR) under conditions where the inducing bacteria
and the challenging pathogen remain spatially separated. Both types of induced
resistance render uninfected plant parts more resistant to pathogens in several plant
species. Rhizobacteria belonging to the genera Pseudomonas and Bacillus are well
known for their antagonistic effects and their ability to trigger ISR. Resistance-
inducing rhizobacteria might be useful in formulating new inoculants with combi-
nations of different mechanisms of action, leading to a more efficient use of
biocontrol strategies to improve cropping systems (Beneduzi et al. 2012). So in this
study, the seeds of maize cultivar, Pioneer 30 V 92, have been inoculated with iso-
lates as per our published methods with some modification (Jha and Subramanian
2013b).
The seeds are washed thoroughly with sterile water and kept on a rotary shaker
for 5–6 h. Later the seeds are transferred to petri dishes containing tryptone glucose
yeast extract agar medium and incubated in the dark at 30 °C to test for possible
contamination. The germinated seedlings devoid of any contamination have been
used for inoculation experiments. The maize seedlings are transferred to culture
tubes containing 400 ml Hoagland’s nutrient medium, 400 ml micronutrients, and
1% agar in 40 ml distilled water to analyze the effect of the isolated bacteria on the
biochemical parameters. Before the transfer, the bacterial inoculum of the isolated
bacteria has been added to the medium at a concentration of 6 × 108 cfu ml−1.
To obtain a mixture of both bacterial cultures, an equal volume of both cultures
is mixed into the medium to give a concentration of 6 × 108 cfu ml−1. The tubes are
incubated at 27 °C in a 12 h light-dark cycle in a growth chamber. Maize roots are
surface sterilized with sodium hypochlorite and are incubated overnight in the TTC
(2,3,5-triphenyl tetrazolium chloride) stain which consists of maleic acid and 1.5 g
of TTC in sterile potassium phosphate buffer (pH 7). An association of PGPR within
the root has been confirmed by cross-sectioning of the root that has been examined
under an image analyzer microscope (Carl Zeiss) (Jha and Subramanian 2011a).
The presence of bacteria in the root cortex region can be clearly visualized as
red-colored cells under the microscope after TTC staining (Fig. 5.3). Such inocu-
lated plants have been transferred to pots containing sterilized sand-perlite (1:1) and
kept in a greenhouse. The plants are irrigated with water and Hoagland’s nutrient
solution once a week and analyzed for its effect on plant growth promotion. The pot
study shows that both individual bacterial isolates and their mixture enhance plant
height, root length, and dry weight. Among the two isolates, P. aeruginosa are more
effective than B. megaterium, and the mixture of both showed the best growth
response of maize plant (Table 5.2).
Fig. 5.3 A section of maize plant root showing the association of bacteria in root cortex as brown
sport due to TTC staining, and no anatomical change has been observed in the xylem vessels due
to PGPR
Table 5.2 Effect of PGPR strains on plant growth-promoting activity and on disease index study
in maize plant
Plant Dry
Germination Shoot Root height biomass Disease
Treatment (%) Length (cm) (g) incidence (%)
Control 66.66d 14.50d 15.0d 29.50d 0.32d 100
Control + B. 75.13bc 22.66bc 22.0abc 44.66c 0.48bc 61
megaterium
Control + P. 83.33ab 24.00b 22.5ab 49.50ab 0.54b 72
aeruginosa
Control + B. 86.66a 28.16a 24.0a 52.16a 0.67a 54
megaterium + P.
aeruginosa
Values are the means of replicates. Values with different letters are significantly different at
P < 0.05 (Duncan’s test). Values in columns followed by the same letter are not significantly dif-
ferent at (P ≤ 0.05)
The bacterial isolates, either alone or as a mixture, are assessed for their effi-
ciency in suppressing disease under greenhouse conditions. The spore suspension of
A. niger with a spore load of 104 conidia ml−1 has been sprayed on the plants, which
caused ~ 75% infection under greenhouse conditions. Disease index is calculated as
grades 0–5 using the formula:
Total grade ´ 100

Disease index = ´ Maximum grade
No. of diseased leaf observed
The antifungal activity of isolated PGPR causes plant growth stimulation by pro-
tecting the plants against phytopathogens. The antifungal activity has been tested
against fungi A. niger, and antifungal activity of P. aeruginosa is higher compared
to that of B. megaterium. This strongly supports the development of biocontrol strat-
132 Y. Jha
egies using such bacterial strains having antagonistic metabolites, to reduce the
damage caused by plant pathogens (Jha et al. 2014b). The study shows that plants
co-inoculated with PGPR and fungus A. niger have lower disease index in compari-
son to non-inoculated plants as shown in Table 5.2.
The plant that grows in agricultural soil is influenced by many environmental
factors. The productive efficiency of a specific PGPR may be further enhanced with
the optimization and acclimatization according to the prevailing soil conditions. In
the future, the chemical fertilizer, pesticides, and artificial growth regulators are
replaced by the ecofriendly PGPR, as these chemicals have several side effects on
sustainable agriculture (Prathap and Kumari 2015). Further understanding and
research on mechanisms of PGPR-mediated phytostimulation would provide the
way to discover more capable rhizobacterial strains which may work under varied
agroecological conditions. So, antibiotic production, growth promotion, biocontrol
potential induced responses of PGPR is an effective yield management tool in maize.
5.4 ffect of PGPR on Morphology and Anatomy

E
of Plant Root
The terrestrial plants develop the root system to explore the soil for better acquisi-
tion of nutrients for their sustainable growth. They participate in the formation of
definite microbial biological niches in plant-based systems, predominantly in the
case of soil in contact with plant roots, i.e., rhizosphere. Besides that the root system
is in close contact with a variety of soil microbes, it also helps the plant anchorage
in soil, absorption of water and ions, plant vegetative growth, and nutrient storage
(Berg and Smalla 2009).
Root is a complex organ with distinct regions such as root hairs that are differen-
tiated epidermal cells which increase the surface area of the root and nutrient accu-
mulation capacities (Ahn et al. 2004). The functional efficiency of the root has a
direct relation with the level of plant-microbe interactions. Root system architecture
incorporates root system topology, the spreading of main and lateral roots, and the
quantity and length of various types of roots. Numerous abiotic and biotic factors
can affect root system architecture, including PGPR (Jha and Subramanian 2013c;
Jha et al. 2014a).
PGPR modify root system architecture and the structure of root tissues, mainly
through their ability to interfere with the plant hormonal balance. The presence of
denser root hairs has increased the surface area of the root, which improves water as
well as mineral uptake. The presence of denser root hairs has increased the surface
area of root, which improve water as well as mineral uptake ability and enhanced
root growth is proposed as a possible mechanism by which PGPR affects plant
growth is also reported by Kaymak et al. (2008). To analyze the effect of PGPR on
plant root, plants from each treatment after 35 days of sowing the seeds are carefully
collected with the root, and cross sections of roots are examined under image ana-
lyzer microscope (Carl Zeiss).
In non-inoculated control as well as in inoculated plants, no anatomical change

has been observed in the xylem tissues, but inoculated plants show an increase in root
length as well as root hair development (Fig. 5.3). The production of plant hormones
such as indole acetic acid and gibberellic acid increased root length, root surface
area, and a number of root tips, thereby improving nutrient and water uptake and
plant growth response under stress conditions (Egamberdieva and Kucharova 2009).
Ten plants of each treatment are collected, for evaluation of lignin and lignin
monomers. The shoots are separated from the root, washed, and placed in a forced
air circulation oven at 65 °C for 7 days until a constant mass was reached. The
shoots are then ground using liquid nitrogen and stored at ±4 °C. According to
Kovacik and Klejdus (2008), for total lignin and lignin monomers, samples are
homogenized in 50 mM sodium phosphate buffer, pH 7.0; purified in 1% Triton
X-100, 1MNaCl, and acetone; and centrifuged for 15 min.
The final pellet has been dried and considered to be the protein freed from the
cell walls. Lignin has been quantified using the thioglycolic acid, and lignin mono-
mers are quantified using alkaline nitrobenzene peroxidation (Van Der Rest et al.
2006). Lignin and lignin monomer increased in inoculated plants have been observed
in this study. Niranjan Raj et al. (2012) also reported that the biocontrol agent
Bacillus megaterium is able to enhance lignin deposition in pearl millet epidermal
tissues, and this plant defense response appears much more rapidly in PGPR-primed
plants infected by the pathogen Sclerospora graminicola compared to non-primed
plants.
The cell wall modifications by the PGPR protect plants against phytopathogens
by activating ISR plant defense responses (Garcia-Gutierrez et al. 2013). One of the
consequences of ISR is thus the reinforcement of the cell wall through enhanced
lignin synthesis and callose apposition which restricts the progression of phyto-
pathogens through plant tissues (Vacheron et al. 2013).
5.5 Effect of PGPR on Induction of Defense Enzymes
Plants are under constant pressures being sessile and face challenge by a group of
biological, chemical, and environmental agents. Every plant is thus enforced to
develop its own physical and biochemical defense mechanisms for its survival
through various levels and types of challenges. These challenges trigger a defense
system that includes a range of induced mechanisms such as the hypersensitive
response and the stimulation of PR proteins (Sels et al. 2008). Plant rapidly induce
PR proteins in response to infection or wound and abundantly accumulate PR pro-
teins at the site of infection and subsidize to systemic acquired resistance (SAR).
The production and accumulation of PR proteins in plants in response to invading
pathogens are among the crucial steps in the inducible portion of a plant’s self-
defense mechanism.
Biocontrol using PGPR may be an alternative method for controlling plant dis-
eases. Some PGPR has the ability to produce antifungal metabolites. Another alter-
134 Y. Jha
native for controlling plant disease is either induced systemic resistance (ISR) or
systemic acquired resistance (SAR). Systemic plant resistance induced by PGPR
represents ISR and is believed to be regulated by jasmonic acid and ethylene. ISR
can protect plants against a wide range of pathogens through the activation of PR
proteins like PAL, β-1,3-glucanases, and peroxidases (Jha et al. 2011b), the accu-
mulation of phytoalexins, and the formation of physical barriers such as callose and
lignin (Whipps 2001).
The PAL activity has been significantly enhanced (p ≤ 0.05), both in the pres-
ence and absence of the pathogen A. niger in our study. The induction of PAL in
plants inoculated with P. aeruginosa and B. megaterium and infected with A. niger
showed significant variation. An early induction of PAL is very important as biosyn-
thesis of lignin originates from L-phenylalanine. General phenylpropanoid metabo-
lism is defined as the sequence of reactions involved in the conversion of
L-phenylalanine to activated cinnamic acids.
The first enzyme of this pathway is PAL, which catalyzes the trans-elimination
of ammonia from L-phenylalanine to form trans-cinnamic acid, which enters in dif-
ferent biosynthetic pathways for the production of phenolics and phytoalexin.
β-1,3-Glucanase enzyme activity is assayed by the laminarin-dinitrosalicylic acid
and expressed as 1 nmol of reducing substances min−1 mg −1 of fresh weight. Its
activity is highest in plants inoculated with P. aeruginosa, B. megaterium, and com-
bination of both as compared to control in this study. β-1,3-glucanase is well known
as a defense-related enzyme in plants. PGPR like fluorescent Pseudomonas induce
systemic resistance in several crops, and such induced systemic resistance is associ-
ated with the accumulation of PR proteins like β-1,3-glucanase and PAL enzymes.
These defense proteins have the potential to hydrolyze the major components of
fungal cell walls, viz., chitin and β-1,3-glucan, respectively.
5.6 Effect of PGPR on Gene Expression
Plants have developed numerous ways of managing the changing environment. The
adaptive responses of plants are directly controlled by inherent and biological fea-
tures, which can be manipulated. The biochemical changes involved in plant stress
responses will enable us to develop the genetically modified plant with improved
resistance to biotic and abiotic stress. Plants activate the manifestation of different
PR genes in response to pathogens to recover its defensive ability (Jiang et al. 2015).
There are also several reports on overexpressing PR genes, resulting in improved
tolerance of plants to biotic stress. Plants draw on a large repertoire of defense
responses when infected by pathogens and the synthesis of new proteins that can
have direct or indirect action on the course of pathogenesis. A diverse group of
extracellular proteins collectively known as PR proteins includes enzymes involved
as peroxidase, β-1,3-glucanase, and catalase. Among these proteins having known
enzymatic functions, β-1,3-glucanases are particularly interesting because they are
hormonally and developmentally regulated in uninfected plants (Kikuchi et al.
2005) and thought to protect plants from fungal infection. β-1,3-Glucan is an impor-
tant structural component of fungal cell walls, and in vitro evidence shows that
β-1,3-glucanase in combination with catalase has a direct fungicidal action on some
phytopathogenic fungi. These enzymes could, therefore, act directly by inhibiting
the growth of invading fungal hyphae.
Since this effect most likely is associated with changes in plant gene expression,
so the total RNA has been isolated 1 week after inoculation from PGPR and
pathogen-co-inoculated and control plants, respectively, for analyzing induction of
genes by the PGPR in plants under biotic stress. The mRNA has been converted
into cDNA and subsequently amplified gene by PCR with specific primers. In order
to amplify β-1,3-glucanase genes, two degenerate primers for β-1,3-glucanase
forward 5′-GTGTCTGCTATGGCGTTGTCG-3′ and reverse 5′-GGTT-
CTCGTTGAACATGGCGA-3′ are designed. Accordingly, 1.05 kb DNA segment
has been amplified for β-1,3-glucanases (data already communicated) having
accession no HM569719.1.
“Similarly, catalase gene is amplified by using forward prime TTAATC-
AGCCATGGATCCT, and reverse primer AGCAGATTGCAACGCTGATC.” A
band of 2 kb has been obtained which has been sequenced and submitted to the
NCBI data bank having accession no. JX875103. This study reports that changes in
gene expression in plants are induced by the PGPR. It is therefore surprising that
induction of stress-related gene can be induced prior to biotic and abiotic stress, i.e.,
merely by inoculation with PGPR (Jha et al. 2014c). It is not unexpected that differ-
ent plant stress response pathways could be activated in concert, e.g., biotic stress
conditions may result in physical damage to plant tissue (Jha and Subramanian
2015) which in turn should facilitate access of pathogens.
Earlier work has indicated that biotic stress can activate defenses against abiotic
stress, and the reverse has been found more efficient. So far, most stress-related
proteins have not been analyzed for their biochemical activities, although some of
them may carry out functions that are of importance in both types of stress situa-
tions. Moreover, some biotic and abiotic stress situations may result in similar phys-
iological effects, and hence co-regulation of certain defense genes may be
evolutionarily selected. PGPR induced different small protein molecules in the
plant under stress as well as control conditions to establish itself in the host plant
and to protect the plant from stress. Mechanisms of PGPR-mediated phytostimula-
tion would help us to find more capable rhizobacterial strains having the ability to
function efficiently under different agroecological conditions for sustainable agri-
culture (Jha and Subramanian 2016c).
5.7 Conclusions
The interaction of PGPR and plants results in the induction of series of morphologi-
cal, anatomical, and enzymatic changes in plants. This study contributed to under-
stand that the interactions of PGPR and plants resulted in induction of series of
136 Y. Jha
morphological, anatomical and enzymatic changes in plants and such induction

capable the plant for overcoming infection of phyto-pathogenic microorganism spe-
cially fungus. Such interaction also helps in the induction of defense-related
enzymes and stress-related gene in paddy under biotic stress. It speculates through
our studies that induction of such stress-related gene is irrespective of stress and
prior to any biotic or abiotic stress, merely by inoculation with PGPR bacteria. Our
results concur with the suggestion that inoculation with PGPR can effectively pro-
tect plants against biotic stress by various mechanisms. On the basis of all above
results, it indicates that the ecofriendly PGPR can serve as a simple and cheap tool
for combating infection in crops as well as for increasing productivity by its growth-
promoting ability. Agriculture in developed countries is definitely the major pro-
moter of microbial inoculants that are “environmentally friendly,” more efficient,
productive, and accessible to marginal and small farmers over chemical fertilizers.
Acknowledgment Our special thanks to the principal of Natubhai V. Patel College of Pure and
Applied Sciences for his kind support and providing me the resources and infrastructure for this
manuscript.
References
https://doi.org/10.1007/978-81-322-2776-2_21
Ahn SJ, Shin R, Schachtman DP (2004) Expression of KT/KUP genes in Arabidopsis and the role
of root hairs in K+ uptake. Plant Physiol 134:1135–1145
Armada E, Portela G, Roldan A, Azcon R (2014) Combined use of beneficial soil microorgan-
ism and agro-waste residue to cope with plant water limitation under semiarid conditions.
Geoderma 232:640–648
from indo-gangetic plain of India. Geomicrobiol J 34:454–466. https://doi.org/10.1080/01490
451.2016.1219431
Bais HP, Weir TL, Perry LG, Gilroy S, Vivanco JM (2006) The role of root exudates in rhizosphere
interactions with plants and other organisms. Ann Rev Plant Biol 57:233–266
Beneduzi A, Ambrosini A, Passaglia LM (2012) Plant growth-promoting rhizobacteria (PGPR):
their potential as antagonists and biocontrol agents. Genet Mol Biol 35(4):1044–1051
Berg G, Smalla K (2009) Plant species and soil type cooperatively shape the structure and function
of microbial communities in the rhizosphere. FEMS Microbiol Ecol 68:1–13
org/10.1007/978-81-322-2776-2_20
pp 77–98. https://doi.org/10.1007/978-81-322-2776-2_6
org/10.1007/978-81-322-2776-2_19
Egamberdieva D, Kucharova Z (2009) Selection for root colonizing bacteria stimulating wheat
growth in saline soils. Biol Fertil Soil 45:563–571
Garcïa-Gutiérrez L, Zeriouh H, Romero D, Cubero J, de Vicente A, Pérez-Gracia A (2013) The
antagonistic strain Bacillus subtilis UMAF6639 also confers protection to melon plants against
cucurbit powdery mildew by activation of jasmonate- and salicylic acid-dependent defence
responses. Microb Biotechnol 6:264–274
9(2):1211–1221
Jha Y, Subramanian RB (2011) Endophytic Pseudomonas pseudoalcaligenes shows better
response against the Magnaporthe grisea than a rhizospheric Bacillus pumilus in Oryza sativa
(Rice). Arch Phytopathol Plant Protect 44:592–604
Jha Y, Subramanian RB (2013a) Root associated bacteria from the rice antagonizes the growth of
Magnaporthe grisea. J Plant Pathol Microbiol 4:164
Jha Y, Subramanian RB (2013b) Paddy inoculated with PGPR show better growth physiology and
nutrient content under salinity. Chil J Agric Res 73(1):213–219
Jha Y, Subramanian RB (2013c) Paddy physiology and enzymes level is regulated by rhizobacteria
under saline stress. J Appl Bot Food Qual 85:168–173
Jha Y, Subramanian RB (2014a) Under saline stress plant growth promoting bacteria affect growth,
photosynthesis and antioxidant activities in paddy. Int J Agric Environ Biotechnol 7(2):205–212
Jha Y, Subramanian RB (2014b) Characterization of root associated bacteria from paddy and its
growth promotion efficacy. 3 Biotech 4(3):325–330
Jha Y, Subramanian RB (2015) Reduced apoptosis like cell death and improved cell membrane
integrity in paddy under salinity by root associate bacteria. Theor Exp Plant Physiol 27:227–235
Jha Y, Subramanian RB (2016a) Regulation of plant physiology and antioxidant enzymes for alle-
viating salinity stress by potassium-mobilizing bacteria. In: Meena VS et al (eds) Potassium
solubilizing microorganisms for sustainable agriculture. Springer, New Delhi, pp 149–162
Jha Y, Subramanian RB (2016b) Regulation of plant physiology and antioxidant enzymes for alle-
Jha Y, Subramanian RB (2016c) Rhizobacteria enhance oil content and physiological status of
Hyptis suaveolens under salinity stress. Rhizosphere 1:33–35
Jha Y, Subramanian RB, Patel S (2011a) Combination of endophytic and rhizospheric plant growth
promoting rhizobacteria in Oryza sativa shows higher accumulation of osmoprotectant against
saline stress. Acta Physiol Plant 33:797–802
Jha Y, Subramanian RB, Patel S (2011b) Endophytic bacteria induced enzymes against M. grisea
in O. sativa under biotic stress. Afr J Basic Appl Sci 3:136–146
138 Y. Jha
Jha Y, Sablok G, Naidu Subbarao N, Sudhakar R, Turabe Fazil MHU, Subramanian RB, Squartini
KS (2014a) Bacterial-induced expression of RAB18 protein in Oryza sativa salinity stress and
insights into molecular interaction with GTP ligand. J Mol Recognit 27:521–527
Jha Y, Subramanian RB, Jethwa R, Patel N (2014b) Isolation and identification of PGPR from
rhizobacteria from Suaeda nudiflora plant and its effect on maize (pioneer 30 v92). Indian
J Plant Prot 42(4):422–429
Jha Y, Subramanian RB, Sahoo S (2014c) Antifungal potential of fenugreek coriander, mint, spin-
ach herbs extracts against Aspergillus niger and Pseudomonas aeruginosa phyto-pathogenic
fungi. Allelopath J 34(2):325–334
Jiang L, Wu J, Fan S, Li W, Dong L, Cheng Q et al (2015) Isolation and characterization of a novel
pathogenesis-related protein gene (GmPRP) with induced expression in soybean (Glycine max)
during infection with Phytophthora sojae. PLoS ONE 10(6):e0129932. https://doi.org/10.1371/
journal.pone.0129932
Kamilova F, Kravchenko LV, Shaposhnikov AI, Azarova T, Makarova N, Lugtenberg B (2006)
Organic acids, sugars and L-tryptophane in exudates of vegetables growing on stonewool and
their effects on activities of rhizosphere bacteria. Mol Plant-Microbe Interact 9:250–256
Kaymak HC, Yarali F, Guvenc I, Donmez MF (2008) The effect of inoculation with plant growth
rhizobacteria (PGPR) on root formation of mint (Mentha piperita L.) cuttings. Afr J Biotechnol
7(24):4479–4483
Kikuchi T, Shibuya H, Jones TJ (2005) Molecular and biochemical characterization of an endo-β-
1,3-glucanase from the pinewood nematode Bursaphelenchus xylophilus acquired by horizon-
tal gene transfer from bacteria. Biochem J 389:117–125
Kováčik J, Klejdus B (2008) Dynamics of phenolic acids and lignin accumulation in metal-treated
Matricaria chamomilla roots. Plant Cell Rep 27:605–615
L.) in the alluvial soil under indo-gangetic plain of India. J Plant Growth Regul 36:608–617.
https://doi.org/10.1007/s00344-016-9663-5
Maksimov IV, Abizgil’dina RR, Pusenkova LI (2011) Plant growth promoting rhizobacteria as
alternative to chemical crop protectors from pathogens (review). Appl Biochem Microbiol
47:333–345
https://doi.org/10.1007/978-81-322-2776-2_10
Massad TJ, Dyer LA, Vega CG (2012) Cost of defense and a test of the carbon-nutrient balance
and growth-differentiation balance hypotheses for two co-occurring classes of plant defense.
PLoS One 7:7554
jclepro.2015.04.044
mentation of their plant growth promoting traits. Biocatalysis Agric Biotechnol 4:806–811
Niranjan Raj S, Lavanya SN, Amruthesh KN, Niranjana SR, Reddy MS, Shetty HS (2012) Histo-
chemical changes induced by PGPR during induction of resistance in pearl millet against
downy mildew disease. Biol Control 60:90–102
Patel JS, Subramanian RB, Jha Y (2011) Biochemical and molecular studies of early blight disease
in tomato. Phytoparasitica. (2011 39:269–283
Prathap M, Kumari R (2015) A critical review on plant growth promoting rhizobacteria. J Plant
Pathol Microb. 2015 6:4
140 Y. Jha
org/10.1007/978-81-322-2776-2_4
pp 127–136. https://doi.org/10.1007/978-81-322-2776-2_9
Sels J, Mathys J, De Coninck BM, Cammue BP, De Bolle MF (2008) Plant pathogenesis-related
(PR) proteins: a focus on PR peptides. Plant Physiol Bioch 46:941–950
Shao HB, Chu LY, Jaleel CA, Zhao CX (2008) Water-deficit stress—induced anatomical changes
in higher plants. C R Biol 331:215–225
Vacheron J, Desbrosses G, Bouffaud ML, Touraine B, Moënne-Loccoz Y, Muller D, Legendre L,
Wisniewski-Dyé F, Prigent-Combaret C (2013) Plant growth-promoting rhizobacteria and root
system functioning. Front Plant Sci 17(4):356
Van der Rest B, Danoun S, Boudet AM, Rochange SF (2006) Down-regulation of cinnamoyl-CoA
reductase in tomato (Solanum lycopersicum L.) induces dramatic changes in soluble phenolic
pools. J Exp Bot 57:1399–1411
Van Loon LC (2007) Plant responses to plant growth-promoting rhizobacteria. Eur J Plant Pathol
119:243–254
84(8):914–919
Whipps JM (2001) Microbial interactions and biocontrol in the rhizosphere. J Exp Bot 52:487–511
org/10.1007/978-81-322-2776-2_14
org/10.1007/978-81-322-2776-2_12
org/10.1007/978-81-322-2776-2_3
Chapter 6
Bioremediation of Metal Contaminated
Soil for Sustainable Crop Production
M. L. Dotaniya, N. R. Panwar, V. D. Meena, C. K. Dotaniya, K. L. Regar,

Manju Lata, and J. K. Saha
Abstract Heavy metal pollution is emerging with time and reduces the chances of
healthy food production from natural resources. Heavy metals are toxic in nature
and caused various types of malfunction in plant, animal, and human bodies. Some
heavy metals are essential for plant growth in lower level; but higher level shows
toxic effects on plant growth. Heavy metals are also having carcinogenic, muta-
genic, malfunctioning, and teratogenic and mostly affected the neurological, liver,
and kidney function. Increasing population with higher pace needs food from the
fixed-cultivated land. It is a great challenge for the researcher and policy-maker in
one side mitigating the food crisis without contamination of natural resources. The
waste generation per capita increased with tremendous rate and vice versa freshwa-
ter resources shrinking. The needs of management for wastewater (WW) or metal-
contaminated soil for the sustainable crop production in most of the developing
countries. Various heavy metal remediation techniques are used for the removal of
metals from environment. Among the techniques, bioremediation techniques are
eco-friendly in nature, in situ, low cost, and energy saving. Phytoremediation tech-
niques are green techniques with a wider scope of contamination removal. The cli-
matic changes are also affecting the crop and soil production capacity; it needs more
research in abiotic stress.
M. L. Dotaniya (*) · V. D. Meena · J. K. Saha

ICAR-Indian Institute of Soil Science, Bhopal, India
N. R. Panwar
ICAR-Central Arid Zone Research Institute, Jodhpur, India
C. K. Dotaniya
Department of Soil Science & Agricultural Chemistry, College of Agriculture, SKRAU,
Bikaner, India
K. L. Regar
Department of Soil Science & Agricultural Chemistry, IAS, BHU, Varanasi, India
M. Lata
Barkatullah University, Bhopal, India

https://doi.org/10.1007/978-981-10-8402-7_6
144 M. L. Dotaniya et al.
Keywords Geo-accumulation index · Heavy metals · Human health ·

Phytoremediation · Sustainable crop production
6.1 Introduction
Sustainable crop production is a demand of today agriculture. From the old age,
agricultural practices having an immense natural resources and less pressure for the
food grain production across the globe. As the human and animal population is
growing, the per capita pressure on natural resources is increasing with the pace of
time. The fast industrialization, increasing burning of fossil fuels, poor management
of natural resources, and low awareness among the peoples toward environment
promote the pollution in natural resources. Indian population is growing higher in
annual rate and needs 280 Mt food for fulfilling the hungry mouth of the country in
2020. If we consider at global level, it is much more than the potential capacity of
natural resources. To mitigate the food crisis, we can follow (i) using the poor-
quality natural resources, (ii) using high potential genetic crop varieties, and (iii)
using sustainable management of natural resources. The use of poor-quality water
for crop production reduced the soil fertility potential of soil and ultimately pro-
duced poor crop. This is also toxic in helping humans, due to the presence of various
heavy metals. These metals in trace amount affected the living systems and physi-
ological function and in higher level also caused death. In soil, the presence of
heavy metals affected the plant nutrient transformation and enzymatic activities
(Dotaniya et al. 2016f). The restriction of nutrient transformation reduced the plant
nutrient supplying capacity of soil, as a result poor crop production.
Heavy metals are metal and metalloids having higher density compared to water
(Dotaniya et al. 2016g). A metal having specific gravity of more than 5.0 or atomic
number higher than 20 (calcium- Ca) is termed as heavy metal (Dotaniya et al.
2013e). It is the main group of inorganic contamination in a larger land, mostly due
to application of sludge and sewage and municipal waste, through agricultural
inputs, metallurgical industries, and mining (Rusan et al. 2007; Rajendiran et al.
2015; Lenka et al. 2016; Dotaniya and Saha 2017). These include metal and metal-
loids of chromium (Cr), cadmium (Cd), nickel (Ni), lead (Pb), mercury (Hg), arse-
nic (As), selenium (Se), and zinc (Zn). Apart from these, other heavy metals are also
important, but these are having less account of human and plant health, i.e. alumi-
num, cobalt, and molybdenum. Among the heavy metals, few are necessary for the
completion of biochemical cycles in plant, animal, and human systems (Ajay et al.
2012; Pingoliya et al. 2015). Heavy metals are also having the lowest level of con-
centration in soil, but they cause major effect on biotic life cycle (Dotaniya et al.
2014h; Meena et al. 2013a). Heavy metals are carcinogenic in nature; therefore, its
decontamination from a system is necessary for sustainable crop production or a
healthy environment.
6 Bioremediation of Metal Contaminated Soil for Sustainable Crop Production 145
6.2 Source of Heavy Metals
On the basis of heavy metal source and mode of dispersing into other systems are
classified into the following groups. A list of heavy metal sources and its effect on
human health are described in Table 6.1.
6.2.1 Geogenic
Such type of sources includes the heavy metal toxicity from its origin of soils from
rocks. The produced toxicity of heavy metals is in soil or in groundwater (Dotaniya
et al. 2014h, 2016c). With the help of various soil and crop management practices,
contaminated soil can be used for crop or forest plant cultivation. The As toxicity in
Bangladesh and West Bengal of India is a good example of geogenic source of As
metal. The weathering of natural rocks, erosion, and volcanic eruptions are major
sources of geogenic activities. Few pockets across the globe have geogenic sources
of heavy metals, and with the anthropogenic activities, it is dispersed in other natu-
ral ecosystems (Dotaniya et al. 2016d).
Table 6.1 Source and effect of heavy metals on human health (Singh et al. 2011)
Metals Major source Effect on human health
Arsenic Pesticides, fungicides, metal Bronchitis, dermatitis, poisoning
smelters
Cadmium Welding, electroplating, Renal dysfunction, lung disease, lung cancer, bone
pesticides, fertilizers, Cd and defects, increased blood pressure, kidney damage,
Ni batteries, nuclear fission gastrointestinal disorder, cancer
plant
Lead Paint, pesticide, smoking, Mental retardation of children, developmental
automobile emission, mining, delay, congenital paralysis, sensory neural
burning of coal deafness, acute and chronic damage of the nerve
system, liver, kidney, gastrointestinal tract
Mercury Pesticides, batteries, paper Tremors, gingivitis, minor psychological changes,
industry spontaneous abortion, damage to nervous system,
protoplasm poisoning
Chromium Mines, minerals, leather Damage to the nervous system, fatigue, irritability
industry
Zinc Refineries, brass manufacture, Zinc fumes have a corrosive effect on the skin and
metal plating, plumbing cause damage to nervous membrane
Copper Mining, pesticide production, Liver and kidney damage, stomach and intestinal
chemical industry, metal irritation
piping
6.2.2 Anthropogenic Sources
These heavy metals are extracted from point sources or from geogenic sites for
utilization in different activities. The contamination in the environment may be due
to natural as well as anthropogenic activities. The activities of mining, smelting, and
electroplating and other industrial units are discharging significant amount of met-
als into natural systems. The leather industries are using chromium sulfate and dis-
charging noteworthy amount of Cr into effluent. This effluent is used for the
cultivation of crops and other agricultural purposes, mostly in water-scarce areas.
Dotaniya et al. (2014c) reported that long-term application of leather industrial
effluent for crop production accumulated ~25–30% more Cr in soil than tube well-
irrigated fields. Similarly, other industries like Pb, Hg, Cr, Ni, Cd, Zn, As, and Se are
also contributing a meaning amount of metals into natural ecosystems. Apart from
these, various heavy metals are used for preservation of wood and other household
activities (Ahmad et al. 2016; Parewa et al. 2014).
Sewage water or biosolids for the cultivation of vegetable in peri-urban areas of
megacities are also a source of heavy metal accumulation in soil (Dotaniya et al.
2013f, 2016h). Due to progressive industrial developmental activities and increas-
ing population growth, huge volume of domestic sewage water is being produced in
megacities. On an average ~90% of generating wastewater (WW) at the global level
is left untreated, causing extensive water contamination, especially in developing
countries. Here the WW means industrial effluent, household WW, and sewage
effluent (Meena et al. 2015a). It is cheaper to dispose such effluent in this way and
provides water and nutrients to crop (Saha et al. 2010). Therefore, Indian agriculture
is encountering the problems of irrigation water scarcity and rising cost of fertiliz-
ers; domestic sewage water generated from cities is the better option to successfully
use irrigation. People are using WW for crop production and getting good yield due
to the presence of organic matter and trace amounts in micronutrients; but in nega-
tive side, these WW channels are also contributing heavy metals into the soil and
human body via food chain contamination (Rana et al. 2010; Meena et al. 2013a;
Dotaniya et al. 2015a).
One of the major sources of heavy metal contamination in soil and water bodies
is through agricultural crop production inputs. In recent years, there has been
increasing concern toward the health hazards through heavy metal contamination
via food chain contamination (Dotaniya et al. 2014g). Fertilizers contain heavy met-
als as impurities; in this respect rock phosphate is a highly potential source. The
contaminated soil or contamination through fertilizer impurities came into human
and animal body and caused various types of malfunctions (Dotaniya et al. 2012a).
The application of rock phosphate or its products during crop production in soil
always implies the addition of a significant amount of Pb and Cd into the soils. The
analysis of Pb and Cd from phosphatic fertilizers suggested that low-grade and
straight fertilizers have more chance of contamination than high analysis and mixed
fertilizers (Dotaniya et al. 2014h; Singh 2002). During the application of phosphatic
fertilizers for crop production accumulated heavy metal concentration on the surface
of the soil and is easily available to plants (Meena et al. 2015b, c; Dominguez-
Nunez et al. 2016; Dotaniya et al. 2016g). The surface retention of heavy metals has
more chances to contaminants in the water bodies during rains and via soil
erosion.
In soils with coarser textures and acidic reaction, having greater chances of
heavy metal availability and mobility than finer texture (contain more amount of
clay) and with the alkaline reaction medium for plants. It is very interesting that less
than 6% of annual deposition of Cd in the soil of the European Economic Community
comes, due to the use of phosphate fertilizers, with a further 2% from phosphoric
acid manufacture industries. Whereas, two third is contributed from solid wastes
and excrement, aerial deposition, and use of pigments and stabilizers (Roberts
2014).
6.3 Geo-accumulation Indexes
The heavy metal contamination in soil is due to wider sources and whether these
soils are heavy metal contamination or not. In this index the metal concentration
with respect to uncontaminated soil is used for the cultivation of toxicity. Geo-
accumulation index (Igeo) is widely used for assessing heavy metal contamination in
sediments (Ball and Izbicki 2004; Chabukdhara and Nema 2012), dust (Kong et al.
2011), and trace metal pollution in agricultural soils (Wei and Yang 2010). The geo-
accumulation index was calculated using the following formula described by Muller
(1969):
Cn
I geo = log 2
1.5 Bn
where Igeo stands for the geo-accumulation index, Cn is the soil trace metal concen-
tration (mg kg−1), and Bn geochemical baseline concentration (mg kg−1), i.e. the
mean trace metal concentration in the uncontaminated soils. The soil sample with
Igeo ≤ 0 indicates unpolluted and classified under class I. Similarly, Igeo values 0–1,
1–2, 2–3, 3–4, 4–5, and >5 indicate unpolluted to moderate polluted (class II), mod-
erate polluted (class III), moderate to heavily polluted (class IV), heavily polluted
(class V), heavily to extremely polluted (class VI), and extremely polluted (class
VII), respectively.
6.4 Metal Transfer Factors
The contaminated soil or water is used for the cultivation of food crops and the
transfer of heavy metal soil to the human body via food chain contamination. To
calculate the heavy metal toxic effect in the human body, the metal transfer factor
and hazard quotient (HQgv) are calculated for the safe utilization of metals through
dilatory intake. The metal transfer factor showed the heavy metal concentration in
edible part of leafy vegetables. It is a simple ration between metal concentrations in
the plant part (on dry weight basis) from soil. The DTPA extractable concentration
of heavy metals in soil is considered for computation of metal transfer factor. Risk
assessment of heavy metal is calculated with the help of hazard quotient for the
intake of leafy vegetables like palak, mustard, and coriander; those growing in efflu-
ent irrigated soil were computed with the help of Pierzynski et al. (2000).
add
HQgv =
RfD
where HQgv is the hazard quotient to a human from consumption of green vegeta-
bles; add the average daily dose (mg metal per kg body weight per day) and RfD the
reference dose. The values of RfD for Zn, Ni, Cd, Pb, and Cr were used as 0.3, 0.02,
0.001, 0.0035, and 0.003 mg kg−1 body weight day−1, respectively (IRIS 2015). For
Cu, value of provisional maximum tolerable daily intake is 0.5 mg kg−1 body weight
day−1 (WHO 1982), and the same is used as RfD (Alam et al. 2003). Daily intake of
green vegetable was considered as 0.2 kg−1 person day−1, which is recommended
amount from a nutritional point of view (Hassan and Ahmed 2000). A factor of
0.085 was used to convert the fresh to dry weight of these green vegetables. Average
body weight for an adult was considered as 70 kg (USEPA 1991). Average daily
dose (add) was computed using following relationship:
mc × cf × di
add =
bw
where mc is the metal concentrations in plant (mg kg−1) on dry weight basis, cf the
fresh to dry weight conversion factor, di the daily intake of green vegetable (kg), and
bw the body weight (kg). Assessment of risk as computed here is not complete since
metal accumulation to soil organisms, groundwater, and surface water direct uptake
of soil by human and animal are some of the other risks which have not been con-
sidered here.
6.5 Effect of Heavy Metals on Plant, Human, and Animals
6.5.1 Lead
Mental retardation, developmental delay, congenital paralysis, sensory neural deaf-

ness, acute and chronic damage of the nerve system, liver, kidney, gastrointestinal
in human. In the present context, use of nanomaterial for the removal of Pb from
water bodies is a major area of research at the top of the global issues. Use of tita-
nium oxide and hematite nanoparticles is the foremost, for the 100% recovery of the
Pb ions. This efficiency is also affected by the pH and contact time, which is ≤6 and
≥60 min, respectively, for the typical optimum conditions for Pb removal of water
bodies. The recovery percent is also affected by adsorbent dose for the adequate
surface area and number of adsorption sites (Bhatia et al. 2016; Masood and Bano
2016).
6.5.2 Mercury
It is also a toxic is associated with kidney damage. Hair fall in early age is a symp-
tom of Hg toxicity. Apart from these, tremors, gingivitis, minor psychological
changes, spontaneous abortion, damage to the nervous system, and protoplasm poi-
soning are also happing due to Hg toxicity. It is mostly in Hg industries’ WW utili-
zation for fish and crop production.
6.5.3 Arsenic
This heavy metal problem aggravated mostly as chronically in Bangladesh, India,

Chile, Mexico, Taiwan, and part of West Bengal of India. These countries are suf-
fering due to geogenic concentration of As and also use of As-contaminated ground-
water for consumptive use. The natural level of As in soil mostly ranges from 1 to
40 ppm, but use of pesticides or As-contaminated waste enhanced the level and
caused toxicity (Tchounwou et al. 2004). Arsenic exposure much affected the mech-
anism of organs, including cardiovascular, renal, bronchitis, nervous, and also respi-
ratory disease in human (Tchounwou et al. 2003). Many cases are reported in
affected areas due to higher intakes of As through drinking water or via food chain
contamination. The higher level caused the cancer of the kidney, gall bladder, and
liver in major affected areas. The severity of ill effect on health of plant, animal, and
human health is closely related to the chemical form of As and time and level of
dose. In the harmful effect situation, As (V) replaced the phosphate ions, which is
key to many biochemical pathways in different organ systems. The inorganic triva-
lent arsenite is two to ten times more toxic than pentavalent arsenate for the human
system. With the binding of the thiol or sulfhydryl groups on protein, As (III) can
inactivate more than 200 enzymes (Hughes 2002).
6.5.4 Cadmium
In general, Cd poisoning occurs through inhalation of cigarette smoke and also

ingestion of Cd-contaminated food materials. In other specific routes like people
working in metal industries, working at a Cd-contaminated workplace and also eat-
ing or drinking with contaminated hand are the sources of Cd in the human body.
Vegetables growing in Cd-contaminated WW nearby peri-urban areas of major cit-
ies are having more chances of metal contamination. Cadmium negatively affected
the lung and bone and increased the blood pressure, and higher dose can cause
cancer and mortality. In plant system, Cd reduced transportation of food material
from root to shoot, by damaging the root tissues. The blackish-brown root or
necrotic root is a clear-cut symptom of Cd toxicity in plants. The chronic inhalation
exposure of Cd is associated with the malfunction or decrease in the pulmonary and
olfactory functions (Mascagni et al. 2003). The level of Cd in the body is measured
through the presence of Cd concentration in blood or urine. Both the blood and
urine contaminated with Cd are higher in highly cigarette smokers.
6.5.5 Chromium
It is a carcinogenic metal. Occupational exposure is a major concern for the

Cr-induced disease in industrial worker due to hexavalent Cr (Guertin 2005). Long-
term exposure can cause kidney and liver damage and damage to circulatory and
nerve tissue. It is estimated that 33 tons of total Cr is released annually into the
environment, which is a matter of health concern. The US Occupational Safety and
Health Administration (OSHA) fixed a safe level 5 μg m−3 for 8 h working at the
industrial work place. This level also may still pose a carcinogenic risk in the human
body. In crop plants Cr reduced the germination rate and root and shoot growth in
wheat (Dotaniya et al. 2014d) and pigeon pea (Dotaniya et al. 2014f).
6.6 Heavy Metal Chemistry in Soil
6.6.1 Lead
It is bluish gray, a constituent of the earth’s crust ranging from 10 to 67 mg kg−1, and
belonging to group IV and period 6 in the periodic table. It has atomic number 82
and density 11.4 g cm−3 with atomic mass 207.2. It is naturally occurring, but due to
massive anthropogenic activities like burning of fossil fuels, metallic mining and
industrial waste disposal spread the Pb concentration into the environment. The
application of Pb in day-to-day life is more prominent mostly in industrial and
domestic equipment. In nature, it is found in combination with other elements like
sulfur (Pbs, PbSO4) and oxygen (PbCO3) (USDHHS 1999). In nature, ionic form of
Pb, Pb(II), and various types of oxide and hydroxide as well as lead metal oxyanion
complexes are in the general form of Pb, which is mainly contributed in soil, sur-
face, and groundwater across the global length and width. The most common stable
form of Pb is Pb(II); it is forming mononuclear and polynuclear oxides and hydrox-
ides in major soil groups (GWRTAC 1997).
Lead ranked fifth place after Fe, Cu, Al, and Zn in the list of industrial production
of metal and metalloids. Major part of Pb is used in batteries, solders and pipes,
electric cable covers, bearing, tire manufacturing, pigmentation, plumbing, X-ray
shielding, and caulking. Very high concentration of Pb in soil affected the soil pro-
cess and is necessary to produce toxic response. It is fixed in soil by hydrolysis and
polymerization mechanisms. Some of the metals commonly alloyed with Pb are (1)
in storage batteries, antimony; (2) Ca and Sn in maintenance-free storage electric
batteries; (3) in solder and anode work, silver metal; (4) as anodes in electrowinning
process with Sr and Sn; and (5) tellurium during the process of pipe and sheet in
chemical installation as well as nuclear shielding (Manahan 2003). The fraction of
Pb from these metal industries is released into effluent and reached ultimately soil
and water bodies. Soil factors such as high-cation exchange capacity, alkaline pH,
high organic matter, and P-content in the soil antagonize Pb uptake by plants. The
various types of soil also affected the availability of Pb metal for plant availability
and also affected the soil critical limit for toxicity. It implies that if wastes rich in
phosphorus (P) and organic matter (such as, sewage water and sludge) are applied
to the soil, very little hazards due to Pb are expected.
6.6.2 Chromium
Chromium is the 21st most abundant element in the earth’s crust (Dotaniya et al.
2014h). It occurs in nature in bound forms that constitute 0.1–0.3 mg kg−1 of the
earth’s crust. It has several oxidation states ranging from Cr(−II) to Cr(+VI). It
exists predominantly in the Cr+3 and Cr+6 oxidation states. The most stable oxidation
state of Cr is Cr(III), and under most prevailing environmental conditions Cr(VI) is
rapidly reduced to Cr(III). The intermediate states of +IV and +V are metastable
and rarely encountered (Lokhande et al. 2011). The Cr(III) is strongly adsorbed on
soil particles, whereas Cr(VI) is weakly adsorbed and is readily available to plant
uptake or leaching to groundwater (James and Bartlett 1983). Plants do not accumu-
late a significant amount of Cr from soil in high concentrations. Thus, plants can
tolerate higher amounts of Cr present in soil due to accumulation by long-term
application of sewage or sludge.
When the Cr was applied through hexavalent for soil, with the soil constituents,
it is rapidly converted into nontoxic form of Cr(III) as insoluble hydroxides or
oxides. Suitable conditions for Cr(VI) reduction occur where organic matter is pres-
ent and act as an electron donor, and Cr(VI) reduction is enhanced in acidic rather
than alkaline soils mentioned in Eq. 1 (Bartlett and Kimble 1976; Bolan et al. 2003).
2Cr2 O7 + 3Co + 16H + → 4Cr 3 + + 3CO2 + 8H 2 O (6.1)
From the global research side, many researchers find out the effect of organic
matter or organic-rich soil amendments for the reduction of Cr toxicity by trans-
forming Cr(VI) to Cr(III) (Dotaniya et al. 2015b). Losi et al. (1994) reported that
addition of cattle manure reduced the potential Cr toxicity from Cr(VI) to nontoxic
Cr(III) in soil. The presence of organic matter supplies the C and protons and also
stimulated the growth of soil microorganisms, which mediated and facilitated the Cr
reduction process Cr(VI) to Cr(III) (Losi et al. 1994).
6.6.3 Cadmium
It is one of the toxic metals in nature located in transition element category. It is

having atomic number 48 with density 8.65 g cm−3. In nature, it exists as Cd(II) ion.
It is having similarity with essential element of Zn, which is essentially required for
plant and animal systems for potential growth. In Zn deficiency conditions, plant
take up Cd as a substitution of Zn and may affect the metabolism of plants (Campbell
2006). Cadmium is one of the most toxic elements not having any well-known
essential physiological functions in plant and human. At low concentration in soil,
it is toxic to a number of plants. Accumulation of Cd varies with plant species, vari-
eties, and plant part under consideration and soil properties. Cadmium has a ten-
dency to accumulate more in a leafy part rather than in fruits and grains/seeds.
Factors such as soil pH, applied fertilizers, presence of other heavy metals, tempera-
ture, and soil organic matter have a profound influence on Cd uptake by plants.
Although incidence of itai-itai disease in the Jintsu Valley of Japan occurred because
of the high Cd content of rice, reducing soil conditions hinder the uptake of Cd by
rice. Anaerobic conditions during the grain filling stage depress the Cd content of
grains (Singh 2002). Most common use of Cd in Ni-Cd electric batteries is for
rechargeable or storage for secondary purpose, due to high output, durability, low
wearing and tearing, and larger tolerance to physical and electrical fluctuations.
Cadmium is also utilized for better corrosive resistance coating in most of marine
equipment, i.e. vessels and vehicles.
6.6.4 Nickel
It is a transitional metal having atomic number 28 and atomic weight 58.69. It is

much affected by the soil-water pH. In most of the low-pH regions, nickelous ion,
Ni(II), is found; whereas in neutral to slightly higher-pH soils, nickelous hydroxide,
Ni(OH)2, precipitates as a stable compound. This stable compound is readily soluble
in acid environment and formed Ni(III) and in high alkaline conditions formed nick-
elite ion, HNiO2, which is soluble in water. In very oxidizing and the alkaline envi-
ronment, Ni found in the form of stable nickel-nickelic oxide, Ni3O4, is easily
soluble in acid solvents. In highly acidic condition, various types of Ni oxides, i.e.
nickelic oxide and nickel peroxide, Ni2O3, are converted into Ni2+ ions (Wuana and
Okieimen 2011). Nickel content in the range of 50–100 mg g−1 (dry weight basis) is
indicative of its toxicity to plants. Nickel behaves largely like essential plant nutrient
Zn in the soil-plant system, but it forms stronger chelates with soil organic matter,
thereby showing closeness to Cu. Possibility of Ni toxicity to plants cannot be ruled
out when industrial or municipal wastes with high Ni concentrations are applied to
agricultural lands. Nevertheless, like Zn and Cu, phytotoxicity of Ni appears to pro-
vide an effective barrier against Ni toxicity to human population and animals.
6.6.5 Mercury
It is also one of the toxic metals in the human and animal systems. It belongs to the
same group of Zn and Cd in the periodic table with atomic number 80 and mass
200.6. It is liquid in nature and mostly recovered during ore processing (Smith et al.
1995). In the environment, its major contribution through combustion of coal and
release from manometers located at gas or oil pipelines. Mostly in the environment
it is present in mercuric (Hg2+), mercurous (Hg22+), elemental (Hgo), and also in
alkylated form as methyl or ethyl mercury. Mercury is more toxic in alkylated form,
because these are soluble in water and volatile in air (Smith et al. 1995). In most
cases the form of Hg depends on the redox potential and pH of the existing environ-
ment. For example, under oxidizing condition, Hg2+ and Hg22+ are more stable,
whereas under reducing conditions, organic or inorganic Hg may be converted to
elemental Hg and then again converted to alkylated forms by a biotic or abiotic
process of nature. Mercury(II) formed strong complex with the organic and inor-
ganic ligands present in the environment, which is easily soluble in oxidized aquatic
systems (Bodek et al. 1988; Wuana and Okieimen 2011). In the uncontaminated
environment, its concentration in plant part seldom exceeds 500 parts per billion
(ppb). In naturally contaminated areas, i.e., near Hg-bearing deposits, its level can
be as high as 3500 ppb. Many agricultural crop inputs are having significant amounts
of Hg like fungicide Ceresan M. Mercury is strongly held by the soil particles at
various adsorption sites for the element never approaches saturation before another
toxic element becomes hazardous. The Hg content in the aboveground part of plants
is very low except Hg seed treatment or its addition to soil.
Most of the cases, Hg toxicity was reported in aquatic food chains compared to
intensive agriculture. For the removal of Hg from solution, sorption to soil, sedi-
ment- and humic-containing material is playing a valuable mechanism. Increasing
the pH of the system increases the sorption mechanism. Removal of Hg from solu-
tion may be recovered by coprecipitation with sulfides, and under low oxygen con-
ditions, anaerobic microorganisms especially sulfur-reducing bacteria converted
organic and inorganic forms of Hg to alkylated form. In anaerobic conditions, ele-
mental Hg also transformed into demethylation of methyl-Hg or by reduction of
Hg(II) in environment. In high acidic condition, pH <4 preferred the formation of
methyl mercury; and higher pH range favors precipitation of HgS(s).
6.6.6 Arsenic
Arsenic is classified under the metallic group of VA and period 4 in the periodic
table associated with other minerals widely, mainly as As2O3. It has atomic number
33 and atomic mass 75 and exists in various forms of oxidation (i.e., -III, 0, III, V).
In most of the aerobic environment, As(V) is the dominant species in the form of
arsenate (AsO43−) in the different protonation states like H3AsO4, H2AsO4−,
HAsO42−, and AsO43−. It is recovered during the ore processing of Cu, Pb, Zn, Ag,
and Au. Arsenic builds up in the natural soil environment through natural processes
of weathering of As-bearing bocks or As-contaminated groundwater used for crop
production as a means of irrigation. Apart from these are anthropogenic activities
such as mining operations, burning of coal, smelting of base metal ores, and appli-
cation of As-containing agricultural inputs. The concentration of As in world soils
varied widely. In common, soils overlying sulfide ore deposits or derived from
shales and granites and those surrounding geothermal activity have high As con-
tents. Arsenate and other anionic forms of As act as a chelates and precipitated with
the presence of cations (Bodek et al. 1988). In West Bengal, water samples from
about 55% tube wells have been found to contain As in a concentration greater than
10 μg L−1, which is the maximum permissible limit of the World Health Organization
(Chowdhury et al. 1999). The soils being irrigated with As-contaminated waters
have already started showing the presence of 6–10 mg kg−1 of EDTA extractable As.
Arsenic retention by soil is mainly performed by the adsorption mechanism rather
than the precipitation of sparingly soluble As compounds.
The toxicity of As depends on soil environment by the oxidation states and its
presence with organic and inorganic combinations. The oxidation states of As metal
are affected by pH and redox potential. The As mobility increases with increasing
soil pH (Reed et al. 1995). The arsenates are very soluble, mobile, and toxic than the
arsenates. The biological availability and phytotoxicity of As in soil increases on
reduction of the As(III) state, which is facilitated on the flooding of the soils. The As
uptake pattern is highly affected by crop, varieties, soil chemical environment, and
some extent by climatic factors. The lowland rice is more susceptible to As toxicity
than upland rice.
6.6.7 Zinc
It is an essential plant nutrient element and keeps the place in the period 4, group
IIB, having atomic number 30 and mass 65.4. It is also a transitional metal, occur-
ring naturally in soil systems. Fast industrialization or other anthropogenic activities
like mining, coal, waste combustion, and use of steel processing activities enhance
the Zn concentration in environment. The Zn availability varies with pH values.
Increasing the soil pH decreased the availability of Zn in soil and reduced the con-
centration in soil solution toward plant uptake. In higher-pH condition, carbonate
and bicarbonates are precipitated into unavailable forms and induced Zn deficiency
in soils (Dotaniya and Meena 2013).
6.7 Cellular Mechanisms for Heavy Metals
Most of the heavy metals are toxic to plant systems except few. Largely heavy met-
als have low mobility in soils and have high adsorption with organic matter or sili-
cate minerals. The plant uptake pattern is much affected by the presence of metal in
soil and plant biochemical cycles. Hyperaccumulation in higher plant is a complex
phenomenon and governed by various factors like (1) transport of heavy metals
across the plasma membrane of root cells, (2) xylem loading and translocation in
various part of plants, and (3) heavy metal detoxification and sequestration at the
plant and cellular level (Lombi et al. 2002). The first hyperaccumulator plants were
identified by the family of Brassicaceae and Fabaceae; and the list of plants crossed
more than 400 (Halim et al. 2003). These plants have a particular gene for the hyper-
accumulation of metal or metals (Yang et al. 2005). Many of the plants accumulated
a particular metal, and a few plants are having the capacity to accumulate more than
one metal. These metal accumulator mechanisms are not fully understood; but the
capacity of plants toward metal uptake is accounted. The intracellular mechanism of
heavy metal uptake has also helped to understand the various metal uptake phenom-
ena in soil-plant dynamics. Some of the major processes influencing the accumula-
tion rate in plants are defined in Fig. 6.1.
Distribution and
sequestration
(cell wall binding,
vacuole sequestration,
cytoplasmic chelation,
etc)
Xylem transport
(symplastic loading
and ion exchange
etc.)
Root absorption and

compartmentation
(transporters, channels,
cytoplasmic chelators,
etc)
Bioactivation in the
rhizosphere
(root-microbe
interaction, etc)
Fig. 6.1 Major process involved in heavy metal hyperaccumulation by plants (Yang et al. 2005)
The hyperaccumulator plants showing the higher or extraordinary potential abil-

ity to absorb heavy metals from the contaminated soil or aquatic systems and accu-
mulated in various part of the plant (Ma et al. 2001; Yang et al. 2002). The metal
uptake by a plant and total metal present in soil does not have a true correlation in
the heavy metal dynamics. Knight et al. (1994) reported that no significant correc-
tion was observed between Zn accumulated by the Thlaspi caerulescens and total
Zn metal in the soil. However, the close relation was also observed between metal
concentration in plant shoot and metal concentration in soil solution. The bio-
availabity of metals is the part of total metal concentration, and these fractions are
truly represented of plant uptake. Plant roots and microbial population and their
interaction much determine the availability of a metal and also the form of metal in
soil. Plants secrete various types of low-molecular organic acids through root exu-
dates and act as a chelating agent or supply the food materials to soil microorganism
(Dotaniya et al. 2013c, d). The interaction of microorganisms and plant roots can
enhance the metal bioavailability in rhizosphere due to secretion of protons, amino
acids, enzymes, and phytochelatins. A part of proton extrusion of the roots is
Table 6.2 Genes of transportation isolated from plants involved in heavy metal uptake
Genes Plant Elements References
OsNramp1 Rice Mn Belouchi et al. (1997)
OsNramp2
Cpx-type heavy Arabidopsis Cu, Zn, Cd, Tabata et al. (1997), Williams et al. (2000),
metal ATPases rice Pb Belouchi et al. (1997), and Hirayama et al.
(1999)
Nramp Arabidopsis Cd, divalent Belouchi et al. (1997), Alonso et al.
metals (1999), and Thomine et al. (2000)
CDF family Arabidopsis Cd, Co, Cd Maser et al. (2001)
proteins
ZIP family (ZAT1, Arabidopsis Cd, Zn, Mn Van der Zaal et al. (1999)
ZAT2, ZAT3) T. caerulescens Lombi et al. (2002), Pence et al. (2000),
and Assuncao et al. (2001)
ediated by the plasma membrane H+-ATPase and H+ pump. The molecular bases
m
and various effects of these mechanisms are a matter of research regarding heavy
metal removal by plant systems. Arabidopsis thaliana is an AtHMA4 P-1B-ATPase
which is responsible for the transportation of Zn and Cd. Verret et al. (2004)
described that AtHMA4 is located in the plasma membrane and expressed its effect
on tissue surrounding the root vascular vessels. Yang et al. (2005) mentioned that
the ectopic overexpression of AtHMA4 positively influenced the root growth in the
presence of toxic metals like Zn, Cd, and Co, whereas a null mutant exhibited a
lower translocation response in the plant root-shoot system with regard to Zn and
Cd metals. In plant nutrient-deficient conditions, plant which secreted the phytosid-
erophores can reduce the plant-available metal form, i.e. Fe3+, Cu2+, and Cd2+
(Dotaniya et al. 2013c). The metal transportation from contaminated sites to plant
root membrane and further in various plant parts is mediated by a particular gene in
a specific plant species. A broader understanding about the metal transportation
process in plant is required for the better understanding for the formulation of the
effective strategies to develop genetically engineered plant species that can accumu-
late higher amount of metal from toxicant. A range of gene is responsible for a
particular metal or metal accumulations mentioned in Table 6.2.
6.8 Remediation Techniques
The polluted environment can be remedied with the help of physical, chemical, and
biological techniques. Various types of remediation techniques are also categorized
in various heads as per the mode of action listed in Table 6.3. In classical method of
heavy metal remediation from soil and water bodies with the help of chemical and
physical technologies are mentioned from ancient periods. With these techniques
addition of chemical (chemical remediation’s), which mobilize or immobilize the
heavy metal contents from contaminated sites; and in physical remediation
Table 6.3 Technologies for remediation of heavy metal-contaminated soils (Wuana and Okieimen
2011)
Category Remediation technologies
Isolation i. Capping
ii. Subsurface barriers
Immobilization i. Solidification/stabilization
ii. Vitrification
Toxicity and/or i. Chemical treatment
mobility reduction ii. Permeable treatment walls
iii. Biological treatment bioaccumulation, phytoremediation
(phytoextraction, phytostabilization, and rhizofiltration), bioleaching,
biochemical processes
Physical separation/ i. Soil washing, pyrometallurgical extraction, in situ soil flushing, and
extraction electrokinetic treatment
excavations, capping, soil mixing, soil washing and solidification, mixing of con-
taminated soil with uncontaminated soil are included (Dotaniya et al. 2012b;
Dotaniya and Lata 2012; Velazquez et al. 2016). In bioremediation techniques, use
of biological means for reducing the heavy metal toxicity in environment. These
techniques have advantages and disadvantages as per the potential of remediation
and cost.
6.8.1 Physical Remediation
This type of technique is applicable on particular form of metals. It consists of

mechanical screening, floatation, electric and magnetic separation, and floation
(Gunatilake 2015). The potential efficiency of these techniques depends on soil
properties and type and extension of pollution. Sometimes contaminated soil is
washed with good-quality water. Highly metal-polluted soils can be remediated by
physical scraps in which heavy metal-contaminated upper layer of soils shifted to
another place. Sometimes, uncontaminated soil is mixed with contaminated soil to
reduce the heavy metal concentration in lower side to grow the forage or crops.
These methods are primarily important for check and balance mode for the soil and
water pollution. It is almost necessary before discharging polluted WW into soil or
water bodies. In the heavy metal remediation point of view, it is crucial for organic
load containing metals or solid disposal in natural systems.
6.8.2 Chemical Remediation
It is mostly used for the removal of heavy metal from a smaller area. In this head it
consists of chemical precipitation, coagulation and flocculation, electrochemical
treatments, ion exchange, membrane filtration, and electrodialysis. The chemical
precipitation method is one of the widely used methods, in which use of chemical
formed insoluble precipitation with metals as hydroxide, carbonate, sulfide, and
phosphate ions. Fine particle coagulates into bigger particle and can be removed by
physical methods. The coagulation and flocculation methods are based on zeta
potential. Apart from these, electric field is also used for the remediation of pollut-
ant from liquid medium. The opposite ions of metals are accumulated on the metal-
bearing cathode plate and insoluble anode. These methods are costly in nature and
require highly skilled persons.
In these techniques various substances comprised with organic and inorganic in
nature are using for the remediation of heavy metals from environment (Dotaniya
et al. 2016a). These are reacting with various heavy metals and converted into non-
toxic or less available to plant and microbes. Some of the substances are responsible
for the immobilization of a particular metal, whereas few are used for more than one
metal. The inorganic binder, i.e. clay (bentonite or kaolinite), fly ash, basic slag,
calcium carbonate, and Fe/Mn oxides, is described in Table 6.4; and organic
stabilizers such as various types of manure, organic residues, composts, and a com-
bination of organic and inorganic substances listed in Table 6.5 may be used for the
immobilization of heavy metals. Organic residues are used for the plant nutrient
mobilization (Dotaniya 2014, Dotaniya et al. 2014b; Dotaniya et al. 2015b) and also
use for the reduction of heavy metal in soil. The organic residues decompose with the
help of soil microbial population and act as a biosorption (Dotaniya 2012; Dotaniya
et al. 2012c; Meena et al. 2017). Low-molecular organic acids released during the
microbial decomposition of organic material by soil biota (Dotaniya and Datta 2014;
Dotaniya et al. 2014e) bind the metal or decomposed the metal and ultimately
reduced the metal toxicity (Guo et al. 2006). On the other side of the decomposition,
it released the plant nutrients, which also enhanced the crop plant immunity (Dotaniya
et al. 2013b, 2014a). The use of biochar reduced the metal toxicity particularly Cd
in spinach crop (Coumar et al. 2016a, b). The efficiency of applied organic and
Table 6.4 Inorganic amendments for heavy metal immobilization (Guo et al. 2006)
Material Source Heavy metal immobilization
Lime Lime factory Cd, Cu, Ni, Pb, Zn
Phosphate salt Fertilizer plant Pb, Zn, Cu, Cd
Hydroxyapatite Phosphorite Zn, Pb, Cu, Cd
Fly ash Thermal power plant Cd, Pb, Cu, Zn, Cr
Slag Thermal power plant Cd, Pb, Zn, Cr
Ca-montmorillonite Mineral Zn, Pb
Portland cement Cement plant Cr, Cu, Zn, Pb
Bentonite – Pb
Table 6.5 Organic amendments for heavy metal immobilization (Guo et al. 2006)
Material Heavy metal immobilization
Bark saw dust (from timber industry) Cd, Pb, Hg, Cu
Xylogen (from paper mill wastewater) Zn, Pb, Hg
Chitosan (from crab meat-canning industry) Cd, Cr, Hg
Bagasse (from sugarcane industry) Pb
Poultry manure (from poultry farm) Cu, Pb, Zn, Cd
Cattle manure (from cattle farm) Cd
Rice hulls (from rice processing) Cd, Cr, Pb
Sewage sludge Cd
Leaves Cr, Cd
Straw Cd, Cr, Pb
inorganic substances is affected by climatic factors and soil parameters (Dotaniya

2013; Dotaniya et al. 2013a). The increase in the atmospheric temperature enhanced
the photosynthetic rate in low-temperature regions and increased the root exudation
in soil (Kushwah et al. 2014; Dotaniya et al. 2018). Soil microbes take root exudates
as a food material and increased the microbial population and diversity (Dotaniya
and Kushwah 2013). It helps to reduce the metal toxicity toward plants. The carbon
sequestration potential of soil enhanced the plant sustainability in abiotic stress con-
dition (Kundu et al. 2013; Meena et al. 2016), because more carbon sequestra-
tion helps in nutrient mobilization from soil (Sharma et al. 2014a, b; Dotaniya 2015;
Dotaniya et al. 2016e, g). The silicon fertilization in rice crop enhanced the abiotic
stress and improved the crop yield (Meena et al. 2013b).
6.8.3 Bioremediation
Bioremediation is the removal of heavy metal from polluted soil and WW with the
help of biological techniques. The techniques are classified into (1) bioremediation
by microorganism and (2) bioremediation by plants known as phytoremediation.
6.8.3.1 Bioremediation by Microorganism
In this method, suitable microorganisms are used for the removal of heavy metals.
In this method microorganism converted toxic metal to nontoxic or less toxic sub-
stances (Lata and Dotaniya 2013a). Technologies can be categorized into in situ or
ex situ as per the place of treatment. In in situ, contaminated soil or water is treated
at polluted sites; in ex situ conditions, contaminants can be displaced from polluted
sites and remediated. For the removal of heavy metals from activated sludge, micro-
organism treatments break down the organic material with aeration and agitation
and finally allow solids to settle down in the bottom of the sewage treatment plants.
A particular type of microorganisms is responsible for a specific type of metal
removal (Lata and Dotaniya 2013b). The part of the metals is taken by
microorganism as food materials and converted as nontoxic substances (Saha et al.

2017). These microorganisms are specific in nature and also sensitive to climatic
factors. However, all the metals are not treated or remediated easily by microorgan-
isms. For example, Cd and Pb are not readily absorbed by the microorganisms. The
availability of food materials for soil biota enhanced the bioremediation rate in WW
and contaminated soils (Pingoliya et al. 2014a, b; Singh et al. 2016). Increasing the
N availability in contaminated soil may encourage the heavy metal biodegradation
(Sims 2006). These efficient microorganisms used for the metal remediation func-
tion are known as bioremediators (Meena et al. 2013a; Singh et al. 2016). If fungi
are used for the removal of heavy metals, they are known as mycoremediation. In
this line, a lot of work is going on to understand the different pathways and regula-
tory network to remediate from various contaminated systems. Calculate the C flux
from different systems for the environmental aspect for a particular compound vis-
a-vis microorganisms. The genetically engineered microorganisms may be impor-
tant in the process of bioremediation. The bacterium Deinococcus radiodurans is
modified with the help of genetic engineering for remediation of toluene and ionic
mercury from the radioactive reactor WW and solids (Brim et al. 2000). These tech-
niques are specific for a particular metal and microorganisms and need specific tool
and techniques for the remediation purpose (Dotaniya et al. 2016b). The higher cost
for installation of modern equipment and hygienic conditions is also needed for
bioremediation with microorganisms.
6.8.3.2 Phytoremediation
Use of various types of plants for the remediation of metals from contaminated
environment is known as phytoremediation. It can be used for the removal of organic
pollutant, trace metals, and radioactive materials from polluted soil and aquatic bod-
ies. It is cost-effective, environmental, eco-friendly, and driven by the solar energy.
It is used as in situ application and required less technical skill. The phytoremedia-
tion consists with two words: Greek phyto means plants and Latin remediation
tends to correct or remove an evil. The green plants have immense potential to
remediate pollutant and also detoxification by various mechanisms. This concept
(as phytoextraction) was suggested by Chaney (1983). The phytoremediation tech-
niques include phytoexpraction, phytofiltration, phytovolatilization, phytostabiliza-
tion, phytodegradation, phytotransformation, removal of aerial contaminants, etc. A
list of methods, action mechanism, and medium treated is given in Table 6.6.
6.8.3.3 Hyperaccumulator Plants
Those plants have higher capacity of heavy metal adsorption in plant parts as com-
pared to normal plants. These plants are not showing any adverse effect on plant
growth. Such type of plants is specific with a particular metal or a group of metals.
Plants that accumulated heavy metals in various parts are listed in Table 6.7.
Table 6.6 List of phytoremediation strategies (Yang et al. 2005; Dotaniya and Lata 2012)
Phytoremediation techniques Action mechanism Medium treated
Phytoextraction Direct accumulation of contaminants Soil
into plant shoots with subsequent
removal of the plant shoots
Rhizofiltration Absorb and adsorb pollutants in plant Surface water and
(phytofiltration) roots water pumped through
roots
Phytostabilization Root exudates cause metals to Groundwater, soil,
precipitate, and biomass becomes less mine tailings
bioavailable
Phytovolatilization Plant evaporates certain metal ions and Soil, groundwater
volatile organics
Phytodegradation (plant- Microbial degradation in the Groundwater within the
assisted bioremediation) rhizosphere region rhizosphere and soil
Phytotransformation Plant uptake of organic contaminants Surface and
and degradation groundwater
Removal of aerial Uptake of various volatile organics by Air
contaminants leaves
Table 6.7 Heavy metal distribution in hyperaccumulators at tissue/cellular level

Tissue/organ Element Plant species Reference
Trichone Zn, Cd Arabidopsis halleri Kupper et al. (1999)
Cd Brassica juncea Salt et al. (1995)
Ni Alyssum lesbiacum Kramer et al. (1997)
Epidermal Zn T. caerulescens Kupper et al. (1999)
Zn T. caerulescens Vazquez et al. (1994)
Ni Alyssum Kramer et al. (1997)
Mesophyll Zn Arabidopsis halleri Kupper et al. (1999)
Cd Sedum alfredi H. Xiong et al. (2004)
Cell wall Ni T. goesingense Kramer et al. (2000)
Cu Elsholtzia splendens Yang (2002)
Zn Sedum alfredii H. Kramer et al. (2000)
Pb Sedum alfredii H. He et al. (2003)
Vacuole Zn T. caerulescens Kupper et al. (1999)
Zn T. caerulescens Vazquez et al. (1994)
Cd Sedum alfredii H. Xiong et al. (2004)
Zn Sedum alfredii H. Kramer et al. (2000)
The hyperaccumulator plant should have higher capacity to produce plant bio-
mass and suitable for a wide range of contamination. Hyperaccumulator plants do
not transfer the metal into edible parts. The capacity of phytoremediation can be
enhanced through inserting various foreign genes into plants through genetic engi-
neering or biotechnological techniques (Table 6.8).
Table 6.8 Genes introduced into plants and the effects of their expression on heavy metal
tolerance, accumulation, or volatilization (Yang et al. 2005)
Gene Product Source Target Maximum observed effecta
merA Hg(II) reductase Gram-negative Liriodendron 50 μmol L−1 HgCl2;
bacteria tulipifera 500 mg HgCl2 kg−1
Nicotiana V: Hg-volatilization rate
tabacum increase 10 fold
merA Hg (II) reductase Gram-negative Arabidopsis T: 10 μmol L−1 CH3HgCl
bacteria thaliana (>40-fold)
merB Organomercurial Gram-negative A. thaliana V: upto 59 pg Hg(0) mg−1
lyase bacteria fresh biomass min−1
APS1 ATP sulfurylase A. thaliana B. juncea A: twofold increase in Se
concentration
MT-I MT Mouse N. tabacum T: 200 μmol L−1 CdCl2
(20-fold)
CUP1 MT Saccharomyces B. oleracea T: 400 μmol L−1 CdCl2
cerevisiae (approximately 16-fold)
gsh2 GSH synthase E. coli B. juncea A: Cd concentration 125%
gsh1 Γ-Glu-Cys E. coli B. juncea A: Cd concentration 190%
synthase
NtCBP4 Cation channel N. tabacum N. tabacum T: 250 μmol L−1 NiCl2
(2.5-fold), Pb sensitive
A: Pb concentrations
200%
ZAT1 Zn transporter A. thaliana A. thaliana T: Slight increase
TaPCS1 PC Wheat Nicotiana A: Pb concentrations
glauca R. 200%
Graham
A accumulation in the shoot, GSH glutathione, MT metallothionein, T tolerance, V volatilization
Relative values refer to control plants not expressing the transgene
a
Hyperaccumulation or the removal of metals from soil or water system can be

calculated with various parameters, i.e., bioconcentration factors, translocation fac-
tor, and translocation efficiency and crop removal with the help of below formulas.
Bioconcentration Factor (BCF) It is defined as the contamination removal capac-
ity of the plant and was calculated by Zhuang et al. (2007).
Crharvested tissue
BCF =
Crsoil / water
Here, Crharvested tissue is a concentration of Cr in harvested plant parts (root, shoot),

and Crsoil is total applied Cr levels of respective treatment.
Translocation Factor (TF) Means transfer of Cr metal ions from root to shoot part
and quantified by formula proposed by Adesodun et al. (2010).
Crshoots
TF =
Crroots
Translocation Efficiency (TE) TE was calculated with the help of formula

described by Meers et al. (2004).
Crcontent in shoots ( mg / kg )
TE ( % ) = × 100
Crcontent in the whole plant
The Cr Removal (%) Percent Cr removal represented the Cr removal capacity of

the crop with respect to contamination level; it was calculated as per given
formula:
Total Cr uptake by plant

Cr removal ( x ) =
Total Cr applied to the soil
= Cr removal ( % ) = Value ( x ) × 100
6.8.3.3.1 Phytoextraction
In this technique, plant uptake contaminants from soil and water through plant roots
and accumulate in aboveground parts, i.e. shoots. This is also known as phytoaccu-
mulation, phytoabsorption, or phytosequestration. This process which stored metal
in shoot is a crucial biochemical process; and researches are focused more on poten-
tial uptake in aboveground part, because the root biomass is generally not feasible
(Tangahu et al. 2011). Phytoextraction may be classified into two types.
6.8.3.3.1.1 Natural Phytoextraction

It is usually conducted through planting selected species in the contaminated soil.
These plants are grown under normal farming conditions to reach the optimal size,
harvested and disposed of appropriately. The plants (such as Pteris vittata) are
highly specialized, occur naturally, and can tolerate highly elevated concentrations
of metals that would be toxic to other plants. Typically, these plants are small, have
a shallow root system, and grow relatively slowly.
6.8.3.3.1.2 Induced Phytoextraction

In non-hyperaccumulator plants such as Thlaspi perfoliatum, factors limiting their
potential for phytoextraction include small root uptake and little root-shoot translo-
cation of metals. Methods that use metal-mobilizing agents have been proposed
specifically to overcome these limitations. Following this approach, a high-biomass
crop is grown on the contaminated soil requiring remediation. Throughout the
growth period, amendments are added to the soil to increase availability of metals
to the plants. The most commonly used agents for induced phytoextraction are eth-
ylenediaminetetraacetic acid (EDTA), diethylenetriaminepentaacetic acid (DTPA),
cyclohexylenedinitrilotetraacetic acid (CDTA), citric acid, etc.
6.8.3.3.2 Phytofiltration
This technique is also little bit similar to phytoextraction but is concerned with the
remediation of contaminated groundwater rather than the remediation of polluted
soils. The contaminants are absorbed or adsorbed, and thus their movement is less
in underground water. This method is also known as rhizofiltration (by roots),
blastofiltration (by seedlings), and caulofiltration (used plant shoots) (Mesjasz-
Przybylowicz et al. 2004). Plants (such as Helianthus annuus used for rhizofiltra-
tion are not planted directly but are acclimated to the pollutant first. Plants are
hydroponically grown in clean water rather than the soil until a large root system
develops. Once a large root system is in place, the water supply is substituted for a
polluted water supply to acclimatize the plant. Then they are planted in the polluted
area where the roots uptake the polluted water and the contaminants along with it.
As the roots become saturated, they are harvested and disposed of safely.
6.8.3.3.3 Phytostabilization
Phytostabilization is the process in which plants (Festuca rubra L, Agrostis tenuis)

are used to immobilize soil and water contaminants. It mainly focuses on sequester-
ing pollutants in soil near the roots rather than in the plant tissues itself. Pollutants
become less bioavailable, and livestock, wildlife, and human exposure are reduced.
The contaminants are absorbed and accumulated by the roots, adsorbed onto the
roots, or precipitated in the rhizosphere. This reduces or even prevents the contami-
nants migrating into the groundwater or air as well as the bioavailability of the
contaminant which prevent its spread through the food chain. This technique can
also be used to reestablish a plant community on sites that have been denuded due
to high levels of metal contamination. Once a community of tolerant species has
been established, the potential for wind erosion (and thus spread of the pollutant)
and the leaching of the soil contaminants is also reduced. Phytostabilization involves
three processes which include humification, lignification, and irreversible binding.
6.8.3.3.4 Phytovolatilization
It refers to the process through which plants uptake water-soluble contaminants and
release them into the atmosphere as they transpire water. As the water travels along
the plant’s vascular system from the roots to the leaves, the contaminant may be
modified whereby it evaporates or volatilizes into the air surrounding the plant.
Phytovolatilization is relevant in the remediation of soils rich in mercury, selenium,

and to some extent in arsenic. The mercury ion is transformed into less toxic ele-
mental mercury, and selenium is lost to the atmosphere in the form of dimethyl
selenide (DMSe). It is also applicable for the removal of organic contaminants. For
example, poplar trees have been shown to volatilize 90% of the TCE they take up.
6.8.3.3.5 Phytodegradation
In this process plant secreted various types of enzymes, i.e., dehalogenase and oxy-
genase through root cells, which break down the organic pollutants in soil (Vishnoi
and Srivastava 2008; Dotaniya and Lata 2012). Some contaminants can be absorbed
by the plants and broken down by their enzymes. These smaller pollutant molecules
may then be used as metabolites by the plant as it grows, thus becoming incorpo-
rated into the plant tissues. Plant enzymes that break down ammunition wastes,
chlorinated solvents such as trichloroethane (TCE), have been identified.
6.9 Conclusions
Heavy metal pollution is emerging with time, and the functional capacities of natu-
ral resources are shrinking toward production of food materials. The increasing crop
production on limited land with poor-quality resources is a challenge to researcher
and policy-maker across the globe. The use of poor-quality soil and water after
proper management is needed for today and tomorrow. The poor-quality water or
industrial effluent is having trace metal, which is carcinogenic in nature and affects
the natural biochemical mechanism in living organisms. More focus on the safe
utilization of poor-quality water and contaminated soil after proper remediation or
treatment. In present context, one industry is located at nearby the other industrial
unit and the effluent merging at a common point and utilized for various purposes.
The multi-metal toxicity should be identified, and proper strategies should be made
to reduce the metal inhaled in human body. The effect of climate change on heavy
metal uptake pattern in soil and in crop should be investigated. The extension of
phytoremediation techniques in urban and contaminated areas also needs attention.
The uses of modern biotechnological with traditional techniques are in combination
to combat the heavy metal toxicity. Public awareness is also a need of today regard-
ing heavy metal toxicity with the help of government agencies as well as nongov-
ernment agencies (NGOs) for sustainable crop production.
Acknowledgment Authors are highly thankful to Dr Kuldeep Kumar, Scientist, ICAR-Indian

Institute of Soil and Water Conservation, Dehradun, India, for the needful help during the writing
of the manuscript.
References
Adesodun JK, Atayese MO, Agbaje TA, Osadiaye BA, Mafe OF, Soretire AA (2010)
Phytoremediation potentials of sunflowers (Tithonia diversifolia and Helianthus annuus) for
metals in soils contaminated with zinc and lead nitrates. Water Air Soil Pollut 207:195–201
solubilizing microorganisms for sustainable agriculture. Springer, New Delhi, pp 293–313
Ajay, Dotaniya ML, Meena VD (2012) Zinc-an important element for biofortification. Agrobios
Newsl XI(7):30–31
Alam MGM, Snow ET, Tanaka A (2003) Arsenic and heavy metal contamination of vegetables
grown in Samta village, Bangladesh. Sci Total Environ 308:83–96
Alonso JM, Hirayama T, Roman G, Nourizadeh S, Ecker JR (1999) A bifunctional transducer of
ethylene and stress responses in Arabidopsis. Science 284:2148–2152
Assuncao AGL, Martins PD, De Folter S, Vooijs R, Schat H, Aarts MGM (2001) Elevated expres-
sion of metal transporter genes in three accessions of the metal hyperaccumulator Thlaspi
caerulescens. Plant Cell Environ 24(2):217–226
Ball JW, Izbicki JA (2004) Occurrence of hexavalent chromium in groundwater in the Western
Mojave Desert, California. Appl Geochem 19(7):1123
Bartlett RJ, Kimble JM (1976) Behaviour of chromium in soils. II. Hexavalent forms. J Environ
Qual 5:383–386
Belouchi A, Kwan T, Gros P (1997) Cloning and characterization of the OsNramp family from
Oryza sativa, a new family of membrane proteins possibly implicated in the transport of metal
ions. Plant Mol Biol 33:1085–1092
Bhatia M, Babu RS, Sonawane SH, Gogate PR, Girdhar A, Reddy ER, Pola M (2016) Application
of nanoadsorbents for removal of lead from water. Int J Environ Sci Technol 14:1135–1154
Bodek I, Lyman WJ, Reehl WF, Rosenblatt DH (1988) Environmental inorganic chemistry: prop-
erties, processes and estimation methods. Pergamon Press, Elmsford
Bolan NS, Adrino DC, Natesan R, Bon-jun K (2003) Reduction and phytoavailability of Cr (VI) as
influenced by organic manure compost. J Environ Qual 32:120–128
Brim H, McFarlan SC, Fredrickson JK, Minton KW, Zhai M, Wackett LP, Daly MJ (2000)
Engineering Deinococcus radiodurans for metal remediation in radioactive mixed waste envi-
ronments. Nat Biotechnol 18(1):85–90
Campbell PGC (2006) Cadmium-A priority pollutant. Environ Chem 3(6):387–388
Chabukdhara M, Nema AK (2012) Assessment of heavy metal contamination in Hindon River
sediments: a chemometric and geo chemical approach. Chemotherapy 87:945–953
Chaney RL (1983) Plant uptake of inorganic waste constituents. In: Parr JFEA (ed) Land treatment
of hazardous wastes. Noyes Data Corp, Park Ridge, pp 50–76
Chowdhury TR, Basu GK, Mandal BK, Biswas BK, Samanta G, Chowdhury UK (1999) Arsenic
poisoning in the Ganges Delta. Nature 401:545–546
Coumar MV, Parihar RS, Dwivedi AK, Saha JK, Lakaria BL, Biswas AK, Rajendiran S, Dotaniya
ML, Kundu S (2016a) Pigeon pea biochar as a soil amendment to repress copper mobility in
soil and its uptake by spinach. BioResources 11(1):1585–1595
Coumar MV, Parihar RS, Dwivedi AK, Saha JK, Rajendiran S, Dotaniya ML, Kundu S (2016b)
Impact of pigeon pea biochar on cadmium mobility in soil and transfer rate to leafy vegetable
spinach. Environ Monit Assess 188:31
pp 77–98
Dotaniya ML (2012) Crop residue management in rice-wheat cropping system. Lap Lambert
Academic Publisher, Germany
Dotaniya ML (2013) Impact of various crop residue management practices on nutrient uptake by
rice-wheat cropping system. Curr Adv Agric Sci 5(2):269–271
Dotaniya ML (2014) Role of bagasse and pressmud in phosphorus dynamics. Lap Lambert
Academic Publisher, Germany
Dotaniya ML (2015) Impact of rising atmospheric CO2 concentration on plant and soil process.
In: Mohanty M, Sinha NK, Hati KM, Chaudhary RS, Patra AK (eds) Crop growth simulation
modelling and climate change. Scientific Publisher, New Delhi, pp 69–86
Dotaniya ML, Datta SC (2014) Impact of bagasse and press mud on availability and fixation
capacity of phosphorus in an inceptisol of north India. Sugar Tech 16(1):109–112
Dotaniya ML, Kushwah SK (2013) Nutrients uptake ability of various rainy season crops grown in
a vertisol of central India. Afr J Agric Res 8(44):5592–5598
Dotaniya ML, Lata M (2012) Cleaning soils with phytoremediation. Geo You 12(73):18–21
Dotaniya ML, Meena VD (2013) Rhizosphere effect on nutrient availability in soil and its uptake
by plants -a review. Proc Natl Acad Sci India Sec B Biol Sci 85(1):1–12
Dotaniya ML, Saha JK (2017) Sewage farming: a potential threat to agriculture. Indian Farmers
Dig 1:14–21
Dotaniya ML, Ajay, Meena BP, Kundu S (2012a) Soil pollution: a necessary evil. Agrobios Newsl
X(12):39–40
Dotaniya ML, Ajay, Meena BP, Kundu S, Meena VD (2012b) Phytoremediation: a cost-effective
technique. Agrobios Newsl XI(3):79–80
Dotaniya ML, Meena HM, Rajendiran S, Coumar MV, Verma R (2012c) Biosorption of heavy
metal with agro waste. Agrobios Newsl XI(7):37
Dotaniya ML, Datta SC, Biswas DR, Meena BP (2013a) Effect of solution phosphorus concentra-
tion on the exudation of oxalate ions by wheat (Triticum aestivum L.) Proc Natl Acad Sci India
Sec B Biol Sci 83(3):305–309
Dotaniya ML, Sharma MM, Kumar K, Singh PP (2013b) Impact of crop residue management
on nutrient balance in rice-wheat cropping system in an Aquic hapludoll. J Rural Agric Res
13(1):122–123
Dotaniya ML, Prasad D, Meena HM, Jajoria DK, Narolia GP, Pingoliya KK, Meena OP, Kumar K,
Meena BP, Ram A, Das H, Chari MS, Pal S (2013c) Influence of phytosiderophore on iron and
zinc uptake and rhizospheric microbial activity. Afr J Microbiol Res 7(51):5781–5788
Dotaniya ML, Meena HM, Lata M, Kumar K (2013d) Role of phytosiderophores in iron uptake by
plants. Agric Sci Dig 33(1):73–76
Dotaniya ML, Meena HM, Lata M (2013e) Heavy metal toxicity: pandora’s box for human dis-
ease. Read Shelf 9(6):5–6
Dotaniya ML, Meena HM, Lata M, Jajoria DK, Meena MD (2013f) Use of biosolids in agriculture.
Agrobios Newsl XI(8):21–22
Dotaniya ML, Datta SC, Biswas DR, Meena HM, Kumar K (2014a) Production of oxalic acid as
influenced by the application of organic residue and its effect on phosphorus uptake by wheat
(Triticum aestivum L.) in an inceptisol of north India. Natl Acad Sci Lett 37(5):401–405
Dotaniya ML, Datta SC, Biswas DR, Kumar K (2014b) Effect of organic sources on phosphorus
fractions and available phosphorus in Typic Haplustert. J Indian Soc Soil Sci 62(1):80–83
Dotaniya ML, Saha JK, Meena VD, Rajendiran S, Coumar MV, Kundu S, Rao AS (2014c) Impact
of tannery effluent irrigation on heavy metal build up in soil and ground water in Kanpur.
Agrotechnology 2(4):77
Dotaniya ML, Das H, Meena VD (2014d) Assessment of chromium efficacy on germination, root
elongation, and coleoptile growth of wheat (Triticum aestivum L.) at different growth periods.
Environ Monit Assess 186:2957–2963
Dotaniya ML, Kushwah SK, Rajendiran S, Coumar MV, Kundu S, Rao AS (2014e) Rhizosphere
effect of kharif crops on phosphatases and dehydrogenase activities in a Typic Haplustert. Natl
Acad Sci Lett 37(2):103–106
Dotaniya ML, Meena VD, Das H (2014f) Chromium toxicity on seed germination, root elongation
and coleoptile growth of pigeon pea (Cajanus cajan). Legum Res 37(2):225–227
Dotaniya ML, Pingoliya KK, Lata M, Verma R, Regar KL, Deewan P, Dotaniya CK (2014g) Role
of phosphorus in chickpea (Cicer arietinum L.) production. Afr J Agric Res 9(51):3736–3743
Dotaniya ML, Thakur JK, Meena VD, Jajoria DK, Rathor G (2014h) Chromium pollution: a threat
to environment. Agric Rev 35(2):153–157
Dotaniya ML, Saha JK, Meena VD (2015a) Sewage water irrigation boon or bane for crop produc-
tion. Indian Farm 65(12):24–27
Dotaniya ML, Datta SC, Biswas DR, Meena HM, Rajendiran S, Meena AL (2015b) Phosphorus
dynamics mediated by bagasse, press mud and rice straw in inceptisol of North India.
Agrochimica 59(4):358–369
Dotaniya ML, Meena VD, Basak BB, Meena RS (2016a) Potassium uptake by crops as well as
microorganisms. In: Meena VS, Maurya BR, Verma JP, Meena RS (eds) Potassium solubilizing
microorganisms for sustainable agriculture. Springer, New Delhi, pp 267–280
Dotaniya ML, Datta SC, Biswas DR, Dotaniya CK, Meena BL, Rajendiran S, Regar KL, Lata M
(2016b) Use of sugarcane industrial byproducts for improving sugarcane productivity and soil
health-a review. Intl J Rec Org Waste Agric 142:1583–1608
Dotaniya ML, Kundu S, Saha JK (2016c) Role of biotechnology in environmental monitoring and
pollution control. Kheti 6:26–28
Dotaniya ML, Meena VD, Rajendiran S, Coumar MV, Saha JK, Kundu S, Patra AK (2016d) Geo-
accumulation indices of heavy metals in soil and groundwater of Kanpur, India under long term
irrigation of tannery effluent. Bull Environ Contam Toxicol 98:706–711
Dotaniya ML, Meena VD, Srivastava A (2016e) Plastic pollution: a threat to ecosystem. Indian
Farm 66(3):12–14
Dotaniya ML, Rajendiran S, Meena BP, Meena AL, Meena BL, Jat RL, Saha JK (2016f) Elevated
carbon dioxide (CO2) and temperature vis- a-vis carbon sequestration potential of global ter-
restrial ecosystem. In: Bisht JK, Meena VS, Mishra PK, Pattanayak A (eds) Conservation
agriculture: an approach to combat climate change in Indian Himalaya. Springer, Singapore,
pp 225–256
Dotaniya ML, Rajendiran S, Meena VD, Saha JK, Coumar MV, Kundu S, Patra AK (2016g)
Influence of chromium contamination on carbon mineralization and enzymatic activities in
Vertisol. Agric Res 6:91–96
Dotaniya ML, Meena VD, Kumar K, Meena BP, Jat SL, Lata M, Ram A, Dotaniya CK, Chari MS
(2016h) Impact of biosolids on agriculture and biodiversity. Today and Tomorrow’s Printer and
Publisher, New Delhi, pp 11–20
Dotaniya ML, Dotaniya CK, Sanwal RC, Meena HM (2018) CO sequestration and transformation
potential of agricultural system. In: Martínez L, Kharissova O, Kharisov B (eds) Handbook of
ecomaterials. Springer, Cham. https://doi.org/10.1007/978-3-319-48281-1_87-1
Guertin J (2005) Toxicity and health effects of chromium (all oxidation states). In: Guertin J,
Jacobs JA, Avakian CP (eds) Chromium (VI) handbook. CRC Press, Boca Raton, pp 216–234
Gunatilake SK (2015) Methods of removing heavy metals from industrial wastewater. J Multidiscip
Eng Sci Stud 1(1):12–18
Guo G, Zhou Q, Ma LQ (2006) Availability and assessment of fixing additives for the in situ reme-
diation of heavy metal contaminated soils: a review. Environ Monit Assess 116(1–3):513–528
GWRTAC (1997) Remediation of metals-contaminated soils and groundwater, Tech Rep TE-97-01.
GWRTAC, Pittsburgh
Halim M, Conte P, Piccolo A (2003) Potential availability of heavy metals to phytoextraction from
contaminated soils induced by exogenous humic substances. Chemosphere 52(1):265–275
Hassan N, Ahmed K (2000) Intra familiar distribution of food in rural Bangladesh. Institute of
Nutrition and food Science, University of Dhaka, Bangladesh. Internet http://www.unu.edu/
unpress/food/8F064e/
He B, Yang XE, Ni WZ, Wei YZ, Ye HB (2003) Pb uptake, accumulation, subcellular distribution
in a Pb-accumulating ecotype of Sedum alfredii (Hance). J Zhejiang Univ Sci 4(4):474–479
Hirayama T, Kieber JJ, Hirayama N (1999) Responsive-toantagonist1, a Menkes/Wilson disease-
related copper transporter, is required for ethylene signaling in Arabidopsis. Cell 97(3):383–393
Hughes MF (2002) Arsenic toxicity and potential mechanisms of action. Toxicol Lett 133:1–16
IRIS (2015) Integrated risk information system-database. US Environmental Protection Agency,
Washington, DC
James BR, Bartlett RJ (1983) Behaviour of chromium in soils. VIII. Adsorption and reduction of
hexavalent forms. J Environ Qual 12:177–181
Knight B, Zhao FJ, McGrath SP, Shen ZG (1994) Zinc and cadmium uptake by hyperaccumulator
Thlaspi caerulescens in contaminated soils and its effects on the concentration and chemical
speciation of metals in soil solution. Plant Soil 197:71–78
Kong SF, Lu B, Ji YQ, Zhao XY, Chen L, Li ZY, Han B, Bai ZP (2011) Levels, risk assessment
and sources of PM10 fraction heavy metals in four types dust from a coal-based city. Microchem
J 98:280–290
Kramer U, Smith RD, Wenzel WW, Raskin I, Salt DE (1997) The role of metal transport and
tolerance in nickel hyperaccumulation by Thlaspi goesingense Halacsy. Physiol Plant
115:1641–1650
Kramer U, Pickering IJ, Prince RC, Raskin I, Salt DE (2000) Subcellular localization and specu-
lation of nickel in hyperaccumulator and non-accumulator Thlaspi species. Plant Physiol
122:1343–1353
Kundu S, Dotaniya ML, Lenka S (2013) Carbon sequestration in Indian agriculture. In: Lenka S,
Lenka NK, Kundu S, Rao AS (eds) Climate change and natural resources management. New
India Publishing Agency, New Delhi, pp 269–289
Kupper H, Zhao FJ, McGrath SP (1999) Cellular compartmentation of zinc in leaves of the hyper-
accumulator Thlaspi caerulescens. Plant Physiol 119:305–311
Kushwah SK, Dotaniya ML, Upadhyay AK, Rajendiran S, Coumar MV, Kundu S, Rao AS (2014)
Assessing carbon and nitrogen partition in kharif crops for their carbon sequestration potential.
Natl Acad Sci Lett 37(3):213–217
Lata M, Dotaniya ML (2013a) Water pollution: a global problem. Read Shelf 9(12):9–10
Lata M, Dotaniya ML (2013b) Environmental pollution: a big challenge to control. Ind Farmers’
Dig 46(8):9–11
Lenka S, Rajendiran S, Coumar MV, Dotaniya ML, Saha JK (2016) Impacts of fertilizers use
on environmental quality. In: National seminar on environmental concern for fertilizer use in
future at Bidhan Chandra Krishi Viswavidyalaya, Kalyani on February 26, 2016
Lokhande RS, Singare PU, Pimple DS (2011) Toxicity study of heavy metals pollutants in waste
water effluent samples collected from Taloja industrial estate of Mumbai, India. Res Environ
1(1):13–19
Lombi E, Tearall KL, Howarth JR, Zhao FJ, Hawkesford MJ, McGrath SP (2002) Influence of
iron status on calcium and zinc uptake by different ecotypes of the hyperaccumulator Thlaspi
caerulescens. Plant Physiol 128:1359–1367
Losi ME, Amrhein C, Frankenberger WT (1994) Factor affecting chemical and biological reduc-
tion of Cr(VI) in soil. Environ Toxicol Chem 13:1727–1735
Ma LQ, Komar KM, Tu C, Zhang W, Cai Y, Kennelly ED (2001) A fern that hyperaccumulates
arsenic. Nature 409:579
Manahan SE (2003) Toxicological chemistry and biochemistry, 3rd edn. Boca Raton CRC Press/
Limited Liability Company (LLC)
Mascagni P, Consonni D, Bregante G, Chiappino G, Toffoletto F (2003) Olfactory function in
workers exposed to moderate airborne cadmium levels. Neurotoxicology 24:717–724
Maser P, Thomine S, Schroeder JI, Ward JM, Hirschi K, Sze H, Talke IN, Amtmann A, Maathuis
FJM, Sanders D, Harper JF, Tchieu J, Gribskov M, Persans MW, Salt DE, Kim SA, Guerinot
ML (2001) Phylogenetic relationships within cation transporter families of Arabidopsis. Plant
Physiol 126:1646–1667
doi.org/10.1007/978-81-322-2776-2_10
Meena VD, Dotaniya ML, Meena BP, Das H (2013a) Organic food safer but not healthy: truth in
myth. Ind Farmers Dig 46(8):43–44
Meena VD, Dotaniya ML, Rajendiran S, Coumar MV, Kundu S, Rao AS (2013b) A case for silicon
fertilization to improve crop yields in tropical soils. Proc Natl Acad Sci India Sec B Biol Sci
84(3):505–518
Meena VD, Dotaniya ML, Saha JK, Patra AK (2015a) Antibiotics and antibiotic resistant bac-
teria in wastewater: impact on environment, soil microbial activity and human health. Afr
J Microbiol Res 9(14):965–978
Meena RS, Meena VS, Meena SK, Verma JP (2015b) The needs of healthy soils for a healthy
Meena RS, Meena VS, Meena SK, Verma JP (2015c) Towards the plant stress mitigate the agricul-
Meena BP, Shirale AO, Dotaniya ML, Jha P, Meena AL, Biswas AK, Patra AK (2016) Conservation
agriculture: a new paradigm for improving input use efficiency and crop productivity. In: Bisht
JK, Meena VS, Mishra PK, Pattanayak A (eds) Conservation agriculture: an approach to com-
bat climate change in Indian Himalaya. Springer, Singapore, pp 39–69
Meena VS, Maurya BR, Meena SK, Meena RK, Kumar A, Verma JP, Singh NP (2017) Can Bacillus
species enhance nutrient availability in agricultural soils? In: Islam MT, Rahman M, Pandey
P, Jha CK, Aeron A (eds) Bacilli and agrobiotechnology. Springer International Publishing,
Cham, pp 367–395
Meers E, Hopgood M, Lesage E, Vervaeke P, Tack FMG, Verloo M (2004) Enhanced phytoextrac-
tion: in search for EDTA alternatives. Int J Phytoremed 6(2):95–109
Mesjasz-Przybylowicz J, Nakonieczny M, Migula P, Augustyniak M, Tarnawska M, Reimold
WU, Koeberl C, Przybylowicz W, Glowacka E (2004) Uptake of cadmium, lead, nickel and
zinc from soil and water solutions by the nickel hyperaccumulator Berkheya coddii. Acta Biol
Cracov Ser Bot 46:75–85
Muller G (1969) Index of geoaccumulation in sediments of the Rhine river. Geochem J 2:109–118
Pence NS, Larsen PB, Ebbs SD, Letham DLD, Lasat MM, Garvin DF, Eide D, Kochian LV (2000)
The molecular physiology of heavy metal transport in the Zn/Cd hyperaccumulator Thlaspi
caerulescens. Proc Natl Acad Sci U S A 97:4956–4960
Pierzynski GM, Sims JT, Vance GF (2000) Soils and environmental quality. CRC Press, Boca
Raton, pp 155–207
Pingoliya KK, Dotaniya ML, Lata M (2014a) Effect of iron on yield, quality and nutrient uptake
of chickpea (Cicer arietinum L.) Afr J Agric Res 9(37):2841–2845
Pingoliya KK, Mathur AK, Dotaniya ML, Jajoria DK, Narolia GP (2014b) Effect of phosphorus
and iron levels on growth and yield attributes of chickpea (Cicer arietinum L.) under agrocli-
matic zone IV A of Rajasthan, India. Legum Res 37(5):537–541
Pingoliya KK, Mathur AK, Dotaniya ML, Dotaniya CK (2015) Impact of phosphorus and iron on
protein and chlorophyll content in chickpea (Cicer arietinum L.) Legum Res 38(4):558–560
Rajendiran S, Dotaniya ML, Coumar MV, Panwar NR, Saha JK (2015) Heavy metal polluted soils
in India: status and countermeasures. JNKVV Res J 49(3):320–337
Rana L, Dhankhar R, Chhikara S (2010) Soil characteristics affected by long term application of
sewage wastewater. Int J Environ Res 4(3):513–518
Reed SC, Crites RW, Middlebrooks EJ (1995) Natural systems for waste management and treat-
ment. McGraw-Hill, New York
Roberts TL (2014) Cadmium and phosphorous fertilizers: the issues and the science. Procedia
Engin 83:52–59
Rusan MJM, Hinnawi M, Rousan L (2007) Long term effect of wastewater irrigation of forage
crops on soil and plant quality parameters. Desalination 215(1-3):143–152
Saha JK, Panwar N, Srivastava A, Biswas AK, Kundu S, Rao AS (2010) Chemical, biochemical,
and biological impact of untreated domestic sewage water use on Vertisol and its consequences
on wheat (Triticum aestivum) productivity. Environ Monit Assess 161(1-4):403–412
Saha JK, Rajendiran S, Coumar MV, Dotaniya ML, Kundu S, Patra AK (2017) Remediation and
management of polluted sites. In: Saha JK, Rajendiran S, Coumar MV, Dotaniya ML, Kundu
S, Patra AK (eds) Soil pollution - an emerging threat to agriculture. Springer, Singapore,
pp 317–372
Salt DE, Blaylock M, Kumar Nanda PBA, Dushenkov V, Ensley BD, Chet I, Raskin I (1995)
Phytoremediation: a novel strategy for the removal of toxic metals from the environment using
plants. Biotechnology 13:468–474
Sharma MM, Sharma YK, Dotaniya ML (2014a) Effect of press mud and FYM application with
zinc sulphate on yield of hybrid rice. J Environ Agric Sci 1:1–4
Sharma MM, Sharma YK, Dotaniya ML, Kumar P (2014b) Effect of different levels of FYM, press
mud and zinc sulphate application on soil properties. J Plant Dev Sci 6(3):455–459
Sims GK (2006) Nitrogen starvation promotes biodegradation of N-heterocyclic compounds in
soil. Soil Biol Biochem 38:2478–2480
Singh B (2002) Soil pollution and its control. In: Sekhon GS, Chhonkar PK, Das DK, Goswami
NN, Narayanaswamy G, Poonia SR, Rattan RK, Sehgal J (eds) Fundamental of soil science.
Ind Soc Soil Sci, New Delhi, pp 499–514
Singh R, Gautam N, Mishra A, Gupta R (2011) Heavy metals and living systems: an overview. Ind
J Pharmacol 43(3):246–253
Singh M, Dotaniya ML, Mishra A, Dotaniya CK, Regar KL (2016) Role of biofertilizers in con-
servation agriculture. In: Bisht JK, Meena VS, Mishra PK, Pattanayak A (eds) Conservation
agriculture: an approach to combat climate change in Indian Himalaya. Springer, Singapore,
pp 113–134
Smith LA, Means JL, Chen A, Alleman B, Chapman CC, Tixier JS, Brauning SE, Gavaskar AR,
Royer MD (1995) Remedial options for metals-contaminated sites. Lewis Publishers, Boca
Raton
Tabata K, Kashiwagi S, Mori H, Ueguchi C, Mizuno T (1997) Cloning of a cDNA encoding a
putative metal-transporting P-type ATPase from Arabidopsis thaliana. Biochim Biophys Acta
1326:1–6
Tangahu BV, Abdullah SRS, Basri H, Idris M, Anuar N, Mukhlisin M (2011) A review on heavy
metals (As, Pb, and Hg) uptake by plants through phytoremediation. Int J Chem Eng. https://
doi.org/10.1155/2011/939161
Tchounwou PB, Patlolla AK, Centeno JA (2003) Carcinogenic and systemic health effects associ-
ated with arsenic exposure-a critical review. Toxicol Pathol 31(6):575–588
Tchounwou PB, Centeno JA, Patlolla AK (2004) Arsenic toxicity, mutagenesis and carcinogen-
esis – a health risk assessment and management approach. Mol Cell Biochem 255:47–55
Thomine S, Wang R, Ward JM, Crawford NM, Schroeder JI (2000) Cadmium and iron transport
by members of a plant metal transporter family in Arabidopsis with homology to Nramp genes.
Proc Natl Acad Sci U S A 97:4991–4996
USDHHS (1999) Toxicological profile for lead. United States Department of Health and Human
Services, Atlanta
USEPA (1991) US environmental protection agency. Annual reports FY 1990, USEPA
report540/8-91/067. USEPA, Washington, DC
Van der Zaal BJ, Neuteboom LW, Pina JE, Chardonnens AN, Schat H, Verkleij JAC, Hooykaas
PJJ (1999) Overexpression of a novel Arabidopsis gene related to putative zinc-transporter
genes from animals can lead to enhanced zinc resistance and accumulation. Plant Physiol
199:1047–1055
Vazquez MD, Poschenrieder C, Barcelo J, Baker AJM, Hatton P, Cope GH (1994) Compartmentation
of zinc in roots and leaves of the zinc hyperaccumulator Thlaspi caerulescens J & C Presl. Bot
Acta 107:243–250

New Delhi, pp 99–110
Verret F, Gravot A, Auroy P, Leonhardt N, David P, Nussaume L, Vavasseur A, Richaud P (2004)
Overexpression of AtHMA4 enhances root-to-shoot translocation of zinc and cadmium and
plant metal tolerance. FEBS Lett 576:306–312
Vishnoi SR, Srivastava PN (2008) Phytoremediation-green for environmental clean. In: The 12
world lake conference, pp 1016–1021
Wei BG, Yang LS (2010) A review of heavy metal contaminations in urban soils, urban road dusts
and agricultural soils from China. Microchem J 94:99–107
WHO (1982) World Health Organization toxicological evaluation of certain food additives. Joint
FAO/WHO expert committee on food additives, WHO Food additive Series no. 683. World
Health Organization, Geneva
Williams LE, Pittman JK, Hall JL (2000) Emerging mechanisms for heavy metal transport in
plants. Biochim Biophys Acta 1465:104–126
Wuana RA, Okieimen FE (2011) Heavy metals in contaminated soils: a review of sources,
chemistry, risks and best available strategies for remediation. ISRN Ecol. https://doi.
org/10.5402/2011/402647
Xiong YH, Yang XE, Ye ZQ, He ZL (2004) Characteristics of cadmium uptake and accumulation
by two contrasting ecotypes of Sedum alfredii Hance. J Environ Sci Health 39:2925–2940
Yang MJ (2002) Copper hyperaccumulation in Elsholtzia splendens and its mechanisms. PhD dis-
sertation, Zhejiang University
Yang XE, Long XX, Ni WZ (2002) Physiological and molecular mechanisms of heavy metal
uptake by hyperaccumulating plant species. J Plant Nutr Fert 8:8–15
Yang X, Fenga Y, He Z, Stoffella PJ (2005) Molecular mechanisms of heavy metal hyperaccumu-
lation and phytoremediation. J Trace Elem Med Biol 18(4):339–353
Zhuang P, Yang QW, Wang HB, Shu WS (2007) Phytoextraction of heavy metals by eight plant
species in the field. Water Air Soil Pollut 184:235–242
Chapter 7
Biofertilizers Based on Bacterial
Endophytes Isolated from Cereals:
Potential Solution to Enhance These Crops
Lorena Celador-Lera, Alejandro Jiménez-Gómez, Esther Menéndez,

and Raul Rivas
Abstract Due to the increasing demand for the use of agricultural products, along
with new and more restrictive policies regarding the application of fertilizers, the
search for alternative ways to increase crop production in a responsible way with
respect to the environment is necessary, especially considering that the use of
nitrogen-based fertilizers are both very costly and polluting. As regards this chapter
focuses on the production of cereals because they represent the most important
source of total food consumption, particularly in developing countries with diets
based mainly on these types of crops. One possible solution is the application of
microbial-based fertilizers (biofertilizers) to enhance crop production. In the litera-
ture, bacteria that not only promote plant growth but are also capable of colonizing
the interior of plants, known as endophytic bacteria, have been described. Several
studies have characterized the different ways of locating these bacteria inside plants,
as well as the effects of their colonization. In addition, some entophytes are able to
fix nitrogen for their hosts, produce phytohormones (auxins, cytokinins, gibberel-
lins), degrade harmful compounds, decrease the effects of saline stress and improve
seed germination, among others benefits. Several companies have attempted to
L. Celador-Lera (*) · A. Jiménez-Gómez

Departamento de Microbiología y Genética, Universidad de Salamanca, Salamanca, Spain
e-mail: lorenacelador@usal.es
E. Menéndez
ICAAM (Instituto de Ciências Agrárias e Ambientais Mediterrânicas), Universidadede Évora,
Évora, Portugal
R. Rivas
Unidad Asociada Universidad de Salamanca-CSIC (IRNASA), Salamanca, Spain

https://doi.org/10.1007/978-981-10-8402-7_7
176 L. Celador-Lera et al.
exploit the positive effects caused by endophytic bacteria on their hosts by

developing different products, used worldwide (e.g. Inogro®, QuickRoots®), that are
based on these types of bacteria. The application of these products occurs despite
the governing legislation of the different countries where it is used, and there are
usually no specific regulations controlling the process of production, security and
marketing of these biofertilizers.
Keywords PGPBEs · Biofertilization · Maize · Azospirillum · Bioinoculants
7.1 Introduction
The United Nations Food and Agriculture Organization (FAO) estimates that the
total demand for agricultural products will be ~60% higher in 2030 than it is today.
Remarkably, developing countries comprise ~85% of the global food demand. For
over half a century, the world population has relied on modern agriculture for
enhancing crop yields. Cereals are the most important source of total food con-
sumption, especially in developing countries, where diets are based mainly on these
types of crops. World cereal production has significantly increased during the last
two decades, and during this time, the grain yields of several cereal crops has
increased to ~122% all over the world, responding to this ever-increasing demand
for food. However, this trend in grain production cannot be maintained due to the
decrease in the number of hectares of cultivable land, which has been dedicated to
rapidly growing urbanization (Mia and Shamsuddin 2010; Meena et al. 2013a,
2016a; Bahadur et al. 2014; Maurya et al. 2014; Jat et al. 2015; Kumar et al. 2015,
2016b; Ahmad et al. 2016; Parewa et al. 2014; Prakash and Verma 2016).
One of the most important factors in obtaining high-yield cereal crops is the
application of nitrogen-based fertilizers, which is why farmers apply high amounts
of these types of fertilizers that are both very costly and hazardous to the environ-
ment, especially when used indiscriminately. In addition, ~50% of applied
N-fertilizers are somehow lost through different bio-geological processes, which
not only represent an economical loss but also pollute the environment (Ladha et al.
1998). Thus, crop scientists all over the world are facing this alarming situation and
searching for cost-effective and biosafe alternatives (Jeyabal and Kupuswamy
2001). With this aim in mind, the scientific community needs to investigate ways to
increase crop production and at the same time to avoid the problems associated with
the overuse of fertilizers (García-Fraile et al. 2015).
Therefore, it is necessary to enhance crop productivity in a sustainable manner,
which does not exacerbate the problem of pollution. Furthermore, farmers need to
be open to the idea of using other kinds of fertilizing schemes, such as biofertilizers.
The application of plant growth-promoting bacteria, such as those used as biofertil-
izers, for sustainable agriculture may provide a solution to this problem (Meena
et al. 2015a, b, f, 2016b; Priyadharsini and Muthukumar 2016; Kumar et al. 2016a,
7 Biofertilizers Based on Bacterial Endophytes Isolated from Cereals… 177
2017; Raghavendra et al. 2016; Zahedi 2016; Rawat et al. 2016; Dotaniya et al.
2016; Jaiswal et al. 2016; Jha and Subramanian 2016).
The development of a proper biofertilizer requires: (i) isolation and selection of
bacteria, (ii) effective carrier selection, (iii) observation of modes of entry of endo-
phytic bacteria into the host plant, (iv) determining the mechanisms involved in
plant growth promotion, (v) verifying the effectiveness of inoculants, and (vi) to
check the biosafety of these strains for the environment and health (Berg and Smalla
2009; Chauhan et al. 2015). In addition, it is necessary to understand the nature of
the microorganisms before their use as biofertilizers in order to utilize only micro-
organisms safe for human health; this includes not only the consumer or end user
but also those handling the biofertilizers during their production (Meena et al.
2017). Strains belonging to the genera Azospirillum, Gluconacetobacter, Bacillus
or Azotobacter, among others, are currently commercialized as biofertilizers for
nonlegumes without any adverse effects being reported to date (Bashan 2014). In
this chapter, we revise the available data regarding plant growth promotion by bac-
terial endophytes isolated from different cereals and focus on their possible use in
biofertilization. Moreover, we will specifically focus on the culturomics approach,
analysing the role of cultivable microorganisms since they are essential for agricul-
ture and very important in the movement and availability of the minerals required
for plant growth (Yasin et al. 2016; Meena et al. 2016c, d; Saha et al. 2016a; Yadav
and Sidhu 2016; Das and Pradhan 2016; Dominguez-Nunez et al. 2016). Ultimately,
these microorganisms are essential for the partial or total reduction of synthetic
fertilizers (Malusá and Vassilev 2014).
7.2 ndophytic Bacteria: Definition, Importance

E
and Mechanisms of Action
For many years, scientists from all around the world have developed and published
several studies reporting on the great potential that some bacterial strains have in the
promotion of plant growth, namely, plant growth-promoting bacteria or PGPB,
through several mechanisms (García-Fraile et al. 2015). Many of these bacteria are
endophytes, which are defined as bacteria living inside a plant tissue (“endo”,
inside; “phyte”, plant). Some of them can influence plant growth and pertain to a
subset of the endophytic population called PGPBEs (Gaiero et al. 2013).The poten-
tial of PGPBEs to improve plant health has led to a great number of studies examin-
ing their applied use as inoculants, primarily in agricultural crops (Kuklinsky-Sobral
et al. 2004; García-Fraile et al. 2015). Because of these qualities, PGPBEs are
important candidates to be used as inoculants to reduce the need for chemicals, such
as pesticides and fertilizers, becoming important in the development of sustainable
agricultural practices (Saha et al. 2016b; Verma et al. 2014, 2015a, b; Meena et al.
2014a, 2015e; Sharma et al. 2016; Bahadur et al. 2016b).
In general, endophytes are more likely to show plant growth-promoting effects

than bacteria exclusively colonizing the rhizosphere (Conn et al. 1997; Chanway
et al. 2000). Also, some endophytes are better colonizers and are capable of outcom-
peting others present in the surroundings (Verma et al. 2004).Therefore, endophytes
(single or forming consortia) found in a particular plant species can be considered
as more competent and suitable for their reinoculation in the same plant crop from
which they were isolated.
7.2.1 Plant Root Colonization
Colonization and infection processes in cereals by endophytic bacteria differ from

leguminous plants. The infection process can take place at cracks, such as those
occurring at root emergence sites or those created by deleterious microorganisms,
as well as through cells situated at root tips (Reinhold-Hurek and Hurek 2011). To
successfully colonize the host plant, endophytic bacteria have specific traits, such as
flagella, cell wall degrading enzymes (CWDEs) or twitching motility, among others
(Lodewychx et al. 2002). Due to endophytic bacteria being able to penetrate into the
root of the host, they are better candidates than the bacteria found in the rhizosphere
for use as PGPB in plants (Meena et al. 2013b, 2015c, 2016e; Shrivastava et al.
2016; Velazquez et al. 2016; Bahadur et al. 2016a; Masood and Bano 2016; Teotia
et al. 2016).
Active and passive mechanisms have been reported for the translocation pro-
cesses of endophytic bacteria inside their plant hosts, allowing them to progress
from the rhizoplane to the cortex of the root system (Fig. 7.1). Once a bacterium
reaches the root cortical zone, a barrier such as the endodermis can block further
colonization of the inner tissues; only few bacteria are able to pass through the
endodermis (Gregory 2006). It is likely that endophytes able to pass through the
endodermis can secrete CWDEs allowing them to continue colonization through the
inner roots (James et al. 2002). Alternatively, some bacteria may passively enter as
a portion of this endodermal cell layer is often disrupted, such as during the growth
of secondary roots, which derive from the pericycle situated just below the endoder-
mis barrier (Gregory 2006). Under natural conditions, some deleterious bacteria can
also disrupt the endodermis, allowing endophytic bacteria at the same time to pass
into the central cylinder to further reach the root xylem vessels of their hosts
(Compant et al. 2010).
For example, Azorhizobium caulinodans are able to enter rice roots at emerging
lateral roots (lateral root cracks) by crack entry and move into intercellular space
within the cortical cell layer or roots (Goormachtig et al. 2004). Lateral root crack
colonization of rice was also observed with similar frequency following inoculation
with Azospirillum brasilense, where colonization was stimulated by naringenin and
other flavonoids (Jain and Gupta 2003).
In addition, some strains may have the ability to infect rice root tissues via root
hairs located at the emerging lateral roots and to spread extensively throughout the
Fig. 7.1 Sites of plant colonization by endophytic bacteria. Plant growth-promoting endophytic
bacteria (PGPBE), white circles; other endophytic microorganisms, black triangles
rice root (Ladha et al. 1996; Francine et al. 2007). Some naturally occurring rhizo-
bia can invade the emerging lateral roots of rice, wheat, maize and oilseed rape
(Cocking 2003; Bashan 2014; Yanni et al. 2016).
7.2.2 How to Localize Endophytic Bacteria Inside Plants
Colonization by these bacterial endophytes can be confirmed through multiple

methods. These methods include fluorescent-tagging, immunological detection,
fluorescence/confocal microscopy or scanning and transmission electron micros-
copy. Bacterial entry routes into the host plant have been traced and scored in many
cases by using these approaches (Prayitno et al. 1999; Chaintreuil et al. 2000; Verma
et al. 2004; Perrine-Walker et al. 2007a). Otherwise, specific primers could be of
use to analyse bacteria inside plants (Hartmann et al. 2000).
Other authors like Bulgarelli et al. (2015) combine 16S rRNA gene profiling and
shotgun metagenomic analysis to investigate the structure and function of the
bacterial root microbiota in wild and domesticated barley (Hordeum vulgare).

Moreover, Stets et al. (2013) used matrix-assisted laser desorption ionization time-
of-flight mass spectrometry (MALDI-TOF MS) to assess the diversity of wheat-
associated bacterial isolates. Also, they validated their results by using 16S rRNA
gene sequence analyses, which correlated with the clusterization of the mass spectra
profiles. The results obtained demonstrated that this technique had the potential to
classify bacteria at different levels.
Several authors have previously demonstrated the potential of in situ visualiza-
tion of specific gfp-tagged bacteria in plant roots (Chelius and Triplett 2000; Ramos
et al. 2002). GFP-tagged B. subtilis CB-R05 strain was studied to monitor its inter-
action in Oryza sativa under axenic conditions by using confocal laser scanning
microscope (CLSM). CB-R05 cells penetrate through the rhizoplane, especially in
the elongation and differentiation zones of the rice roots and, also, are able to colo-
nize it intracellularly (Ji et al. 2014).
Moreover, Chi et al. (2005) examined the colonization and infection of rice plant
tissues by different species of gfp-tagged rhizobia and their influence on the growth
physiology of rice. Other studies aim to evaluate the potential of Rhizobium sp. to
colonize the roots of a wide variety of cereals by tagging bacteria with fluorescent
proteins (Mitra 2014). Results derived from these studies showed that in the first
days of the rhizobia-plant root interaction, bacteria predominantly colonized the
elongation zone of the roots, the root surfaces and, interestingly, root hairs. Also,
other studies reported the inoculation of rice seedlings with a GFP-tagged strain of
Rhizobium, displaying some phenotypes similar to those seen in the infection pro-
cess that occurs in leguminous plants. Results suggest that some strains may have
the ability to infect rice root tissues via root hairs located at the emerging lateral
roots and to spread extensively throughout the rice roots (Perrine-Walker et al.
2007b).
Quadt-Hallmann and Kloepper (1996) used antibodies coupled to fluorophores
to study the colonization of internal tissues of different plant species by the endo-
phytic bacteria Enterobacter asburiae JM22. Polyclonal and monoclonal antibodies
applied in enzyme-linked immunosorbent assay (ELISA), dot blot assay, tissue
printing, or immunogold labelling was sensitive and specific enough to detect
JM22 in plant tissues.
Thomas and Reddy (2013) used the fluorophore Syto9 (S9), which binds nucleic
acids in bacteria, in combination with propidium iodide (PI) to localize endophytic
bacteria in the inner tissues of Musa acuminate (banana) by epifluorescence and
confocal laser scanning microscopy (CLSM). Their results showed an extensive
bacterial colonization of banana tissues. Rothballer et al. (2003) examined the endo-
phytic potential of two strains of A. brasilense, Sp245 and Sp7, on roots of different
wheat cultivars using fluorescent in situ hybridization (FISH) in combination with
confocal laser scanning microscopy. The results obtained revealed which strain was
able to grow better in contact with wheat roots.
The location of bacteria inside the plants reveals information about the prefer-
ences of colonization of internal tissues by the endophytic bacteria. We can also
distinguish if they perform an intra- or extracellular colonization. However, these

techniques just give us a qualitative idea of the colonization. To quantify and give an
accurate result of bacterial colonization, techniques based on fluorescence should
be combined with other techniques, such as bioinformatic tools. In this sense, Liu
et al. (2001) developed a computer-aided interactive system called “CMEIAS”
(Center for Microbial Ecology Image Analysis System) to analyse the high degree
of morphological diversity in growing microbial communities associated or not to a
substrate, which might be the plant root surface.
7.2.3 Plant Responses to Endophytic Bacterial Colonization
Once bacteria enter into the plant, different defence reactions have often been
described. For example, the strengthening of cell walls, the production of antibiot-
ics, growth-stimulating substances or enzymes and gum formation inside vessels
have been observed (James et al. 2002; Compant et al. 2005; Miché et al. 2006).
However, in contrast to the plant response to phytopathogens, few defence mecha-
nisms have been described in plant response to PGPBEs. Moreover, certain plants
have been shown to change their chemical responses when interacting with PGPBEs
compared with non-beneficial bacteria, indicating that the plant does not recognize
the PGPBEs as harmful agents (Miché et al. 2006; Rocha et al. 2007). It has also
been reported that plants may show defence reactions controlling endophytic colo-
nization, involving the production of salicylic acid (SA), jasmonic acid (JA) or
ethylene, among other molecules. For example, dicotyledonous plants are known to
use salicylic acid (SA) and ethylene as signalling molecules, which control coloni-
zation by some endophytes (Iniguez et al. 2005).
In monocotyledonous plants such as rice, the addition of jasmonic acid (JA), but
not ethylene, was shown to interfere with the colonization of the diazotroph
Azoarcus sp., suggesting that plant defence responses involving the JA signalling
pathway may also control endophytic colonization inside the root system. However,
in a compatible endophytic association, JA-associated plant responses were less
pronounced and did not restrict endophytic colonization (Miché et al. 2006).
For example, rhizobial inoculation in cereal plants, especially rice, is associated
with an increased accumulation of phenolic substances such as gallic, tannic, ferulic
and cinnamic acids in plant leaves (Mirza et al. 2001). Such increases in phenolic
acids are a pathogenic stress-related phenomenon in plants (Pieterse et al. 2002).
Defence reactions triggered in response to rhizobial invasions are termed as
rhizobacteria-mediated induced systemic resistance. However, this systemic
resistance is not enough to prevent the entry of the Rhizobium inside the plant.
Thus, rhizobia successfully colonize and disseminate throughout the inner host
plant without evoking an observable defence reaction in the plant (Mia and
Shamsuddin 2010).
7.3 Nitrogen-Fixing Bacterial Endophytes
Several studies have shown that endophytic bacteria are able to enter the inner tis-
sues of plants, successfully colonize them and cause benefits. Therefore, it is inevi-
table that the use of these endophytic bacteriaasan alternatives to chemical fertilizers
as a means to aid in the demand for food will receive support. According to FAO,
the main cereal crops in terms of global production are maize, rice and wheat. In
2011, their production was more than 833, 723 and 704 Mt., respectively (Perez-
Montaño et al. 2014). In order to maintain high production levels, there is a massive
use of N-based fertilizers, and ~60% of the total synthetic nitrogen fertilizers pro-
duced worldwide is currently used in cereal crops (Dobermann 2007; Westhoff
2009). As nitrogen continues to be a serious problem for agriculture, due to the lack
of available forms for plants or due to the excess of N-based fertilizers, the formula-
tion of biofertilizers based in nitrogen-fixing endophytic bacteria presents itself as
the more suitable solution to overcome these problems. In this section, we focus on
endophytic bacteria that are able to fix nitrogen for these cereal crops with higher
yields worldwide (Mia and Shamsuddin 2010; Sindhu et al. 2016; Meena et al.
2013c, 2014b, 2015d; Singh et al. 2016, 2015).
Bacteria responsible for nitrogen fixation are called diazotrophs, which harbour
nitrogenase, the enzyme complex that catalyses the conversion of N2 gas to ammo-
nia, a form that can be used by plants (Santi et al. 2013). Some of these diazotrophic
bacteria are also PGPBEs. They have been detected inside the plant, causing benefi-
cial effects such as plant growth promoters and nitrogen fixation. These bacteria,
found in close association with roots, are usually designated “associative” nitrogen-
fixing bacteria. However, the frontier between associative and endophytic plant
colonization is not always clear since associative bacteria can also be observed in
plant tissues; although, they are less abundant than strains originally classified as
endophytes (Elmerich 2007). In contrast to what occurs in endosymbiosis, these
bacteria do not induce differentiated structures in the roots, and although endo-
phytic bacteria invade plant tissues, they cannot be regarded as endosymbionts that
reside intracellularly in living plant cells. Endophytic diazotrophs may have an
advantage over root-surface associative diazotrophs as they colonize the interior of
plant roots and can establish themselves in niches that provide more appropriate
conditions for effective nitrogen fixation and subsequent transfer of the fixed nitro-
gen to the host plant (Reinhold-Hurek and Hurek 2011). Some of the main bacteria
that can live in association with maize, rice and wheat and contribute to improve
plant growth are presented in Table 7.1. Some bacterial genera, such as Azospirillum,
Azoarcus, Herbaspirillum and Gluconacetobacter, which promote growth, fix
nitrogen and have more efficiency in colonization, were isolated in a plant species
and were more competent in the reinoculation in the same plant.
The use of the bacterial genus Azospirillum as inoculants and the discovery of the
high acetylene reduction (AR) activity associated with the roots of cereals immedi-
ately attracted much interest among agronomists and soil microbiologists. Many
studies were performed on the inoculation of these crops with Azospirillum sp.,
Table 7.1 Association of cereals and nitrogen-fixing PGP bacteria

Benefits (%
Cereals Diazotroph inoculant increase) References
Rice Azoarcus sp. 16 (total dry Reinhold-Hurek and Hurek (1997),
weight)b Engelhard et al. (2000)
Maize Burkholderia sp. 68 (shoot biomass)b Baldani et al. (2000)
19 (seed biomass)b
B. vietnamiensis 13–22 (yield)a Van et al. (2000)
Gluconacetobacter 30 (total dry Muthukumarasamy et al. (2005)
diazotrophicus weight)b
Herbaspirillum 37.6 (plant dry James et al. (2002)
seropedicae weight)b
Serratia marcescens 23 (total dry Gyaneshwar et al. (2001)
weight)b
Burkholderia sp. 5.9–6.3 (yield)a Estrada et al. (2005)
Azospirillum brasilense 13–25 (yield)b Riggs et al. (2001), Dobbelaere
33 (grain yield)a et al. (2001)
Pseudomonas protegens 44 (total dry Fox et al. (2016)
weight)b
Wheat H. seropedicae 19.5 (yield)a Riggs et al. (2001)
Pseudomonas sp. 11.7 (total biomass)b Shaharoona et al. (2006)
H. seropedicae 49–82 (total Riggs et al. (2001)
biomass)b
P. protegens 47 (total dry Fox et al. (2016)
weight)b
Pearl A.brasilense 12.05 (fresh weight Tien et al. (1979)
millet of roots)b
Soybean A.brasilense 9.19 (total root Molla et al. (2001)
length)b
Sorghum A. brasilense 33–40 (total number Sarig et al. (1992)
of length)b
Modified from Santi et al. (2013)
Experiments in fields (a) or in controlled conditions (b)
particularly the Azospirillum brasilense type strain Sp7 originally isolated from the
rhizosphere soil of Digitaria decumbens (and the closely related strain Cd) (Bashan
and Levanony 1990). Boddey and Dobereiner (1995) showed that Azospirillum
strains isolated from surface-sterilized roots of a certain cereal showed a greater
aptitude to reinfect the same cereal and to promote responses in crop yield and/or N
accumulation when these “homologous” strains were inoculated. In this respect,
several studies showed that the A. brasilense strain Sp 245, isolated from surface-
sterilized wheat roots, repeatedly increased grain yield and N accumulation in wheat
in both field and pot experiments, where Sp 7 and/or Cd promoted little or no plant
response (Baldani et al. 2002). Similar results have been obtained with maize, wheat
and pearl millet by other authors (Couillerot et al. 2013; Masciarelli et al. 2013;
Piccinin et al. 2013; Morley 2013; Lakhani et al. 2014).
The genus Azoarcus is a group of gram-negative, endorhizospheric diazotrophic

bacteria, originally isolated from roots of the grass Leptochloa fusca (L.), namely,
Kallar grass, which are able to invade plant tissues due to their cellulolytic enzymes
(Reinhold-Hurek et al. 1993). Reinhold-Hurek et al. (1993) observed that Azoarcus
is able to colonize the interior of sorghum plants by means of its cellulolytic
enzymes. Therefore, Azoarcus sp. strain BH72 is not specific to its original host
plant, Kallar grass, and maybe used as inoculum for other members of the Gramineae
family. To evaluate its contribution of biological nitrogen fixation (BNF), the total
nitrogen content in the whole system was analysed. After 28 days of cultivation, a
sevenfold increase of total N was measured, from which the majority (72.6%) was
located in the growth medium.
Gluconacetobacter diazotrophicus, a N2-fixing bacterium has been originally
isolated from sugarcane roots and inside stems collected in various sites of Brazil
(Cavalcante and Dobereiner 1988) and of Australia (Li and Macrae 1992). This
endophytic bacterium is able to fix N2 even in the presence of nitrates and seems to
be best adapted to the environment for growing sugarcane (Cavalcante and
Dobereiner 1988). This bacterium could have more economic importance compared
with other diazotrophs associated with sugarcane (Fuentes-Ramirez et al. 1993).
Moreover, some studies have shown its ability to act as a PGPBE (Fuentes-
Ramirez et al. 1993; Saravanan et al. 2008; Mehnaz and Lazarovits 2006; Sahai
et al. 2015). Fuentes-Ramirez et al. isolated 18 strains belonging to this species that
produce different concentrations of indoleacetic acid (IAA). Thus, considering that
G. diazotrophicus was found within the plant tissue, the biosynthesis of IAA sug-
gests that these strains could promote root formation and improve sugarcane growth
by direct effects on metabolic processes, in addition to their role in N2 fixation. G.
diazotrophicus has been isolated from other plant hosts, such as wetland rice, pine-
apples, tea, coffee, etc. (Saravanan et al. 2008). Mehnaz and Lazarovits (2006)
showed the inoculation effects of G. diazotrophicus in maize provided significant
plant growth promotion expressed as increased root and shoot weight when com-
pared to uninoculated plants.
Species from the genus Herbaspirillum, which are classified as plant growth-
promoting rhizobacteria (PGPR), can produce biological nitrogen fixation (BNF)
for plants, as well as present P-solubilization and siderophore production
(Richardson et al. 2009). In a recent study, Alves et al. (2015) showed the plant
growth promotion effect of 21 strains of Herbaspirillum species on maize plants. In
this trial, the grain yield was evaluated as well as the contribution of biological
nitrogen fixation (BNF). This study showed that H. seropedicae ZAE94 was the
best strain under controlled conditions, and its application as a field inoculant
increased maize yield up to ~34%, depending on the plant genotype.
All these nitrogen-fixing endophytic bacteria also improve root development by
the production of different classes of growth regulators that influence primary root
growth and increase the number and length of lateral roots and elongating root hairs,
which in turn results in an increase in the field productivity of crops (Dobbelaere
et al. 1999; Contesto et al. 2008; Combes-Meynet et al. 2011; Walker et al. 2012).
7.4 acterial Endophytes from Cereals Used as Plant

B
Probiotics
Many bacterial endophytes able to promote plant growth have been isolated from
within the cereals, as shown in Table 7.2. Nevertheless, we can observe that these
same isolates are then used to reinoculate the same plant host. It may be due to
adaptation that the bacteria have to colonize the plant. This kind of bacteria has a
potential to interact with cereals, due to the effects and benefits produced. In this
part of the chapter, we focus on the description of various mechanisms used by
endophytes to enhance plant growth, improve agronomic characteristics and solve
problems of pollution.
Currently, there are a huge number of studies published that report the use of
endophytic bacteria as PGPR inoculants (some of them summarized in Table 7.2).
Commonly, plant growth promotion occurs due to a combination of different action
modes, such as the improvement of the host’s nutrient status, promoting root surface
area and increasing the availability of nutrients to the plants (Perez-Montaño et al.
2014 (Fig. 7.2). Every bacterial strain may use one or several mechanisms, depend-
ing on the phase of plant’s life cycle (Long et al. 2008).
According to Govindarajan et al. (2008), rice yield production was increased
with respect to a control treatment when a bacterial inoculant was applied. Moreover,
the effect of the inoculation caused rice seedlings to grow better under N-deficient
conditions. Mäder et al. (2011) showed an increase in wheat grain yield (~31%)
after the inoculation with Pseudomonas jessenii R62 and Pseudomonas synxantha
R81, in comparison to uninoculated control plants.
Recently, the potential of endophytic bacteria to degrade pollutants in order to
allow plants to emerge as the natural vegetation at a contaminated site or to decrease
contaminant concentration is being analysed (Syranidou et al. 2016). Although
many number of studies focus on the degradation of compounds, such as herbicides,
pesticides and hazardous organic compounds, in many occasions, these benefits and
effects are also related and associated with an improvement of plant development.
Sorty et al. (2016) reported that endophytic bacteria could alleviate the harmful
effects of salt stress and enhance seed germination in wheat, as well as to promote
plant growth and to increase dry biomass and total soluble sugars. Wheat seedlings
are able to germinate under different salinity regimes after co-inoculation with
Bacillus subtilis SU47 and Arthrobacter sp. SU18 (Upadhyay et al. 2012).
Under stress conditions, plants increase their ethylene levels causing important
cell damage (Argueso et al. 2007; Hardoim et al. 2015; Perez-Montaño et al. 2014).
Thus, the role of ACC deaminase production by endophytic bacteria and the ability
to decrease ethylene levels have been also analysed (Glick 2014; Etesami et al.
2014; Gamalero and Glick 2015; Khan et al. 2016). Ethylene is a plant hormone,
which is also the key regulator of plant colonization by endophytic bacteria.
According to Etesami et al. (2014), the endophytic strain P. fluorescens REN1,
selected for its high ACC deaminase production, significantly colonized rice seed-
ling roots in comparison with other ACC deaminase-producing isolates in controlled
Table 7.2 Bacterial endophytes isolated from cereals used as plant growth promoters
Bacterial endophytes Reinfection
isolated from cereals tests in cereals Effect (% increase) References
Wheat
Arthrobacter sp. and Wheat 26 (total dry weight) Upadhyay et al.
Bacillus subtilis (2012)
Pseudomonas jessenii (R62) Wheat 41 (grain yield) Mäder et al. (2011)
and Pseudomonas synxantha
(R81)
Rhizobium leguminosarum Wheat 24 (wheat shoot dry Hilali et al. (2001)
bv. trifolii matter and grain yield)
Maize
A. brasilense Maize 45 and 82 (grain yield and de Salamone et al.
total N accumulation, (1996)
respectively)
Rhizobium etli bv. phaseoli Maize 20–45 (total biomass) Gutierrez-Zamora
and Martınez-Romero
(2001)
Serratia liquefaciens, Maize 14 (dry weight) Lalande et al. (1989)
Bacillus sp. Pseudomonas
sp.
Rice
R. leguminosarum bv. trifolii Rice 8–22 (grain yield) Biswas et al. (2000)
E11
R. leguminosarum bv. trifolii Rice 19.7 and 6.31 (grain Yanni et al. (1997)
ARC100 and ARC101 weight and grain yield,
respectively)
Pantoea agglomerans Rice 63.5 (total biomass) Verma et al. (2001)
B. vietnamiensis MGK3 Rice 9.36 (grain yield) Govindarajan et al.
(2008)
Herbaspirillum seropedicae Rice 2.6 (grain yield) Govindarajan et al.
LMG6513 (2008)
B. vietnamiensis LMG10929 Rice 5.4 (grain yield) Govindarajan et al.
(2008)
H. seropedicae LMG6513 Rice 2.6 (grain yield) Govindarajan et al.
(2008)
Bradyrhizobium sp. Rice 20 (total biomass) Chaintreuil et al.
ORS278 (2000)
Gluconacetobacter Rice 30 (total dry weight) Muthukumarasamy
diazotrophicus et al. (2005)
H. seropedicae Rice 38–54 (root biomass) Elbeltagy et al.
(2001)
Rice 22–50 (shoot biomass) Gyaneshwar et al.
(2002)
Rice 37.6 (plant dry weight) James et al. (2002)
Rice 52–112, 71 (fresh and dry Baldani et al. (2000)
weight)
(continued)

Bacterial endophytes Reinfection
isolated from cereals tests in cereals Effect (% increase) References
Serratia marcescens Rice 23 (total dry weight) Gyaneshwar et al.
(2001)
R. leguminosarum bv. trifolii Rice 15–22, 8–22 (grain yield) Yanni et al. (1997),
(2001)
Pantoea agglomerans Rice 63.5 (total biomass) Verma et al. (2001)
B. vietnamiensis Sugarcane 19.5 (yield) Govindarajan et al.
LMG10929T (2006)
H. seropedicae Sugarcane 5–12 (yield) Govindarajan et al.
(2008)
Sugarcane
Enterobacter cloacae Sugarcane 55 and 70 (root and shoot Mirza et al. (2001)
biomass)
Klebsiella pneumoniae Sugarcane 13–19.5 (total biomass) Govindarajan et al.
(2007)
G. diazotrophicus BR 11281 Sugarcane (Mixture of five species) Oliveira et al. (2002)
H. seropedicae BR 11335 23.5 stalk fresh weight
Herbaspirillum and 27.4 dry matter
rubrisubalbicans BR 11504
Azospirillum amazonense BR
11115
Burkholderia sp. BR 11366
G. diazotrophicus Sugarcane 13–16 (yield) Govindarajan et al.
LMG7603 (2007)
H. seropedicae 26 (plant dry weight) Muñoz-Rojas and
Caballero-Mellado
(2003)
18.83–49.86 (total Suman et al. (2005)
biomass)
35 (dry matter) Oliveira et al. (2002)
H. rubrisubalbicans Rice 6.6 (grain yield) Govindarajan et al.
G. diazotrophicus LMG7603 (2008)
Leptochloa fusca Rice 16 (total dry weight) Reinhold-Hurek and
Azoarcus Hurek (1997)
conditions. This result supports the idea of the use of ACC deaminase activity as a
powerful tool to select effective endophytic bacteria with plant growth-promoting
capabilities.
Another key factor to be analysed in the plant-endophytes association is
phytohormone production (auxins, gibberellins and cytokinins), which is one of the
most well-studied mechanisms in relation to plant growth promotion (Hardoim
et al. 2015). Auxins are a class of plant growth regulators, known to stimulate cell
elongation in plants, and their production by endophytic strains has been reported
(Long et al. 2008; Shi et al. 2009). Merzaeva and Shirokikh (2010) presented an
Plant host
Nutrient absorption
Root hair increase
increase
Biocontrol Tolerance to stress
Root growth
Nutrient increase
uptake
PGPR
PGPBE
Increase nutrients
availability Phytostimulation Pathogens
Soluble nutrients
Pollulant compounds
Nitrogen Desgraded pollutant
fixation Phytostimulators
N2 atmospheric
Rhizoremediation Nitrogen asimilated
Fig. 7.2 Schematic representation of plant growth-promoting mechanisms of bacterial endophytes
increase in the germination capacity of rye seedlings, which were treated with aux-
ins produced by endophytic bacteria.
Apart from being typical trait of root-associated endophytes, gibberellins pro-
duction elicits various metabolic functions of plant growth (Macmillan 2001), and
the production by endophytes is currently described worldwide (Khan et al. 2014;
Shahzad et al. 2016). Cytokinin production by bacterial endophytes is commonly
analysed and reported in relation to plant growth promotion. According to the data
presented by Kudoyarova et al. (2014), Bacillus subtilis IB-22 increased amino acid
rhizodeposition in wheat roots due to its ability to produce cytokinins. Apart from
the fact that most of the described endophytes present the mechanisms explained
above, some endophytes are also inoculated as biocontrol agents (Díaz-Herrera
et al. 2016; Xu et al. 2017). According to Pan et al. (2015) B. megaterium BM1
(entophytic strain isolated from wheat) significantly reduces the incidence and
severity of infection by Fusarium graminearum in wheat crops.
7.5 urrent Situation of Commercial Products Based

C
on Endophytic Bacteria
In order to satisfy the increase in food demand and environmental concerns, new
ways of fertilization and the production of agronomic commercial products are
being developed with the principal aim of creating a more sustainable agriculture.
According to the new restrictive laws and some programmes and initiatives (e.g.
Horizon 2020) concerning the use of chemical fertilizers, the creation and commer-
cialization of new green products is expanding worldwide, and several companies
are developing a wide range of products based on different bacterial inoculants.
Researchers and companies must consider the introduction and use of endophytes
for the formulation of these products, where the full understanding of their behav-
iour under different conditions is probably the key aspect for developing an applica-
tion system that assures continuity and efficacy.
Despite the simplicity of production technologies and the low-cost industrial
procedures of biofertilizer production, in comparison to the chemical fertilizer
industry, there are big differences among the number of companies and the products
they produce (Table 7.3), which are currently on sale globally (Naveed et al. 2015).
Europe is one of the areas that have developed more governmental policies for
controlling the biofertilizer market (Garcia-Fraile et al. 2015). However, there are
no existing specific regulations or a single process to regulate the quality for newly
produced biofertilizers, and the already established laws are very different among
the European Union member states. Some EU countries, such as the United
Kingdom and Ireland, do not have specific regulations regarding the use of micro-
bial inoculants.
Since 1998, the European company “Xurian Environnement” has been analysing
and producing a wide range of commercial green products. The team of technical
experts provide personalized assistance to increase the biomass of cereal and oil-
seed crops. One of the bestselling products is Ovalis Rhizofertil®, a microbial inocu-
lant based on the strain P. putida I-4613. Another company, currently in expansion,
is Symborg, which commercializes a product called VitaSoil®, a mix of rhizospheric
microorganisms specific for the growth promotion of cereal crops and soil
regeneration.
According to the Food and Agricultural Organization (FAO), Asia and the Pacific
zone are the largest users of fertilizers in the world and import the three major nutri-
ents (nitrogen, phosphate and potassium) in large amounts. However, regional gov-
Table 7.3 Current commercial products for cereal crops based on endophytic bacteria
Company Product Crop type
Xurian Environnement Ovalis Rhizofertil® Cereal and oilseed
Symborg VitaSoil® Cereal
Ajay Bio-tech Ajay Azo® Wheat, paddy and cotton
Ajay Bio-tech Ajay Azospirillum® Cash
JSC Industrial Innovations Azotobacterin® Wheat, barley, maize, among other cereals
China Bio-Fertilizer AG CBF® Cash
Monsanto QuickRoots® Wheat and corn
Flozyme Corporation Inogro® Rice
Laboratorios BioAgro S.A. Liquid PSA® Wheat
Semillera Guasch SRL Zadpirillum® Maize
Gujarat State Fertilizers Azotobacter® Cereal, cash and horticultural
and Chemicals LTD
Gujarat State Fertilizers Azopirillum® Cereal, cash and horticultural
and Chemicals LTD
Gujarat State Fertilizers Phosphate All kind of crops
and Chemicals LTD Solubilizing Bacteria®
INTERMAG BACTRIM STRAW® Maize and oilseed
Prabhat Fertilizer & Azoto ® Cereals
Chemical Works
Criyagen Agri Azospirillum Paddy, sugarcane, maize, wheat, sorghum,
Biofertilizer® Bajra, cotton and sunflower among others
Criyagen Agri PSB fertilizer® Maize, wheat, paddy
Abiosa BONASEED® Cereals
Criyagen Agri Bumper Crop Cereals
Fertilizer®
ernments promote the development of the biofertilizer market in order to contribute

to a more sustainable agriculture in these countries. The most important companies
in terms of sales and production are Agri Life and Ajay Bio-tech (India) LTD. Some
of the products sold by these companies are suitable for cereal crops, such as Ajay
Azo/Rhizo/Azospirillum® (different biofertilizers based on Azotobacter, Rhizobium
and Azospirillum species, respectively) and Agri Life Nitrofix® (biological fertilizer
based on the strain A. chroococcum MTCC 3853), among others. These biofertilizers
are based on single or combined efficient nitrogen-fixing bacteria (NFB) or phos-
phate-solubilizing bacteria (PSB) that help plant uptake of nutrients when applied
to seed or through the soil. Moreover, the company “JSC Industrial Innovations”
commercializes Azotobacterin®, which produces up to a ~20% increase in yield of
crops such as wheat, barley and maize, among other cereals. This product contains
the diazotrophic bacterial strain A. brasilense B-4485. According to Garcia-Fraile
et al. (2015), this product is one of the most frequently used in Russia.
In China, the company “China Bio-Fertilizer AG” sells a product called “CBF”,
which is formed by a mix of two bacterial species of the genus Bacillus (B. muci-
laginosus and B. subtilis) that are able to solubilize phosphorus and potassium,
resulting in an increase in crop yields (up to ~30% depending on plant species).
In America, farmers are expected to use an additional 300,000 tonnes of nitrogen
fertilizers in 2018, which will be mainly applied to agricultural surface crops (wheat,
corn and forage crops). This continent has the biggest worldwide biofertilizer com-
pany, Monsanto, which currently belongs to the company Bayer. Monsanto focuses
on empowering farmers to produce more from their land while conserving natural
resources such as water and energy. Also, they produce “QuickRoots®”, a microbial
seed inoculant based on a bacteria-fungi mixture, mainly B. amyloliquefaciens and
T. virens, to enhance nutrient uptake in wheat and corn crops, which results in an
enhanced yield potential. Monsanto, as well as other companies such as Novozymes
and BASF, also operates worldwide.
Also in the USA, the Flozyme Corporation, a company that has been testing new
technologies designed to increase crop production and reduce or eliminate the need
for fertilizers, produces and commercializes “Inogro”. This product is a mix of more
than 30 microbial species selected for their plant growth promotion abilities.
Independent tests showed a significant increase in rice yields under greenhouse con-
ditions (www.flozyme.com/agriculture/).
Since 1984, the company “Laboratorios Bioagro S.A. (Argentina)” has focused
on the research and development of highly environmental friendly products to help
satisfy the farmers’ needs. One of their most famous products is “Liquid PSA”,
which contains P. aurantiaca SR1 and is registered by the national service for agri-
cultural health of Argentina, due to its promotion of wheat growth. Moreover, in the
same country, the company Semillera Guasch SRL launched a brand named Zaden
Agrotecnologias®, which produces a biological inoculant called Zadpirillum® that is
based on the plant growth-promoting strain A. brasilense AZ39 and enhances maize
yields.
Even Africa will require 4 million tonnes of nitrogen fertilizers in 2018, and the
use of biofertilizers varies widely among countries due to the farmers’ reticence to
apply microbial biofertilizers. Therefore, the experts recommend a combination
between using local technological knowledge and microbial fertilizers (Babalola
and Glick 2012) as the only way to satisfy the increasing food demand that will
continue to exist over the next decades. As regards there are projects searching for
solutions, such as Engineering Nitrogen Symbiosis for Africa project (ENSA) or
N2Africa project, led by two of the most important European research centres, John
Innes Centre and Wageningen University, respectively, which have received funding
from the Bill and Melinda Gates Foundation and aim to help African farmers to
enhance their crop yields by engineering nonleguminous plants for fixing nitrogen
and to improve inoculants based on microbial strains.
In this context, the collaboration between researchers and industries becomes a
key aspect for the development of microbial-based biofertilizers. The underlying
mechanisms of the interaction of plants with bacterial endophytes is still unknown,
and there are also bio safety issues that need to be addressed; for example, strains
forming part of biofertilization schemes must be tested in order to avoid damages.
The comprehensive research of bacterial endophytic populations will allow more
efficient biofertilizers to be made. Moreover, it is very important that the efforts to

develop biofertilizers must be approved and accepted by farmers around the world,
where they are provided the proper education and simplified procedures for using
the products correctly. These measures would be positive steps to encourage the
commercialization and production of biofertilizers by companies worldwide.
7.6 Conclusion and Future Perspectives
Enhanced cereal crop production by the application of PGPBE-based biofertilizers

is the necessary breakthrough to underpin a more sustainable food production for
feeding the global population and to overcome the environmental issues derived
from the abuse of chemical fertilizers. In this chapter, we have presented the great
diversity of bacterial endophytic strains isolated from several cereal crops and their
potential as plant growth promoters when inoculated onto their isolation source or
other types of crops. These PGPBEs are able to establish a more intimate relation-
ship with cereals crops, showing a better colonization of the inner tissues of these
plants and performing their beneficial actions in a close interaction with their hosts.
Hence, the progressive understanding of microbial populations that are applicable
as inoculants for different crops is absolutely necessary in order to ensure higher
yields in a sustainable way.
The Food and Agriculture Organization (FAO) promotes the use of biofertilizers
in both developed and developing countries, and many have employed them to a
greater or lesser extent (FAO 1991). Moreover, most countries have developed poli-
cies to reduce the use of chemical fertilizers due to the consumer demands for more
organic food. Thus, the commercialization and application of bacterial fertilizers on
agricultural crops are increasing year by year. In the near future, more efforts will
be needed regarding the development of proper inoculants that enhance cereal
growth and yields. Based on this premise, the Horizon 2020 Programme strongly
supports European research dedicated to the biotechnological processes and prod-
ucts. Also, Latin America is one of the world’s largest fertilizer consumers, particu-
larly Mexico, and a programme to support the introduction of N-fixing biofertilizers
based on Azospirillum was carried on ~1.5 M ha (Fuentes-Ramirez and Caballero-
Mellado 2005). India has the most complete legal framework in the world related to
biofertilizers, and ~350–500 t of biofertilizers are requested form the Indian
National Biofertilizer Development Center (NBDC) and the Bio-Tech Consortium
of India Ltd. (BCIL) for agricultural purposes in India (Dewasthale and Bondre
2008). In addition, Japan has long since begun to include nitrogen-fixing bacteria in
the formulation of biofertilizers, and the Tokachi Federation of Agricultural
Cooperatives (TFAC) is the largest producer and marketer of rhizobial biofertilizers
since 1953. This company uses PGPR as biofertilizers and as biocontrol agents,
among others. The Forum for Nuclear Cooperation in Asia (FNCA) is also located
in Japan and actively develops biofertilizers in Asian countries (Naveed et al. 2015).
According to Masso et al. 2014, in Africa, regulatory frameworks are required since
biofertilizers are of poor quality and consequently cause economic loss. For this
reason, Babalola and Glick (2012) suggest the combined use of traditional tech-
niques together with microbial fertilizers.
Therefore, we propose that more work is needed in order to development better
biofertilizers and to ensure their proper use. This also includes the establishment of
specific legislation that regulates biofertilizers in order to facilitate the processes of
production and commercialization. Governments should support the use of biofer-
tilizers and provide proper funding for research and the creation of companies in the
field of biofertilizers. To reduce the farmer’s reticence towards these types of prod-
ucts, specific programmes and initiatives are needed to train farmers in the use of
biofertilizers. Due to the increasing demand for fertilizers worldwide, more research
efforts are needed to elucidate the inner mechanisms affecting the interaction
between cereal crops and beneficial bacteria.
Acknowledgements The authors acknowledge financial support provided by the Spanish

Government (Ministerio de Economía y Competitividad; MINECO) through the projects
AGL2011-29227 and AGL2015-70510-R, by the Junta de Castilla y León (regional government)
through the project JCyL SA169U14 and by the Diputación de Salamanca (local government)
through the project V113/463AC06. AJG is thankful to a PhD grant from the Spanish Government
(Ministerio de Educación, Cultura y Deporte). The authors are grateful to Emma Jane Keck for
correcting English style.
References
https://doi.org/10.1007/978-81-322-2776-2_21
Alves GC, Videira SS, Urquiaga S, Reis VM (2015) Differential plant growth promotion and
nitrogen fixation in two genotypes of maize by several Herbaspirillum inoculants. Plant Soil
387(1–2):307–321
Argueso CT, Hansen M, Kieber J (2007) Regulation of ethylene biosynthesis. J Plant Growth
Regul 26(2):92–105
Babalola OO, Glick BR (2012) Indigenous African agriculture and plant associated microbes: cur-
rent practice and future transgenic prospects. Sci Res Essays 7(28):2431–2439
from indo-gangetic plain of India. Geomicrobiology Journal. https://doi.org/10.1080/014904
51.2016.1219431
Baldani VLD, Baldani JI, Döbereiner J (2000) Inoculation of rice plants with the endophytic
diazotrophs Herbaspirillum seropedicae and Burkholderia spp. Biol Fertil Soils 30:485–491
Baldani JI, Reis VM, Baldani VL, Döbereiner J (2002) Review: a brief story of nitrogen fixation in
sugarcane-reasons for success in Brazil. Funct Plant Biol 29(4):417–423
Bashan Y, Levanony H (1990) Current status of Azospirillum inoculation technology: Azospirillum
as a challenge for agriculture. Can J Microbiol 36:591–608
Bashan Y, De-Bashan LE, Prabhu SR, Hernandez JP (2014) Advances in plant growth-promoting
bacterial inoculant technology: formulations and practical perspectives (1998–2013). Plant
Soil 378(1–2):1–33
Berg G, Smalla K (2009) Plant species and soil type cooperatively shape the structure and function
of microbial communities in the rhizosphere. FEMS Microb Ecol 68:1–13
Biswas JC, Ladha, JK, Dazzo FB (2000) Rhizobia inoculation improves nutrient uptake and
growth of lowland rice. Pak J Bot l64:1644–1650
Boddey RM, Dobereiner J (1995) Nitrogen fixation associated with grasses and cereals: recent
progress and perspectives for the future. Fert Res 42(1–3):241–250
Bulgarelli D, Garrido-Oter R, Münch PC, Weiman A, Dröge J, Pan Y, McHardy AC, Schulze-
Lefert P (2015) Structure and function of the bacterial root microbiota in wild and domesti-
cated barley. Cell Host Microbe 17(3):392–403
Cavalcante VA, Dobereiner J (1988) A new acid-tolerant nitrogen-fixing bacterium associated with
sugarcane. Plant Soil 108:23–31
Chaintreuil C, Giraud E, Prin Y, Lorquin J, Ba A, Gillis M, de Lajudie P, Dreyfus B (2000)
Photosynthetic Bradyrhizobia are natural endophytes of the African wild rice Oryza breviligu-
lata. Appl Environ Microbiol 66:5437–5447
Chanway CP, Shishido M, Nairn J, Jungwirth S, Markham J, Xiao G, Holl FB (2000) Endophytic
colonization and field responses of hybrid spruce seedlings after inoculation with plant growth-
promoting rhizobacteria. Forest Ecol Manag 133(1):81–88
Chauhan H, Bagyaraj DJ, Selvakumar G, Sundaram SP (2015) Novel plant growth promoting
rhizobacteria-prospects and potential. Appl Soil Ecol 95:38–53
Chelius MK, Triplett EW (2000) Dyadobacter fermentans gen. Nov., sp. nov., a novel gram-
negative bacterium isolated from surface-sterilized Zea mays stems. Int J Syst Evol Microbiol
50(2):751–758
Chi F, Shen SH, Cheng HP, Jing YX, Yanni YG, Dazzo FB (2005) Ascending migration of endo-
phytic rhizobia, from roots to leaves, inside rice plants and assessment of benefits to rice growth
physiology. Appl Environ Microbiol 71(11):7271–7278
Cocking EC (2003) Endophytic colonization of plant roots by nitrogen-fixing bacteria. Plant Soil
252(1):169–175
Combes-Meynet E, Pothier JF, Moenne-Loccoz Y, Prigent-Combaret C (2011) The pseudomo-
nas secondary metabolite 2, 4-diacetylphloroglucinol is a signal inducing rhizoplane expres-
sion of Azospirillum genes involved in plant-growth promotion. Mol Plant-Microbe Interact
24:271–284
Compant S, Duffy B, Nowak J, Clément C, Barka EA (2005) Use of plant growth-promoting bac-
teria for biocontrol of plant diseases: principles, mechanisms of action, and future prospects.
Appl Environ Microbiol 71:4951–4959
Compant S, Clément C, Sessitsch A (2010) Plant growth-promoting bacteria in the rhizo-and
endosphere of plants: their role, colonization, mechanisms involved and prospects for utiliza-
tion. Soil Biol Biochem 42(5):669–678
Conn KL, Nowak J, Lazarovitz G (1997) A gnotobiotic bioassay for studying interactions between
potato and plant growth-promoting rhizobacteria. Can J Microbiol 43:801–808
Contesto C, Desbrosses G, Lefoulon C, Béna G, Borel F, Galland M, Gamet L, Varoquaux F,
Touraine B (2008) Effects of rhizobacterial ACC deaminase activity on Arabidopsis indicate
that ethylene mediates local root responses to plant growth-promoting rhizobacteria. Plant Sci
175:178–189
Couillerot O, Ramírez-Trujillo A, Walker V, Felten A, Jansa J, Maurhofer M, Défago G, Prigent-
Combaret C, Comte G, Caballero-Mellado J, Moënne-Loccoz Y (2013) Comparison of promi-
nent Azospirillum strains in Azospirillum–Pseudomonas–Glomus consortia for promotion of

maize growth. Appl Microbiol Biotechnol 97(10):4639–4649
org/10.1007/978-81-322-2776-2_20
de Salamone IEG, Dobereiner J, Urquiaga S, Boddey RM (1996) Biological nitrogen fixation in
Azospirillum strain-maize genotype associations as evaluated by the 15N isotope dilution tech-
nique. Biol Fertil Soils 23:249–256
Dewasthale G, Bondre (2008) Marketing of biofertilizers. Conference on rural marketing. Indian
Institute of Management, Kozhikode
Díaz-Herrera S, Grossi C, Zawoznik M, Groppa MD (2016) Wheat seeds harbour bacterial
endophytes with potential as plant growth promoters and biocontrol agents of Fusarium gra-
minearum. Microbiol Res 186–187:37–43
Dobbelaere S, Croonenborghs A, Thys A, Broek AV, Vanderleyden J (1999) Phytostimulatory
effect of Azospirillum brasilense wild type and mutant strains altered in IAA production on
wheat. Plant Soil 212:155–164
Dobbelaere S, Croonenborghs A, Thys A, Ptacek D, Vanderleyden J, Dutto P, Labandera-Gonzalez
C, Caballero-Mellado J, Aguirre JF, Kapulnik Y, Brener S, Burdman S, Kadouri D, Sarig S,
Okon Y (2001) Responses of agronomically important crops to inoculation with Azospirillum.
Aust J Plant Physiol 28:871–879
Dobermann A (2007) Nutrient use efficiency-measurement and management in a time of new
challenges. In: Proceedings of the IFA International Workshop on Fertilizer Best Management
Practices. Fertilizer Best Management Practices, 7–9 March 2007, Brussels, Belgium.
International Fertilizer Industry Association, pp 1–28
pp 77–98. https://doi.org/10.1007/978-81-322-2776-2_6
org/10.1007/978-81-322-2776-2_19
Elbeltagy AK, Sato NT, Suzuki H, Ye B, Hamada T, Isawa T, Mitsui H, Minamisawa K (2001)
Endophytic colonization and in plant nitrogen fixation by a Herbaspirillum sp. isolated from
wild rice species. Appl Environ Microbiol 67:5285–5293
Elmerich, C (2007) Historical perspective: from bacterization to endophytes. In: Associative and
endophytic nitrogen-fixing bacteria and cyanobacterial associations. Springer, Dordrecht,
pp 1–20
Engelhard M, Hurek T, Reinhold-Hurek B (2000) Preferential occurrence of diazotrophic endo-
phytes, Azoarcus spp., in wild rice species and land races of Oryza sativa in comparison with
modern races. Environ Microbiol 2:131–141
Estrada P, Mavingui P, Cournoyer B, Fontaine F, Balandreau J, Caballero-Mellado J (2005) A
N-fixing endophytic Burkholderia sp. associated with maize plants cultivated in Mexico. Int
J Syst Evol Microbiol 55:1233–1237
Etesami H, Hosseini HM, Alikhani HA (2014) Bacterial biosynthesis of 1-aminocyclopropane-1-
caboxylate (ACC) deaminase, a useful trait to elongation and endophytic colonization of the
roots of rice under constant flooded conditions. Physiol Mol Biol Plants 20(4):425–434
FAO (1991) Organic recycling in Asia and the Pacific. Regional office for Asia and Pacific (RAPA)/
FAO, Bangkok, Thailand
Flozyme Corporation Inc; Agriculture, Inogro. Flozyme Corporation Web. http://www.flozyme.
com/agriculture/ (2016). Accessed 21 Nov 2016
Fox AR, Soto G, Valverde C, Russo D, Lagares A, Zorreguieta A, Alleva K, Pascuan C, Frare
R, Mercado-Blanco J, Dixon R, Ayub ND (2016) Major cereal crops benefit from biological
nitrogen fixation when inoculated with the nitrogen-fixing bacterium Pseudomonas protegens
Pf-5 X940. Environ Microbiol 18(10):3522–3534
Francine M, Walker P, Prayiton J, Rolfe BG, Weinman JJ, Hocart CH (2007) Infection process and
the interaction of rice roots with rhizobia. J Exp Bot 58(12):3343–3350
Fuentes-Ramirez LE, Caballero-Mellado J (2005) Bacterial biofertilizers. In: PGPR: biocontrol
and biofertilization. Springer, Dordrecht, pp 143–172
Fuentes-Ramirez LE, Jiminez-Salgado T, Abarca-Ocampo IR, Caballero-Mellado J (1993)
Acetobacter diazotrophicus, an indolacetic acid-producing bacterium isolated from sugarcane
cultivars in Mexico. Plant Soil 154:145–150
Gaiero JR, McCall CA, Thompson KA, Day NJ, Best AS, Dunfield KE (2013) Inside the root micro-
biome: bacterial root endophytes and plant growth promotion. Am J Bot 100(9):1738–1175
Gamalero E, Glick BR (2015) Bacterial modulation of plant ethylene levels. Plant Physiol
169:13–22
García-Fraile P, Menéndez E, Rivas R (2015) Role of bacterial biofertilizers in agriculture and
forestry. AIMS Bioeng 2:183–205. https://doi.org/10.3934/bioeng.2015.3.183
Glick BR (2014) Bacteria with ACC deaminase can promote plant growth and help to feed the
world. Microbiol Res 169:30–39
Goormachtig S, Capoen W, James E, Holsters M (2004) Switch from intracellular to intercel-
lular invasion during water stress-tolerant legume nodulation. Proc Natl Acad Sci USA
101:6303–6308
Govindarajan M, Balandreau J, Muthukumarasamy R, Revathi G, Lakshminarasimhan C
(2006) Improved yield of micropropagated sugarcane following inoculation by endophytic
Burkholderia vietnamiensis. Plant Soil 280(1–2):239–252
Govindarajan M, Kwon SW, Weon HY (2007) Isolation, molecular characterization and growth-
promoting activities of endophytic sugarcane diazotroph Klebsiella sp. GR9. World J Microbiol
Biotechnol 23(7):997–1006
Govindarajan M, Balandreau J, Kwon SW, Weon HY, Lakshminarasimhan C (2008) Effects of
the inoculation of Burkholderia vietnamensis and related endophytic diazotrophic bacteria on
grain yield of rice. Microb Ecol 55(1):21–37
Gregory PJ (2006) Plant roots: growth, activity and interaction with soils. Blackwell Publishing,
Oxford, 318 pp
Gutierrez-Zamora ML, Martınez-Romero E (2001) Natural endophytic association between
Rhizobium etli and maize (Zea mays L.) J Biotechnol 91(2):117–126
Gyaneshwar P, James EK, Mathan N, Reinhold-Hurek B, Ladha JK (2001) Endophytic coloniza-
tion of rice by a diazotrophic strain of Serratia marcescens. J Biotechnol 183:2634–2645
Gyaneshwar P, James EK, Reddy PM et al (2002) Herbaspirillum colonization increases growth
and nitrogen accumulation in aluminium-tolerant rice varieties. New Phytol 154(1):131–145
Hardoim PR, Van Overbeek LS, Berg G, Ladha JK (2015) The hidden world within plants: eco-
logical and evolutionary considerations for defining functioning of microbial endophytes.
Microbiol Mol Biol Rev 79:3
Hartmann A, Stoffels M, Eckert B, Kirchhof G, Schloter M, Triplett EW (2000) Analysis of the
presence and diversity of diazotrophic endophytes. Prokaryotic nitrogen fixation: a model sys-
tem for the analysis of a biological process, pp 727–736
Hilali A, Prévost D, Broughton WJ, Antoun H (2001) Effets de l’inoculation avec des souches de
Rhizobium leguminosarum biovar trifolii sur la croissance du blé dans deux sols du Maroc. Can
Iniguez L, Dong Y, Carter HD, Ahmer BM, Stone JM, Triplett EW (2005) Regulation of enteric
endophytic bacterial colonization by plant defences. MPMI 18(2):169–178
Jain V, Gupta K (2003) The flavonoid naringenin enhances intercellular colonization of rice roots
by Azorhizobium caulinodans. Biol Fertil Soils 38:119–123
James EK, Gyaneshwar P, Mathan N, Barraquio WL, Reddy PM, Iannetta PPM, Olivares FL,
Ladha JK (2002) Infection and colonization of rice seedlings by the plant growth-promoting
bacterium Herbaspirillum seropedicae Z67. Mol Plant-Microbe Interact 15:894–906
9(2):1211–1221
Jeyabal A, Kupuswamy G (2001) Recycling of organic wastes for the production of vermicompost
and its response in rice-legume cropping system and soil fertility. Eur J Agron 15:153–170
Ji SH, Gururani MA, Chun SC (2014) Expression analysis of rice pathogenesis-related proteins
involved in stress response and endophytic colonization properties of gfp-tagged Bacillus sub-
tilis CB-R05. Appl Biochem Biotechnol 174(1):231–241
Khan Z, Roman D, Kintz T, Delas Alas M, Yap R, Doty S (2014) Degradation, phytoprotection
and phytoremediation of phenanthrene by endophyte Pseudomonas putida, PD1. Environ Sci
Technol 48(20):12221–12228
Khan AL, Halo BA, Elyassi A, Ali S, Al-Hosni K, Hussai J, Al-Harrasi A, Lee I (2016) Indole ace-
tic acid and ACC deaminase fromendophytic bacteria improves the growth of Solanum lycop-
ersicum. Electron J Biotechnol 21:58–64
Kudoyarova GR, Melentiev AL, Martynenko EV, Timergalina LN, Arkhipova TN, Shendel GV,
Kuz'mina LY, Dodd IC, Veselov SY (2014) Cytokinin producing bacteria stimulate amino acid
deposition by wheat roots. Plant Physiol Biochem 83:285–291
Kuklinsky-Sobral J, Araújo WL, Mendes R, Geraldi IO, Pizzirani-Kleiner AA, Azevedo JL (2004)
Isolation and characterization of soybean-associated bacteria and their potential for plant
growth promotion. Environ Microbiol 6(12):1244–1251
Kumar A, Bahadur I, Maurya BR, Raghuwanshi R, Meena VS, Singh DK, Dixit J (2015)
Does a plant growth-promoting rhizobacteria enhance agricultural sustainability? J Pure
ApplMicrobiol 9:715–724
org/10.1007/s00344-016-9663-5
Ladha JK, Kundu DK, Coppenolle MGA, Carangal VR, Peoples MB, Dart PJ (1996) Legume
productivity and soil nitrogen dynamics in lowland rice-based cropping systems. Soil Sci Soc
Amer J 60:183–192
Ladha JK, Padre AT, Punzalan GC, Castillo E, Singh U, Reddy CK (1998) Nondestructive estima-
tion of shoot nitrogen in different rice genotypes. Agron J 90:33–40
Lakhani SH, Gediya KM, Patel AP (2014) Response of pearl millet (Pennisetum glaucum L.) to
sowing methods and bio-fertilizers during summer season under middle Gujarat conditions.
Trends Biosc 7(21):3423–3427
Lalande R, Bissonnette N, Coutlée D, Antoun H (1989) Identification of rhizobacteria from maize

and determination of their plant-growth promoting potential. Plant Soil 115(1):7–11
Li R, MacRae IC (1992) Specific identification and enumeration of Acetobacter diazotrophicus in
sugarcane. Soil Biol Biochem 24:413–419
Liu JFBD, Dazzo FB, Glagoleva O, Yu B, Jain AK (2001) CMEIAS: a computer-aided system
for the image analysis of bacterial morphotypes in microbial communities. Microb Ecol
41(3):173–194
Lodewychx C, Vangronsveld J, Porteous F, Moore ER, Taghavi S, Mezgeay M, der Lelie DV
(2002) Endophytic bacteria and their potential applications. Cr Rev Plant Sci 21:583–606
Long HH, Schmidt DD, Baldwin IT (2008) Native bacterial endophytes promote host growth
in a species-specific manner; phytohormone manipulations do not result in common growth
responses. PLoS One 3:e2702
MacMillan J (2001) Occurrence of gibberellins in vascular plants, fungi and bacteria. J Plant
Growth Regul 20(4):387–442
Mäder P, Kaiser F, Adholeya A, Singh R, Uppalb HS, Sharmac AK, Srivastavac R, Sahaid V,
Aragnoe M, Wiemkenf A, Johrig BN, Friedh PM (2011) Inoculation of root microorganisms for
sustainable wheat-rice and wheat-black gram rotations in India. Soil Biol Biochem 43:609–619
Malusá E, Vassilev N (2014) A contribution to set a legal framework for biofertilisers. Appl
Microbiol Biotechnol 98(15):6599–6607
Masciarelli O, Urbani L, Reinoso H, Luna V (2013) Alternative mechanism for the evaluation of
indole-3-acetic acid (IAA) production by Azospirillum brasilense strains and its effects on the
germination and growth of maize seedlings. J Microbiol 51(5):590–597
https://doi.org/10.1007/978-81-322-2776-2_10
Masso C, Jefwa JM, Jemo M, Thuita M, Tarus D, Vanlauwe B (2014) Chapter twenty-two impact
of inadequate regulatory frameworks on the adoption of bio-fertilizer (eg PGPR) Technologies.
Recent advances in biofertilizers and biofungicides (PGPR) for sustainable agriculture, p 258
jclepro.2015.04.044
mentation of their plant growth promoting traits. Biocatalysis Agricult Biotechnol 4:806–811
Bacillus species enhance nutrient availability in agricultural soils?. In: Islam MT, Rahman M,
https://doi.org/10.1007/978-3-319-44409-3_16
Mehnaz S, Lazarovits G (2006) Inoculation effects of Pseudomonas putida, Gluconacetobacter
azotocaptans, and Azospirillum lipoferum on corn plant growth under greenhouse conditions.
Microb Ecol 51(3):326–335
Merzaeva OV, Shirokikh IG (2010) The production of auxins by the endophytic bacteria of winter
rye. Appl Biochem Microbiol 44:44–50
Mia MB, Shamsuddin ZH (2010) Rhizobium as a crop enhancer and biofertilizer for increased
cereal production. Afr J Biotechnol 9(37):6001–6009
Miché L, Battistoni F, Gemmer S, Belghazi M, Reinhold-Hurek B (2006) Upregulation of
jasmonate-inducible defense proteins and differential colonization of roots of Oryza sativa
cultivars with the endophyte Azoarcus sp. Mol Plant-Microbe Interact 19:502–511
Mirza MS, Ahmad W, Latif F, Haurat J, Bally R, Normand P, Malik KA (2001) Isolation, partial
characterization, and effect of plant growth promoting bacteria (PGPB) on micropropagated
sugarcane in vitro. Plant Soil 237:47–54
Mitra S (2014) Interaction of Rhizobium sp. Strain IRBG74 with a Legume (Sesbania Cannabina)
and a Cereal (Oryza Sativa)
Molla AH, Shamsuddin ZH, Halimi MS, Morziah M, Puteh AB (2001) Potential for enhancement
of root growth and nodulation of soybean co-inoculated with Azospirillum and Bradyrhizobium
in laboratory systems. Soil Biol Biochem 33(4):457–463
Morley R (2013) Impact of free-living diazotrophs, Azospirillum lipoferum and Gluconacetobacter
azotocaptans, on growth and nitrogen utilization by wheat (Triticum aestivum cv. Lillian)
Muñoz-Rojas J, Caballero-Mellado J (2003) Population dynamics of Gluconacetobacter diazotro-
phicus in sugarcane cultivars and its effect on plant growth. Microb Ecol 46(4):454–464
Muthukumarasamy R, Cleenwerck I, Revathi G, Vadivelu M, Janssens D, Hoste B, Kang
Ui Gum KU, Park K, Son CY, Sa T, Caballero-Mellado J (2005) Natural association of
Gluconacetobacter diazotrophicus and diazotrophic Acetobacter peroxydans with wetland
rice. Syst Appl Microbiol 28(3):277–286
Naveed M, Mehboob I, Shaker MA, Hussain MB, Farooq M (2015) Biofertilizers in Pakistan:
initiatives and limitations. Int J Agril Biol 17:411–420
Oliveira AD, Urquiaga S, Döbereiner J, Baldani JI (2002) The effect of inoculating endophytic
N2-fixing bacteria on micropropagated sugarcane plants. Plant Soil 242(2):205–215
Pan D, Mionetto A, Tiscornia S, Bettucci (2015) Endophytic bacteria from wheat grain as biocon-
trol agents of Fusarium graminearum and deoxynivalenol production in wheat. Mycotoxin
Res 31:137
Parewa HP, Yadav J, Rakshit A, Meena VS, Karthikeyan N (2014) Plant growth promoting rhi-
zobacteria enhance growth and nutrient uptake of crops. Agricult Sustain Dev 2(2):101–116
Perez-Montaño F, Alías-Villegas C, Bellogín RA, Del Cerro P, Espuny MR, Jiménez-Guerrero I,
López-Baena FJ, Ollero FJ, Cubo T (2014) Plant growth promotion in cereal and leguminous
agricultural important plants: from microorganism capacities to crop production. Microbiol
Rev 169:325–336
Perrine-Walker FM, Gartner E, Hocart CH, Becker A, Rolfe BG (2007a) Rhizobium-initiated rice
growth inhibition caused by nitric oxide accumulation. Mol Plant-Microbe Interact 20:283–292
Perrine-Walker FM, Prayitno J, Rolfe BG, Weinman JJ, Hocart CH (2007b) Infection process and
the interaction of rice roots with rhizobia. J Exp Bot 58(12):3343–3350
Piccinin GG, Braccini AL, Dan LG, Scapim CA, Ricci TT, Bazo GL (2013) Efficiency of seed
inoculation with Azospirillum brasilense on agronomic characteristics and yield of wheat. Ind
Crop Prod 43:393–397
Pieterse CMJ, Van Wees SCM, Ton J, Van Pelt JA, Van Loon LC (2002) Signaling in rhizobacteria-
induced systemic resistance in Arabidopsis thaliana. Plant Biol (Stuttgrat) 4:535–544
Prayitno J, Stefaniak J, Mclever J, Weinman JJ, Dazzo FB, Ladha JK, Barraquio W, Yanni G, Rolfe
BG (1999) Interactions of rice seedlings with bacteria isolated from rice roots. Aust J Plant
Physiol 26:521–535
Quadt-Hallmann A, Kloepper JW (1996) Immunological detection and localization of the cot-
ton endophyte Enterobacter asburiae JM22 in different plant species. Can J Microbiol
42(11):1144–1154
org/10.1007/978-81-322-2776-2_4
Ramos HJ, Roncato-Maccari LD, Souza EM, Soares-Ramos JR, Hungria M, Pedrosa FO (2002)
Monitoring Azospirillum-wheat interactions using the gfp and gusA genes constitutively
expressed from a new broad-host range vector. Aust J Biotechnol l97(3):243–252
Reinhold-Hurek B, Hurek T (1997) Azoarcus spp. and their interactions with grass roots. Plant
Soil 194:57–64
Reinhold-Hurek B, Hurek T (2011) Living inside plants: bacterial endophytes. Curr Opin Plant
Biol 14:435–443
Reinhold-Hurek B, Hurek T, Claeyssens M, Van Montagu M (1993) Cloning, expression in
Escherichia coli, and characterization of cellulolytic enzymes of Azoarcus sp., a root-invading
diazotroph. J Bacteriol 175:7056–7065
Richardson AE, Barea JM, McNeill AM, Prigent-Combaret C (2009) Acquisition of phosphorus
and nitrogen in the rhizosphere and plant growth promotion by microorganisms. Plant Soil
321:305–339
Riggs PJ, Chelius MK, Iniguez AL, Kaeppler SM, Triplett EW (2001) Enhanced maize productiv-
ity by inoculation with diazotrophic bacteria. Aust J Plant Physiol 28:829–836
Rocha FR, Papini-Terzi FS, Nishiyama MY, Vêncio RZN, Vicentini R, RDC D, De Rosa VE Jr,
Vinagre F, Barsalobres C, Medeiros AH, Rodrigues FA, Ulian EC, Zingaretti SM, Galbiatti
JA, Almeida RS, AVO F, Hemerly AS, Silva-Filho MC, Menossi M, Souza GM (2007) Signal
transduction-related responses to phytohormones and environmental challenges in sugarcane.
BMC Genomics 8(1):1
Rothballer M, Schmid M, Hartmann A (2003) In situ localization and PGPR-effect of Azospirillum
brasilense strains colonizing roots of different wheat varieties. Symbiosis 34(3):261–279
pp 127–136. https://doi.org/10.1007/978-81-322-2776-2_9
of potassium solubilizing bacteria (KSB) from indo-Gangetic Plains of India. Biocatal Agric
Sahai R, Saxena AK, Tilak KV (2015) Effect of Gluconacetobacter diazotrophicus on sweet sor-
ghum (Sorghum bicolor) in tropical semi-arid soil. Agribiol Res 4(4):347–353
Santi C, Bogusz D, Franche C (2013) Biological nitrogen fixation in non-legume plants. Ann Bot
111(5):743–767
Saravanan VS, Madhaiyan M, Osborne J, Thangaraju M, Sa TM (2008) Ecological occurrence of
Gluconacetobacter diazotrophicus and nitrogen-fixing Acetobacteraceae members: their pos-
sible role in plant growth promotion. Microb Ecol 55(1):130–140
Sarig S, Okon Y, Blum A (1992) Effect of Azospirillum brasilense inoculation on growth dynamics
and hydraulic conductivity of Sorghum bicolor roots. J Plant Nutr 15(6–7):805–819
Shaharoona B, Arshad M, Zahir ZA (2006) Effect of plant growth promoting rhizobacteria con-
taining ACC-deaminase on maize (Zea mays L.) growth under axenic conditions and on nodu-
lation in mung bean (Vigna radiata L.) Lett Appl Microbiol 42:155–159
Shahzad R, Waqas M, Al K, Asaf S, Khan MA, Kang S, Yun B, Lee I (2016) Seed-borne endo-
phytic Bacillus amyloliquefaciens RWL-1 produces gibberellins and regulates endogenous
phytohormones of Oryza sativa. Plant Physiol Biochem 106:236–243
Shi Y, Lou K, Li C (2009) Promotion of plant growth by phytohormone producing endophytic
microbe of sugar beet. Biol Fertil Soils 45:645–653
Singh NP, Singh RK, Meena VS, Meena RK (2015) Can we use maize (Zea Mays) rhizobacteria as
Sorty Am, Meena KK, Choudhary K, Bitla UM, Minhas PS, Krishnani KK (2016) Effect of plant
growth promoting bacteria associated with halophytic weed (Psoralea corylifolia L) on ger-
mination and seedling growth of wheat under saline conditions. Appl Biochem Biotechnol
180(5):872–882
Stets MI, Pinto AS, Huergo LF, Souza EM, Guimarães VF, Alves AC, Steffens MBR, Monteiro
RA, Pedrosa FO, Cruz LM (2013) Rapid identification of bacterial isolates from wheat roots by
high resolution whole cell MALDI-TOF MS analysis. J Biotechnol 165(3):167–174
Suman A, Gaur A, Shrivastava AK, Yadav RL (2005) Improving sugarcane growth and nutrient
uptake by inoculating Gluconacetobacter diazotrophicus. Plant Growth Regul 47(2–3):155–162
Syranidou E, Christofilopoulos S, Gkavrou G, Thijs S, Weyens N, Vangronsveld J, Kalogerakis N
(2016) Exploitation of endophytic bacteria to enhance the phytoremediation potential of the
wetland helophyte Juncus acutus. Front Microbiol 7:1016
Thomas P, Reddy KM (2013) Microscopic elucidation of abundant endophytic bacteria coloniz-
ing the cell wall–plasma membrane peri-space in the shoot-tip tissue of banana. AoB plants,
5, plt011
Tien TM, Gaskins MH, Hubbell DH (1979) Plant growth substances produced by Azospirillum
brasilense and their effect on the growth of pearl millet (Pennisetum americanum L.) Appl
Upadhyay SK, Singh JS, Saxena AK, Singh DP (2012) Impact of PGPR inoculation on growth and
antioxidant status of wheat under saline conditions. Plant Biol 14(4):605–611
Van VT, Berge O, Ke S, Balandreau J, Heulin T (2000) Repeated beneficial effects of rice inocu-
lation with a strain of Burkholderia vietnamiensison early and late yield components in low
fertility sulphate acid soils of Vietnam. Plant Soil 218(1–2):273–284
Verma SC, Ladha JK, Tripathi AK (2001) Evaluation of plant growth promoting and colonization
ability of endophytic diazotrophs from deep water rice. J Biotechnol 91(2):127–141
Verma SC, Singh A, Chowdhury S, Tripathi AK (2004) Endophytic colonization ability of two
deepwater rice endophytes, Pantoea sp and Ochrobacterium sp using green florescent protein
reporter. Biotechnol Lett 26:425–429
on growth, yield and quality of cabbage (Brassica oleracea var capitata). Indian Journal of
Agricultural Sciences 84(8):914–919
Walker V, Couillerot O, Von Felten A, Bellvert F, Jansa J, Maurhofer M, Bally R, Moënne-Loccoz
Y, Comte G (2012) Variation of secondary metabolite levels in maize seedling roots induced by
inoculation with Azospirillum, Pseudomonas and Glomus consortium under field conditions.
Westhoff P (2009) The economics of biological nitrogen fixation in the global economy. In:
Emerich DW, Krishnan HB (Eds) Nitrogen fixation in crop production. Agronomy monograph
no. 52. Madison, WI: J Am Soc Agronl309–328
Xu T, Zeng X, Yang X Shanshan Yuan S, Hu X, Zeng J, Wang Z, Liu O, Liu Y, Liao H, Tong C, Liu
X, Zhu Y (2017) Isolation and evaluation of endophytic Streptomyces endus OsiSh-2 potential
application for biocontrol of rice blast disease. J Sci Food Agric 97(4):1149–1157
org/10.1007/978-81-322-2776-2_14
Yanni YG, Rizk RY, Corich V, Squartini A, Ninke K, Philip-Hollingsworth S, Orgambide G, Bruijn
F, Stoltzfus J, Buckley D, Schmidt TM, Mateos PF, Ladha JK, Dazzo FB (1997) Natural endo-
phytic association between Rhizobium leguminosarum bv. trifolii and rice roots and assessment
of its potential to promote rice growth. Plant Soil 194(1–2):99–114
Yanni YG, Rizk RY, El-Fattah FKA, Squartini A, Corich V, Giacomini A, Bruijn F, Rademaker J,
Maya-Flores J, Ostrom P, Vega-Hernandez M, Hollingsworth RI, Martinez-Molina E, Mateos
PF, Velazquez E, Wopereis J, Triplett E, Umali-Garcia M, Anarna JA, Rolfe BG, Ladha JK,
Hill J, Mujoo R, Dazzo NPKFB (2001) The beneficial plant growth-promoting association of
Rhizobium leguminosarum bv. trifolii with rice roots. Funct Plant Biol 28(9):845–870
Yanni YG, Dazzo FB, Squartini A, Zanardo M, Zidan MI, Elsadany AEY (2016) Assessment of the
natural endophytic association between Rhizobium and wheat and its ability to increase wheat
production in the Nile delta. Plant Soil:1–17
Yasin M, Munir I, Faisal M (2016) Can bacillus spp. enhance K+ uptake in crop species.
org/10.1007/978-81-322-2776-2_12
org/10.1007/978-81-322-2776-2_3
Chapter 8
Plant Growth-Promoting Rhizobacteria:
A Biological Approach Toward
the Production of Sustainable Agriculture
Mona Nagargade, Vishal Tyagi, and M. K. Singh
Abstract The plant growth-promoting rhizobacteria (PGPR) are naturally occur-

ring soil bacteria that aggressively colonize plant roots and benefit plants by provid-
ing growth promotion. Inoculation of crop plants with certain strains of PGPR at an
early stage of development improves biomass production through direct effects on
root and shoot growth. These PGPR can enhance plant growth by a wide variety of
mechanisms like nutrient solubilization (P, K, and Zn), siderophore production, bio-
logical nitrogen fixation (BNF), rhizosphere engineering, phytohormone produc-
tion, exhibiting antifungal activity, production of volatile organic compounds
(VOC), induction of systemic resistance (ISR), promoting beneficial plant-microbe
symbioses, interference with pathogen toxin production, etc. The potentiality of
PGPR in agriculture is steadily increased as it offers an attractive way to replace the
use of chemical fertilizers, pesticides, and other supplements.
Keywords Biofertilizers · Plant growth-promoting rhizobacteria (PGPR) ·

Siderophore · Sustainable agriculture
8.1 Introduction
In modern cultivation process, indiscriminate use of fertilizers, particularly the

nitrogenous and phosphorous, has led to substantial pollution of soil, air, and water.
Excessive use of these chemicals exerts deleterious effects on soil microorganism,
affects the fertility status of soil, and also pollutes the environment. The application
of these fertilizers on a long-term basis often leads to reduction in pH and exchange-
able bases, thus making them unavailable to crops, and the productivity of crop
declines (Meena et al. 2013a; Bahadur et al. 2014; Maurya et al. 2014; Jat et al.
2015; Kumar et al. 2015, 2016b; Ahmad et al. 2016). To obviate this problem and
M. Nagargade (*) · V. Tyagi · M. K. Singh

Department of Agronomy, Institute of Agricultural Sciences, Banaras Hindu University,
Varanasi, Uttar Pradesh, India

https://doi.org/10.1007/978-981-10-8402-7_8
206 M. Nagargade et al.
obtain higher plant yields, farmers have become increasingly dependent on chemi-
cal sources of nitrogen and phosphorus. Besides being costly, the production of
chemical fertilizers depletes nonrenewable resources, the oil and natural gas used to
produce these fertilizers, and poses human and environmental hazards. Sustainable
agriculture is vitally important in today’s world because it offers the potential to
meet our future agricultural needs, something that conventional agriculture will not
be able to do. Recently there has been a great interest in eco-friendly and sustainable
agriculture (Meena et al. 2016a, b; Parewa et al. 2014; Prakash and Verma 2016;
Priyadharsini and Muthukumar 2016; Kumar et al. 2016a, 2017).
Toward a sustainable agricultural vision, crops produced need to be equipped
with disease resistance, salt tolerance, drought tolerance, heavy metal stress toler-
ance, and better nutritional value (Vejan et al. 2016). To fulfill the above desired
crop properties, one possibility is to use soil microorganisms (bacteria, fungi, algae,
etc.) that increase the nutrient uptake capacity and water use efficiency. Among
these potential soil microorganisms, bacteria known as PGPR are the most promis-
ing. In this sense, PGPR may be used to enhance plant health and promote plant
growth rate without environmental contaminations. PGPR are naturally occurring
soil bacteria that aggressively colonize plant roots and benefit plants by providing
growth promotion (Saharan and Nehra 2011).
PGPR shows an important role in the sustainable agriculture industry. The
increasing demand for crop production with a significant reduction of synthetic
chemical fertilizer and pesticide use is a big challenge nowadays. The use of PGPR
has been proven to be an environmentally sound way of increasing crop yields by
facilitating plant growth through either a direct or indirect mechanism (Meena et al.
2015a, b, f; Raghavendra et al. 2016; Zahedi 2016; Rawat et al. 2016; Jaiswal et al.
2016; Jha and Subramanian 2016). The mechanisms of PGPR include regulating
hormonal and nutritional balance, inducing resistance against plant pathogens, and
solubilizing nutrients for easy uptake by plants. In addition, PGPR show synergistic
and antagonistic interactions with microorganisms within the rhizosphere and
beyond in bulk soil, which indirectly boosts plant growth rate. For decades, varieties
of PGPR have been studied and some of them have been commercialized, including
the species Pseudomonas, Bacillus, Enterobacter, Klebsiella, Azotobacter,
Variovorax, Azospirillum, and Serratia (Vejan et al. 2016). The successful utiliza-
tion of PGPR is dependent on its survival in soil, the compatibility with the crop on
which it is inoculated, the interaction ability with indigenous microflora in soil, and
environmental factors. According to Nakkeeran et al. (2005), an ideal PGPR should
possess high rhizosphere competence, enhance plant growth capabilities, have a
broad spectrum of action, be safe for the environment, be compatible with other
rhizobacteria, and be tolerant to heat, UV radiation, and oxidizing agent (Yasin et al.
2016; Meena et al. 2016c, d; Saha et al. 2016a, b; Yadav and Sidhu 2016; Dotaniya
et al. 2016).
8 Plant Growth-Promoting Rhizobacteria: A Biological Approach Toward… 207
8.2 Plant Growth-Promoting Rhizobacterial (PGPR) Forms
Plant growth-promoting rhizobacteria can be classified into extracellular plant

growth-promoting rhizobacteria (ePGPR) and intracellular plant growth-promoting
rhizobacteria (iPGPR). ePGPR may exist in the rhizosphere, on the rhizoplane, or in
the spaces between the cells of root cortex, while iPGPR locate generally inside the
specialized nodular structures of root cells (Gupta et al. 2015; Verma et al. 2014,
2015a, b; Sharma et al. 2016; Meena et al. 2013b, 2014a; Das and Pradhan 2016;
Dominguez-Nunez et al. 2016) (Table 8.1).
The bacterial/rhizobacterial genera such as Agrobacterium, Arthrobacter,
Azotobacter, Azospirillum, Bacillus, Burkholderia, Caulobacter, Chromobacterium,
Erwinia, Flavobacterium, Micrococcus, Pseudomonas, and Serratia belong to
ePGPR. iPGPR belongs to the family of Rhizobiaceae which includes Allorhizobium,
Bradyrhizobium, Mesorhizobium and Rhizobium, endophytes, and Frankia species,
both of which can symbiotically fix atmospheric nitrogen with the higher plants
(Bhattacharyya and Jha 2012; Shrivastava et al. 2016; Velazquez et al. 2016; Meena
et al. 2015c, e; Teotia et al. 2016; Bahadur et al. 2016b).
PGPR plays an important role in enhancing plant growth through a wide variety
of mechanisms. The mode of action of PGPR that promotes plant growth includes
(i) abiotic stress tolerance in plants, (ii) nutrient fixation for easy uptake by plant,
(iii) plant growth regulators, (iv) production of siderophores, (v) production of vola-
tile organic compounds, and (vi) prevention of plant diseases (by production of
protection enzyme such as chitinase, glucanase, and ACC deaminase) (Fig. 8.1).
Table 8.1 PGPR and their effect on growth parameters/yields of crop/fruit plants
PGPR Crop parameters
Rhizobium leguminosarum Direct growth promotion of canola and lettuce
Pseudomonas putida Early developments of canola seedlings, growth
stimulation of tomato plant
Azospirillum brasilense, A. irakense Increase in growth of wheat and maize plants
Pseudomonas fluorescens Increase in growth of pearl millet, leaf nutrient
contents, and yield of banana (Musa)
Azotobacter, Azospirillum sp. Growth and productivity of canola
P. alcaligenes, Bacillus polymyxa, Enhance uptake of N, P, and K by maize crop
Mycobacterium phlei
Pseudomonas, Azotobacter, Stimulate growth and yield of chickpea (Cicer
Azospirillum sp. arietinum)
R. leguminosarum, Pseudomonas sp. Improve the yield and phosphorus uptake in wheat
P. putida, P. fluorescens, A. brasilense Improve seed germination, seedling growth, and yield
of maize
P. putida, P. fluorescens, A. brasilense Enhance the germination, growth, and yield attributes
of maize crop
Prevention of
N-fixation
plant diseases
Production of
Abiotic stress plant growth
Direct
tolerance regulators
Production of
Mechanism of Nutrient volatile organic
PGPR solubilization compounds
Siderophore Crop
Indirect
production sustainablity
Fig. 8.1 Direct and indirect role of PGPR in enhancing plant growth
However, the mode of action of different PGPR varies depending on the type of
host plants. Plant growth is influenced by a variety of stresses due to the soil
environment, which is a major constraint for sustainable agricultural production
(Sindhu et al. 2016; Meena et al. 2014b, 2015d; Singh et al. 2016).
8.3 Abiotic Stress Tolerance in Plants
Abiotic stresses affect the productivity of agricultural crops as well as the microbial
activity in soil. PGPR mitigate most effectively the impact of abiotic stresses
(drought, low temperature, salinity, metal toxicity, and high temperature) on plants
through the production of exopolysaccharides (EPS) and biofilm formation (Nada
et al. 2012). Symbiotic fungi (arbuscular mycorrhizal fungi) and dual symbiotic
systems (endophytic rhizospheric bacteria and symbiotic fungi) also tend to miti-
gate the abiotic stress in plants. Plant growth-promoting rhizobacteria (PGPR) colo-
nize the rhizosphere of many plant species and confer beneficial effects, such as
increased plant growth and reduced susceptibility to diseases caused by plant patho-
genic fungi, bacteria, viruses, and nematodes (Kloepper 2004; Singh et al. 2015;
Meena et al. 2013c, 2016e; Bahadur et al. 2016a; Masood and Bano 2016).
8.3.1 Drought
Drought stress limits crop growth and productivity, especially in arid and semiarid
regions. Some microbial species and/or strains that inhabit plant rhizosphere use
different mechanisms to mitigate negative effects of drought on plants (Table 8.2).
PGPR mitigate the impact of drought on plants through a process called induced
systemic tolerance (IST), which includes (a) bacterial production of cytokinins,
Table 8.2 Effect of microorganisms on drought mitigation in crops

Microorganism Crop Mechanism
Pantoea agglomerans Wheat Rhizosphere soil aggregation through EPS
Paenibacillus polymyxa Arabidopsis Induction of stress-resistant gene ERD 15
Rhizobium sp. Sunflower Soil aggregation through EPS
Azospirillum sp. Wheat Improved water relations
Paraphaeosphaeria Arabidopsis Induction of HSP
quadriseptata
P. polymyxa, Rhizobium tropici Common Change in hormone balance and stomatal
bean conductance
Pseudomonas mendocina Lettuce Improved antioxidant status
Pseudomonas putida P45 Sunflower Improved soil aggregation due to EPS
production
Bacillus megaterium, Glomus Trifolium IAA and proline production
sp.
Adopted from Grover et al. (2011)
which causes the accumulation of abscisic acid (ABA) in leaves, which in its turn
results in the closing of stomata; (b) the production of antioxidants (e.g., the enzyme
catalase) which causes the degradation of reactive forms of oxygen; and (c) the
bacterial-produced ACC deaminase which degrades the ethylene precursor 1-amino
cyclopropane-1-carboxylic acid (ACC). PGPR also produce osmolytes and bacte-
rial exopolysaccharides (EPS) to ensure survival of plants under drought-stressed
conditions (Kaushal and Wani 2016). Some PGPR also elicit physical or chemical
changes related to plant defense, a process referred as “induced systemic resistance”
(ISR) (Van Loon 2004; Meena et al. 2017). Timmusk and Wagner (1999) reported
that inoculation with the PGPR Paenibacillus polymyxa enhanced the drought toler-
ance of Arabidopsis thaliana.
PGPR mitigate the impact of drought on plants through a process so-called
induced systemic tolerance (IST), which includes: (a) Bacterial production of cyto-
kinins, which causes the accumulation of abscisic acid (ABA) in leaves, which in its
turn results in the closing of stomata, (b) The production of antioxidants (e.g., the
enzyme catalase) causes the degradation of reactive forms of oxygen, (c) The
bacterial-produced ACC deaminase degrades the ethylene precursor
1-aminocyclopropane- 1-carboxylate (ACC). PGPR also produce osmolytes and
bacterial exopolysaccharides (EPS) to ensure survival of plants under drought
stressed conditions (Kaushal and Wani 2016). Some PGPR also elicit physical or
chemical changes related to plant defence, a process refers as ‘induced systemic
resistance’ (ISR) (Van Loon 2004). Timmusk and Wagner (1999) reported that inoc-
ulation with the PGPR Paenibacillus polymyxa enhanced the drought tolerance of
Arabidopsis thaliana.
8.3.2 Excess Moisture
With the changing climatic scenario these stressful conditions of excessive mois-
ture, microorganisms take up the available oxygen while toxic substances accumu-
late in the soil. In such conditions, plants reduce the permeability of roots, water
absorption, and nutrient uptake, which reduce the growth of aboveground plant
parts and roots (Nada et al. 2012). Provoked by excessive moisture, roots release
large quantities of aminocyclopropane carboxylate-1 (ACC) into the soil. Some
groups of bacteria degrade ACC and reduce its concentration in the soil by secreting
the enzyme ACC deaminase. In excessively moist soil, bacteria such as Enterobacter
cloacae and Pseudomonas putida predominate over fungi and actinomycetes
(Grichko and Glick 2001). Mycorrhizal fungi mitigate the stress caused in plants by
excessive moisture.
8.3.3 Temperatures
All organisms respond to a sudden increase in temperature by inducing the synthe-

sis of specific group of polypeptides known as heat shock proteins (HSPs). HSPs
consist of chaperons (such as GroEL, DnaK, DnaJ, GroES, ClpB, ClpA, ClpX,
small heat shock proteins (sHSP), and proteases). Chaperons are involved in the
proper folding of denatured proteins, and proteases are required for the degradation
of irreversibly damaged proteins (Grover et al. 2011). A thermotolerant P. aerugi-
nosa strain AMK-P6 isolated from semiarid location showed induction of HSPs
when exposed to high temperature (Ali et al. 2009). Some bacterial species and
strains affect plant tolerance to high temperature. So, Pseudomonas sp. strain
NBRI0987 causes thermotolerance in sorghum seedlings, which consequently syn-
thesize high molecular weight proteins in leaves, thus increasing the plant biomass.
Meena et al. (2015) also reported that Pseudomonas aeruginosa (strain 2CpS1)
reduced cell membrane injury (%) in wheat under high temperature stress.
The bacterium Burkholderia phytofirmans PSJN colonizes grapevine residues
and protects the plant against heat and frost through increases in the levels of starch,
proline, and phenols (Ait Barka et al. 2006). Inoculation of wheat seeds with
Serratia marcescens strain SRM and Pantoea dispersa strain 1A increases the seed-
ling’s biomass and nutrient uptake at low temperatures. In an experiment, Turan
et al. (2012) reported that application of Bacillus megaterium M3 and Bacillus sub-
tilis OSU142 alleviates the low-temperature deleterious effect in wheat and barley.
8.3.4 Salinity
Microorganisms use different mechanisms to alleviate the salinity stress in agricul-

tural crops (Table 8.3). Inoculation of wheat seedlings with bacteria that produce
exopolysaccharides (EPS) affects the restriction of sodium uptake and stimulation
Table 8.3 Effect of microorganisms on mitigation of salinity stress in agricultural crops

Microorganism Crop Mechanism
Achromobacter piechaudii Tomato Synthesis of ACC deaminase
Piriformospora indica Barley Increased antioxidative capacity
AM fungi Sorghum Increased water circulation
B. amyloliquefaciens, B. insolitus Wheat Restricted Na+ uptake
Pseudomonas fluorescens Groundnut Synthesis of ACC deaminase
Source: Grover et al. (2011)
of plant growth under conditions of stress caused by high salinity. Corn, beans, and
clover inoculated with AM fungi improved their osmoregulation and increased pro-
line accumulation which resulted in salinity resistance.
8.3.5 Heavy Metals
Heavy metals affect the soil microbial population, their effects depending on the
element in question and its concentration on one side and the bacterial species/strain
on the other. Some heavy metals are essential micronutrients that are required in
small quantities for the growth of microorganisms and plants. Microorganisms bind
soluble heavy metals in three ways (biosorption, bioaccumulation, and the binding
by metabolic products), which indirectly reduce the negative impact of heavy met-
als on plants. Methylobacterium oryzae and Burkholderia sp. reduce nickel and
cadmium stress in tomato by reducing their uptake and translocation (Marquez et al.
2007). Heavy metals such as Cd, Ni, and Pb disrupt the water regime in plants.
Proline accumulation in plant cells is a biomarker for stress induced by heavy met-
als (Ciupa et al. 2013).
8.4 Plant Growth Regulators
A wide range of microorganisms found in the rhizosphere are able to produce sub-
stances that regulate plant growth and development. Plant growth-promoting rhizo-
bacteria produce phytohormones such as auxins, cytokinins, gibberellins, and
ethylene which can affect cell proliferation in the root architecture by overproduc-
tion of lateral roots and root hairs with a subsequent increase of nutrient and water
uptake (Arora et al. 2013).
Indoleacetic acid (IAA): Among plant growth regulators, IAA is the most com-
mon natural auxin found in plants and its positive effect on root growth.
Rhizobacterial strains synthesize ~80% of IAA colonized the seed or root surfaces
is proposed to act in conjunction with endogenous IAA in plant to stimulate cell
proliferation and enhance the host’s uptake of minerals and nutrients from the soil.
The IAA affects plant cell division, extension, and differentiation; stimulates seed
and tuber germination; increases the rate of xylem and root development; controls
processes of vegetative growth; initiates lateral and adventitious root formation;
mediates responses to light, gravity, and florescence; and affects photosynthesis,
pigment formation, biosynthesis of various metabolites, and resistance to stressful
conditions (Spaepen and Vanderleyden 2011). Tryptophan is an amino acid com-
monly found in root exudates and has been identified as main precursor molecule
for biosynthesis of IAA in bacteria. The biosynthesis of indoleacetic acid by plant
growth-promoting rhizobacteria involves formation via indole-3-pyruvic acid and
indole-3-acetic aldehyde, which is the most common mechanism in bacteria like
Pseudomonas, Rhizobium, Bradyrhizobium, Agrobacterium, Enterobacter, and
Klebsiella (Shilev 2013).
Cytokinins, gibberellins and ethylene: Several plant growth-promoting rhizobac-
teria, e.g., Azotobacter sp., Rhizobium sp., Pantoea agglomerans, Rhodospirillum
rubrum, Pseudomonas fluorescens, Bacillus subtilis, and Paenibacillus polymyxa,
can produce either cytokinins or gibberellins or both for plant growth promotion.
Ethylene is a key phytohormone that has a wide range of biological activities that
can affect plant growth and development in a large number of different ways includ-
ing promoting root initiation, inhibiting root elongation, promoting fruit ripening,
promoting lower wilting, stimulating seed germination, promoting leaf abscission,
and activating the synthesis of other plant hormones (Glick 2007). The high concen-
tration of ethylene induces defoliation and other cellular processes that may lead to
reduced crop performance. The enzyme 1-aminocyclopropane-1-carboxylic acid
(ACC) is a prerequisite for ethylene production, catalyzed by ACC oxidase. Iqbal
et al. (2012) reported improved nodule number, nodule dry weight, fresh biomass,
grain yield, straw yield, and nitrogen content in grains of lentil as a result of lower-
ing of the ethylene production via inoculation with plant growth-promoting strains
of Pseudomonas sp. containing ACC deaminase along with R. leguminosarum.
Currently, bacterial strains exhibiting ACC deaminase activity have been identified
in a wide range of genera such as Acinetobacter, Achromobacter, Agrobacterium,
Alcaligenes, Azospirillum, Bacillus, Burkholderia, Enterobacter, Pseudomonas,
Ralstonia, Serratia, Rhizobium, etc. (Kang et al. 2010).
8.5 Role of PGPR as a Biofertilizer
PGPR have the activity to fix atmospheric nitrogen and also enhance nutrient uptake
from soils, thus reducing the need for fertilizers and preventing the accumulation of
nitrates and phosphates in agricultural soils. A reduction in fertilizer use would
lessen the effects of water contamination from fertilizer runoff and lead to savings
for farmers. As per findings of Mishra et al. (2013),
biofertilizer is a mixture of live or latent cells encouraging N-fixing, P-solubilization, K-
solubilization and Zn-solublization or cellulolytic microorganisms used for biopriming of
soil, seed, roots, or composting areas with the purpose of increasing the quantity of those
mutualistic beneficial microorganisms and accelerating those microbial processes, which

augment the availability of nutrients that can then be easily assimilated and absorbed by the
plants.
Meanwhile, biofertilizer products are usually based on the plant growth-promoting

microorganisms (PGPMs). These PGPMs can be classified into three dominant
groups of microorganisms, arbuscular mycorrhizal fungi (AMF), PGPR, and
N-fixing rhizobia, which are deemed to be beneficial to plant growth and nutrition.
However, it has been reported that PGPR have been used worldwide as biofertiliz-
ers, contributing to increased crop yields and soil fertility (Gupta et al. 2015).
Hence, with the potential contribution of the PGPR, this leads to sustained agricul-
ture and forestry. Previous studies show that a biofertilizer prepared by combining
PGPR with composts could enhance PGP effects and biocontrol of plants. Bacillus
sp. and Pseudomonas sp. are two PGPR that have been reported to be effective bio-
control agents. Among these bacterial species, Bacillus subtilis, Bacillus amyloliq-
uefaciens, and Bacillus cereus are the most effective species at controlling plant
diseases through various mechanisms. The ability to form endospores allows PGPR,
especially Bacillus sp. and Pseudomonas sp., to survive in a wide range of environ-
mental conditions, thus facilitating the effective formulation of biofertilizer.
Sufficient densities of PGPR in biofertilizer provide a beneficial role in creating a
proper rhizosphere for PGPR and converting nutritionally important elements
through biological process, for example, increasing the availability of N, P, and K,
as well as inhibiting pathogen growth. The high availability of N, P, and K could
enhance soil fertility, improve antagonistic isolate’s biocontrol effects, and extend
microorganisms survival rates in soil (Vejan et al. 2016).
8.6 Biological Nitrogen Fixation (BNF)
The use of chemical nitrogen fertilizers in agriculture not only depletes nonrenew-
able energy resources but also poses human and environmental hazards, besides
being very expensive. For sustainable crop production, PGPR may be used to
enhance plant health and promote plant growth rate without environmental contami-
nation (Armada et al. 2014). The efficient BNF microorganisms are considered one
of the major mechanisms by which plants benefit from the association of micropart-
ners. One of the benefits that diazotrophic microorganisms provide to plants is fixed
nitrogen in exchange for fixed carbon released as root exudates (Zahir et al. 2004).
The BNF contributes 180 × 106 Mt/year globally, out of which symbiotic associa-
tions produce ~80% and the rest comes from free-living or associative systems
(Saharan and Nehra 2011). The use of biofertilizer and bio-enhancer such as
N-fixing bacteria and beneficial microorganism can reduce chemical fertilizer appli-
cations and consequently lower production cost (Meena 2013). PGPR can fix atmo-
spheric nitrogen either symbiotically or nonsymbiotically.
8.7 Symbiotic Nitrogen Fixation
Two groups of nitrogen-fixing rhizobacteria (NFR) have been studied extensively,

which includes Rhizobia and Frankia. The Frankia forms root nodules in symbiosis
with more than 200 species of nonleguminous woody plants in 24 genera of angio-
sperms (Welsh et al. 2009). When rhizobia colonize the roots from nonlegume plant
in a nonspecific relationship, the strains from this genus may behave as PGPR
(Saharan and Nehra 2011). The beneficial effects of the symbiotic association
between rhizobia and legumes are well known, and these have been intensively
investigated. Moreover, previous studies have shown that free-living bacteria as
well as rhizobial strains can promote the growth of cereal plants by contributing to
N-economy through their ability to fix N2 (Biswas et al. 2000).
8.8 Nonsymbiotic Nitrogen Fixers
The nonsymbiotic biological N fixation is basically carried out by free-living diazo-

trophs that belong to the genera like Azospirillum (Bashan and de-Bashan 2010),
Burkholderia, Gluconacetobacter, Pseudomonas (Mirza et al. 2006), Azotobacter,
Arthrobacter, Acinetobacter, Bacillus, Enterobacter, Erwinia, Flavobacterium,
Klebsiella, Acetobacter, etc. associated with the plant rhizosphere and fix atmo-
spheric N2 into form which is taken up by the plants. These are free-living rhizobac-
teria and live outside the plant cells and do not produce nodules. Tan et al. (2015)
observed that multi-strain biofertilizer with a locally isolated PGPR (UPMB19,
Lysinibacillus xylanilyticus) and an indigenous rhizobia (UPMR30, Bradyrhizobium
japonicum) promoted rice shoot (6–20%) and root growth (19–76%), tiller numbers
(4–32%), plant dry weight (13–22%), and nutrient accumulations (0.2–30%) and
substantially increased the BNF of the plant. The combined PGPR and rhizobia
inoculation reduced the plant dependence on chemical N-fertilizer through their
synergistic BNF activities and contributed up to 22% of N2 fixed from the atmo-
sphere. Biswas et al. (2000) also reported that biological nitrogen fixation by diazo-
trophic PGPR strains may be a contributing factor of rice growth promotion in
addition to other mechanisms.
8.9 Phosphate Solubilization
Phosphorus (P) is second most important plant nutrient, but most of P remains fixed
in soil which is not available to plants. Microorganisms offer a biological rescue
system capable of solubilizing the insoluble inorganic P of soil and make it avail-
able to the plants. The ability of some microorganisms to convert insoluble P to an
accessible form, like orthophosphate, is an important trait for increasing plant yields
(Rodriguez et al. 2006). Many scientists have reported the ability of different bacte-
rial species to solubilize insoluble inorganic phosphate compounds such as dical-
cium phosphate, tricalcium phosphate, rock phosphate, and hydroxyapatite. These
bacteria solubilize phosphate through the production of acids and by some other
mechanism and are termed as phosphate-solubilizing bacteria or rhizobacteria (PSB
or PSR). A number of metabolites are released by these strains which strongly affect
the environment and increase nutrient availability for the plants, viz., Bacillus sub-
tilis, B. licheniformis, B. megaterium var. phosphaticum, and Pseudomonas lutea.
Bacterial genera like Azospirillum, Azotobacter, Bacillus, Beijerinckia,
Burkholderia, Enterobacter, Erwinia, Flavobacterium, Microbacterium,
Pseudomonas, Rhizobium, and Serratia are reported as the most significant PSB
(Mehnaz and Lazarovits 2006). Lavakush et al. (2014) revealed that treatment com-
bination of CPC [PGPR strains, e.g., Pseudomonas aeruginosa BHUJY16, P. aeru-
ginosa BHUJY20, Pseudomonas putida BHUJY13, P. putida BHUJY23, and
Pseudomonas fluorescens BHUJY29 were known as combined Pseudomonas cul-
ture (CPC)] with Azotobacter chroococcum, Azospirillum brasilense, and 30 kg
ha−1 P2O5 is saving 50% chemical fertilizer than treatment combination of CPC with
A. chroococcum, A. brasilense, and 60 kg ha−1 P2O5 and also enhances significant
plant growth attributes, yields, and nutrient content in rice crops. These combina-
tions of microbial consortia may be used as efficient bi-inoculants for integrated
nutrient management for rice production under sustainable agriculture. It is
environment-friendly, economically cheaper alternate to chemical fertilizer and
efficient combination for enhancing rice production as well as enhancing the soil
fertility and health.
8.10 Production of Siderophores
The efficient microorganisms have evolved specialized mechanisms for the assimi-
lation of iron, including the production of low molecular weight iron-chelating
compounds known as siderophores, which transport this element into their cells.
Siderophores are divided into three main families depending on the characteristic
functional group, i.e., hydroxamates, catecholates, and carboxylates. At present
more than 500 different types of siderophores are known, of which ~270 have been
structurally characterized (Cornelis 2010).
Siderophore production confers competitive advantages to PGPR that can colo-
nize roots and exclude other microorganisms from this ecological niche. Under
highly competitive conditions, the ability to acquire iron via siderophores may
determine the outcome of competition for different carbon sources that are available
as a result of root exudation or rhizodeposition. Among most of the bacterial sidero-
phores studied, those produced by pseudomonads are known for their high affinity
to the ferric ion. The potent siderophore, pyoverdin, for example, can inhibit the
growth of bacteria and fungi that present less potent siderophores in iron-depleted
media in vitro (Kloepper et al. 1980a). A pseudobactin siderophore produced by P.
putida B10 strain was also able to suppress Fusarium oxysporum in soil deficient in
iron; this suppression was lost when the soil was replenished with iron, a condition
that represses the production of iron chelators by microorganisms (Kloepper et al.
1980b). Recent studies have demonstrated the suppression of soilborne fungal
pathogens through the release of iron-chelating siderophores by fluorescent pseudo-
monads (Dwivedi and Johri 2003). Two fluorescent Pseudomonads, Pseudomonas
fluorescens NCIM 5164 and Pseudomonas aeruginosa NCIM 2036, produced sid-
erophores under iron-limiting conditions. Both the Pseudomonas sp. were further
tested as seed inoculants and found to be very effective in seed germination and
plant growth promotion of Triticum aestivum and Apios americana plants under pot
culture conditions (Bholay et al. 2012).
8.11 PGPR as Biocontrol Agent
PGPR are indigenous to soil and the plant rhizosphere and play a major role in the
biocontrol of plant pathogens. They can suppress a broad spectrum of bacterial,
fungal nematode, and viral diseases. Most of the PGPR produce antifungal metabo-
lites (AFMs), i.e., phenazines, pyrrolnitrin, 2, 4-diacetylphloroglucinol (DAPG),
pyoluteorin, viscosinamide, and tensin (Table 8.4).
Among PGPR, Pseudomonas is the best-characterized biocontrol agent at
molecular level. Pseudomonads possess many traits that make them well suited as
biocontrol and growth-promoting agents (Saharan and Nehra 2011). These include
the ability to (i) grow rapidly in vitro and to be mass produced, (ii) rapidly utilize
seed and root exudates, (iii) colonize and multiply in the rhizosphere and spermo-
sphere environments and in the interior of the plant, (iv) produce a wide spectrum
of bioactive metabolites (i.e., antibiotics, siderophores, volatiles, and growth-
Table 8.4 PGPR used as biocontrol agents against different diseases, pathogens, and insects
affecting different crops
PGPR Crops Disease/pathogen/insect
Bacillus amyloliquefaciens Tomato Tomato mottle virus
Pseudomonas fluorescens Tobacco Tobacco necrosis virus
Bacillus pumilus SE 34 Tobacco Blue mold
Bacillus licheniformis Pepper Myzus persicae
Bacillus cereus MJ-1 Red pepper Myzus persicae
Enterobacter sp. Chickpea Fusarium avenaceum
Azospirillum brasilense Prunus cerasifera L. Rhizosphere fungi
Pseudomonas aeruginosa Mung bean Root rot
Bacillus subtilis G803 Pepper Myzus persicae
Bacillus amyloliquefaciens Bell pepper Myzus persicae
Adopted from Bhattacharyya and Jha (2012)
promoting substances), (v) compete aggressively with other microorganisms, and

(vi) adapt to environmental stresses. In addition, Pseudomonas is responsible for the
natural suppressiveness of some soilborne pathogens (Weller et al. 2002). The major
weakness of Pseudomonas as biocontrol agents is their inability to produce resting
spores (as do many Bacillus sp.), which complicates formulation of the bacteria for
commercial use. Yuttavanichakul et al. (2012) study demonstrated that isolate PGPR
A20 and A45 (108 cell per ml) significantly reduced disease incidence and disease
severity when 105 or 106 spores per ml of Aspergillus niger were applied to plants.
PGPR isolates A20 and A45 co-inoculated with commercial Bradyrhizobium sp.
TAL 173 (108 cell per ml) provided further protection of the seed from the patho-
genic fungus A. niger and promoted the growth of peanut plants.
8.12 Conclusions
As long as the human population continues to increase, the world will have to with-
stand the escalating demand for food. Seven decades ago, the Green Revolution
increased agricultural production globally, saving about one billion people from
starvation and undernourishment; it triggered the development of chemical fertiliz-
ers, along with other advances. This has to be put to rest; the conventional crop
approach cannot be practiced anymore since anthropogenic activities such as inten-
sive agriculture, crop monocultures, and the use of agrochemicals are grave con-
cerns and disturb the ecosystem. The present review indicates the development and
formulations of PGPR in biological promotion of different characteristics of plant
growth. Use of PGPR can play an important role toward achieving the objectives of
sustainable agriculture. Several benefits of PGPR in terms of biofertilization, bio-
control, and bioremediation exert a positive influence on crop productivity and eco-
system functioning. The development of stable formulations of antagonistic PGPR
in sustainable agricultural systems thus established as another promising approach
replacing the use of chemical fertilizers. Besides, PGPR are protecting natural envi-
ronments as well as biological resources by playing a significant role in integrated
pest management system (IPM). Thus, it is becoming increasingly apparent that
most of the PGPR strains can promote plant growth by several mechanisms, though
most studies currently focus on individual mechanisms and have not yet been able
to sort out the relative contributions of different processes that are also responsible
for successful plant growth promotion. However, carefully controlled field trials of
crop plants inoculated along with rhizobacteria are necessary for maximum com-
mercial exploitation of PGPR strains.
Acknowledgments We thank the editor and anonymous reviewers for their constructive com-
ments, which helped us to improve the manuscript.
References
https://doi.org/10.1007/978-81-322-2776-2_21
Ait Barka E, Nowak J, Clement C (2006) Enhancement of chilling resistance of inoculated grape-
vine plantlets with a plant growth promoting rhizobacterium, Burkholderia phytofirmans strain
PsJN. Appl Environ Microbiol 72:7246–7252
Ali SZ, Sandhya V, Grover M, Kishore N, Rao LV, Venkateswarlu B (2009) Pseudomonas sp.
strain AKM-P6 enhances tolerance of sorghum seedlings to elevated temperatures. Biol Fertil
Soil 46:45–55
Armada E, Portela G, Roldan A, Azcon R (2014) Combined use of beneficial soil microorganism
and agrowaste residue to cope with plant water limitation under semiarid conditions. Geoderma
232:640–648
Arora NK, Tewari S, Singh R (2013) Multifaceted plant-associated microbes and their mecha-
nisms diminish the concept of direct and indirect PGPRs. In: Arora NK (ed) Plant microbe
symbiosis: fundamentals and advances. Springer, New Delhi, pp 411–449
219431
Bashan Y, De-Bashan LE (2010) How the plant growth- promoting bacterium Azospirillum pro-
motes plant growth–a critical assessment. Adv Agron 108:77–136
Bhattacharyya PN, Jha DK (2012) Plant growth-promoting rhizobacteria (PGPR): emergence in
agriculture. World J Microbiol Biotechnol 28:1327–1350
Bholay AD, Jadhav Priyanka U, Borkhataria BV, Mayuri V, Dhalkari (2012) Fluorescent pseudo-
monads as plant growth promoting rhizobacteria and their siderophoregenesis. IOSR J Pharm
Biol Sci 3(1):27–32
Biswas JC, Ladha JK, Dazzo FB (2000) Rhizobia inoculation improves nutrient uptake and growth
of lowland rice. Soil Sci Soc Am J 64:1644–1650
Ciupa MK, Ciepał R, Socha AN, Barczyk G (2013) A comparative study of heavy metal accumula-
tion and antioxidant responses in Vaccinium myrtillus L. leaves in polluted and non-polluted
areas. Environ Sci Pollut Res 20:4920–4932
Cornelis P (2010) Iron uptake and metabolism in Pseudomonads. Appl Microbiol Biotechnol
86:1637–1645
org/10.1007/978-81-322-2776-2_20
pp 77–98. https://doi.org/10.1007/978-81-322-2776-2_6
org/10.1007/978-81-322-2776-2_19
Dwivedi D, Johri BN (2003) Antifungals from fluorescent pseudomonads: biosynthesis and regu-
lation. Curr Sci 12:1693–1703
Glick BR (2007) Promotion of plant growth by bacterial ACC deaminase. Crit Rev Plant Sci
26:227–242
Grichko VP, Glick BR (2001) Flooding tolerance of transgenic tomato plants expressing the bac-
terial enzyme ACC deaminase controlled by the 35S, rolD or PRB1b promoter. Plant Physiol
Biochem 39:19–25
Grover M, Ali SZ, Sandhya V, Rasul A, Venkateswarlu B (2011) Role of microorganisms in adap-
tation of agriculture crops to abiotic stresses. World J Microbiol Biotechnol 27:1231–1240
Gupta G, Parihar SS, Ahirwar NK, Snehi SK, Singh V (2015) Plant growth promoting rhizobac-
teria (PGPR): current and future prospects for development of sustainable agriculture. Microb
Biochem Technol 7(2):096–102
Iqbal MA, Khalid M, Shahzad SM, Ahmad M, Soleman N (2012) Integrated use of Rhizobium
leguminosarum, plant growth promoting rhizobacteria and enriched compost for improving
growth, nodulation and yield of lentil (Lens culinaris Medik). Chil J Agric Res 72:104–110
9(2):1211–1221
Kang BG, Kim WT, Yun HS, Chang SC (2010) Use of plant growth-promoting rhizobacteria to
control stress responses of plant roots. Plant Biotechnol Rep 4:179–183
Kaushal M, Wani SP (2016) Plant-growth-promoting rhizobacteria: drought stress alleviators to
ameliorate crop production in dry. Ann Microbiol 66:35–42
Kloepper JW (2004) Induced systemic resistance and promotion of plant growth by Bacillus spe-
cies. Phytopathology 94:1259–1266
Kloepper JW, Leong J, Teintze M, Schroth MN (1980a) Enhancing plant growth by siderophores
produced by plant growth-promoting rhizobacteria. Nature 286:885–886
Kloepper JW, Leong J, Teintze M, Schroth MN (1980b) Pseudomonas siderophores: a mechanism
explaining disease-suppressive soils. Curr Microbiol 4:317–320
org/10.1007/s00344-016-9663-5
Lavakush, Yadava J, Verma JP, Jaiswal DK, Kumar A (2014) Evaluation of PGPR and different
concentration of phosphorus level on plant growth, yield and nutrient content of rice (Oryza
sativa). Ecol Eng 62:123–128
Marquez LM, Redman RS, Rodriguez RJ, Roosinck MJ (2007) A virus in a fungus in a plant:
three-way symbiosis required for thermal tolerance. Science 315(5811):513–515
https://doi.org/10.1007/978-81-322-2776-2_10
Meena RK (2013) Plant growth-promoting rhizobacteria: a biological approach towards the pro-
duction of sustainable agriculture. Popularkheti 1(1):29–36
Meena H, Ahmed MA, Prakash P (2015) Amelioration of heat stress in wheat, Triticum aesti-
vum by PGPR (Pseudomonas aeruginosa strain 2CpS1). Biosci Biotechnol Res Commun
8(2):171–174
jclepro.2015.04.044
mentation of their plant growth promoting traits. Biocatalysis and Agric Biotechnol 4:806–811
Bacillus species enhance nutrient availability in agricultural soils? In: Islam MT, Rahman M,
https://doi.org/10.1007/978-3-319-44409-3_16
Mehnaz S, Lazarovits G (2006) Inoculation effects of Pseudomonas putida, Gluconacetobacter
azotocaptans, and Azospirillum lipoferum on corn plant growth under greenhouse conditions.
Microb Ecol 51:326–335
Mirza MS, Mehnaz S, Normand P (2006) Molecular characterization and PCR detection of a nitro-
gen fixing Pseudomonas strain promoting rice growth. Biol Fertil Soils 43:163–170
Mishra D, Rajvir S, Mishra U, Kumar SS (2013) Role of bio-fertilizer in organic agriculture: a
review. Res J Recent Sci 2:39–41
Nada A, Milosevic JB, Marinkovic BBT (2012) Mitigating abiotic stress in crop plants by micro-
organisms. Proc Natl Sci 123:17–26
Nakkeeran S, Fernando WGD, Siddiqui ZA (2005) Plant growth promoting rhizobacteria formula-
tions and its scope in commercialization for the management of pests and diseases. In: Siddiqui
ZA (ed) PGPR: biocontrol and biofertilization. Springer, Dordrecht, pp 257–296
org/10.1007/978-81-322-2776-2_4
Rodriguez H, Fraga R, Gonzalez T, Bashan Y (2006) Genetics of phosphate solubilization
and its potential applications for improving plant growth-promoting bacteria. Plant Soil
287(1–2):15–21
pp 127–136. https://doi.org/10.1007/978-81-322-2776-2_9
Saharan BS, Nehra V (2011) Plant growth promoting rhizobacteria: a critical review. Life Sci Med
Res 21:1–30
Shilev S (2013) Soil rhizobacteria regulating the uptake of nutrients and undesirable elements by
plants. In: Arora NK (ed) Plant microbe symbiosis: fundamentals and advances. Springer, New
Delhi, pp 147–150
Spaepen S, Vanderleyden J (2011) Auxin and plant-microbe interactions. Cold Spring Harb
Perspect Biol 3:a001438
Tan KZ, Radziah O, Halimi MS, Khairuddin AR, Shamsuddin ZH (2015) Assessment of plant
growth-promoting rhizobacteria (PGPR) and rhizobia as multi-strain biofertilizer on growth
and N2 fixation of rice plant. Aust J Crop Sci 9(12):1257–1264
Timmusk S, Wagner GH (1999) The plant-growth-promoting rhizobacterium Paenibacillus poly-
myxa induces changes in Arabidopsis thaliana gene expression: a possible connection between
biotic and abiotic stress responses. Mol Plant-Microbe Interact 12:951–959
Turan M, Gulluce M, Fikrettin S (2012) Effects of plant-growth-promoting rhizobacteria on yield,
growth, and some physiological characteristics of wheat and barley plants. Commun Soil Sci
Plant Anal 43:1658–1673
Van Loon LC (2004) Systemic resistance induced by rhizosphere bacteria. Annu Rev Phytopathol
36:453–483
Vejan P, Abdullah R, Khadiran T, Ismail S, Boyce ANI (2016) Role of plant growth promoting
rhizobacteria in agricultural sustainability—a review. Molecules 21(573):1–17
84(8):914–919
Weller DM, Raaijmakers JM, McSpadden Gardener BB, Thomashow LS (2002) Microbial popu-
lations responsible for specific soil suppressiveness to plant pathogens. Annu Rev Phytopathol
40:309–348
Welsh AK, Dawson JO, Gerald J, Gottfried HD (2009) Diversity of Frankia populations in root
nodules of geographically isolated Arizona alder trees in Central Arizona (United States). Appl
org/10.1007/978-81-322-2776-2_14
org/10.1007/978-81-322-2776-2_12
Yuttavanichakul W, Lawongsa P, Wongkaew S, Teaumroong N, Boonkerd N, Nomura N, Tittabutr
P (2012) Improvement of peanut rhizobial inoculant by incorporation of plant growth promot-
ing rhizobacteria (PGPR) as biocontrol against the seed borne fungus, Aspergillus niger. Biol
Control 63:87–97
org/10.1007/978-81-322-2776-2_3
Zahir AZ, Arshad M, William TF (2004) Plant growth promoting rhizobacteria: applications and
perspectives in agriculture. Adv Agron 81:97–168
Chapter 9
Application and Mechanisms of Bacillus
subtilis in Biological Control of Plant
Disease
X. Q. Wang, D. L. Zhao, L. L. Shen, C. L. Jing, and C. S. Zhang
Abstract The pathogenic microorganisms affecting plant health are major and
chronic threats to sustainable food production and ecosystem stability worldwide.
Currently, synthetic chemicals are the most widely used as a control methods.
However, the continuous use of pesticides has caused environmental harm.
Biological disease control using beneficial antagonists is an environmentally
sustainable alternative to using synthetic pesticides. One of the promising
microorganisms for sustainable agriculture is Bacillus subtilis, which has been
reported as a growth promoter and as antagonistic to a variety of pathogens in vitro
and in greenhouse and field studies. The disease suppression by B. subtilis is the net
result of multiple mechanisms, including plant growth promotion (PGP), antibiosis,
competition for space and nutrients, lysis of pathogen hyphae, and induced systemic
resistance (ISR). Most of the B. subtilis isolates exhibit several mechanisms that
may affect the “disease triangle” directly, indirectly, or synergistically. This chapter
examines associations between B. subtilis and plant disease control, with a focus on
mechanisms and knowledge gaps.
Keywords Bacillus subtilis · Biological control · Sustainable agriculture · Disease

suppression
9.1 Introduction
The crop diseases cause major yield losses, and emerging diseases pose new threats
to global food security (Wulff et al. 2011). Bacillus subtilis is a gram-positive,
spore-forming bacterium that is widely distributed in the environment. As B. subtilis
produces different biologically active compounds, forms stress-tolerant endospores,
X. Q. Wang · D. L. Zhao · L. L. Shen · C. L. Jing · C. S. Zhang (*)

Pest Integrated Management Key Laboratory of China Tobacco, Tobacco Research Institute
of Chinese Academy of Agricultural Sciences, Qingdao, China
e-mail: zhangchengsheng@caas.cn

https://doi.org/10.1007/978-981-10-8402-7_9
226 X. Q. Wang et al.
and is easily isolated and cultured, it has received considerable attention as a

biological control agent. B. subtilis can suppress several important plant pathogens,
including Fusarium sp. (Cao et al. 2011; Zhao et al. 2013), Rhizoctonia solani
(Kumar et al. 2012), Sclerotium rolfsii (De Curtis et al. 2010), Sporisorium reilianum
(Mercado-Flores et al. 2014), and Verticillium dahliae (Li et al. 2013). In addition
to controlling diseases, B. subtilis application can enhance plant growth and yields
(Mercado-Flores et al. 2014). Nowadays, many products that contain B. subtilis are
available.
Intensive research has indicated that the effects of B. subtilis on plant disease
suppression are attributable to antibiosis, competition for space and nutrients, lysis
of pathogen hyphae, and induced systemic resistance (ISR) (Yu et al. 2011; Cao
et al. 2012; Li et al. 2013). In addition, B. subtilis increases N uptake, phosphate
solubilization, and siderophore and phytohormone production, promoting plant
growth. B. subtilis has a demonstrated positive effect on disease suppression by
altering the composition and function of soil microbial communities (You et al.
2016). This chapter begins with describing the application of B. subtilis in agriculture
to exert their benefit in plant disease control. Followed by elaborating the mechanisms
of B. subtilis on plant growth promotion and disease control. Finally, it summarized
the problems and prospects in B. subtilis research and application to have a better
future for development as reliable components in the management of sustainable
agricultural production systems and knowledge gaps.
9.2 Application of B. subtilis in Plant Disease Control
B. subtilis is the most studied biocontrol agent that is widely used in sustainable
agriculture. According to reports, most antagonistic B. subtilis strains were
rhizosphere or endophytic bacteria or rhizobacteria. Different B. subtilis strains
have demonstrated in vitro pathogen antagonistic activity (Yánez-Mendizábal et al.
2012). Many other strains have the potential to control different diseases caused by
rhizobacterial or fungal pathogens in greenhouses and fields (Meena et al. 2013a,
2016a; Bahadur et al. 2014; Maurya et al. 2014; Jat et al. 2015; Kumar et al. 2015,
2016b; Ahmad et al. 2016; Parewa et al. 2014).
Table 9.1 lists some B. subtilis strains associated with plant disease control,
including corn leaf blight (Ye et al. 2012), Fusarium head blight of wheat (Dunlap
et al. 2015), wheat take-all (Yang et al. 2015), and rice blast (Yang et al. 2015). B.
subtilis is also used to control tomato gray mold (Hua et al. 2008), tomato Fusarium
wilt (Akram et al. 2014), tomato bacterial wilt (Tan et al. 2013), cucumber root rot
(Senol et al. 2014), and pepper Phytophthora blight (Lee et al. 2008). Moreover, B.
subtilis has shown potential as a biocontrol for many post-harvest diseases, including
gray mold of vegetables (Hua et al. 2008), soft rot of fruits (Tang et al. 2014), and
citrus decay (Arrebola et al. 2010). Other diseases such as tobacco black shank (Han
et al. 2015; You et al. 2016), cotton Verticillium wilt (Li et al. 2013), and chir pine
root rot (Singh et al. 2008) were also suppressed by B. subtilis. However, it is not
clear how B. subtilis affects viral diseases. Wang (2011) showed that an engineered
9 Application and Mechanisms of Bacillus subtilis in Biological Control of Plant… 227
Table 9.1 Summary of studies investigating the effect of Bacillus subtilis against plant diseases
Strains Host Pathogen/disease Mechanisms References
Y-1 Apple Fusarium sp. (root PGP; ISR Ju et al. (2014)
rot)
EA- Banana Mycosphaerella Fengycin C, surfactin, Gutierrez-
CB0015 fijiensis iturin A Monsalve et al.
(2015)
BN1 Chir pine Macrophomina PGP; lytic enzymes, Singh et al. (2008)
phaseolina (root rot) chitinase and
b-1,3-glucanase
PPCB001 Citrus Penicillium sp. Antifungal volatiles Arrebola et al.
(post-harvest decay) (2010)
B47 Corn Bipolaris maydis Iturin A2 Ye et al. (2012)
(leaf blight)
HJ5 Cotton Verticillium dahliae Biofilm formation Li et al. (2013)
(Verticillium wilt)
TV-125 Cucumber F. culmorum (root Chitinase enzymes Senol et al. (2014)
rot)
JA Fruit Botrytis cinerea Antifungal volatiles Hua et al. (2008)
(gray mold)
Y-IVI Muskmelon F. oxysporum f. sp. Competence sites; Zhao et al. (2013)
Melonis lipopeptides, iturin A
CPA-8 Peach Monilinia sp.(brown Fengycin-like lipopeptides Yánez-
rot) Mendizábal et al.
(2012)
fmbJ Peach Rhizopus stolonifer Fengycin Tang et al. (2014)
(soft rot disease)
R33, R13 Pepper Phytophthora capsici Siderophores, hydrogen Lee et al. (2008)
(P. blight) cyanide, and hydrolytic
enzymes
EDR4 Rapeseed Sclerotinia Cell lytic effect Chen et al. (2014)
sclerotiorum (stem
rot)
SYX04 Rice M. oryzae (rice blast) Compete for colonization Mnif et al. (2015)
sites; ISR
Tpb55 Tobacco P. nicotianae Biofilm formation You et al. (2016)
(tobacco black antibiotic substances; and Han et al.
shank) enhanced bacterial (2015)
diversity
IAGS174 Tomato Fusarium sp. ISR Akram et al.
(Fusarium wilt) (2014)
OTPB1 Tomato P. infestans (early PGP and ISR Chowdappa et al.
and late blight) (2013)
QST 713 Tomato Xanthomonas Biofilms formation; Abbasi and
(bacterial spot) surfactin and iturin A Weselowski
(2015)
OKBHF Tomato Cucumber mosaic ISR Wang et al. (2011)
virus
OH 131.1 Wheat F. graminearum Bioactive metabolites Dunlap et al.
(head blight) (2015)
Table 9.2 Commercial products of B. subtilis in plant disease management

Target pathogens/ Crops
Product diseases recommended Manufacturer
B. subtilis – AvoGreen Colletotrichum Avocado Ocean Agriculture,
gloeosporioides, South Africa
Cercospora sp.
B. subtilis – BioSafe Foliar blight Bean Laboratorio de
Biocontrole
Farroupilha, Brazil
B. subtilis GBO3 + Seedling pathogens Beans, pea Helena Chemical
chemical pesticides – Co., Memphis,
system 3 USA
B. subtilis – Ecoshot Gray mold (B. cinerea) Grape, citrus, Kumiai Chemical
legumes, Industry, Japan
vegetables, and
others
B. subtilis GBO3 – Rhizoctonia solani, Legumes Gustafson Inc.,
Kodiak, Kodiak HB, Fusarium sp., Alternaria Dallas, Texas,
Kodiak AT, Epic, sp., Aspergillus sp. USA
Concentrate
B. subtilis – Subtilex/ Root rot and seed Ornamental plants
Premier
Pro-Mix treatments and other crops Horticulture Inc.,
Canada
B. subtilis MB1600 – Fusarium sp., Ornamentals, Becker
HiStick N/T, Subtilex Rhizoctonia sp., Pythium vegetable crops, Underwood, Ames,
sp. Aspergillus sp. dry/snap beans IA, USA
B. subtilis – FZB24 WG, Root rot and wilts Several crops ABiTEP GmbH,
LI, and TB Germany
B. subtilis + B. Broad-spectrum action Tomato, cucumber, Gustafson Inc.,
amyloliquefaciens – Bio against greenhouse pepper, tobacco Dallas, USA
Yield pathogens
B. subtilis strain with the harpin gene HpaGXooc could induce cucumber mosaic
virus resistance in tomato by enhancing the expression of three expansin genes
(Meena et al. 2017). This is the only known report of antiviral activity of B. subtilis
at present.
Efforts to develop disease control products from microbes have led to the regis-
tration of commercial biofungicides based on B. subtilis. Reddy (2014) reported
that more than 30 plant growth-promoting rhizobacteria (PGPR) products have been
registered for commercial use in greenhouses and fields in North America; even
more PGPR products are available now. Table 9.2 listed only a small part of the
products available on market. B. subtilis strain GBO3 (trade name Kodiak®) was
the first large-scale, fungicidal biological control agent developed for industrial use
in agriculture, and it is registered for use on all agricultural seeds.
A commercial formulation of B. subtilis MBI 600 (Integral®, containing 2.2 ×
1010 cfu mL−1) effectively controlled rice sheath blight (Kumar et al. 2013). Strain
QST 713 (Serenade®) was registered in America and Canada and used on various
crops to control foliar diseases such as Botrytis blight, early blight, downy mildew,
fire blight, powdery mildew, and white mold (Abbasi and Weselowski 2014). A
metabolic complex, Gamair, which was formed by B. subtilis M-22 (Novikova and
Shenin 2011), controlled tomato bacterial diseases caused by Clavibacter
michiganensis subsp. michiganensis, Erwinia carotovora subsp. carotovora, and
Pseudomonas corrugata. In China, ~ 10 commercial products based on B. subtilis
have been registered. Baikang, which is based on B. subtilis B908, was the first
microorganism fungicide registered for controlling rice sheath blight, panax root
rot, and tobacco black shank. Other important commercially available biocontrol
agents include a mixture of B. subtilis strain GB122 and B. amyloliquefaciens strain
GB99 (BioYield™), B. subtilis B916, and B. subtilis B908 (Haas and Défago 2005;
Prakash and Verma 2016; Meena et al. 2015a, 2016b; Priyadharsini and Muthukumar
2016; Kumar et al. 2016a, 2017; Raghavendra et al. 2016; Jaiswal et al. 2016; Jha
and Subramanian 2016).
This type of research continues on the direct use of microorganisms including B.
subtilis to promote plant growth and to control plant diseases. The beneficial effects
of these organisms, which can occur simultaneously or sequentially, can include
biological control of diseases, plant growth promotion, increased crop yields, and
quality improvements.
9.3 Mechanisms of B. subtilis in Plant Disease Control
The severity of disease caused by plant pathogens has traditionally been considered
a function of the interplay between the factors at the three vertices of the “disease
triangle”: host susceptibility, pathogen virulence, and environmental conditions
(Fig. 9.1). When B. subtilis is used for plant disease control, it may profoundly
influence the complex plant-environment-pathogen system through plant growth
promotion (PGP), ISR, biofilm formation, competition for nutrients or colonization
sites, cell lysis effects, and antibiotic production (Fig. 9.1). Our conceptual model
shows that B. subtilis might affect the disease triangle factors directly or indirectly.
Thus, the effects of B. subtilis on the environment, host plants, and pathogens can
have domino effects on both plant development and disease progress. Some of these
aspects are explored in this section, and many B. subtilis strains possess two or more
of the mechanisms mentioned in Table 9.2. Moreover, biocontrol activity may be
enhanced by genetically engineered strains that overexpress one or more traits so
that strains with several different anti-pathogen traits can act synergistically (Zahedi
2016; Meena et al. 2015b, 2015f, 2016c; Rawat et al. 2016; Yasin et al. 2016; Saha
et al. 2016a; Dominguez-Nunez et al. 2016; Dotaniya et al. 2016).
The vertices of the disease triangle include host susceptibility, pathogen viru-
lence, and environmental conditions. In this system, changes of any molecular
mechanisms (PGP, ISR, cell lytic effect, antibiotic production, and competition for
nutrition and colonization sites) related to biocontrol activity of B. subtilis may
influence the other factors in the disease triangle directly or indirectly.
Fig. 9.1 Conceptual model for the interplay between Bacillus subtilis and the disease triangle
9.3.1 Plant Growth Promotion (PGP)
As biocontrol agents, most B. subtilis strains can promote plant growth. They regu-
late plant growth and development through phytohormones (auxins, cytokinins, gib-
berellins, and ethylene) and enzymes (e.g., 1-aminocyclopropane-1-carboxylic acid
(ACC) deaminase). Besides, these strains promote mineralization of nutrients (e.g.,
phosphate, potassium, and zinc solubilization), nitrogen fixation, and increased root
absorption ability. Among all PGP traits, phytohormones and siderophores appeared
to be more promising in B. subtilis isolates. Phytohormones produced by B. subtilis
play a major role in growth promotion; the well-studied phytohormones produced
by strain include auxins, gibberellins, cytokinins, and ethylene (Singh et al. 2008;
Ju et al. 2014; Chowdappa et al. 2013). Indole-3-acetic acid (IAA), a phytohor-
mone, is generally considered the most important native auxin. It may function as
an important signal molecule in the regulation of plant development (Ashrafuzzaman
et al. 2009). Application of a B. subtilis GB03 and B. amyloliquefaciens IN937, a
strain mixture, enhanced the growth of Arabidopsis mutants deficient in IAA (Ryu
et al. 2007). Ashrafuzzaman et al. (2009) indicated that increased rice seed germina-
tion and seedling growth after PGPR application were probably due to the induction
of IAA production and P solubilization (Yadav and Sidhu 2016; Meena et al. 2014a,
2015e, 2016d; Saha et al. 2016b; Sharma et al. 2016; Verma et al. 2014, 2015a,
2015b; Bahadur et al. 2016b; Das and Pradhan 2016).
Siderophore-mediated competition for iron is one of the mechanisms responsible

for antagonistic activity. The involvement of siderophore production in disease
suppression by B. subtilis has been implicated in the biocontrol of fungal and
bacterial pathogens, such as Penicillium chrysogenum, Clavibacter michiganensis,
Fusarium oxysporum, and Rhizoctonia solani (Asaka and Shoda 1996; Yu et al.
2011). When starved of iron, B. subtilis can produce the catecholate siderophores 2,
3-dihydroxybenzoate and 2, 3-dihydroxybenzoyl glycine. Itoic acid, the first
bacterial siderophore to be structurally characterized, was isolated from low-iron
fermentation cultures of B. subtilis. B. subtilis strain CAS15 produced the catecholic
siderophore 2, 3-dihydroxybenzoate-glycine-threonine trimeric ester bacillibactin
(Yu et al. 2011), which acts as a growth promoter for Capiscum sp. (Meena et al.
2013b, 2015c, 2016e; Shrivastava et al. 2016; Velazquez et al. 2016; Sindhu et al.
2016; Masood and Bano 2016; Teotia et al. 2016).
In addition, phosphate solubilization, ACC deaminase, and ammonia were also
reported as growth promotion mechanisms from some B. subtilis strains (Zhao et al.
2013). B. subtilis is also involved in mycorrhizal colonization of roots. Dual
inoculation of an arbuscular mycorrhizal (AM) fungus and N-fixing B. subtilis
Daz26 can promote plant growth, enhance AM colonization, and increase plant
biomass and nutrient uptake from the soil (Awasthi et al. 2011). The rhizobacteria
associated with AM fungi possibly feed on the outer hyaline fungal spore layer and
facilitate spore maturation and germination (Roesti et al. 2005).
Plant growth stimulation seems to be the net result of multiple mechanisms that
may be activated simultaneously. Certain isolates may exhibit several PGP traits,
which may promote plant growth directly, indirectly, or synergistically. For example,
B579 stimulated cucumber seedling growth, possibly through phosphate
solubilization, IAA, and siderophore production (Chen et al. 2010). Similarly, B.
subtilis BN1 stimulated chir pine seedling growth through same mechanisms (Singh
et al. 2008).
9.3.2 Competition on Nutrition and Colonization Sites
The plant disease suppression by a microbial agent usually stems from competitive
colonization and the excretion of antifungal compounds (Compant et al. 2010; Zhao
et al. 2013; Li et al. 2013). Successful biological control requires colonization by
the added biocontrol agents (Fig. 9.2). Studies have shown that the colonization of
plant roots or leaves by beneficial microbes directly contributes to the effective
biocontrol of soilborne pathogens (Zhao et al. 2011; Li et al. 2013).
Bacillus species including B. subtilis have been regarded as less effective in rhi-
zosphere colonization than fluorescent pseudomonads (Weller et al. 2002). However,
several studies have reported that B. subtilis may effectively colonize plants and
control diseases (Liu et al. 2009; Zhao et al. 2011; Li et al. 2013). For example, B.
subtilis B246 effectively attached, colonized, and survived on avocado flowers. It
also attached to conidia and hyphae of stem-end rot pathogens (Dothiorella aro-
Fig. 9.2 Illustration of the most important mechanisms of biological control of plant diseases by
bacteria (Lugtenberg and Kamilova 2009). (a) Antibiosis. The bacterium colonizes the growing
root system and delivers antibiotic molecules around the root, thereby harming pathogens that
approach the root (b) Induced systemic resistance (ISR). (c) Competition for nutrients and niches
matica and Phomopsis perseae) and caused cell degradation, preventing pathogens
from attaching to and colonizing the flowers (Demoz and Korsten 2006).
The B. subtilis strain E1R-j endophytically colonized wheat seedling roots and
leaves and effectively retarded infection and colonization of Gaeumannomyces
graminis var. tritici (take-all pathogen) in root tissue (Liu et al. 2009). Similarly, B.
subtilis BN1 showed excellent root colonization ability on chir pine seedlings
(Singh et al. 2008).
Chemotaxis was proposed as the key trait for colonization (Compant et al. 2010).
Organic compounds released by plant roots include amino acids, fatty acids,
nucleotides, organic acids, phenolics, plant growth regulators, polyamines, sterols,
sugars, and vitamins (Lugtenberg and Kamilova 2009). Competition for these
nutrients and niches is a fundamental mechanism by which B. subtilis protects
plants from phytopathogens (Cao et al. 2011). Individual B. subtilis exhibits
chemotaxis and uses their flagella to reach root surfaces. Known chemical attractants
in root exudates include organic acids, amino acids, and specific sugars.
The quantity and composition of attractants and antimicrobials exuded by plant
roots are under genetic and environmental control (Bais et al. 2004). The importance
of chemotaxis in colonization was also reported for B. subtilis FB17 on Arabidopsis
roots (Rudrappa et al. 2008) and B. subtilis N11 on cucumber and banana roots
(Zhang et al. 2014). This implies that B. subtilis competence is highly dependent on
the ability to take advantage of a specific environment or the ability to adapt to
changing conditions. In a more recent study, Gao et al. (2016) clarified the roles
played by swarming motility and chemotaxis in B. subtilis SWR01 colonization of
tomato root, and demonstrated that the role played by swarming is greater than that
of chemotaxis, although both are important in root colonization (Meena et al. 2013c,
2014b, 2015d; Singh et al. 2015, 2016; Bahadur et al. 2016a).
Studies have shown that different B. subtilis strains display different colonization
patterns on plant surfaces and colonize different regions. B. subtilis can colonize
roots and leaves by forming aggregates or microcolonies. One of the first stages of
attachment involves the production of fibril-like strands. Within 2 h of B. subtilis
B246 application to avocado flowers, fibril-like strands were observed. The presence
of these strands strongly supports the observation that strain B246 can effectively
attach to the surfaces of avocado flower pistils (Demoz and Korsten 2006). Zhang
et al. (2011) observed that GFP-tagged B. subtilis N11 occurred in aggregates
attached to the surface of plant roots after inoculation. Bacteria preferentially
colonized defined regions of root elongation and differentiation zones, lateral roots,
and junctions between roots. Biofilms and microcolonies of B. subtilis HJ5 occurred
in the elongation and differentiation zones of plant primary roots (Li et al. 2013). In
cucumber, B. subtilis SQR9 often colonized at the surfaces of primary roots, the
zones of differentiation and elongation, and the lateral root junctions (Cao et al.
2011).
On tobacco roots, strain Tpb55 colonized diffusely, primarily on the root meri-
stem and in the elongation zone. Bacteria can gather into microcolonies, forming a
biofilm-like structure. A small number of these bacteria can colonize intercellular
spaces and around vascular bundles (Han et al. 2016). The endophyte B. subtilis
strain BB was observed intracellularly in cortical tissues and was also found in the
intercellular spaces of the inner cortex and in xylem cells (Wulff et al. 2011). B.
subtilis GY-IVI can successfully colonize external root surfaces and the interior of
muskmelon roots and crowns (Zhao et al. 2011).
Root colonization and persistence by B. subtilis are prerequisites for its success-
ful protection against soilborne pathogens, which is largely dependent on the forma-
tion of biofilm (Bais et al. 2004). Surfactins, unlike iturins or fengycins, are essential
for biofilm formation and root colonization (Bais et al. 2004; Zeriouh et al. 2014).
B. subtilis was able to colonize melon leaves owing to surfactin-triggered biofilm
formation through the increased production of an exopolysaccharide (EPS) and a
protein, TasA (Zeriouh et al. 2014).
Plant polysaccharides, which serve as a carbon source for extracellular matrix
production, can also activate biofilm formation and facilitate root colonization. B.
subtilis colonization on leaves is less understood than on roots (Ongena and Jacques
2008). Luo (2015) observed that B. subtilis 916 formed a robust biofilm on rice
sheath blight lesions and colonized well on rice sheaths infected with R. solani.
They found that surfactin and bacillomycin both play essential but different roles in
the antagonistic activity and swarming motility of B. subtilis 916 against R. solani
through biofilm formation and colonization; in contrast, Zeriouh et al. (2014) found
that surfactin contributed primarily to the fitness and biocontrol traits of B. subtilis
UMAF6614 on melon leaves.
Biocontrol strain applications have been hampered by inconsistent performance
in field tests owing to poor rhizosphere competence (Gao et al. 2016); application of
biocontrol strains has been hampered by inconsistent performance in field tests.
Rhizosphere competence of biocontrol agents comprises effective root colonization
combined with the ability to survive and proliferate along growing plant roots over
a considerable period, in the presence of the indigenous microflora (Lugtenberg and
Kamilova 2009). Given the importance of rhizosphere competence as a prerequisite
for effective biological control, understanding root-microbe communication (Bais
et al. 2004), as affected by genetic and environmental determinants in spatial and
temporal contexts, will significantly improve the efficacy of these biocontrol agents.
9.3.3 Antibiotic Substances
Antibiotic production has been postulated to play a principal role in disease sup-
pression by microbes including B. subtilis (Fig. 9.2). More than two dozen antibiot-
ics with wide spectra and diverse structures have been reported from B. subtilis.
Structures produced by B. subtilis include peptides, proteins (enzymes), and non-
peptide products in which peptides were predominant. The peptides can be classi-
fied by their synthesis mechanisms (ribosomal or nonribosomal) (Wang et al. 2015).
9.3.3.1 Nonribosomal Peptide Antibiotics
The primary type of nonribosomal peptide antibiotics is the lipopeptides (LPs). LPs
are among the most common biosurfactants. The structures of LPs derived from B.
subtilis are usually similar to each other, only differing in the amino acid sequence
of the peptide portion, the length of the fatty acid chain, or the linkage between the
two peptides. These LPs from B. subtilis usually produce a wide variety of antibac-
terial and antifungal antibiotics, which are classified into three groups according to
their structures: surfactins, iturins, and fengycins (Mnif and Ghribi 2015).
Surfactins are the most thoroughly studied family of lipopeptides and were
named for their exceptional surfactant activity. Surfactins were initially identified as
potent inhibitors of fibrin clots and in recent years have been identified as having
antibacterial, antiviral, and antimycoplasmic activities. Surfactins have antibacterial
activity but are not effective against fungi (Meena and Kanwar 2015).
Iturins are a group of cyclic heptapeptides with an invariable LDDLLDL chiral
sequence linked to a β-amino fatty acid chain that can vary from 14 to 17 carbon
atoms; they generally have a molecular weight of ∼1.1 kDa (Fig. 9.3). Iturins were
first isolated from a B. subtilis strain from Ituri, Democratic Republic of the Congo.
Fig. 9.3 Structures of iturins
The iturins include iturins A, C, D, and E; bacillomycins D, F, and L; bacillopeptin;

and mycosubtilin (Maget-Dana and Peypoux 1994; Ye et al. 2012; Mnif and Ghribi
2015). They exhibit strong antifungal activities against a wide variety of fungi and
pathogenic yeasts and can be used as biopesticides for plant protection. However,
the antimicrobial activity of iturins was mainly against fungi; few research was
related to antibacterial activities (Maget-Dana and Peypoux 1994; Wang et al. 2015).
The fengycin group compromises fengycins A, B, and C, which are also referred
to as plipastatins. Fengycins A and B differ by one amino acid (Alavs Val) in position
6. Fengycin C differs from B at position 9 (Thrvs Tyr) and from A at positions 6 and
9 (Val and ThrvsAla and Tyr, respectively) (Wang et al. 2015). Fengycins are less
hemolytic than iturins and surfactins but retain strong antifungal activity and inhibit
the growth of a wide range of plant pathogens, especially filamentous fungi. The
active mechanism of fengycins is less well known compared with iturins and
surfactins, but the compounds readily interact with lipid layers and to some extent
retain the potential to alter cell membrane structure (packing) and permeability in a
dose-dependent way. Fengycins act in a synergistic manner with surfactins and
iturins, increasing their effectiveness (Ongena and Jacques 2008).
Other nonribosomal peptide antibiotics include bacilysins, rhizocticins, amicou-
macins, TL-119, mycobacillin, diketopiperazines (DKPs), and another kind of LPs,
antibiotic maltacines, which differ from surfactins, iturins, and fengycins. Among
them, bacilysins, amicoumacins, TL-119, and DKPs display obvious antibacterial
activity, while rhizocticins, mycobacillin, DKPs, and maltacines exhibit distinct
antifungal activity (Wang et al. 2015).
Fig. 9.4 Structures of some nonpeptide antibiotics
9.3.3.2 Ribosomal Peptide Antibiotics
Bacteriocins, which are the primary type of ribosomally synthesized peptide antibi-
otics from B. subtilis, are produced by all kinds of living organisms and are consid-
ered part of the innate host immunity. Bacteriocins from B. subtilis are often
membrane-permeabilizing cationic peptides with fewer than 60 amino acid resi-
dues. The bacteriocins are grouped into four classes (I–IV) based on their biochemi-
cal and genetic properties. The most representative bacteriocins are class I
lantibiotics, which have been intensively studied for their antibiotic activity (Joseph
et al. 2013). Lantibiotics are a group of bacteriocins that undergo posttranslational
modification during biosynthesis. Lantibiotics from B. subtilis are further subdi-
vided into type A and type B according to their chemical structures and antimicro-
bial activities (Kumar 2012).
9.3.3.3 Nonpeptide Antibiotics
Most of the secondary metabolites of B. subtilis are peptide antibiotics, from which
other kinds of antibiotics are derived. These compounds include polyketides, ter-
penes, isocoumarins, plant growth hormones, and miscellaneous metabolites;
polyketides account for most of the nonpeptide products (Fig. 9.4).
Bacillaene, difficidin, oxidifficidin, and macrolactins are the most representative
polyketides of B. subtilis. Bacillaene is a linear molecule with two amide bonds, and
it inhibits prokaryotic but not eukaryotic protein synthesis. It exhibits high

bacteriostatic activity against a wide spectrum of bacteria such as Serratia
marcescens, Klebsiella pneumoniae, and Staphylococcus aureus. Difficidin and
oxidifficidin are highly unsaturated 22-membered macrocyclic polyene lactone
phosphate esters with broad-spectrum antibacterial activity. The scaffolds of
macrolactins contain three separate diene structure elements in a 24-membered
lactone ring. Macrolactin N has shown antibacterial activity against Escherichia
coli, and S. aureus, and may represent a new class of peptide deformylase inhibitors
because it significantly inhibited the S. aureus peptide deformylase (Hamdache
et al. 2011; Wang et al. 2015).
Sporulenes A–C were isolated from B. subtilis spores. They are pentacyclic ter-
penoids formed by cyclization of regular polyprenes and may protect Bacillus
spores against oxidative stress. As sporulenes are present only when B. subtilis
produces spores, their biological role is clearly related to sporulation (Hamdache
et al. 2011; Wang et al. 2015).
Other kinds of nonpeptide antibiotics from B. subtilis include amino sugars such
as 3, 3′-neotrehalosadiamine, proteins such as bacisubin, and phospholipids such as
bacilysocin. These compounds manifest varying degrees of antibacterial or
antifungal activities (Wang et al. 2015).
9.3.4 Induction of Plant Disease Resistance
Application of PGPR could activate plant host defense responses against pathogens,
including ultrastructural changes and cytochemical alterations (ISR) during patho-
gen attacks (Fig. 9.2). Elicitation of ISR was one of the major mechanisms of B.
subtilis strains in plant disease control. It is widely believed that signal transduction
pathways elicited by B. subtilis in plants are dependent on jasmonic acid (JA),
ethylene, and the regulatory gene NPR1, but independent of salicylic acid (SA), a
signal of systemic acquired resistance elicited by pathogens (Garcia-Gutierrez et al.
2013). However, JA and SA signals can operate in B. subtilis. For example, B.
subtilis UMAF6614 induced systemic resistance against melon powdery mildew by
activation of JA- and SA-dependent defense responses (Garcia-Gutierrez et al.
2013). These signals all lead to the systemic expression of a broad spectrum, which
confer long-lasting disease resistance that is efficient against fungi, bacteria, and
viruses.
Studies have indicated that elicitation of ISR by B. subtilis is associated with
changes in cell wall composition, de novo production of pathogenesis-related (PR)
proteins such as chitinases and glucanases, and synthesis of phytoalexins associated
with resistance. In most cases, multiple compounds generated by one B. subtilis
strain are involved in the restriction of pathogens. For example, foliar application of
B. subtilis AUBS1 led to an increase in the activities of phenylalanine ammonia-
lyase (PAL) and peroxidase (POD) and an accumulation of PR proteins in rice
leaves, which significantly reduced sheath blight disease in rice (Jayaraj et al. 2004).
Other studies have shown that cyclic LPs play an important role in host defense
gene expression. B. subtilis can elicit defense-related gene transcription and activity
of defense-related enzymes in grapevine, citrus fruit, and cucumber to suppress
pathogens by producing surfactins, iturins, and fengycins (Farace et al. 2015).
Multiple strains of B. subtilis can stimulate plant defense responses. Protection
resulting from ISR elicited by B. subtilis has been reported against fungal and
bacterial pathogens, systemic viruses, and root-knot nematodes. For example, B.
subtilis OTPB1 enhanced systemic resistance in tomato seedlings against early and
late blight through induction of growth hormones and defense enzymes including
POD, polyphenol oxidase (PPO), and superoxide dismutase (SOD) (Chowdappa
et al. 2013).
Antagonist B. subtilis AR12 significantly increased activities of PAL, PPO, POD,
and SOD to control bacterial wilt of tomato (Lycopersicon esculentum Miller) in the
greenhouse, showing biocontrol efficiency of ~90% (Li et al. 2008). B. subtilis SW1
significantly reduced mosaic symptoms and disease severity of tobacco mosaic
virus by significantly increasing amounts of defense enzymes and PR proteins (Lian
et al. 2011). In some studies, the plant-mediated effect was the primary cause of
antagonism, rather than direct mechanisms. B. subtilis Sb4-23, known for its
antagonistic potential against fungal pathogens, also controlled root-knot nematodes
by ISR of tomato plants (Adam et al. 2014).
ISR often accompanies PGP, for example, the isolate BS21-1 was an effective
biocontrol agent for disease suppression in four vegetable crops through systemic
resistance, and it also promoted plant growth (Lee et al. 2014). Presumably, B.
subtilis induced plant disease resistance and promoted growth first, allowing the
plants to suppress pathogenic infections.
B. subtilis has long served as a robust model organism to study the mechanism of
biocontrol all over the world; the use of ISR-promoting B. subtilis could be a
promising strategy for the integrated control of plant disease. Further progress will
lead to a more efficient use of these strains and perhaps lead to new biocontrol
strategies.
9.3.5 Microbial Community Shifts
The application of high densities of viable microbes for rapid colonization of the
host rhizosphere is expected to at least transiently perturb the composition and
function of soil microbial communities (Trabelsi and Mhamdi 2013). The
disturbance of indigenous rhizosphere microbial communities caused by inoculating
microbes has become a focal point in the use of biocontrol agents (Grosch et al.
2012). Several studies investigating the effects of microbial inoculants on soil eco-
systems (Trabelsi and Mhamdi 2013) indicated that inoculation could significantly
affect soil microbial communities. Such changes, in some cases, might affect the
abundance of soil pathogens, thereby promoting plant health (Sang and Kim 2012).
Inoculation of B. subtilis Tpb55 increased the diversity and species richness of

the bacterial community in tobacco rhizosphere (You et al. 2016). Another study on
the effects of B. subtilis Tpb55 on tobacco rhizosphere microbial community
confirmed the previous results and speculated that improving the diversity of the
soil bacterial community and ecosystem stability might explain the strain’s
biocontrol efficacy on tobacco black shank (Han et al. 2016). Similarly, Zhang et al.
(2014) reported that the suppression ability of bioorganic fertilizers containing
B. subtilis N11 against banana Fusarium wilt was associated with soil microbial
community regulation, with increased densities of bacteria and actinomycetes but
decreased numbers of fungi in the rhizosphere soil. Generally, susceptibility of the
rhizosphere to invasion by soil pathogens is inversely related to the diversity of the
rhizosphere microbiome (Matos et al. 2005), whereby increased diversity can result
in decreased pathogen virulence.
Moreover, promoted microbes can compete with pathogens for resources, pro-
duce compounds that are inhibitory to pathogens, or parasitize pathogens. Indeed,
most rhizosphere bacteria and fungi are prolific producers of metabolites that inhibit
the growth or activity of competing microorganisms. However, Li et al. (2016)
found that B. bacillus B068150 did not significantly change the diversity of micro-
bial communities in a cucumber rhizosphere, indicating that the effects of different
strains on the soil microbial community are variable.
9.4 Genes of B. subtilis Associated to Disease Biocontrol
A striking feature of some Bacillus sp. is production of various secondary metabo-

lites, which can be used for plant disease management. B. subtilis is an excellent
model system for gene function analysis, especially genes associated with disease
control (Table 9.3). Analysis of the genetic elements and molecular mechanisms in
B. subtilis may benefit the development of biologically based management approaches
for plant diseases while potentially providing means to develop biocontrol agents.
A chitinase-producing B. subtilis CHU26 was isolated from a Taiwanese potato
field and exhibited strong extracellular chitinase activity on an agar plate containing
colloidal chitin, showing the potential to inhibit activity of the phytopathogen R.
solani. The gene chi18, which encodes chitinase, was responsible for this antimicro-
bial activity (Yang et al. 2009). Proteolysis plays an essential step in the bacterial
endospores germination progress, namely the degradation of the spore cortex pepti-
doglycan wall; in strain B. anthracis and B. subtilis, spore germination was affected
by the gene YpeB which associated to proteolysis (Bernhards et al. 2015).
Iturin group operons (i.e., iturin A, mycosubtilin, and bacillomycin D) are
responsible for the biosynthesis of iturin A and its derivatives, which were important
lipopeptide antibiotics produced by B. subtilis and several closely related bacteria
(Tsuge et al. 2005). In B. subtilis strain 168, biofilm formation was regulated by
eight rap-phr quorum-sensing operons (Bendori et al. 2015). In addition, EPS, a key
biofilm matrix component in B. subtilis, is regulated at the posttranslational level by
the bacterial tyrosine kinase (BY-kinase) EpsB (Gao et al. 2015).
Table 9.3 Summary of genes associated with disease control of Bacillus sp.
Strain Gene/cluster Function/products Reference
B. subtilis srfA Surfactin Hsieh et al. (2004)
B. subtilis ltaS Lipoteichoic acid (LTA) Kasahara et al. (2016)
synthase
B. subtilis cheV Chemotaxis Kearns and Losick
(2003)
B. subtilis ahpC Alkyl hydroperoxide Broden et al. (2016)
reductase
B. subtilis AprE and NprE Extracellular proteases Barbieri et al. (2016)
B. subtilis CodY Global transcriptional Barbieri et al. (2016)
regulator
B. subtilis tyrZ Growth and biofilm Williams-Wagner et al.
formation (2015)
B. subtilis tapA Surfactin synthesis van Gestel et al. (2015)
B. subtilis epsA-O operon Synthesis of biofilm Vlamakis et al. (2013)
matrix
B. subtilis FlgM Anti-sigma factor Calvo and Kearns
(2015)
B. subtilis HtrC Spore formation Bernhards et al. (2015)
B. subtilis168 Sfp Polyketide production Parashar et al. (2013)
B. subtilis168 degQ Secretion of degradative Parashar et al. (2013)
enzymes
B. subtilis Hag Flagella encode Bais et al. (2004)
6051
B. subtilis 916 locD, locA, locB, and Locillomycins Luo et al. (2015)
locC gene cluster
B. subtilis ypqP Biofilm determinant Sanchez-Vizuete et al.
NDmed (2015)
B. subtilis minJ Swarming Gao et al. (2016)
SWR01
Bacillus sp. bacA Bacilysin Mora et al. (2011)
Bacillus sp. fenB Fengycin Ramarathnam et al.
(2007)
B. subtilis pks gene cluster Bacillaene Muller et al. (2014)
Organisms exposed to hydrogen peroxide (H2O2) will lead to damage of enzymes

and DNA and may even cause cell death. In response, B. subtilis genes katA and
ahpC appear to be responsible for the encoding of catalase and an alkyl hydroperoxide
reductase to reduce the stress of H2O2 (Broden et al. 2016). The bacterial flagellum
plays an important role in root colonization and nutrient competition for biocontrol
strain B. subtilis. The anti-sigma factor FlgM is the crucial unit in flagellar gene
regulation (Calvo and Kearns 2015).
The genes encoding and regulating the biosynthetic pathways that are responsi-
ble for the production of antimicrobial compounds are valuable resources for anti-
infective areas of pharmaceutical and development of efficient, environmentally

friendly biologic antimicrobial agents.
9.5 Problems and Prospects
9.5.1 Challenges in B. subtilis Research
Effective strategies for the initial selection and screening of antagonist are chal-
lenges in developing B. subtilis for commercial application. One approach for the
selection of organisms with the potential to control soilborne phytopathogens is to
isolate them from soils that suppress that pathogen (Weller et al. 2002). Other
approaches involve selection based on traits known to be associated with B. subtilis,
such as root colonization (Gao et al. 2016), antibiotic production (Ye et al. 2012;
Gutierrez-Monsalve et al. 2015), siderophore production (Lee et al. 2008), and bio-
film formation (Sanchez-Vizuete et al. 2015). The development of high-throughput
assay systems and effective bioassays will facilitate selection of superior strains.
The other challenge of using B. subtilis in field is natural variation. The coloniza-
tion of B. subtilis is the critical factor for success biocontrol under natural condi-
tions. Biocontrol strains were screened under controllable conditions such as
laboratory or greenhouse. However, many factors (e.g., pesticide application or
pesticide residue) are unfavorable for colonization in field. The application of
biocontrol B. subtilis is also affected by temperature, humidity, soil type, pH, and so
on (Lee et al. 2014). Therefore, it is difficult to predict how an organism may
respond when released to the natural environment compared to the controlled
environment of a laboratory or greenhouse. Moreover, the stability of antimicrobial
substances, produced by B. subtilis, is also important. Metabolites of B. subtilis are
very complex, and they are prone to degradation with the influence of various
factors under field conditions. In fact, the effect of disease control is always less
than satisfactory.
In conclusion, colonization and stability of antibiotic production are the main
restricted factors for application and commercialization of B. subtilis in sustainable
agriculture. Therefore, knowledge of these factors can aid in determination of
optimal concentration, timing, and placement of inoculant and of soil and crop
management strategies to enhance survival and proliferation of the inoculant
(Gardener et al. 2002).
9.5.2 Future Prospects and Conclusions
Over the years, B. subtilis strains have gained worldwide importance and accep-
tance for their agricultural benefits. These microorganisms are the potential tools for
sustainable agriculture and the trend for the future. Scientific research involves
multidisciplinary approaches to understand adaptation of B. subtilis to the rhizo-

sphere, mechanisms of root colonization, effects on plant physiology and growth,
biofertilization, induced systemic resistance, biocontrol of plant pathogens, and
production of determinants.
In other aspects, B. subtilis is widely used for recombinant proteins production,
such as proteases, amylases, lipases, and many other enzymes in industry area. The
B. subtilis isolated from natural environment has the ability to secrete enzymes
directly into their living environments and is an important production platform to
deliver protein products in great yields with higher quality and at lower cost (Van
Dijl and Hecker 2013).
Genetic enhancement of B. subtilis strains to enhance colonization and effective-
ness may involve the addition of one or more traits associated with plant growth
promotion (Bloemberg and Lugtenberg 2001). The use of multi-strain inocula of
PGPR with known functions is of interest as these formulations may increase con-
sistency and disease control efficacy in the field. The combined use of these strains
offers the potential to address multiple modes of action, multiple pathogens, and
temporal or spatial variability. In this regard, the integration of B. subtilis antagonist
and other disease-controlling agents (such as elicitor, organic fertilizer, or fungi-
cide) is also promising. Since this synergistic function has been demonstrated by
many cases (Zhang et al. 2011; Ryu et al. 2007), the combined use of B. subtilis
antagonists and other agents might be helpful as a strategy for biological control of
plant disease.
Current and future progress in our understanding of B. subtilis colonization abil-
ity, mechanisms of action, and application could facilitate its development as a reli-
able management component of sustainable agricultural systems.
Acknowledgments We thank Dr. Shi-En Lu for the critical review on this manuscript. This study
was conducted at Tobacco Research Institute of Chinese Academy of Agricultural Sciences,
Qingdao, China.
References
Abbasi PA, Weselowski B (2014) Influence of foliar sprays of Bacillus subtilis QST 713 on
development of early blight disease and yield of field tomatoes in Ontario. Can J Plant Pathol
36:170–178
Abbasi PA, Weselowski B (2015) Efficacy of Bacillus subtilis QST 713 formulations, copper
hydroxide, and their tank mixes on bacterial spot of tomato. Crop Prot 74:70–76
Adam M, Heuer H, Hallmann J (2014) Bacterial antagonists of fungal pathogens also control root-
knot nematodes by induced systemic resistance of tomato plants. PLoS One 9:e90402
doi.org/10.1007/978-81-322-2776-2_21
Akram W, Anjum T, Ali B (2014) Searching ISR determinants from Bacillus subtilis IAGS174
against Fusarium wilt of tomato. Biocontrol 60:271–280
Arrebola E, Sivakumar D, Korsten L (2010) Effect of volatile compounds produced by Bacillus

strains on postharvest decay in citrus. Biol Control 53(1):122–128
Asaka O, Shoda M (1996) Biocontrol of Rhizoctonia solani damping-off of tomato with Bacillus
subtilis RB14. Appl Environ Microbiol 62:4081–4085
Ashrafuzzaman M, Hossen FA, Ismail MR, Hoque MA, Islam MZ, Shahidullah SM, Meon S
(2009) Efficiency of plant growth-promoting rhizobacteria (PGPR) for the enhancement of rice
growth. Afr J Biotechnol 8:1247–1252
Awasthi A, Bharti N, Nair P, Singh R, Shukla AK, Gupta MM, Darokar MP, Kalra A (2011)
Synergistic effect of Glomus mosseae and nitrogen fixing Bacillus subtilis strain Daz26 on
artemisinin content in Artemisia annua L. Appl Soil Ecol 49:125–130
451.2016.1219431
Bais HP, Park SW, Weir TL, Callaway RM, Vivanco JM (2004) How plants communicate using the
underground information superhighway. Trends Plant Sci 9:26–32
Barbieri G, Albertini AM, Ferrari E, Sonenshein AL, Belitsky BR (2016) Interplay of CodY and
ScoC in the regulation of major extracellular protease genes of Bacillus subtilis. J Bacteriol
198:907–920
Bendori SO, Pollak S, Hizi D, Eldar A (2015) The RapP-PhrP quorum-sensing system of Bacillus
subtilis strain NCIB3610 affects biofilm formation through multiple targets, due to an atypical
signal-insensitive allele of RapP. J Bacteriol 197:592–602
Bernhards CB, Chen Y, Toutkoushian H, Popham DL (2015) HtrC is involved in proteolysis of
YpeB during germination of Bacillus anthracis and Bacillus subtilis spores. J Bacteriol
197:326–336
Bloemberg GV, Lugtenberg BJJ (2001) Molecular basis of plant growth promotion and biocontrol
by rhizobacteria. Curr Opin Plant Biol 4:343–350
Broden NJ, Flury S, King AN, Schroeder BW, Coe GD, Faulkner MJ (2016) Insights into the func-
tion of a second, nonclassical Ahp peroxidase, AhpA, in oxidative stress resistance in Bacillus
subtilis. J Bacteriol 198:1044–1057
Calvo RA, Kearns DB (2015) FlgM is secreted by the flagellar export apparatus in Bacillus subti-
lis. J Bacteriol 197:81–91
Cao Y, Zhang ZH, Ling N, Yuan YJ, Zheng XY, Shen BA, Shen QR (2011) Bacillus subtilis SQR
9 can control Fusarium wilt in cucumber by colonizing plant roots. Biol Fert Soils 47:495–506
Cao Y, Xu Z, Ling N, Yuan Y, Yang X, Chen L, Shen B, Shen Q (2012) Isolation and identification
of lipopeptides produced by B. subtilis SQR 9 for suppressing Fusarium wilt of cucumber. Sci
Hortic 135:32–39
Chen F, Wang M, Zheng Y, Luo JM, Yang XR, Wang XL (2010) Quantitative changes of plant
defense enzymes and phytohormone in biocontrol of cucumber Fusarium wilt by Bacillus
subtilisB579. World J Microbiol Biotechnol 26:675–684
Chen Y, Gao X, Chen Y, Qin H, Huang L, Han Q (2014) Inhibitory efficacy of endophytic Bacillus
subtilis EDR4 against Sclerotinia sclerotiorum on rapeseed. Biol Control 78:67–76
Chowdappa P, Mohan Kumar SP, Jyothi Lakshmi M, Upreti KK (2013) Growth stimulation and
induction of systemic resistance in tomato against early and late blight by Bacillus subtilis
OTPB1 or Trichoderma harzianum OTPB3. Biol Control 65:109–117
Compant S, Clément C, Sessitsch A (2010) Plant growth-promoting bacteria in the rhizo- and
endosphere of plants: their role, colonization, mechanisms involved and prospects for utiliza-
tion. Soil Biol Biochem 42:669–678
fertility and health. In: Meena VS, Maurya BR, Verma JP, Meena RS (eds) Potassium solu-
bilizing microorganisms for sustainable agriculture. Springer, India, pp 281–291. https://doi.
org/10.1007/978-81-322-2776-2_20
De Curtis F, Lima G, Vitullo D, De Cicco V (2010) Biocontrol of Rhizoctonia solani and Sclerotium
rolfsii on tomato by delivering antagonistic bacteria through a drip irrigation system. Crop Prot
29(7):663–670
Demoz BT, Korsten L (2006) Bacillus subtilis attachment, colonization, and survival on avocado
flowers and its mode of action on stem-end rot pathogens. BioControl 37:68–74
https://doi.org/10.1007/978-81-322-2776-2_6
microorganisms. In: Meena VS, Maurya BR, Verma JP, Meena RS (eds) Potassium solubi-
org/10.1007/978-81-322-2776-2_19
Dunlap CA, Schisler DA, Bowman MJ, Rooney AP (2015) Genomic analysis of Bacillus subtilis
OH 131.1 and co-culturing with Cryptococcus flavescens for control of Fusarium head blight.
Plant Gene 2:1–9
Farace G, Fernandez O, Jacquens L, Coutte F, Krier F, Jacques P, Clement C, Barka EA, Jacquard
C, Dorey S (2015) Cyclic lipopeptides from Bacillus subtilis activate distinct patterns of
defence responses in grapevine. Mol Plant Pathol 16:177–187
Gao TT, Greenwich J, Li Y, Wang Q, Chai YR (2015) The bacterial tyrosine kinase activator TkmA
contributes to biofilm formation largely independently of the cognate kinase PtkA in Bacillus
subtilis. J Bacteriol 197:3421–3432
Gao SF, Wu HJ, Yu XF, Qian LM, Gao XW (2016) Swarming motility plays the major role in
migration during tomato root colonization by Bacillus subtilis SWR01. Biol Control 98:11–17
Garcia-Gutierrez L, Zeriouh H, Romero D (2013) The antagonistic strain Bacillus subtilis
UMAF6639 also confers protection to melon plants against cucurbit powdery mildew by acti-
vation of jasmonate-and salicylic acid-dependent defence responses. Microbiol Biotechnol
6:264–274
Gardener MS, Fravel DR, Gardener MS, Fravel DR (2002) Biological control of plant patho-
gens: research, commercialization, and application in the USA. Plant Health Prog. https://doi.
org/10.1094/PHP-2002-0510-01-RV
Grosch R, Dealtry S, Schreiter S, Berg G, Mendonça-Hagler L, Smalla K (2012) Biocontrol of
Rhizoctonia solani: complex interaction of biocontrol strains, pathogen and indigenous micro-
bial community in the rhizosphere of lettuce shown by molecular methods. Plant and Soil
361(1-2):343–357
Gutierrez-Monsalve JA, Mosquera S, González-Jaramillo LM, Mira JJ, Villegas-Escobar V (2015)
Effective control of black Sigatoka disease using a microbial fungicide based on Bacillus sub-
tilis EA-CB0015 culture. Biol Control 87:39–46
Haas D, Défago G (2005) Biological control of soil-borne pathogens by fluorescent pseudomo-
nads. Nat Rev Microbiol 3:307–319
Hamdache A, Lamarti A, Aleu J, Collado IG (2011) Non-peptide metabolites from the genus
Bacillus. J Nat Prod 74(4):893–899
Han T, You C, Zhang L, Feng C, Zhang C, Wang J, Kong F (2015) Biocontrol potential of antago-
nist Bacillus subtilis Tpb55 against tobacco black shank. BioControl 1–11
Han T, Zhang L, Gao J, Kong F, Chao F, Jing W, Zhang C (2016) Correlation between root irriga-
tion of Bacillus subtilis Tpb55 and variation of bacterial diversity in tobacco rhizosphere. Acta
Microbiol Sin. 2016, 56(5): 835–845 (in Chinese)
Hsieh FC, Li MC, Lin TC, Kao SS (2004) Rapid detection and characterization of surfactin-
producing Bacillus subtilis and closely related species based on PCR. Curr Microbiol
49:186–191
Hua C, Xiang X, Wang J, Wu L, Zheng Z, Yu Z (2008) Antagonistic effects of volatiles generated

by Bacillus subtilis on spore germination and hyphal growth of the plant pathogen Botrytis
cinerea. Biotechnol Lett 30:919–923
9(2):1211–1221
Jayaraj J, Yi H, Liang GH, Muthukrishnan S, Velazhahan R (2004) Foliar application of Bacillus
subtilis AUBS1 reduces sheath blight and triggers defense mechanisms in rice. J Plant Dis
Protect 111:115–125
Joseph B, Dhas B, Hena V, Raj J (2013) Bacteriocin from Bacillus subtilis as a novel drug against
diabetic foot ulcer bacterial pathogens. Asian Pac J Trop Med 3(12):942–946
Ju R, Zhao Y, Li J, Jiang H, Liu P, Yang T, Bao Z, Zhou B, Zhou X, Liu X (2014) Identification
and evaluation of a potential biocontrol agent, Bacillus subtilis, against Fusarium sp. in apple
seedlings. Ann Microbiol 64:377–383
Kasahara J, Kiriyama Y, Miyashita M, Kondo T, Yamada T, Yazawa K, Yoshikawa R, Yamamoto
H (2016) Teichoic acid polymers affect expression and localization of DL-endopeptidase LytE
required for lateral cell wall hydrolysis in Bacillus subtilis. J Bacteriol 198:1585–1594
Kearns DB, Losick R (2003) Swarming motility in undomesticated Bacillus subtilis. Mol
Magdalena KÃ¶b, Wibberg D, Grosch R, Eikmeyer F, Verwaaijen B, Chowdhury SP, Hartmann A,
Alfred PÃ¼h, Andreas SÃ¼t (2014) Effect of the strain Bacillus amyloliquefaciens FZB42 on
the microbial community in the rhizosphere of lettuce under field conditions analyzed by whole
metagenome sequencing. Front Microbiol:5
Kumar N (2012) Lantibiotics a novel antimicrobial agents: a review. Pharmacol Sci Monit
3(4):2990–3009
Kumar KVK, Yellareddygari SK, Reddy MS, Kloepper JW, Lawrence KS, Zhou XG, Sudini H,
Groth DE, Raju SK, Miller ME (2012) Efficacy of Bacillus subtilis MBI 600 against sheath
blight caused by Rhizoctonia solani and on growth and yield of rice. Rice Sci 19(1):55–63
https://doi.org/10.1007/s00344-016-9663-5
Kumar KVK, Yellareddygari SK, Reddy MS, Kloepper JW, Lawrence KS, Miller ME, Sudini H,
Reddy ECS, Zhou XG, Groth DE (2013) Ultrastructural studies on the interaction between
Bacillus subtilis MBI 600 (Integral) and the rice sheath blight pathogen, Rhizoctonia solani.
Afr J Microbiol Res 7(19):2078–2086
Lee KJ, Kamala-Kannan S, Han SS, Seong CK, Lee GW (2008) Biological control of Phytophthora
blight in red pepper (Capsicum annuum L.) using Bacillus subtilis. World J Microb Biotechnol
24:1139–1145
Lee SW, Lee SH, Balaraju K, Park KS, Nam KW, Park JW, Park K (2014) Growth promotion and
induced disease suppression of four vegetable crops by a selected plant growth-promoting
rhizobacteria (PGPR) strain Bacillus subtilis 21-1 under two different soil conditions. Acta
Physiol Plant 36:1353–1362
Li SM, Hua GG, Liu HX, Guo JH (2008) Analysis of defence enzymes induced by antagonis-
tic bacterium Bacillus subtilis strain AR12 towards Ralstonia solanacearum in tomato. Ann
Li S, Zhang N, Zhang Z, Luo J, Shen B, Zhang R, Shen Q (2013) Antagonist Bacillus subtilis HJ5
controls Verticillium wilt of cotton by root colonization and biofilm formation. Biol Fertil Soils
49:295–303
Li L, Ma J, Ibekwe M, Wang Q, Yang C (2016) Cucumber rhizosphere microbial community
response to biocontrol agent Bacillus subtilis B068150. Agriculture 6(1):2. https://doi.
org/10.3390/agriculture6010002
Lian LL, Xie LY, Zheng LP, Lin QY (2011) Induction of systemic resistance in tobacco against
Tobacco mosaic virus by Bacillus spp. Biocontrol Sci Technol 21:281–292
Liu B, Qiao H, Huang L, Buchenauer H, Han Q, Kang Z, Gong Y (2009) Biological control of
take-all in wheat by endophytic Bacillus subtilis E1R-j and potential mode of action. Biol
Control 49:277–285
Lugtenberg B, Kamilova F (2009) Plant-growth-promoting rhizobacteria. Annu Rev Microbiol
63:541–556
Luo C, Zhou H, Zou J, Wang X, Zhang R, Xiang Y, Chen Z (2015) Bacillomycin L and sur-
factin contribute synergistically to the phenotypic features of Bacillus subtilis 916 and the
biocontrol of rice sheath blight induced by Rhizoctonia solani. Appl Microbiol Biotechnol
99(4):1897–1910
Maget-Dana R, Peypoux F (1994) Iturins, a special class of spore-forming lipopeptides: biological
and physicochemical properties. Toxicology 87(1–3):151–174
doi.org/10.1007/978-81-322-2776-2_10
Matos A, Kerkhof L, Garland JL (2005) Effects of microbial community diversity on the survival
of Pseudomonas aeruginosa in the wheat rhizosphere. Microb Ecol 49(2):257–264
Meena KR, Kanwar SS (2015) Lipopeptides as the antifungal and antibacterial agents:
applications in food safety and therapeutics. Biomed Res Int 2015:473050. https://doi.
org/10.1155/2015/473050
jclepro.2015.04.044
Cham, pp 367–395. https://doi.org/10.1007/978-3-319-44409-3_16
Mercado-Flores Y, Cardenas-Alvarez IO, Rojas-Olvera AV, Perez-Camarillo JP, Leyva-Mir SG,
Anducho-Reyes MA (2014) Application of Bacillus subtilis in the biological control of the
phytopathogenic fungus Sporisorium reilianum. Biol Control 76:36–40
Mnif I, Ghribi D (2015) Review lipopeptides biosurfactants: mean classes and new insights for
industrial, biomedical, and environmental applications. J Pept Sci 104(3):129–147
Mnif I, Hammami I, Triki MA, Azabou MC, Ellouze-Chaabouni S, Ghribi D (2015) Antifungal
efficiency of a lipopeptide biosurfactant derived from Bacillus subtilis SPB1 versus the phyto-
pathogenic fungus, Fusarium solani. Environ Sci Pollut R 22:18137–18147
Mora I, Cabrefiga J, Montesinos E (2011) Antimicrobial peptide genes in Bacillus strains from
plant environments. Int Microbiol 14:213–223
Muller S, Strack SN, Hoefler BC, Straight PD, Kearns DB, Kirby JR (2014) Bacillaene and sporu-
lation protect Bacillus subtilis from predation by Myxococcus xanthus. Appl Environ Microb
80:5603–5610
Novikova II, Shenin YD (2011) Isolation, identification, and antifungal activity of a gamair com-
plex formed by Bacillus subtilis M-22, a producer of a biopreparation for plant protection from
mycoses and bacterioses. Appl Biochem Microbiol 47:817–826
Ongena M, Jacques P (2008) Bacillus lipopeptides: versatile weapons for plant disease biocontrol.
Trends Microbiol 16(3):115–125
Parashar V, Konkol MA, Kearns DB, Neiditch MB (2013) A plasmid-encoded phosphatase regu-
lates Bacillus subtilis biofilm architecture, sporulation, and genetic competence. J Bacteriol
195:2437–2448
ture. Springer, India, pp 111–125. https://doi.org/10.1007/978-81-322-2776-2_8
Raghavendra MP, Nayaka NC, Nuthan BR (2016) Role of rhizosphere microflora in potas-
sium solubilization. In: Meena VS, Maurya BR, Verma JP, Meena RS (eds) Potassium sol-
ubilizing microorganisms for sustainable agriculture. Springer, India, pp 43–59. https://doi.
org/10.1007/978-81-322-2776-2_4
Ramarathnam R, Bo S, Chen Y, Fernando WGD, Gao XW, de Kievit T (2007) Molecular and bio-
chemical detection of fengycin- and bacillomycin D-producing Bacillus spp., antagonistic to
fungal pathogens of canola and wheat. Can J Microbiol 53:901–911
Reddy PP (2014) Plant growth promoting Rhizobacteria for horticultural crop protection. Springer
India
Roesti D, Ineichen K, Braissant O, Redecker D, Wiemken A, Aragno M (2005) Bacteria associated
with spores of arbuscular mycorrhizal fungi Glomus geosporum and Glomus constrictum. Appl
Environ Microbiol 71:6673–6679
Rudrappa T, Biedrzycki ML, Bais HP (2008) Causes and consequences of plant-associated bio-
films. Fems Micro Ecol 64(2):153–166
Ryu CM, Murphy JF, Reddy MS, Kloepper JW (2007) A two-strain mixture of rhizobacteria
elicits induction of systemic resistance against Pseudomonas syringae and cucumber mosaic
virus coupled to promotion of plant growth on Arabidopsis thaliana. J Microbiol Biotechnol
17:280–286
Saha M, Maurya BR, Bahadur I, Kumar A, Meena VS (2016a) Can potassium-solubilising bac-
teria mitigate the potassium problems in India? In: Meena VS, Maurya BR, Verma JP, Meena
RS (eds) Potassium solubilizing microorganisms for sustainable agriculture. Springer, India,
pp 127–136. https://doi.org/10.1007/978-81-322-2776-2_9
of potassium solubilizing bacteria (KSB) from indo-gangetic plains of India. Biocatal Agric
Sanchez-Vizuete P, Le Coq D, Bridier A, Herry JM, Aymerich S, Briandet R (2015) Identification
of ypqP as a new Bacillus subtilis biofilm determinant that mediates the protection of
Staphylococcus aureus against antimicrobial agents in mixed-species communities. Appl
Environ Microb 81:109–118
Sang MK, Kim KD (2012) Plant growth-promoting rhizobacteria suppressive to Phytophthora
blight affect microbial activities and communities in the rhizo-sphere of pepper (Capsicum
annuum L.) in the field. Appl Soil Ecol 62:88–97
Senol M, Nadaroglu H, Dikbas N, Kotan R (2014) Purification of Chitinase enzymes from Bacillus
subtilis bacteria TV-125, investigation of kinetic properties and antifungal activity against
Fusarium culmorum. Ann Clin Microbiol Antimicrob 13:1–7

Singh N, Pandey P, Dubey RC, Maheshwari DK (2008) Biological control of root rot fungus
Macrophomina phaseolina and growth enhancement of Pinus roxburghii (Sarg.) by rhizo-
sphere competent Bacillus subtilis BN1. World J Microb Biotechnol 24:1669–1679
Conservation agriculture: an approach to combat climate change in Indian Himalaya. Springer
Singapore, Singapore, pp 113–134. https://doi.org/10.1007/978-981-10-2558-7_4
Tan S, Jiang Y, Song S, Huang J, Ling N, Xu Y, Shen Q (2013) Two Bacillus amyloliquefaciens
strains isolated using the competitive tomato root enrichment method and their effects on sup-
pressing Ralstonia solanacearum and promoting tomato plant growth. Crop Prot 43:134–140
Tang Q, Bie X, Lu Z, Lv F, Yang T, Qu X (2014) Effects of Fengycin from Bacillus subtilis fmbJ
on apoptosis and necrosis in Rhizopus stolonifer. J Microbiol 52:675–680
Trabelsi D, Mhamdi R (2013) Microbial inoculants and their impact on soil microbial communi-
ties: a review. Biomed Res Int 2013:863240
Tsuge K, Inoue S, Ano T, Itaya M, Shoda M (2005) Horizontal transfer of iturin A operon, itu, to
Bacillus subtilis 168 and conversion into an iturin A producer. Antimicrob Agents Chemother
49:4641–4648
Van Dijl JM, Hecker M (2013) Bacillus subtilis: from soil bacterium to super-secreting cell fac-
tory. Microb Cell Factories 12:3
Van Gestel J, Vlamakis H, Kolter R (2015) New tools for comparing microscopy images: quantita-
tive analysis of cell types in Bacillus subtilis. J Bacteriol 197:699–709
Velazquez E, Silva LR, Ramírez-Bahena MH, Peix A (2016) Diversity of potassium-solubiliz-
ing microorganisms and their interactions with plants. In: Meena VS, Maurya BR, Verma JP,
84(8):914–919
Vijay KKK, Kr YS, M SR JWK, K SL MEM, Sudini H, Surendranatha REC, Zhou XG, Groth DE
(2013) Ultrastructural studies on the interaction between Bacillus subtilis MBI 600 (Integral)
and the rice sheath blight pathogen, Rhizoctonia solani. Afr J Microbiol Res 7:2078–2086
Vlamakis H, Chai Y, Beauregard P, Losick R, Kolter R (2013) Sticking together: building a biofilm
the Bacillus subtilis way. Nature Reviews. Microbiology 11(3):157–168
Wang S, Wu H, Zhan J, Xia Y, Gao S, Wang W, Xue P, Gao X (2011) The role of synergistic
action and molecular mechanism in the effect of genetically engineered strain Bacillus sub-
tilis OKBHF in enhancing tomato growth and Cucumber mosaic virus resistance. BioControl
56(1):113–121
Wang T, Liang Y, Wu MB, Chen ZJ, Yang LR (2015) Natural products from Bacillus subtilis with
antimicrobial properties. Chin J Chem Eng 23(4):744–754
Weller DM, Raaijmakers JM, Gardener BBM, Thomashow LS (2002) Microbial populations
responsible for specific soil suppressiveness to plant pathogens. Annu Rev Phytopathol 40:309
Williams-Wagner RN, Grundy FJ, Raina M, Ibba M, Henkin TM (2015) The Bacillus subtilis tyrZ
gene encodes a highly selective Tyrosyl-tRNA synthetase and is regulated by a MarR regulator
and T box riboswitch. J Bacteriol 197:1624–1631
Wulff BB, Horvath DM, Ward ER (2011) Improving immunity in crops: new tactics in an old
game. Curr Opin Plant Biol 14(4):468–476
Yadav BK, Sidhu AS (2016) Dynamics of potassium and their bioavailability for plant
nutrition. In: Meena VS, Maurya BR, Verma JP, Meena RS (eds) Potassium solubiliz-
ing microorganisms for sustainable agriculture. Springer, India, pp 187–201. https://doi.
org/10.1007/978-81-322-2776-2_14
Yánez-Mendizábal V, Zeriouh H, Viñas I, Torres R, Usall J, Vicente AD, Pérez-García A, Teixidó
N (2012) Biological control of peach brown rot (Monilinia spp.) by Bacillus subtilis CPA-8 is
based on production of fengycin-like lipopeptides. Eur J Plant Patholol 132:609–619
Yang CY, Ho YC, Pang JC, Huang SS, Tschen JSM (2009) Cloning and expression of an antifungal
chitinase gene of a novel Bacillus subtilis isolate from Taiwan potato field. Bioresour Technol
100:1454–1458
Yang L, Quan X, Xue B, Goodwin PH, Lu S, Wang J, Du W, Wu C (2015) Isolation and identifica-
tion of Bacillus subtilis strain YB-05 and its antifungal substances showing antagonism against
Gaeumannomyces graminis var. tritici. Biol Control 85:52–58
Yasin M, Munir I, Faisal M (2016) Can Bacillus spp. enhance K+ uptake in crop species. In: Meena
VS, Maurya BR, Verma JP, Meena RS (eds) Potassium solubilizing microorganisms for sustain-
able agriculture. Springer, India, pp 163–170. https://doi.org/10.1007/978-81-322-2776-2_12
Ye YF, Li QQ, Fu G, Yuan GQ, Miao JH, Lin W (2012) Identification of antifungal substance
(Iturin A_2) produced by Bacillus subtilis B47 and its effect on southern corn leaf blight.
J Integr Agric 11:90–99
You C, Zhang C, Kong F, Feng C, Wang J (2016) Comparison of the effects of biocontrol agent
Bacillus subtilis and fungicide metalaxyl–mancozeb on bacterial communities in tobacco rhi-
zospheric soil. Ecol Eng 91:119–125
Yu X, Ai C, Xin L, Zhou G (2011) The siderophore-producing bacterium, Bacillus subtilis CAS15,
has a biocontrol effect on Fusarium wilt and promotes the growth of pepper. Eur J Soil Biol
47(2):138–145
crop species. In: Meena VS, Maurya BR, Verma JP, Meena RS (eds) Potassium solubi-
org/10.1007/978-81-322-2776-2_3
Zeriouh H, de Vicente A, Pérez-García A, Romero D (2014) Surfactin triggers biofilm formation
of Bacillus subtilis in melon phylloplane and contributes to the biocontrol activity. Environ
Zhang N, Wu K, He X, Li S, Zhang Z, Shen B, Yang X, Zhang R, Huang Q, Shen Q (2011) A new
bioorganic fertilizer can effectively control banana wilt by strong colonization with Bacillus
subtilis N11. Plant Soil 344:87–97
Zhang N, He X, Zhang J, Raza W, Yang X, Ruan Y, Shen Q, Huang Q (2014) Suppression of
Fusarium wilt of banana with application of bio-organic fertilizers. Pedosphere 24(5):613–624
Zhao Q, Ran W, Wang H, Li X, Shen Q, Shen S, Xu Y (2013) Biocontrol of Fusarium wilt disease
in muskmelon with Bacillus subtilis Y-IVI. BioControl 58:283–292
Zhao Q, Shen Q, Ran W, Xiao T, Xu D, Xu Y (2011) Inoculation of soil by Bacillus subtilis Y-IVI
improves plant growth and colonization of the rhizosphere and interior tissues of muskmelon
(Cucumis melo L.) Biol Fertil Soils 47(5):507–514
Chapter 10
Mycorrhizae: A Potential Microorganism
and Its Implication in Agriculture
Debabrata Nath and Vijay Singh Meena
Abstract Mycorrhiza is a symbiotic mutualistic relationship between special soil

fungi and fine plant root system. Mycorrhizal fungi are a heterogeneous group of
diverse fungal taxa, associated with the roots of over 90% of all plant species. They
play a crucial role in plant nutrient uptake, water relations, ecosystem establishment,
plant diversity and the productivity of plants. Scientific research involves
multidisciplinary approaches to understand the adaptation of mycorrhizae to the
rhizosphere, mechanism of root colonization, effect on plant physiology and growth,
biofertilization, plant resistance and biocontrol of plant pathogens, reclamation of
heavy metals and contribution in soil aggregation. Mycorrhizae are an essential
belowground component in the establishment and sustainability of plant
communities, but thorough knowledge is required to achieve maximum benefits
from these microorganisms and their associations.
Keywords Mycorrhiza · Glomalin · Ectomycorrhiza · Endomycorrhiza
10.1 Introduction
Mycorrhizal fungi have existed since the first plants appeared on dry land more than
450 million years ago. They form a close symbiotic relationship with plant roots.
They are called mycorrhizae from the Greek “mycos”, meaning fungus, and “rhiza”,
meaning roots. The word mycorrhiza was first used by German researcher
A.B. Frank in 1885. Mycorrhiza is a symbiotic mutualistic relationship between
D. Nath (*)
Banaras Hindu University, Varanasi, India
ICAR-Indian Institute of Soil Science, Bhopal, Madhya Pradesh, India
V. S. Meena

https://doi.org/10.1007/978-981-10-8402-7_10
252 D. Nath and V. S. Meena
special soil fungi and fine plant roots; it is neither the fungus nor the root but rather
the structure formed from these two partners. Since the association is mutualistic,
both organisms benefit from the association (Meena et al. 2013a, 2016a; Bahadur
et al. 2014; Maurya et al. 2014; Jat et al. 2015; Kumar et al. 2015, 2016b; Ahmad
et al. 2016; Parewa et al. 2014; Prakash and Verma 2016). The fungus receives
carbohydrates (sugars) and growth factors from the plant, which in turn receives
many benefits, including increased nutrient absorption. In this association, the
fungus takes over the role of the plant’s root hairs and acts as an extension of the
root system (Muchovej 2001).
Mycorrhizae form a network of filaments that associate with plant roots and
draw nutrients from the soil that the root system would not be able to access
otherwise. This fungus-plant alliance stimulates plant growth and accelerates root
development. It also makes the plant less susceptible to soil-borne pathogens and to
other environmental stresses such as drought and salinity. In return the plant provides
carbohydrates and other nutrients to the fungi. They utilize these carbohydrates for
their growth and to synthesize and excrete molecules like glomalin (glycoprotein).
The release of glomalin in the soil environment results in better soil structure and
higher organic matter content (Rillig 2004). However, in soil that has been disturbed
by human activity, the quantity of mycorrhizae decreases drastically so that there
are not enough of them to produce a significant benefit on plant growth and soil
health (Meena et al. 2015a, 2016b; Priyadharsini and Muthukumar 2016; Kumar
et al. 2016a, 2017; Raghavendra et al. 2016; Zahedi 2016).
10.2 Mycorrhizal Types
There are two major groups of mycorrhizal fungi: ectomycorrhizal and endomycor-
rhizal fungi. Members of the former group develop exclusively on the exterior of
root cells, whereas those of the latter penetrate the plant cells where direct meta-
bolic exchanges can occur. Ectomycorrhizae are essentially found on trees and form
visible structures, whereas endomycorrhizal fungi colonize trees as well as shrubs
and most herbaceous plants and do not form visible structures.
10.2.1 Ectomycorrhizae
Ectomycorrhizal fungi are also found in natural environments, mainly in forest eco-
systems. These fungi can form visible reproductive structures (mushrooms) at the
feet of trees they colonize. Ectomycorrhizal fungi grow between root cells without
penetrating them. Their hyphae grow externally, forming dense growth known as a
fungal mantle. These fungi form symbiotic relationships with most pines, spruces
and some hardwood trees including beech, birch, oak and willow.
10 Mycorrhizae: A Potential Microorganism and Its Implication in Agriculture 253
10.2.2 Endomycorrhizae
Among the types of endomycorrhizal fungi, arbuscular mycorrhizal (AM) fungi are
the most prevalent in soils. Their name is derived from structures they form within
the plant root cell arbuscules. Arbuscules are finely branched structures that form
within a cell and serve as a major metabolic exchange site between the plant and the
fungus. Vesicles are found in some species of AM fungi; they are saclike structures,
emerging from hyphae, which serve as a storage organ for lipids. Endomycorrhizae
are further divided into orchid, ericoid and arbuscular mycorrhizae (AMs).
10.3 Mechanism of Symbiosis
Trees in the families Pinaceae, Fagaceae, Dipterocarpaceae and Caesalpinoidaceae

found in many forests all interact with hundreds of ectomycorrhizal species of
Basidiomycetes and Ascomycetes, so that these fungi can be said to have shaped the
present forests. The ectomycorrhizal fungi colonize the lateral roots of these trees
with sheathing mycorrhizae, in which a fungal mantle covers the root tip, and a so-
called Hartig net of intercellular hyphae surrounds the epidermal and outer cortical
cells (Figs. 10.1 and 10.2).
The ectomycorrhizal fungus surrounds the root tip with a thick mantle of closely
appressed hyphae, whereas the Hartig net develops around the epidermal cells
Ectomycorrhizae Endomycorrhizae
chlamydospore
xylem
epidermis epidermis
cortex
Hartig net arbuscule
endodermis
vesicle
root hair
fungal
sheath 100 µm
cortex
Fig. 10.1 Schematic diagram on ecto- and endomycorrhizae

Ectomycorrhiza Arbuscular mycorrhiza
* Hyphopodium
Mycellium
Mantle
#
Arbuscule
Hartig net
Fig. 10.2 Illustration of root colonization structures in ectomycorrhizal (blue) and arbuscular
mycorrhizal (pink) interactions
(green). In the case of arbuscular mycorrhizae, the root tip is usually not colonized.
Hyphae develop from a spore and produce a hyphopodium on the root epidermis.
Intraradical colonization proceeds both intra- and intercellularly and culminates with
the formation of arbuscules, little fungal trees, inside inner cortical cells (brown).
Arbuscule Highly branched structure produced by arbuscular mycorrhizal fungi
inside the cell lumen of their host. Arbuscules are considered to be the key element
of the symbiotic nutrient exchanges between the plant and the fungus.
Hyphopodium Specialized hypha of an arbuscular mycorrhizal fungus, often

branched and swollen, which adheres to the root epidermis before intracellular fun-
gal penetration (Fig. 10.3).
Fig. 10.3 The transition from the free-living status of an EM fungus to the symbiotic phase.
(Adapted from Bonfante and Genre 2010)
A growing hypha from the mycelium of T. melanosporum as observed in fluores-

cence microscopy is shown in (a) (Courtesy: R. Balestrini). Hyphal morphology
changes in the mantle, in which the repeated branching, characterized by incom-
plete transversal walls (arrowheads), originates a pseudoparenchymatous structure,
are evident in the electron micrograph shown in (b). In both images, the fungal wall
is falsely coloured in blue and nuclei in red. The transverse section of a mycorrhizal
root tip stained with Trypan blue is presented in (c), showing the organization of
hyphae in the mycelium, mantle and Hartig net.
Fig. 10.4 Scheme summarizing the main nutrient exchange processes in EM and AM symbiosis
10.4 Nutrient and Signal Exchange in Ectomycorrhiza
Mycorrhizal fungi, similar to other plant-interacting fungi, base their life cycle on
the uptake of organic carbon from a living plant (Fig. 10.4).
Emphasis is placed on the translocation of phosphorus (P), nitrogen (N) and
carbon (C) at the soil-fungus and fungus-plant interface. Inorganic P and mineral or
organic forms of N, such as NH4+, NO3− and amino acids (AA), are taken up by
specialized transporters located on the fungal membrane in the extraradical myce-
lium. NH3/NH4+ and Pi (the latter originated in AM fungi from the hydrolysis of
polyphosphate) are imported from the symbiotic interface to the plant cells through
selective transporters. Hexose transporters import plant-derived carbon to the fun-
gus, whereas transporter proteins involved in the export of nutrients from either the
plant or fungus have not been identified yet (Meena et al. 2015b, f, 2016c; Rawat
et al. 2016; Yasin et al. 2016; Saha et al. 2016a; Yadav and Sidhu 2016; Dotaniya
et al. 2016; Jaiswal et al. 2016; Jha and Subramanian 2016).
10.5 Finding the Host Root
The dissection of plant responses illustrates how the mechanisms operating to

accommodate the AM fungus inside the plant cell lumen are shared by diverse
plants and have been conserved during evolution (Fig. 10.5); root colonization is
vital to AM fungi.
Fig. 10.5 Schematic summary of the root colonization process by AM fungi under soil-plant
system
The germination of a resting spore is followed by the production of a short

explorative mycelium. The perception of plant exudates, released by the host root,
induces recursive hyphal branching, increasing the probability of a direct contact
between the symbionts. In the meantime, fungal exudates are perceived by the root,
where they trigger calcium spiking. Signal transduction leads to the activation of
cellular and transcriptional responses (green cells and nuclei). The contact between
the plant and fungus is followed by the adhesion of a hyphopodium to the root sur-
face (Meena et al. 2014a, 2015e, 2016d; Saha et al. 2016b; Verma et al. 2014, 2015b;
Sharma et al. 2016; Bahadur et al. 2016b; Das and Pradhan 2016; Dominguez-
Nunez et al. 2016). This triggers the assembly of a broad aggregation of cytoplasm
(yellow), named the prepenetration apparatus (PPA), in the contacted epidermal cell
and underlying outer cortical cell. Subsequent intracellular fungal colonization
strictly follows the route of PPAs from the epidermis to the inner cortex. Here, inter-
cellular hyphae can develop along the root axis. The PPA mechanism is then repli-
cated in the contacted inner cortical cells, both before fungal entry and—on a
smaller scale—branching. Eventually, a highly branched arbuscule occupies most
of the cell volume, forming an extensive surface for nutrient exchange (Verma et al.
2015a; Meena et al. 2013b, 2015c; Shrivastava et al. 2016; Velazquez et al. 2016;
Teotia et al. 2016).
10.6 Beneficial Effects of AM
Beneficial effects of AM result from one or several of these mechanisms:

(i) Increased overall absorption capacity of roots due to morphological and physi-
ological changes in the plant. There is increased absorption surface area,
greater soil area explored (since the fungus acts as an extension of the root),
greater longevity of absorbing roots, better utilization of low-availability nutri-
ents and better retention/storage of soluble nutrients, thus reducing reaction
with soil colloids or leaching losses (Fig. 10.6).
(ii) Increased mobilization and transfer of nutrients (P, N, S, micronutrients Cu and
Zn) from the soil to the plant. Mycorrhizal fungi have been estimated to “sub-
stitute” up to 500 lb/a of P for citrus and 170 lb/a for soybeans in tropical areas.
(iii) AM aids plant in foraging for unevenly distributed nutrients by increasing the
soil volume that is explored for P and also facilitating mineral weathering of
apatite.
(iv) Arbuscular mycorrhizal fungi can be a useful tool of integrated weed manage-
ment (Li et al. 2016).
(v) Modification of plant-pathogen relations: Mycorrhizae influence the coloniza-
tion of roots by other microorganisms and reduce the susceptibility (or increase
the tolerance) of roots to soil-borne pathogens such as nematodes or phyto-
pathogenic fungi such as Fusarium oxysporum and F. solani. Development of
Fig. 10.6 Schematic view of possible interactions among different components of the mycorrhi-
zosphere. (Adapted from Johansson et al. 2004)
basal stem rot (BSR) disease in oil palm (Elaeis guineensis) caused by
Ganoderma boninense is reduced by combination effect of arbuscular mycor-
rhizal fungi (AMF) with with endophytic bacteria (EB) (Sundram et al. 2015).
(vi) Effects of AM fungi on fungal pathogens:
AM fungi may also interact with other root-associated microorganisms, such as
pathogenic fungi. In a study by Filion et al. (1999), the differential effects in vitro of
a crude extract from the growth medium of the AM fungus Glomus intraradices on the
sporulation of two pathogenic fungi and on the growth of two bacterial species were
investigated. Conidial germination of the mycoparasitic fungus T. harzianum and the
growth of P. chlororaphis were stimulated, whereas conidial germination of the plant
root pathogen F. oxysporum was reduced, and the growth of Clavibacter michiganen-
sis was unaffected. The measured effects were correlated with extract concentration,
and no significant influence of pH on growth or germination was detected (Filion et al.
1999; Sindhu et al. 2016; Meena et al. 2014b, 2015d, 2016e; Singh et al. 2016).
The authors concluded that the release of unspecified substances by the AM fun-
gus into the growth medium was the main factor explaining the differential growth
of the tested microorganisms. In field experiments, Newsham et al. (1995) found
Glomus sp. inoculated and uninoculated seedlings of the annual grass Vulpia ciliata
into a natural population and that AM inoculation did not affect P concentrations in
the plants. However, mycorrhiza protected the plants from the deleterious effects of
F. oxysporum infection on shoot and root growth.
Apparently, the AM suppressed pathogen development in the roots. Following
transplantation, comparison of root-infecting mycofloras of AM and non-AM plants
revealed that AM plants had fewer naturally occurring infections of F. oxysporum
and Embellisia chlamydospora. It was proposed that the main benefit supplied by
AM fungi to V. ciliata is the protection from pathogenic fungi, rather than improved
P uptake (Filion et al. 1999; Meena et al. 2017) and increased production of plant
growth hormones such as cytokinins and gibberellins;
(vii) Modification of soil-plant-water relations, promoting better adaptation of
plant to adverse environment conditions (drought, metals). At elevated heavy
metal concentrations in soils, mycorrhizal fungi have been shown to detoxify
the environment for plant growth.
(viii) Arbuscular mycorrhizal fungi responded to differences in host community
and resource availability, suggesting that mycorrhizal functions, such as
carbon sequestration and soil stability, will be affected by global change
(Antoninka et al. 2011; Singh et al. 2015; Meena et al. 2013c; Bahadur et al.
2016a; Masood and Bano 2016).
(ix) Arbuscular mycorrhizae enhance plant interception of leached nutrients
(Asghari and Cavagnaro 2011).
(x) Effects of AM fungi on plant and soil function and interaction: An increase in
water-soluble aggregates in mycorrhizal soybean (Glycine max), which were
dependent on the mycorrhizal fungal species, was found. Differences in the
bacterial communities were also found among the fungal species, suggesting
that AM species may influence both water-soluble aggregates and bacterial
composition (Schreiner et al. 1997).
Ectomycorrhizal inoculum is easily produced for application in forest nurseries,

but the necessity of AM inoculum production via a host plant is still an obstacle to
ample utilization of AM fungi in agricultural crops. Nevertheless, progress is being
made in this area, and some commercial inoculum is currently marketed. Some of
the important practical applications of mycorrhizae are (a) in soil that are constantly
fumigated or receiving high rates of fungicides to eliminate/reduce soil-borne patho-
gens (importance of mycorrhizae for agricultural crops such as in horticultural crops
and fruits), (b) in revegetation of eroded or mined areas (extreme pH, metal toxicity,
low organic matter content, natural AM inoculum and overall fertility) and (c) in arid
and semi-arid regions. With increasing concerns about excessive nutrient application
to the environment, the use of mycorrhizal symbioses to promote plant growth while
reducing the inputs of fertilizer and pesticides may have great potential for citrus and
vegetable crops, which respond very well to inoculation (Mukhovej 2001) (Fig. 10.7).
Mycorrhizae are the rule in nature, not the exception. Most plants (more than
90% of all known species) present at least one type of mycorrhiza. Among the
Fig. 10.7 An overview of mycorrhizal root and non-mycorrhizal root function

Fig. 10.8 The boxes represent the four phases of formation of the plant-fungus association in the
AM symbiosis; (a) plant roots exude strigolactones and induce hyphal branching; (b) the AM
fungus contacts the root surface and forms hyphopodia; (c) epidermal plant cells produce a prepen-
etration apparatus; the AM fungus starts to grow inside the plant and reaches the cortex; (d) the
AM fungal hypha branches inside the cortex cells and forms the arbuscules. (Adapted from Marco
et al. 2015)
important plants that associate with mycorrhizal fungi are corn, carrots, leek, pota-
toes, beans, soybeans, other legumes, tomatoes, peppers, onions, garlic, sunflower,
strawberries, citrus, apples, peaches, grapes, cotton, coffee, tea, cocoa, sugarcane,
forest species, wild plants and even weeds. Cabbage, Cruciferae in general, and
some aquatic plants are usually non-mycorrhizal (Mukhovej 2001) (Fig. 10.8).
10.6.1 Effects of Mycorrhizosphere Bacteria on AM Fungi
Mycorrhizosphere bacteria may affect AM fungi and their plant hosts through a
variety of mechanisms (Fig. 10.6). Some of these have been more fully studied in
ectomycorrhizal fungi by Garbaye (1994), but possibilities include (i) effects on the
receptivity of the root, (ii) effects on the root-fungus recognition, (iii) effects on the
fungal growth, (iv) modification of the chemistry of the rhizospheric soil and (v)
effects on the germination of the fungal propagules.
The germination was also enhanced following addition of kaolin or activated
charcoal, indicating that the spores contained self-inhibitors, which were possibly
inactivated by soil bacteria or were immobilized by substances with a high ion
exchange capacity. Carpenter-Boggs et al. (1995) tested the stimulatory effects of

actinomycetes and Streptomyces orientalis on Gigaspora margarita spore germina-
tion and found that amounts of volatile compounds produced by the isolates corre-
lated well with AM spore germination. Conversely, other studies using pasteurization,
fumigation or sterilization of soils have demonstrated that the presence of some soil
bacteria may also inhibit spore germination (Tommerup 1985; Ross 1980; and
Wilson et al. 1988).
10.6.2 Arbuscular Mycorrhizal Fungi Act As a Biocontrol
Microbial inoculants can be used as an alternative means for controlling pests and
disease in agricultural cropping systems, permitting the reduced use of pesticides
that could otherwise pose threats to human health and nontargeted organisms. The
biocontrol organisms may affect AM fungi, or be affected themselves by AM fungi,
in similar ways to the interactions already described above. Biocontrol agents
against pathogenic fungi may in particular have negative effects on “nontarget” AM
fungi. The mechanisms of antagonistic interactions resulting in biocontrol may
involve competition for colonization sites or nutrients and production of fungistatic
compounds. Although the literature concerning biocontrol is extensive, few studies
have explicitly considered interactions involving AM fungi. The main conclusions
that can be drawn are as follows: (1) AM associations can reduce damage caused by
soil-borne plant pathogens, (2) the abilities of the AM symbioses to enhance resis-
tance or tolerance in roots are not equal for the different AM fungi so far tested, (3)
protection is not effective for all pathogens, and (4) protection is modulated by soil
and other environmental conditions. Some positive effects of rhizobacteria on AM
fungal colonization of roots may be due to antagonistic effects of competing patho-
gens (Azcon et al. 1996) but also direct synergistic effects on mycorrhizal coloniza-
tion itself (Budi et al. 1999); however AM-induced suppression of root pathogens
and stimulation of plant growth-promoting microorganisms may also be important
(Kapoor and Mukerji 1998).
10.6.2.1 echanisms by Which an AM Association Could Control Root

M
Pathogens
(i) Improved nutrient status of the host plant: Increased nutrient uptake made pos-
sible by the AM symbiosis results in more vigorous plant, and the plant itself
may thus be more resistant and tolerant to pathogen attack. It has been sug-
gested that AM fungi increase host tolerance of pathogen attack by compensat-
ing for the loss of root biomass or function caused by pathogens (Linderman
1994).
(ii) Competition for host photosynthates: It has been proposed that the growth of
both the AM fungi and root pathogens depends on host photosynthates and that
they compete for the carbon compounds reaching the root (Smith 1987;
Linderman 1994). When AM fungi have primary access to photosynthates, the
higher carbon demand may inhibit pathogen growth.
(iii) Anatomical and morphological changes in the root system: It has been demon-
strated that AM colonization induces remarkable changes in root system mor-
phology, as well as in the meristematic and nuclear activities of root cells
(Atkinson et al. 1994).
(iv) Activation of plant defence mechanisms: The activation of specific plant
defence mechanisms as a response to AM colonization is an obvious basis for
the protective capacity of AM fungi (Gianinazzi-Pearson et al. 1994).
Endotrophic mycorrhizal fungus Glomus fasciculatus causes an increase in Luffa
cylindrica L. plant resistance to nematode infection and development. Inoculation
of plants with fungus before nematode infestation seemed necessary to allow the
fungal symbiont to become established and colonize extensively the cortical cells of
Luffa transplant and seedling (Nangyal et al. 2016).
10.6.3 ontribution of Mycorrhiza in Glomalin Production,

C
Soil Aggregation and Soil Quality
The formation of a biomolecule such as glomalin would have served as an evolu-

tionary advantage to the fungus. Glomalin is a glycoprotein produced on the hyphae
of mycorrhiza in the soil. The indirect or “secondary” impacts of glomalin on the
formation and stabilization of soil aggregates further improved the efficiency of the
symbiotic relationship and the growth environment (Rillig and Mummey 2006).
Glomalin rich soil protein released by AMF enhances soil aggregation. There is
increasing circumstantial evidence accumulating from decomposition studies that
GRSP is of AMF origin (Fig. 10.9). When AMF growth is eliminated, e.g. by incu-
bating soil without host plants, we have observed that GRSP concentrations decline,
along with AMF hyphae (Steinberg and Rillig 2003).
Tillage results in destroying soil structure and also hyphae of mycorrhizae. So
due to tillage, efficiency of mycorrhizae and also carbon requirement for glomalin
production subsequently reduced. No-tillage (NT) practices along with continuous
cropping systems (by eliminating fallow periods and/or growing cover crops), using
mycorrhizal host crops, and reducing synthetic inputs (especially P), enhance the
plant-mycorrhizal symbiotic relationship (Nichols and Wright 2004; Preger et al.
2007; Roldan et al. 2007; Rillig 2004; Rillig et al. 2007).
AMF, as a factor of soil quality, can perhaps be viewed to be important via three
main mechanisms: influences on plant physiology, soil ecological interactions and
Immunoreactivity
monoclonal
antibody
GPRS is (at
least partly of
AMF origin
Decomposition In-vitro culture

evidence evedence
Fig. 10.9 Various lines of evidence suggest that GRSP in soil is of arbuscular mycorrhizal fungal
origin, although conclusive evidence can only come from additional detection tools
soil engineering (Fig. 10.10). These mirror the importance of the symbiosis at the
individual plant level, in community ecology and in influencing processes at the
ecosystem scale, respectively (Fig. 10.11).
Glomalin is present in large amounts in soils which is indeed a distinct compo-
nent of soil organic matter. This is a glycoprotein from Glomales which is the taxo-
nomic genera to which AMF belong (Wright and Upadhyaya 1996). The main
detection tool is a monoclonal antibody (MAb32B11), raised originally against
crushed AMF spores (Wright and Upadhyaya 1996). The extraction of glomalin
from plant hyphae and soils is extremely drastic.
In fact, it is the severity of the extraction conditions that clearly demonstrates its
uncommonly high stability. Glomalin is very difficult to solubilize, and it is resistant
to most chemical used in routine and characterization methods (Wright and
Upadhyaya 1996). Table 10.1 shows the various fractions of soil proteins and glo-
malin and the correlation coefficients for EEG and TG on soil aggregation accord-
ing to Wright and Upadhyaya (1998) (Table 10.2).
Strength of Ecosystem and soil ecology GRSP correlation with WSA

available Responses to treatments
evidence Persistence, distribution
Fungal community ecology Differences in GRSP production
Fungal physiology Functions in AMF biology

(organism) • Habitat engineering
• others
Cell/hyphal biology Glomalin secretion

Presence in hyphal wall
Biochemistry/ Biochemical characterization
Molecular biology of putative gene product
Fig. 10.10 Reflecting the origins of research on GRSP in soil sciences, there is currently a strong
gradient of knowledge available from the ecosystem level to the biochemistry level
Soil ecological Habitat engineering

interactions capability
Soil Quality:
Sustained capacity to produce
Plant physiology
influences
Fig. 10.11 Arbuscular mycorrhizal fungi as a component of soil quality, more than just plant
nutrition
Table 10.1 Proposal for a new terminology describing various fractions of soil proteins and
glomalin
Proposed new
Current usage Identity name/usage Justification
TG (total Bradford-reactive soil protein BRSP (Bradford- Bradford assay is
glomalin) (after autoclave/citrate reactive soil non-specific for a
extraction) protein) particular protein
EEG (easily Bradford-reactive soil protein EE-BSRP (easily Bradford assay is
extractable (easily extracted autoclave/ extractable) non-specific for a
glomalin) citrate extraction) particular protein
Glomalin Gene product and protein GRSP (glomalin- It is a very complex
related soil protein) compound
Table 10.2 Correlation coefficients for fractions of glomalin, %C in soil aggregates and aggregate
stability (Wright and Upadhyaya 1998)
%C EEG TG
EEG 0.49**
TG 0.61*** 0.94***
Aggregate stability 0.65*** 0.69*** 0.70***
** and *** denote significance at p < 0.1 and p < 0.01, respectively
0.7
0.6
0.5 a
a
weight (gm)
0.4
0.3 Mycorrhiza
0.2 Non Mycorrhiza
0.1
b b
0
Fresh Weight Dry Weight
Parameters
Fig. 10.12 Effects of mycorrhizal inoculation on the growth of Ipomoea aquatica. Error bars
indicate standard deviations (SDs). Mean values followed by the different letters are significantly
different (P < 0.05) and same letters are not significantly different (P < 0.05)
10.6.4 ffect of Arbuscular Mycorrhizal Fungi Inoculation

E
on Growth and Uptake of Mineral Nutrition
10.6.4.1 Increase in Ipomoea aquatica Weight After Mycorrhizal
Inoculation
The fresh weight of mycorrhiza-inoculated plants was higher than that of uninocu-
lated (control) plants (Fig. 10.12). The average fresh weight of mycorrhiza treat-
ment plants was 0.48 ± 0.l6 gm, whereas the fresh weight of control plants was 0.45
± 0.09 g. Similarly to the fresh weight, the dry weight of treatment plants (0.034 ±
0.005) was similar to the control plants (0.032 ± 0.018 gm). There were no signifi-
cant (p < 0.05) differences between the plant weight of mycorrhiza-inoculated
plants and non-mycorrhizal-infected plants. Tabassum et al. (2011) showed that the
AM fungi significantly increase the growth of cowpea plants compared to nonin-
fected plants.
10.6.4.2 Effects of AMF Infection on Macronutrient Uptake
Among the measured macronutrients, K uptake was highest compared to other mac-
ronutrient uptake followed by Na and Mg for both the cases of mycorrhiza-treated
and mycorrhiza-nontreated plants. Least amount of P uptake was observed (treated
with mycorrhiza as 0.01 mg/plant and untreated as 0.007 mg per plant). In mycor-
rhiza-inoculated plants, Na and Mg uptake was 0.015 mg/plant and 0.014 mg/plant
higher than control plants as 0.013 mg/plant and 0.01 mg/plant, respectively. These
findings are supported by the work of Tabassum Yaseen et al. (2011) who showed
that nutrient uptake of AMF-infected plants is higher compared to non-AMF-
infected plants.
10.6.4.3 Effects of AMF Infection on Micronutrient Uptake
All determined micronutrient uptakes in AMF-treated plants were higher than con-
trol plants (without AMF). The uptake of micronutrients like Fe, Mn and Zn was
0.24, 0.07 and 0.23 mg/plant in case of mycorrhiza infection, but for noninfected
plant the uptake was 0.16, 0.02 and 0.09 mg/plant, respectively. AMF have been
also shown for betterment of immobile soil nutrient uptake such as P, Zn and Cu
(Jiang et al. 2013; Liu et al. 2002).
10.6.5 rbuscular Mycorrhizal Fungi: Implications

A
for Integrated Weed Management
(i) Mycorrhizal growth responses (MGRs) in different environmental conditions

will help identify situations that favour AMF in IWM (Li et al. 2016). Depending
upon the conditions and weed communities of a particular agroecosystem, it
may be feasible for producers to use different levels of tillage intensity, vegetation
management and soil fertility inputs to manage AMF-weed-crop interactions
and thereby enhance IWM (Table 10.3).
AMF did not differentiate in their impacts on strong host crops and strong host
weeds. However, AMF may differentially benefit high-mycorrhizal growth response
crops compared to low-mycorrhizal growth response host weeds, enhancing indi-
rect weed suppression by crop competition, as proposed in Fig. 10.13.
10.6.6 Reclamation of Heavy Metals by Mycorrhiza
Extraradical mycelium (ERM) of mycorrhiza from polluted soils accumulated Cu in

the mucilaginous outer hyphal wall zone, cell wall and inside the hyphal cytoplasm.
The accumulated Cu was mainly associated with Fe in the mucilaginous outer
Table 10.3 Recommended management decisions based on host status and crop-weed community
composition for use of arbuscular mycorrhizal fungi (AMF) in integrated weed management
(IWM) approach
Dominant Dominant
crop weed Management for greater AMF weed control
Strong host Weak host AMF are mostly weed suppressive under these conditions.
crop weed Practices supporting high AMF diversity and low N and P fertilizer
addition are suggested
Weak host Strong host Practices supporting high AMF diversity and relatively high N and
crop weed P fertilizer addition are suggested
Weak host Weak host Low N and P fertilizer addition suggested
crop weed
Strong host Strong host AMF suppression of weeds is not favoured
crop weed
Fig. 10.13 Proposed interactions among crops, weeds and arbuscular mycorrhizal fungi (AMF).
Black arrow: AMF may directly suppress the growth of weak host weeds through impeding their
root growth. Grey arrows: AMF may indirectly suppress the growth of some strong host weeds
through increasing the competitive ability of their adjacent strong host crops
hyphal wall zone and in the cell wall. Copper was associated with traces of arsenate
inside the cytoplasm of the ERM of Glomus mosseae (Gonzalez-Chavez et al.
2002).
Although the mycorrhizal mechanisms for enhancing uptake are not entirely
known, some of them could be the following:
1. Transfer of metals to the hyphae by cation exchange and chelation (non-meta-
bolic binding of metals to cell walls).
2. Interacting with hyphal synthesized products or metabolites that act as biosorp-
tion agents such as chitin and glomalin, an insoluble glycoprotein.
3. The thin hyaline layer of the spore wall of Glomus geosporum AMF is composed
mainly of chitin (Sabrana et al. 1995).
4. Chelation of metals inside the fungus. Intracellular precipitation with phosphate
(PO4).
Table 10.4 Elemental content of 14-week-old maize grown in heavy metal-contaminated soil
from Breinigerberg with and without the arbuscular mycorrhizal fungus Glomus intraradices
Sy167. The elemental concentrations in roots and shoots were measured by AAS and are given in
mg/kg of dry weight
Element Shoot (+AMF) Shoot (−AMF) Root (+AMF) Root (−AMF)
Mg 3330 ± 35 5475 ± 30 8750 ± 10 4520 ± 6
Ca 7190 ± 45 30,300 ± 140 26,200 ± 40 21,900 ± 20
Al 30 ± 4 1124 ± 3 2720 ± 4 5500 ± 50
Fe 62 ± 2 820 ± 20 3030 ± 150 5670 ± 150
Zn 830 ± 15 1170 ± 120 4600 ± 200 5900 ± 200
As <3 10 ± 2 <3 40 ± 3
Pb 45 ± 2 200 ± 15 1200 ± 90 1800 ± 60
Data are from Kaldorf et al. (1999)
Standard deviations are for n = 2
However, arbuscular mycorrhizal fungi (AMF), especially Glomus intraradices,

colonized Festuca and Agropyron species that have shown higher heavy metal (Zn,
Cd, As and Se) content. As for hyperaccumulators, fungi can synthesize cysteine-
rich metal-binding proteins called metallothioneins (Gadd and White 1989).
Mycorrhiza might therefore be directly implicated in heavy metal hyperaccumula-
tion in plants. Maize colonized by Glomus intraradices has considerably smaller
amounts of heavy metals in both its roots and its shoots than non-AMF controls
(Table 10.3). In contrast, essential elements like P, Mg2+ and Ca2+ are enriched in
the roots of AMF-colonized plants, as shown by atomic absorption spectrometry.
This is in contrast to Fe, Zn, Pb and also other toxic elements such as Al and As. The
location of the heavy metals in plant tissues can be demonstrated by biophysical
techniques such as EDXA, SIMS or LAMMA (Kaldorf et al. 1999) (Table 10.4).
10.7 Future Perspective
Since the concepts of “rhizosphere” and “mycorrhizosphere” were coined, it has

been recognized that microbial populations may vary in different fractions of soil
and in the various zones of the rhizosphere and the mycorrhizosphere. A large pro-
portion of mycorrhizosphere bacteria remains unculturable, and it is therefore dif-
ficult to assess the microbial diversity in the mycorrhizosphere and the relative
contribution of unculturable microorganisms to the interactions in the mycorrhizo-
sphere. AM fungi themselves cannot be grown in pure culture, but root organ cul-
tures are routinely used to culture AM fungi in vitro and can be used for investigating
the interactions of AM fungi with their biotic and abiotic environment (Filion et al.
1999). Although the composition of microbial communities in the various parts of
the mycorrhizosphere in different ecosystems has been described and discussed in
many papers, the underlying mechanisms behind the interactions are still poorly
known. Protein identification is strongly dependent on gene and protein sequences
available in databases, and the constant increase in the number of sequenced

genomes in the past decade, together with improvement of mass spectrometry tech-
nology, has helped scientists to obtain more reliable data. Novel MS/MS techniques
developed in the past few years in other research fields could also be applied to
investigate plant-fungus symbiotic interactions. For example, selected reaction
monitoring (SRM) is a targeted MS technique used to complement untargeted shot-
gun methods.
SRM is used to measure across multiple samples – in a consistent, reproducible
and quantitatively precise manner – a set of candidate proteins involved in a
particular cellular process (Picotti and Aebersold 2012). However, methodological
advances have greatly improved the monitoring of the fate and behaviour of
microorganisms in both natural and artificial systems. An intriguing field of research
that needs to be further explored is the role of cell-to-cell interactions of
microorganisms. Mycorrhizal fungi mobilize P and N and are an important C sink
in the soil, having therefore an important impact on the cycling of these elements
(Klironomos 2005). As biofertilizers, they may counteract fertilization excess and
thus promote sustainable agriculture. The selection of new crop varieties giving
yields on poor soils and in low fertilization conditions should therefore consider
new aspects, such as their responsiveness to mycorrhizal fungi, which has never
consciously been taken into account during plant domestication (Sawers et al.
2008). If the promises of mycorrhizal research are easy to catalogue, many
constraints related to the biology of mycorrhizal fungi still limit their fulfilment.
Identification of the signalling molecules released by AM and EM fungi is a first
necessity. Although the potential Myc factor from AMs is currently under
investigation (Bucher et al. 2009), on the basis of potential similarities with the Nod
factor, the production of similar molecules did not emerge from the genomes of EM
fungi; rather, there is evidence of the presence of small secreted proteins. Once
these basic biological questions have answers, we will be ready to exploit the
mycorrhizal fungal community hidden in the soil but quietly benefiting plants and
humans. Studying the spatiotemporal stability of such fungal associations would
provide more information on this potential and improve our understanding of
microbial interactions, which may be important for the development of sustainable
management of soil fertility and crop production.
10.8 Conclusions
Mycorrhizal fungi are now known to provide a wide range of significant benefits to
their plant hosts. In addition to enhancing mineral nutrition, they induce greater
resistance to soil pathogens, enhance tolerance to drought stress and reduce
sensitivity to toxic substances occurring in the soil. Mycorrhizal colonization in
plant root improves mineral nutrient uptake and plant growth. Macronutrient
concentration and uptake as well as micronutrient concentration may be an efficient
strategy to utilize environment-friendly biofertilizer instead of chemical fertilizer.
AMF play important roles in agroecosystems, including the involvement of the

extraradical mycelium in providing soil aggregation. GRSP has been shown to be
correlated with soil aggregate water stability. Many efforts have been made in recent
years to accrue benefits from mycorrhizae for agriculture, horticulture, forestry and
site remediation. The results have been consistently positive, with some difficulties
due to complications from diverse variables under field conditions. Mycorrhizal
interactions between plants, fungi and the environment are complex and often
inseparable. Proteomic techniques will be powerful tools to unravel the molecular
component involved in plant-mycorrhizal fungal interactions. Mycorrhizae are an
essential belowground component in the establishment and sustainability of plant
communities, but thorough knowledge is required to achieve maximum benefits
from these microorganisms and their associations.
Acknowledgement The authors thank the Head of Soil Biology Division, IISS, Bhopal, Dr. MC
Manna for spending his valuable time for review.
References
https://doi.org/10.1007/978-81-322-2776-2_21
Antoninka A, Reich PB, Johnson NC (2011) Seven years of carbon dioxide enrichment, nitrogen
fertilization and plant diversity influence arbuscular mycorrhizal fungi in a grassland ecosys-
tem. New Phytol 192:200–214
Atkinson D, Berta G, Hooker JE (1994) Impact of mycorrhizal colonisation on root architec-
ture, root longevity and the formation of growth regulators. In: Gianinazzi S, Schüepp H
(eds) Impact of arbuscular mycorrhizas on sustainable agriculture and natural ecosystems.
Birkhäuser, Basel, pp 89–99
Asghari HR, Cavagnaro TR (2011) Arbuscular mycorrhizas enhance plant interception of leached
nutrients. Funct Plant Biol 38(3):219
Azcon R, Gomes M, Tobart R (1996) Physiological and nutritional responses by Lactuca sativa
L. to nitrogen sources and mycorrhizal fungi under drought stress conditions. Biol Fertil Soils
22:156–161
451.2016.1219431
Bonfante P, Genre A (2010) Mechanisms underlying beneficial plant- fungus interactions in
mycorrhizal symbiosis. Nat Commun 1:48. https://doi.org/10.1038/ncomms1046
Bucher M, Wegmüller S, Drissner D (2009) Chasing the structures of small molecules in arbuscu-
lar mycorrhizal signaling. Curr Opin Plant Biol 12:500–507
Budi SW, van Tuinen D, Martinotti G, Gianinazzi S (1999) Isolation from the Sorghum bicolor
mycorrhizosphere of a bacterium compatible with arbuscular mycorrhiza development and
antagonistic towards soil borne fungal pathogens. Appl Environ Microbiol 65:5148–5150
Carpenter-Boggs L, Loynachan TE, Stahl PD (1995) Spore germination of Gigaspora margarita
stimulated by volatiles of soil-isolated actinomycetes. Soil Biol Biochem 27:1445–1451
org/10.1007/978-81-322-2776-2_20
pp 77–98. https://doi.org/10.1007/978-81-322-2776-2_6
org/10.1007/978-81-322-2776-2_19
Filion M, St-Arnaud M, Fortin JA (1999) Direct interaction between the arbuscular mycor-
rhizal fungus Glomus intraradices and different rhizosphere microorganisms. New Phytol
141:525–533
Gadd GM, White C (1989) Heavy metal and radionuclide accumulation and toxicity in fungi and
yeasts, the Society for General. Microbiology 26:19–38
Garbaye J (1994) Helper bacteria-a new dimension to the mycorrhizal symbiosis. New Phytol
128:197–210
Gianinazzi-Pearson V, Gollotte A, Dumas-Gaudot E, Franken P, Gianinazzi S (1994) Gene expres-
sion and molecular modifications associated with plant responses to infection by arbuscular
mycorrhizal fungi. In: Daniels M, Downic JA, Osbourn AE (eds) Advances in molecular genet-
ics of plant-microbe interactions. Kluwer, Dordrecht, pp 179–186
Gonzalez-CC JD, Vangronsveld J, Dodd JC (2002) Copper sorption and accumulation by the extr-
aradical mycelium of different Glomus spp. (arbuscular mycorrhizal fungi) isolated from the
same polluted soil. Plant Soil 240:287–297
9(2):1211–1221
Jiang W, Gou G, Ding Y (2013) Influences of arbuscular mycorrhizal fungi on growth and mineral
element absorption of chenglu hybrid bamboo seedlings. Pak J Bot 45(1):303–310
Johansson JF, Paul LR, Finlay RD (2004) Microbial interactions in the mycorrhizosphere and their
significance for sustainable agriculture. FEMS Microbiol Ecol 48:1–13
Kaldorf MO, Kuhn AJ, Schroder WH, Hildebrandt U, Bothe H (1999) Selective element depositsin
maize colonized by a heavy metal tolerance conferring arbuscular mycorrhizal fungus. J Plant
Physiol 154:718–728
Kapoor R, Mukerji KG (1998) Microbial interactions in mycorrhizosphere of Anethum graveolens
L. Phytomorphology 48:383–389
Klironomos JN (2005) Abrupt rise in atmospheric CO2 overestimates community response in a
model plant-soil system. Nature 433:621–624
https://doi.org/10.1007/s00344-016-9663-5
Li M, Jordan NR, Koide RT, Yannarell AC, Davis AS (2016) Meta-analysis of crop and weed
growth responses to arbuscular mycorrhizal fungi: implications for integrated weed manage-
ment. Weed Sci 64:642–652
Linderman RG (1994) Role of VAM fungi in biocontrol. In: Pfleger FL, Linderman RG (eds)
Mycorrhizae and plant health. APS, St Paul, pp 1–26
Liu A, Hamel C, Elmi A, Costa C, Ma B, Smith DL (2002) Concentrations of K, Ca and Mg
in maize colonized by arbuscular mycorrhizal fungi under field conditions. Can J Soil Sci
82(3):271–278
Marco C, Silvia P, Raffaella B (2015) Symbiotic proteomics-state of the art in plant-mycorrhizal
fungi interactions on recent advances in proteomics research, Intech Open Science open minds
(book chapter 4)
https://doi.org/10.1007/978-81-322-2776-2_10
jclepro.2015.04.044
Muchovej RM (2001) Former extension specialist Southwest Florida Research and Education
Center SS-AGR-170, Agronomy Department, Florida Cooperative Extension Service, Institute
of Food and Agricultural Sciences, University of Florida
Nangyal H, Zohra T, Shinwari JK (2016) Morphopathological changes induced by root knot nema-
todes in luffa plant (Luffa cylindrica L.) and their alleviation by vesicular arbuscular mycor-
rhizae fungi. Am-Eurasian J Agric Environ Sci 16(1):198–203
Newsham KK, Fitter AH, Watkinson AR (1995) Arbuscular mycorrhiza protect an annual grass
from root pathogenic fungi in the field. J Ecol 83(6):991
Nichols KA, Wright SF (2004) Contributions of soil fungi to organic matter in agricultural soils.
In: Magdoff F, Weil R (eds) Functions and management of soil organic matter in agroecosys-
tems. CRC, Washington, DC, pp 179–198
Picotti P, Aebersold R (2012) Selected reaction monitoring based proteomics: workflows, poten-
tial, pitfalls and future directions. Nat Methods 9:555–566
Preger AC, Rillig MC, Johns AR, Du Preez CC, Lobe I, Amelung W (2007) Losses of glomalin-
related soil protein under prolonged arable cropping: a chronosequence study in sandy soils of
the South African Highveld. Soil Biol Biochem 39:445–453
org/10.1007/978-81-322-2776-2_4
Rillig MC (2004) Arbuscular mycorrhizae, glomalin, and soil aggregation. Can J Soil Sci
84:355–363
Rillig MC, Mummey DL (2006) Tansley review-mycorrhizas and soil structure. New Phytol
171:41–53
Rillig MC, Caldwell BA, Wosten HAB, Sollins P (2007) Role of protein in soil carbon and nitro-
gen storage: controls on persistence. Biogeochemistry 85:25–44
Roldan A, Salinas-Gracia JR, Alguacil MM, Caravaca F (2007) Soil sustainability indicators fol-
lowing conservation tillage practices under subtropical maize and bean crops. Soil Tillage Res
93:273–282
Ross JP (1980) Effect of nontreated soil on sporulation of vesicular-arbuscular mycorrhizal fungi
associated with soybean. Phytopathology 70:1200–1205
Sabrana C, Avio L, Giovannetti M (1995) The occurrence of calcofluor and lectin binding polysac-
charides in the outer wall of arbuscular mycorrhizal fungal spores. Mycol Res 99:1249–1252
pp 127–136. https://doi.org/10.1007/978-81-322-2776-2_9
Saha M, Maurya BR, Meena VS, Bahadur I, Kumar A (2016b) Identification and characteriza-
tion of potassium solubilizing bacteria (KSB) from Indo-Gangetic Plains of India. Biocatalysis
Agric Biotechnol 7:202–209
Sawers RJ, Gutjahr C, Paszkowski U (2008) Cereal mycorrhiza: an ancient symbiosis in modern
agriculture. Trends Plant Sci 13:93–97
Schreiner RP, Mihara KL, McDaniel H, Bethlenfalvay GJ (1997) Mycorrhizal fungi influence
plant and soil functions and interactions. Plant Soil 188:199–209
Smith GS (1987) Interactions of nematodes with mycorrhizal fungi. In: Veech JA, Dickon DW
(eds) Vistas on nematology. Society of Nematology, Hyattsville, pp 292–300
Steinberg PD, Rillig MC (2003) Differential decomposition of arbuscular mycorrhizal fungal
hyphae and glomalin. Soil Biol Biochem 35:191–194
Sundram S, Meon S, Seman IA, Othman R (2015) Application of arbuscular mycorrhizal fungi
with Pseudomonas aeruginosa UPMP3 reduces the development of Ganoderma basal stem rot
disease in oil palm seedlings. Mycorrhiza 5:387–397
Tabassum Y, Tanvir B, Farrukh H (2011) Effect of arbuscular mycorrhizal inoculation on nutri-

ent uptake, growth and productivity of cowpea (Vigna unguiculata) varieties. Afr J Biotechnol
10(43):8593–8598
Tommerup IC (1985) Inhibition of spore germination of vesicular-arbuscular mycorrhizal fungi in
soil. Trans Br Mycol Soc 85:267–278
Velazquez E, Silva LR, Ramírez-Bahena MH, Peix A (2016) Diversity of potassium-solubiliz-
ing microorganisms and their interactions with plants. In: Meena VS, Maurya BR, Verma JP,
84(8):914–919
Wilson GWT, Hetrick BAD, Kitt DG (1988) Suppression of mycorrhizal growth-response of big
bluestem by nonsterile soil. Mycologia 80:338–343
Wright SF, Upadhyaya A (1996) Extraction of an abundant and unusual protein from soil and com-
parison with hyphal protein of arbuscular mycorrhizal fungi. Plant Soil 198:97–107
Wright SF, Upadhyaya A (1998) A survey of soils for aggregate stability and glomalin, a glycopro-
tein produced by hyphae of arbuscular mycorrhizal fungi. Soil Sci 16:575–586
org/10.1007/978-81-322-2776-2_14
org/10.1007/978-81-322-2776-2_12
org/10.1007/978-81-322-2776-2_3
Chapter 11
Using Mycorrhiza Helper Microorganisms
(MHM) to Improve the Mycorrhizal
Efficiency on Plant Growth
A. Lies, A. Delteil, Y. Prin, and R. Duponnois
Abstract In the context of the “New Green Revolution,” innovative agricultural

practices have to be identified to sustainably improve the traditional cultural
approaches already used in the green revolution and to apply efficient technologies
to solve actual agricultural problems (more particularly in the developing countries)
but without the use of chemical pesticides and fertilizers. To reach this objective,
soil microbes represent a largely unexplored resource to promote agricultural yield
and productivity in the context of sustainable farming practices. Among these ben-
eficial microorganisms, arbuscular mycorrhizal fungi (AMF) form symbiotic asso-
ciation with ~80% of vascular plant species. These efficient symbionts are considered
as a key group of soil microorganisms able to improve P uptake by plants. In addi-
tion, AMF have the potential to improve plant defense against plant pathogens and
to promote plant tolerance against abiotic stresses. AMF are primary biotic soil
components which, when missing or impoverished, e.g., due to anthropic input, can
lead to a less efficient ecosystem functioning. Many environmental factors can
affect the impact of AMF inoculation on the plant growth including the fungal spe-
cies compatibility with soil characteristics and the interactions between the fungal
inoculant and other soil microorganisms. Some microorganisms, named mycorrhiza
helper bacteria (MHB), can facilitate the establishment and the functioning of the
AMF symbiosis by stimulating spore germination, mycelial growth, root coloniza-
A. Lies
Agronutrition, Parc Activestre, Carbonne, France
A. Delteil
Arysta Life Science, Parc Technopolitain Atalante, Saint-Malo Cedex, France
Y. Prin
CIRAD, UMR LSTM, Montpellier, France
R. Duponnois (*)
e-mail: robin.duponnois@ird.fr

https://doi.org/10.1007/978-981-10-8402-7_11
278 A. Lies et al.
tion, or sporulation but also by reducing stresses that could impact AMF symbiosis.
The aim of this chapter is to review mechanisms implemented by MHB to promote
the AMF establishment and to enhance the efficiency of the mycorrhizal effect on
the plant growth.
Keywords Mycorrhizal symbiosis · Rhizosphere microorganisms · Mycorrhiza

helper microorganisms
11.1 Introduction
Agricultural productivity has been drastically increased since the middle of the
twentieth century with the “Green Revolution” to ensuring food security of an
increasing world population (Godfray et al. 2010). This enhanced crop production
was associated with intensive uses of machinery, fertilizers, and pesticides. However,
environmental degradations resulting from intensive application of agrochemicals
(fertilizers, pesticides) are increasingly widespread (Plenchette et al. 2005) leading
to the concept of “the New Green Revolution.” In this context, new agricultural
practices have been proposed to sustainably improve the cultural approaches already
used in the Green Revolution and apply existing technologies to solve actual agri-
cultural problems (more particularly in the developing countries) but without the
use of chemical pesticides and fertilizers (Meena et al. 2013a; Bahadur et al. 2014;
Maurya et al. 2014; Jat et al. 2015; Kumar et al. 2015, 2016b; Ahmad et al. 2016).
To reach this objective, soil microbes represent a largely unexplored resource to
promote agricultural yield and productivity in the context of sustainable farming
practices (Orrell and Bennett 2013). Many microbial interactions are involved in key
environmental processes, such as phosphorus (P), nitrogen (N), and carbon (C) bio-
chemical cycles, plant health, and soil quality. Inside the soil, the rhizosphere has
been defined as a volume of soil under influence of roots and its activity (exudation,
excretion, etc.) (Dessaux et al. 2009) where microorganisms and biological processes
are important for the plant growth and health (Hiltner 1904). Numerous studies have
reported that soil compartment that harbors these microbial interactions and activi-
ties is essential for plant development through its impact on plant nutrient uptake and
its protection against plant pathogens (Hartmann et al. 2008; Berendsen et al. 2012).
Among these beneficial microorganisms, arbuscular mycorrhizal fungi (AMF)
are able to establish a symbiotic interaction with the root organs of more than 80%
of plant families (Trappe 1987; Smith and Read 2008). Despite the widespread dis-
tribution of AMF in several ecosystems, less than 250 species have been described
to date (Öpik et al. 2013). AMF are considered as a key group of soil microorgan-
isms able to improve P uptake by plants (Thingstrup et al. 2000); phosphorus is
among the most limiting nutrient in the soil but one of the most essential to increase
crop yields (Tilman et al. 2002). In 2010, ~13 tons of phosphate fertilizers were
used per 1000 ha to crop production in Europe (FAO 2015). In addition, AMF have
11 Using Mycorrhiza Helper Microorganisms (MHM) to Improve the Mycorrhizal… 279
the potential to improve plant defense against plant pathogens and to promote plant
tolerance against abiotic stresses (Newsham et al. 1995; Celebi et al. 2010). AMF
are primary biotic soil components which, when missing or impoverished, e.g., due
to anthropic input, can lead to a less efficient ecosystem functioning (Meena et al.
2016a, b; Parewa et al. 2014; Prakash and Verma 2016; Jaiswal et al. 2016; Jha and
Subramanian 2016; Kumar et al. 2016a). The process of reestablishing the natural
level of AMF richness can represent a promising alternative to conventional fertil-
ization practices, with a view to sustainable agriculture (Berruti et al. 2015). The
success of this association is related to the soil receptiveness; in case of AMF, it is
the capacity to maintain AMF population and soil mycorrhizal infectivity (Duvert
et al. 1990; Duponnois et al. 2005).
Many factors can affect the success of inoculation and AMF persistence in soil,
including the species compatibility with the environment (abiotic factors) (Wang
et al. 2008; Lenoir et al. 2016), the competition with other soil organisms (biotic
factors) (Barea et al. 2005; Bais et al. 2006; Frey-Klett et al. 2007), and the timing
of inoculation (Liu et al. 2009; Zangaro et al. 2013). It is important to take these
factors into account in order to avoid failure in the AMF inoculation process. Among
the biotic factors, microorganisms can act positively on soil receptivity as MHB
(Duponnois and Plenchette 2003; Singh et al. 2013) but can also promote mutualis-
tic inhibition or negative impact on AMF (Green et al. 1999; Ravnskov et al. 2006).
These biotic factors can promote the establishment of AMF by stimulating spore
germination, mycelial growth, root colonization, or sporulation but also by reducing
stresses that could impact AMF symbiosis (Frey-Klett et al. 2007). The aim of this
chapter is to review mechanisms implemented by soil microorganisms (bacteria and
fungi) to promote the AMF establishment and, consequently, to enhance the sustain-
ability and efficiency of the mycorrhizal effect on the plant growth (Priyadharsini
and Muthukumar 2016; Kumar et al. 2017; Meena et al. 2015a, b, 2016c;
Raghavendra et al. 2016; Zahedi 2016; Rawat et al. 2016; Yasin et al. 2016).
11.2 Soil Bacteria
In the rhizosphere, some soil bacteria can interfere with the establishment of mycor-
rhizal symbioses. These bacteria known to stimulate mycelial growth of AMF and/
or to enhance mycorrhizal formation have been named “mycorrhiza helper bacte-
ria” (MHB) (Garbaye 1994). These bacteria are able to produce plant hormones,
which can influence AM establishment as well as spore germination and hyphal
growth (Barea et al. 2005). They can also produce compounds that stimulate root
exudates, resulting in the activation of AM hyphae and hence higher rate of mycor-
rhizal root colonization (Barea et al. 2005; Saha et al. 2016a, b; Yadav and Sidhu
2016; Meena et al. 2014a, 2015f, 2016d; Verma et al. 2014, 2015b; Sharma et al.
2016; Dotaniya et al. 2016). These MHB belongs to Firmicutes (mainly Bacillus
and Paenibacillus), Actinobacteria (mainly Streptomyces), α-Proteobacteria
(mainly Azospirillum, Bradyrhizobium, and Rhizobium), β-Proteobacteria
280 A. Lies et al.
(Burkholderia), and γ-Proteobacteria (Azotobacter, Klebsiella, and Pseudomonas)

(Table 11.1).
11.2.1 MHB Impact on Spore Germination
MHB like Bacillus pabuli are known to be naturally associated with spores of AMF
(Xavier and Germida 2003; Selvakumar et al. 2016), and spore germination seems
greatly reduced by surface disinfection (Mayo et al. 1986). The stimulation of spore
germination may involve volatile (Mugnier and Mosse 1987; Carpenter-Boggs et al.
1995) or nonvolatile compounds (Xavier and Germida 2003; Azcón 1987). For
example, Xavier and Germida (2003) and Mayo et al. (1986) showed that spores of
Rhizophagus clarus and Glomus versiforme must be in contact with diffusible
metabolites released by spore-associated bacteria to enhance germination from 1.5-
to 2.2-fold. This observation suggests a possible molecular dialogue (ligand-receptor
binding) between both microbes. In contrast, Mugnier and Mosse (1987) found that
a volatile substance produce by Streptomyces orientalis stimulated the germination
of Funneliformis mosseae. Also, Carpenter-Boggs et al. (1995) observed a positive
correlation between high germination rates and the presence of volatile compounds
as geosmin, CO2, and 2-methylisoborneol, produced by Streptomyces orientalis.
Atmospheric CO2 concentration has already been shown to stimulate germination
and hyphal growth of AMF, but could be deleterious at higher concentrations
(Bécard and Piché 1989). Another possible effect is that bacteria, associated with
the spore wall of AMF, erode spore hyaline layer, facilitating spore germination
(Roesti et al. 2005). Hyaline layer is mainly composed of chitin, a straight chain
polymer of N-acetyl glucosamine (Sbrana et al. 1995).
11.2.2 MHB Impact on Mycelial Growth
Mycelial growth is another parameter widely used to measure the MHB effects. A
significant correlation has been shown between the increase of mycelial growth and
mycorrhiza establishment (Gryndler and Vosatka 1996). Many studies demonstrated
that bacteria have a positive effect on the mycelial growth (Bidondo et al. 2011;
Sundram et al. 2011). For instance, the development of hyphae of Funneliformis
mosseae was 12 times faster in the presence of P. fluorescens (Pivato et al. 2008). P.
putida or the low-molecular-weight fraction of the bacterial culture supernatant
(MW <10,000) can increase the hyphal growth rate of G. fistulosum (Vosátka and
Gryndler 1999). This fraction can contain many metabolites like plant growth regu-
lators or vitamins. More specifically, Azcón et al. (1978) have shown that plant
hormone like IAA can promote AM development, but this effect was dependent on
the IAA concentration since higher IAA concentrations can also suppress hyphal
Table 11.1 Summary of the main studies reporting the impact of mycorrhiza helper microorganisms on AMF developmental steps. All species have been
named according to the current classification
Species AMF species Effects Plant Conditions References
Bacteria
Gram +, low G + C
Bacillus cereus Indigenous AMF ↑r.c. Trifolium repens Greenhouse – soil/sand 1:1 + Azcón et al. (2010)
heavy metals
Bacillus coagulans Funneliformis mosseae ↑r.c. Carica papaya Field – level P 50% Mamatha et al. (2002)
Funneliformis caledonium
Bacillus mycoides Indigenous AMF ↑r.c., ↑s. Herbaceous plants Greenhouse – soil von Alten et al. (1993)
Bacillus pabuli Rhizophagus clarus ↑s.g. W/O In vitro Xavier and Germida
(2003)
Bacillus polymyxa Glomus aggregatum ↑r.c., ↑s. Cymbopogon Greenhouse – soil sterilized + Ratti et al. (2001)
martinii TCP
Bacillus subtilis Rhizophagus intraradices ↑r.c. Allium cepa Greenhouse – soil + RP Toro et al. (1997)
Bacillus thuringiensis Rhizophagus intraradices ↑r.c. Retama Greenhouse – soil/sand 1:1, Marulanda et al.
sphaerocarpa sterilized (2006)
Bacillus sp. Funneliformis mosseae ↑r.c. Lactuca sativa GC – sand/vermiculite/sepiolite Vivas et al. (2003)
Rhizophagus intraradices (1:1:1) sterilized + PEG
Exiguobacterium Rhizophagus fasciculatus ↑r.c., ↑s. Mentha arvensis Greenhouse – soil sterilized + Bharti et al. (2016a)
oxidotolerans Rhizophagus intraradices NaCl
Glomus aggregatum
Paenibacillus rhizosphaerae Rhizophagus intraradices ↑r.c., ↑s., W/O Glycine max In vitro greenhouse – perlite/ Bidondo et al. (2011)
↑f.g. vermiculite/soil (1:1:1) sterilized
Paenibacillus validus Rhizophagus intraradices ↑f.g. W/O In vitro Hildebrandt et al.
(2002), 2006)
11 Using Mycorrhiza Helper Microorganisms (MHM) to Improve the Mycorrhizal…
Paenibacillus sp. Funneliformis mosseae ↑r.c. Solanum GC – soil/calcined clay (1:1) Budi et al. (1999)
lycopersicum sterilized + root disease
(continued)
281
282

Gram +, high G+C
Arthrobacter protophormiae Funneliformis mosseae ↑r.c. Pisum sativum Arthrobacter protophormiae Barnawal et al. (2014)
Corynebacterium sp. Glomus versiforme ↑s.g. W/O In vitro – Bactoagar 1% Mayo et al. (1986)
Dietzia natronolimnaea Rhizophagus intraradices ↑r.c. Ocimum basilicum Greenhouse field – soil sterilized Bharti et al. (2016b)
+ NaCl
Streptomyces coelicolor Rhizophagus intraradices ↑r.c. Sorghum bicolor Greenhouse – soil Abdel-Fattah and
Mohamedin (2000)
Streptomyces orientalis Gigaspora margarita ↑s.g. W/O In vitro – noble agar, volatiles Carpenter-Boggs et al.
(1995)
Streptomyces orientalis Funneliformis mosseae ↑s.g. W/O In vitro Mugnier and Mosse
(1987)
Gram –, α-Proteobacteria
Agrobacterium rhizogenes Rhizophagus intraradices ↑r.c. Hordeum vulgare GC – expanded clay Fester et al. (1999)
Azospirillum brasilense Rhizophagus fasciculatus ↑r.c., ↑f.g Sorghum bicolor Greenhouse – soil sterilized Pacovsky et al. (1985)
GC – sand/perlite (2:1)
Azospirillum brasilense Gigaspora margarita ↑r.c. Pennisetum Greenhouse – soil Rao et al. (1985)
americanum
Azospirillum brasilense Glomus aggregatum ↑r.c., ↑s. Cymbopogon Greenhouse – soil sterilized + Ratti et al. (2001)
martinii TCP
Azospirillum sp. Funneliformis mosseae ↑r.c., ↑s. Chloris gayana Greenhouse – soil/sand (3:1) Bhowmik and Singh
sterilized (2004)
Bradyrhizobium japonicum Funneliformis mosseae ↑r.c. Glycine max GC – sand/loam 1:1 sterilized Xie et al. (1995)
Bradyrhizobium japonicum Funneliformis mosseae ↑r.c. Glycine max Greenhouse – soil sterilized Meng et al. (2015)
Methylobacterium oryzae Indigenous AMF ↑r.c., ↑s. Capsicum annuum Greenhouse – soil Kim et al. (2010)
Rhizobium leguminosarum Rhizophagus intraradices ↑r.c. Hordeum vulgare GC – expanded clay Fester et al. (1999)
Rhizobium leguminosarum Funneliformis mosseae ↑r.c. Pisum sativum Greenhouse – soil sterilized Barnawal et al. (2014)
A. Lies et al.
Rhizobium sp. Rhizophagus intraradices ↑r.c. Anthyllis cytisoides Greenhouse – soil sterilized Requena et al. (1997)
Funneliformis coronatum
Gram –, β-Proteobacteria
Burkholderia cepacia Rhizophagus intraradices ↑s.g., ↑f.g. W/O In vitro – Bactoagar 1% Sundram et al. (2011)
Rhizophagus clarus
Burkholderiales Funneliformis mosseae ↑s.g., ↑f.g. W/O In vitro – Bactoagar 1% Pivato et al. (2008)
Gram –, γ-Proteobacteria
Azotobacter chroococcum Funneliformis mosseae ↑r.c., ↑s. Chloris gayana Greenhouse – soil/sand (3:1) Bhowmik and Singh
sterilized (2004)
Azotobacter chroococcum Rhizophagus fasciculatus ↑r.c., ↑s. Solanum Greenhouse – sandy loam/soil 5:1 Bagyaraj and Menge
lycopersicon sterilized or not (1978)
Azotobacter diazotrophicus – Rhizophagus clarus ↑r.c. Ipomoea batatas Greenhouse – soil/sand 1:1 Paula et al. (1992)
Klebsiella sp. fumigated or not
Enterobacter sp. Rhizophagus intraradices ↑r.c. Allium cepa Greenhouse – soil + RP Toro et al. (1997)
Klebsiella pneumoniae Glomus deserticola ↑r.c., ↑s.g., W/O Uniola In vitro greenhouse – soil Will and Sylvia (1990)
↑f.g. paniculata sterilized
Pseudomonas aeruginosa Rhizophagus intraradices ↑s.g., ↑f.g. W/O In vitro – Bactoagar 1% Sundram et al. (2011)
Rhizophagus clarus
Pseudomonas fluorescens Rhizophagus intraradices ↑r.c. Hordeum vulgare GC – expanded clay Fester et al. (1999)
Pseudomonas fluorescens Funneliformis mosseae ↑r.c. Solanum GC – quartz sand sterilized Gamalero et al. (2004)
lycopersicon
Pseudomonas fluorescens Funneliformis mosseae ↑r.c., ↑s.g., Root organ cultures In vitro – Bactoagar 1% Pivato et al. (2008)
↑f.g. Lycopersicon Greenhouse – quartz sand
esculentum sterilized
Pseudomonas fluorescens Funneliformis mosseae ↑r.c., ↑s. Chloris gayana Greenhouse – soil/sand (3:1) Bhowmik and Singh
Pseudomonas striata sterilized (2004)
(continued)
283
284

Pseudomonas monteilii Rhizophagus intraradices ↑r.c. Acacia holosericea Greenhouse – soil sterilized Duponnois and
Plenchette (2003)
Pseudomonas monteilii Rhizophagus fasciculatus ↑r.c., ↑s. Coleus forskohlii Field – root diseases Singh et al. (2013)
Pseudomonas putida Indigenous AMF ↑r.c. Trifolium Greenhouse – soil Meyer and Linderman
subterraneum (1986)
Pseudomonas putida Claroideoglomus ↑r.c., ↑f.g. Zea mays – Solanum Greenhouse – vermiculite/sand Vosátka and Gryndler
claroideum tuberosum (5:1) (1999)
Pseudomonas striata Glomus macrocarpum ↑r.c., ↑s. Capsicum annuum Greenhouse– soil + RP Sreenivasa and
Rhizophagus fasciculatus Krishnaraj (1992)
Pseudomonas sp. Endogone sp. ↑r.c. Trifolium GC – Jensen’s medium Mosse (1962)
parviflorum
Pseudomonas sp. Glomus versiforme ↑s.g. W/O In vitro – Bactoagar 1% Mayo et al. (1986)
Pseudomonas sp. Funneliformis mosseae ↑r.c., ↑f.g W/O Solanum In vitro – Bactoagar 0.8% Barea et al. (1998)
lycopersicon Greenhouse– soil
Pseudomonas sp. Indigenous AMF ↑r.c. Triticum aestivum Field – with TPR or DAP Babana and Antoun
(2005)
Pseudomonas sp. Rhizophagus irregularis ↑r.c. Solanum tuberosum GC – soil + RP Ordoñez et al. (2016)
Fungus
Yeast
Candida parapsilosis Indigenous AMF ↑r.c. Trifolium repens Greenhouse – soil/sand 1:1 + HM Azcón et al. (2010)
Saccharomyces cerevisiae Indigenous AMF ↑r.c., ↑s. Fabaceae Greenhouse – soil Singh et al. (1991)
Saccharomyces cerevisiae Funneliformis mosseae ↑r.c., ↑s. Chloris gayana Greenhouse – soil/sand (3:1) Bhowmik and Singh
sterilized (2004)
Rhodotorula mucilaginosa Funneliformis mosseae ↑r.c., ↑s.g., W/O Glycine max In vitro greenhouse – soil/perlite Sampedro et al. (2004)
Cryptococcus laurentii ↑f.g. (1:1) sterilized
Saccharomyces kunashirensis
A. Lies et al.
Rhodotorula mucilaginosa Funneliformis mosseae, ↑f.g., ↑r.c. W/O Glycine max In vitro greenhouse – soil/perlite Fracchia et al. (2003)
Gigaspora rosea Trifolium pratense (1:1) sterilized
Debaryomyces occidentalis Funneliformis mosseae ↑r.c., ↑s. Vigna unguiculata Greenhouse – soil Boby et al. (2008)
Metschnikowia pulcherrima
Saccharomyces cerevisiae
Cryptococcus laurentii
Rhodotorula mucilaginosa
Trichosporon cutaneum
Yarrowia lipolytica Glomus deserticola ↑r.c. Solanum Greenhouse – soil sterilized + RP Vassilev et al. (2001)
lycopersicum
Filamentous
Aspergillus niger Funneliformis mosseae, ↑r.c., ↑f.g. W/O Glycine max In vitro greenhouse – soil/perlite Fracchia et al. (2004)
Gigaspora rosea (1:1)
Drechslera sp. Gigaspora rosea ↑f.g. W/O In vitro Scervino et al. (2009)
Phomopsis columnaris Indigenous AMF ↑r.c. Sorghum vulgare Greenhouse – soil Vaz et al. (2012)
Phoma schachtii
Bionectria ochroleuca
Eucasphaeria sp.
Cylindrocarpon
paucisepatatum
Talaromyces flavus Gigaspora rosea ↑r.c., ↑f.g. W/O Triticum In vitro greenhouse – soil/perlite Della Mónica et al.
aestivum (2:1) sterilized +TCP (2014)
s.g., spore germination; r.c., root colonization; s., sporulation; f.g., fungal growth. RP, rock phosphate; TCP, tricalcium phosphate; GC, growth chamber
285
286 A. Lies et al.
growth (Gryndler et al. 1998). In contest, although Bidondo et al. (2011) observed
no effects of different IAA concentrations on the growth of Rhizophagus intraradi-
ces, they observed that Paenibacillus sp., a bacterial strain that produces IAA, was
able to promote the hyphal growth of this AMF. These results could indicate that the
interaction between R. intraradices and Paenibacillus strains could not only be
related to the production of indole compounds by the bacteria (Verma et al. 2015a;
Meena et al. 2013b, 2014b, 2015c; Shrivastava et al. 2016; Velazquez et al. 2016;
Sindhu et al. 2016; Das and Pradhan 2016; Dominguez-Nunez et al. 2016).
11.2.3 MHB Impact on AMF Sporulation
The natural sporulation is delayed in the development of mycorrhizal plants, at the

stage of seed ripening (Hayman 1970). Many rhizobacteria have shown a positive
effect on sporulation, like Methylobacterium oryzae on indigenous AMF in
Capsicum annuum (Kim et al. 2010) increasing nearly fourfold the spore density
and Bacillus polymyxa with G. aggregatum in Cymbopogon martinii that enhances
the spore number twofold (Ratti et al. 2001). Von Alten et al. (1993) have shown that
Bacillus mycoides can increase sporulation in soil in greenhouse conditions but only
with one fungal isolate among indigenous AMF. It suggests the existence of speci-
ficity of interaction between bacteria and AMF (Masood and Bano 2016; Meena
et al. 2015e, 2016e; Teotia et al. 2016). Thus, application of bacteria in the field may
alter the AMF population.
Another study shows that Paenibacillus validus is able to induce mycelial growth
up to new spore formation, in the absence of host root under in vitro conditions
(Hildebrandt et al. 2002). This unexpected stimulation seems related with sugar pro-
duction as raffinose (Hildebrandt et al. 2006).
11.2.4 MHB Impact on AMF Root Colonization
MHB could affect AMF colonization at different levels (molecular and physiologi-
cal levels). Colonization of roots by AMF can be facilitated by molecules interfering
in the molecular dialogue between the fungal symbionts and the roots of host plants.
Xie et al. (1995) have demonstrated that Bradyrhizobium japonicum produces Nod
factors that stimulated flavonoid production by Glycine max resulting in an enhance-
ment of root mycorrhizal colonization (Meena et al. 2017). Flavonoids and Nod
factors could act as fungal growth regulators or mimic related unknown signal mol-
ecules from AMF. At a different level, some bacteria indirectly help the AMF root
penetration by modifying root cell wall permeability. Azospirillum brasilense pro-
duces pectolytic enzymes that soften root cell walls in the soil (Umali-Garcia et al.
1980; Budi et al. 2012). This mechanism was suggested by Mosse (1962) during the
interaction between Endogone sp. and Pseudomonas sp. Low concentrations of a
sterile pectolytic/cellulolytic enzyme preparation or sterile bacterial filtrates were

equally effective for their promoting effect on the AMF root infection. The modifi-
cation of the root development is also another way to promote AMF colonization.
Some rhizobacteria can increase the number of penetration entries for the AMF
hyphae by stimulating root branching and indirectly promote AMF establishment
(Barea et al. 2002; Gamalero et al. 2004).
11.2.5 MHB and Plant Stress Reduction
MHB can reduce soil-mediated stresses inhibiting fungal growth and so increase the
establishment of AMF. Stresses may be due to environmental causes (abiotic fac-
tors) or the presence of microorganisms that could affect host plant or AMF (biotic
factors). Among abiotic stresses, Vivas et al. (2003) have observed that co-
inoculation of Bacillus sp. and Glomus sp. can improve the formation and function
of AM symbiosis under drought condition. Likewise, the presence of Brevibacillus
brevis increases spore germination, presymbiotic fungal growth, and mycorrhiza
formation under toxic concentrations of heavy metals. These effects are due to Cd
bioaccumulation ability of B. brevis that reduces the Cd damage on AMF (Vivas
et al. 2005). Azcón et al. (2010) hypothesized that Bacillus cereus can reduce dam-
age to AMF by sequestering Fe and Cd, leading to an increased root colonization of
indigenous AMF.
Another abiotic stress concerns the salt stress that increases the level of ethylene,
known to be an inhibitor of the AM formation. Arthrobacter sp., producing 1-amin
ocyclopropane-1-carboxylate deaminase (ACC deaminase), can decrease the level
of ethylene. ACC deaminase breaks down ACC, an immediate precursor of ethyl-
ene, to ammonia and α-ketobutyrate, which can be further metabolized by bacteria
for their growth (Barnawal et al. 2014). Potential biotic stresses could be driven by
plant pathogens. Pathogen infections lead to several plant root damages, altering the
interactions between AMF and plant or involving a competition for the root coloni-
zation between AMF and root pathogens. Sundram et al. (2011) have shown that P.
aeruginosa and B. cepacia are antagonistic to the phytopathogenic fungus
Ganoderma boninense but, in contrast, promoted AMF spore germination and
hyphal development. Similar observations were reported between the microbial
associations of Phytophthora parasitica, Paenibacillus sp., and G. mosseae (Budi
et al. 1999). Three antagonistic peptides produced by Paenibacillus sp. have been
determined to be active against several gram-negative and gram-positive bacteria
and pathogenic soilborne fungi (Selim et al. 2005).
Barea et al. (1998) also reported that a Pseudomonas strain producing the anti-
fungal metabolite 2,4-diacetylphloroglucinol (DAPG) stimulated mycorrhizal for-
mation with G. mosseae. Frey-Klett et al. (2007) suggested that MHB could have
evolved with respect to interactive mechanisms with their microbial surroundings,
having neutral or positive effects on the mycorrhizal association but negative effects
on root pathogens that might threaten their habitat (Singh et al. 2013).
288 A. Lies et al.
11.3 Soil Fungi
In the rhizosphere, soil fungi (yeast or filamentous fungi) can interact with AMF
and modify their symbiotic efficiency with the host plant. These fungi can affect
directly AMF or induce plant systemic resistance with positive or negative effect on
the symbiosis (Van Wees et al. 2008) and consequently modify the soil receptivity.
11.3.1 Yeast
Several studies have shown that the use of yeast can improve the development or
establishment of AM symbioses (Table 11.1). These yeasts belong to the taxa
Ascomycota or Basidiomycota. Among Basidiomycota, the most represented are
Tremellaceae, as Cryptococcus laurentii improving root colonization, spore germi-
nation, and fungal growth of G. mosseae in Glycine max (Sampedro et al. 2004) but
also root colonization and sporulation in Vigna unguiculata (Boby et al. 2008).
According to Boby et al. (2008), this effect could result from the production of
vitamin B12. B vitamin uptake by roots promotes root development (Dobbelaere
et al. 2003) and possibly enhances AMF activity. Some substances are considered as
germination modulators, stimulating or inhibiting hyphal length depending on their
concentrations (Bécard and Piché 1989). Also, in greenhouse assays, the effects are
observed only when yeast was inoculated 2 weeks before AMF inoculation (Fracchia
et al. 2003). This indicates that yeast could stimulate the development of the fungus
in its saprophytic stage before the root AMF infection. Also the abundance of yeast
cells impacts their beneficial effect on AM root colonization.
Among Ascomycota, Saccharomyces cerevisiae improve sporulation and root
colonization of Chloris gayana (Bhowmik and Singh 2004) and Vigna unguiculata
(Boby et al. 2008) by Funneliformis mosseae but also of indigenous AMF with
Fabaceae (Singh et al. 1991). According to Bhowmik and Singh (2004), only com-
plete microbial culture (yeast and exudates) has an effect on sporulation and root
colonization, but not on plant growth. Singh et al. (1991) showed that live yeast cells
are more effective than dead cells. A same genus, Candida, can have both a positive
effect on root colonization of Trifolium repens infected with indigenous AMF –
where Candida increases AMF root colonization and the plant capacity to metal
bioaccumulation (Azcón et al. 2010) – and, in parallel, a negative effect on fungal
growth of G. intraradices on Zea mays (Gollner et al. 2006) where the presence of
Candida did not significantly affect mycorrhizal colonization but negatively
impacted the length of the AMF extraradical mycelium.
11.3.2 Filamentous Fungi
All filamentous fungi improving the development or establishment of AMF belong

to the division of Ascomycota (Table 11.1). These fungi are grouped into three
classes, Eurotiomycetes, Sordariomycetes, and Dothideomycetes. Aspergillus niger,
a Eurotiomycetes, increases root colonization and fungal growth of G. mosseae and
Gigaspora rosea in Glycine max (Fracchia et al. 2004). As yeasts, the presence of
filamentous fungi or only their soluble exudates promotes the development of the
fungus in the presymbiotic stage (Della Mónica et al. 2014). Moreover, Della
Mónica et al. (2014) revealed differences in the sensitivity of AMF to other fungi
exudates (McAllister et al. 1995). Drechslera sp., a Dothideomycetes, increases the
fungal growth of Gigaspora rosea in in vitro conditions (Scervino et al. 2009).
Among Sordariomycetes, Phomopsis columnaris promotes root colonization of
indigenous AMF in Sorghum vulgare roots (Vaz et al. 2012), but others decrease
root colonization of R. intraradices in Solanum lycopersicum as Clonostachys rosea
(Ravnskov et al. 2006) by mutual inhibition or on Cucumis sativus as T. harzianum
(Green et al. 1999) by mutual inhibition where T. harzianum could exploit the dead
mycelium but not the living fungal biomass of R. intraradices.
11.4 Nonmicrobial Soil Microorganisms
In the rhizosphere, in addition to microbial soil microorganisms, nonmicrobial soil

microorganisms are also present (Bais et al. 2006). Protozoa, arthropods, and nema-
todes are the most abundant. Soil nematodes negatively interact with AMF as
hyphae feeders and root parasites (Miransari 2011). Soil protozoa are also in inter-
action with AMF species, and Bonkowski et al. (2000) have indicated that AMF
species can positively affect their activities and population. Arthropods selectively
eat fungi, but AMF are not considered to be the preferred food source (Klironomos
and Kendrick 1996). In pot experiments, collembolan decreases AMF infection
(Lussenhop 1996), but conversely, in field experiment they were associated with an
increase of mycorrhizal infection. Thus, these experiments show evidence that
micro-arthropods may influence mycorrhizae (Singh et al. 2015, 2016; Meena et al.
2013c, 2015d; Bahadur et al. 2016a, b).
11.5 Conclusions
In this review, we have shown that to ensure AMF establishment and functioning,
the use of mycorrhiza helper microorganisms like bacteria and fungi could be a
relevant approach to ensure the mycorrhizal effect on plant growth in sustainable
agricultural practices and in rehabilitation programs of disturbed areas (Duponnois
290 A. Lies et al.
et al. 2013). Hence it is important to manage the soil components having positive or
negative effects on AM symbiosis. The worst conditions for AMF establishment
include high soil P fertility, the use of pesticide mainly fungicide, impoverished
(anthropically affected) soil microbial communities, etc. A better management of
soil microbial component through the practical application of ecological principles
based on biodiversity, plant interactions, and natural regulation mechanisms is nec-
essary in the context of the New Green Revolution. In order to provide efficient
AMF inocula, future work has to focus on the inoculation with complex inocula
associating AM fungi and mycorrhiza helper microorganisms. Moreover, the bio-
logical and chemical mechanisms involved in the positive interactions between
some soil microorganisms and AMF have to be elucidated to better manage this
microbial effect on AMF establishment and, consequently, on plant growth.
Acknowledgments The authors thank the companies AGRONUTRITION™ (Labege, France)

and ARYSTA LifeScience™ (Saint-Malo, France) that financially supported this study.
References
Abdel-Fattah GM, Mohamedin AH (2000) Interactions between a vesicular-arbuscular mycorrhi-

zal fungus (Glomus intraradices) and Streptomyces coelicolor and their effects on sorghum
plants grown in soil amended with chitin of brawn scales. Biol Fert Soils 32(5):401–409
https://doi.org/10.1007/978-81-322-2776-2_21
Azcón R (1987) Germination and hyphal growth of Glomus mosseae in vitro: effects of rhizo-
sphere bacteria and cell-free culture media. Soil Biol Biochem 19(4):417–419
Azcón R, Azcón-Aguilar C, Barea JM (1978) Effects of plant hormones present in bacterial cul-
tures on the formation and responses to VA endomycorrhiza. New Phytol 80(2):359–364
Azcón R, del Carmen PM, Roldán A, Barea JM (2010) Arbuscular mycorrhizal fungi, Bacillus
cereus, and Candida parapsilosis from a multicontaminated soil alleviate metal toxicity in
plants. Microb Ecol 59(4):668–677
Babana AH, Antoun H (2005) Biological system for improving the availability of Tilemsi
phosphate rock for wheat (Triticum aestivum L.) cultivated in Mali. Nutr Cycl Agroecosyst
2:147–157
Bagyaraj DJ, Menge JA (1978) Interaction between a VA mycorrhiza and Azotobacter and their
effects on the rhizosphere microflora and plant growth. New Phytol 80(3):567–573
from Indo-Gangetic Plain of India. Geomicrobiol J 34:454–466. https://doi.org/10.1080/0149
0451.2016.1219431
Bais HP, Weir TL, Perry LG, Gilroy S, Vivanco JM (2006) The role of root exudates in rhizosphere
interactions with plants and other organisms. Ann Rev Plant Biol 57(1):233–266
Barea JM, Andrade G, Bianciotto V, Dowling D, Lohrke S, Bonfante P, O’Gara F, Azcon-Aguilar C
(1998) Impact on arbuscular mycorrhiza formation of Pseudomonas strains used as inoculants
for biocontrol of soil-borne fungal plant pathogens. Appl Environ Microbiol 64(6):2304–2307
Barea JM, Azcón R, Azcón-Aguilar C (2002) Mycorrhizosphere interactions to improve plant fit-
ness and soil quality. Antonie van Leeuwenhoek 81(1):343–351
Barea JM, Pozo MJ, Azcón R, Azcón-Aguilar C (2005) Microbial co-operation in the rhizosphere.
J Exp Bot 56(417):1761–1778
Barnawal D, Bharti N, Maji D, Chanotiya CS, Kalra A (2014) ACC deaminase-containing
Arthrobacter protophormiae induces NaCl stress tolerance through reduced ACC oxidase
activity and ethylene production resulting in improved nodulation and mycorrhization in Pisum
sativum. J Plant Physiol 171(11):884–894
Bécard G, Piché Y (1989) Fungal growth stimulation by CO2 and root exudates in vesicular-
arbuscular mycorrhizal Symbiosis. Appl Environ Microbiol 55(9):2320–2325
Berendsen RL, Pieterse CMJ, Bakker PAHM (2012) The rhizosphere microbiome and plant health.
Trends Plant Sci 17(8):478–486
Berruti A, Lumini E, Balestrini R, Bianciotto V (2015) Arbuscular mycorrhizal fungi as natural
biofertilizers: let’s benefit from past successes. Front Microbiol 6:1559
Bharti N, Barnawal D, Shukla S, Tewari SK, Katiyar RS, Kalra A (2016a) Integrated application
of Exiguobacterium oxidotolerans, Glomus fasciculatum, and vermicompost improves growth,
yield and quality of Mentha arvensis in salt-stressed soils. Ind Crop 83:717–728
Bharti N, Barnawal D, Wasnik K, Tewari SK, Kalra A (2016b) Co-inoculation of Dietzia natrono-
limnaea and Glomus intraradices with vermicompost positively influences Ocimum basilicum
growth and resident microbial community structure in salt affected low fertility soils. Appl Soil
Ecol 100:211–225
Bhowmik SN, Singh CS (2004) Mass multiplication of AM inoculum: effect of plant growth-
promoting rhizobacteria and yeast in rapid culturing of Glomus mosseae. Curr Sci 86(5):705–709
Bidondo LF, Silvani V, Colombo R, Pergola M, Bompadre J, Godeas A (2011) Pre-symbiotic and
symbiotic interactions between Glomus intraradices and two Paenibacillus species isolated
from AM propagules. In vitro and in vivo assays with soybean (AG043RG) as plant host. Soil
Biol Biochem 43:1866–1872
Boby VU, Balakrishna AN, Bagyaraj DJ (2008) Interaction between Glomus mosseae and soil
yeasts on growth and nutrition of cowpea. Microbiol Res 163(6):693–700
Bonkowski M, Cheng W, Griffiths BS, Alphei J, Scheu S (2000) Microbial-faunal interactions in
the rhizosphere and effects on plant growth. Eur J Soil Biol 36(3–4):135–147
Budi SW, van Tuinen D, Martinotti G, Gianinazzi S (1999) Isolation from the Sorghum bicolor
Mycorrhizosphere of a bacterium compatible with arbuscular mycorrhiza development and
antagonistic towards Soilborne fungal pathogens. Appl Environ Microbiol 65(11):5148–5150
Budi SW, Bakhtiar Y, May NL (2012) Bacteria associated with arbuscular mycorrhizal spores
Gigaspora margarita and their potential for stimulating root mycorrhizal colonization and
neem (Melia azedarach Linn) seedling growth. Microbiol Indones 6(4):180–188
Carpenter-Boggs L, Loynachan TE, Stahl PD (1995) Spore germination of Gigaspora margarita
stimulated by volatiles of soil-isolated actinomycetes. Soil Biol Biochem 27(11):1445–1451
Celebi SZ, Demir S, Celebi R, Durak ED, Yilmaz IH (2010) The effect of Arbuscular Mycorrhizal
Fungi (AMF) applications on the silage maize (Zea mays L.) yield in different irrigation
regimes. EurJ Soil Biol 46(5):302–305
org/10.1007/978-81-322-2776-2_20
Della Mónica IF, Stefanoni Rubio PJ, Cina RP, Recchi M, Godeas AM, Scervino JM (2014) Effects
of the phosphate-solubilizing fungus Talaromyces flavus on the development and efficiency of
the Gigaspora rosea-Triticum aestivum symbiosis. Symbiosis 64(1):25–32
292 A. Lies et al.
Dessaux Y, Hinsinger P, Lemanceau P (2009) Rhizosphere: so many achievements and even more
challenges. Plant Soil 321(1):1–3
the rhizosphere. Critic Rev Plant Sci 22(2):107–149
pp 77–98. https://doi.org/10.1007/978-81-322-2776-2_6
org/10.1007/978-81-322-2776-2_19
Duponnois R, Plenchette C (2003) A mycorrhiza helper bacterium enhances ectomycorrhizal and
endomycorrhizal symbiosis of Australian Acacia species. Mycorrhiza 13(2):85–91
Duponnois R, Colombet A, Hien V, Thioulouse J (2005) The mycorrhizal fungus Glomus intr-
aradices and rock phosphate amendment influence plant growth and microbial activity in the
rhizosphere of Acacia holosericea. Soil Biol Biochem 37(8):1460–1468
Duponnois R, Ramanankierana H, Hafidi M, Baohanta R, Baun É, Thioulouse J, Sanguin H, Bâ
A, Galiana A, Bally R (2013) Des ressources végétales endémiques pour optimiser durable-
ment les opérations de réhabilitation du couvert forestier en milieu méditerranéen et tropical:
exemple des plantes facilitatrices vectrices de propagation des champignons mycorhiziens. C
R Biol 336(5–6):265–272
Duvert P, Perrin R, Plenchette C (1990) Soil receptiveness to VA mycorrhizal association: concept
and method. Plant Soil 124(1):1–6
FAO (2015) FAO statistical pocketbook 2015. Food and Agriculture Organization of the United
Nations, Rome
Fester T, Maier W, Strack D (1999) Accumulation of secondary compounds in barley and wheat
roots in response to inoculation with an arbuscular mycorrhizal fungus and co-inoculation with
rhizosphere bacteria. Mycorrhiza 8(5):241–246
Fracchia S, Sampedro I, Godeas A, Ocampo JA, Garcıa-Romera I (2003) Interaction between the
soil yeast Rhodotorula mucilaginosa and the arbuscular mycorrhizal fungi Glomus mosseae
and Gigaspora rosea. Soil Biol Biochem 35(5):701–707
Fracchia S, Sampedro I, Scervino JM, Garcia-Romera I, Ocampo JA, Godeas A (2004) Influence of
saprobe fungi and their exudates on arbuscular mycorrhizal symbioses. Symbiosis 36:169–182
Frey-Klett P, Garbaye J, Tarkka M (2007) The mycorrhiza helper bacteria revisited. New Phytol
176(1):22–36
Gamalero E, Trotta A, Massa N, Copetta A, Martinotti MG, Berta G (2004) Impact of two fluo-
rescent pseudomonads and an arbuscular mycorrhizal fungus on tomato plant growth, root
architecture and P acquisition. Mycorrhiza 14(3):185–192
Garbaye J (1994) Tansley review no. 76 helper bacteria: a new dimension to the mycorrhizal sym-
biosis. New Phytol 128(2):197–210
Godfray HCJ, Beddington JR, Crute IR, Haddad L, Lawrence D, Muir JF, Pretty J, Robinson
S, Thomas SM, Toulmin C (2010) Food security: the challenge of feeding 9 billion people.
Science 327(5967):812–818
Gollner MJ, Püschel D, Rydlová J, Vosátka M (2006) Effect of inoculation with soil yeasts on
mycorrhizal symbiosis of maize. Pedobiologia 50(4):341–345
Green H, Larsen J, Olsson PA, Jensen DF, Jakobsen I (1999) Suppression of the biocontrol agent
Trichoderma harzianum by mycelium of the arbuscular mycorrhizal fungus Glomus intraradi-
ces in root-free soil. Appl Environ Microbiol 65(4):1428–1434
Gryndler M, Hršelová H, Chvátalová I, Jansa J (1998) The effect of selected plant hormones on
in vitro proliferation of hyphae of Glomus fistulosum. Biol Plant 41(2):255–263
Hartmann A, Rothballer M, Schmid M (2008) Lorenz Hiltner, a pioneer in rhizosphere microbial
ecology and soil bacteriology research. Plant Soil 312(1):7–14
Hayman DS (1970) Endogone spore numbers in soil and vesicular-arbuscular mycorrhiza in wheat
as influenced by season and soil treatment. Trans Brit Mycol Soc 54(1):53–62
Hildebrandt U, Janetta K, Bothe H (2002) Towards growth of arbuscular mycorrhizal fungi inde-
pendent of a plant host. Appl Environ Microbiol 68(4):1919–1924
Hildebrandt U, Ouziad F, Marner FJ, Bothe H (2006) The bacterium Paenibacillus validus stimu-
lates growth of the arbuscular mycorrhizal fungus Glomus intraradices up to the formation of
fertile spores. FEMS Microbiol Lett 254(2):258–267
Hiltner L (1904) Uber neuere Erfahrungen und Probleme auf dem Gebiet der Bodenbakteriologie
und unter besonderer Berucksichtigung der Grundungung and Brache. Arbeiten der Deutschen
Landwirtschaftlichen Gesellschaft 98:59–78
9(2):1211–1221
Kim K, Yim W, Trivedi P, Madhaiyan M, Deka Boruah HP, Islam MR, Lee G, Sa T (2010)
Synergistic effects of inoculating arbuscular mycorrhizal fungi and Methylobacterium ory-
zaestrains on growth and nutrient uptake of red pepper (Capsicum annuum L.) Plant Soil
327(1):429–440
Klironomos JN, Kendrick WB (1996) Palatability of microfungi to soil arthropods in relation to
the functioning of arbuscular mycorrhizae. Biol Fert Soils 21(1):43–52
Enterobacter and Rhizobacteria on yield and nutrient uptake by wheat (Triticum aestivum L.)
in the alluvial soil under Indo-Gangetic Plain of India. J Plant Growth Regul 36:608–617.
https://doi.org/10.1007/s00344-016-9663-5
Lenoir I, Fontaine J, Lounès-Hadj Sahraoui A (2016) Arbuscular mycorrhizal fungal responses to
abiotic stresses: a review. Phytochemistry 123:4–15
Liu Y, He L, An L, Helgason T, Feng H (2009) Arbuscular mycorrhizal dynamics in a chronose-
quence of Caragana korshinskii plantations. FEMS Microbiol Ecol 67(1):81–92
Lussenhop J (1996) Collembola as mediators of microbial symbiont effects upon soybean. Soil
Biol Biochem 28(3):363–369
Mamatha G, Bagyaraj D, Jaganath S (2002) Inoculation of field-established mulberry and
papaya with arbuscular mycorrhizal fungi and a mycorrhiza helper bacterium. Mycorrhiza
12(6):313–316
Marulanda A, Barea JM, Azcón R (2006) An indigenous drought-tolerant strain of Glomus intr-
aradices associated with a native bacterium improves water transport and root development in
Retama sphaerocarpa. Microb Ecol 52(4):670–678
294 A. Lies et al.
https://doi.org/10.1007/978-81-322-2776-2_10
Mayo K, Davis RE, Motta J (1986) Stimulation of germination of spores of Glomus versiforme by
spore-associated bacteria. Mycologia 78(3):426–431
McAllister CB, Garcia-Romera I, Martin J, Godeas A, Ocampo JA (1995) Interaction between
Aspergillus niger van Tiegh. and Glomus mosseae. (Nicol. and Gerd.) Gerd. and Trappe. New
Phytol 129(2):309–316
Meena VS, Maurya BR, Meena RS (2015c) Residual impact of wellgrow formulation and NPK
on growth and yield of wheat (Triticum aestivum L.) Bangladesh J Bottomline 44(1):143–146
jclepro.2015.04.044
Meena VS, Maurya BR, Meena SK, Meena RK, Kumar A, Verma JP, Singh NP (2017) Can bacil-
lus species enhance nutrient availability in agricultural soils? In: Islam MT, Rahman M, Pandey
P, Jha CK, Aeron A (eds) Bacilli and Agrobiotechnology. Springer International Publishing,
Meng L, Zhang A, Wang F, Han X, Wang D, Li S (2015) Arbuscular mycorrhizal fungi and rhi-
zobium facilitate nitrogen uptake and transfer in soybean/maize intercropping system. Front
Plant Sci 6:339
Meyer JR, Linderman RG (1986) Response of subterranean clover to dual inoculation with
vesicular-arbuscular mycorrhizal fungi and a plant growth-promoting bacterium, Pseudomonas
putida. Soil Biol Biochem 18(2):185–190
Miransari M (2011) Interactions between arbuscular mycorrhizal fungi and soil bacteria. Appl
Microbiol Biotechnol 89(4):917–930
Mosse B (1962) The establishment of vesicular-arbuscular mycorrhiza under aseptic conditions.
Microbiology 27(3):509–520
Mugnier J, Mosse B (1987) Spore germination and viability of a vesicular arbuscular mycorrhizal
fungus, Glomus mosseae. Trans Brit Mycol Soc 88(3):411–413
Newsham KK, Fitter AH, Watkinson AR (1995) Arbuscular mycorrhiza protect an annual grass
from root pathogenic fungi in the field. J Ecol 83(6):991–1000
Öpik M, Zobel M, Cantero JJ, Davison J, Facelli JM, Hiiesalu I, Jairus T, Kalwij JM, Koorem K,
Leal ME (2013) Global sampling of plant roots expands the described molecular diversity of
arbuscular mycorrhizal fungi. Mycorrhiza 23(5):411–430
Ordoñez YM, Fernandez BR, Lara LS, Rodriguez A, Uribe-Vélez D, Sanders IR (2016) Bacteria
with phosphate solubilizing capacity Alter mycorrhizal fungal growth both inside and outside
the root and in the presence of native microbial communities. PLoS One 11(6):e0154438
Orrell P, Bennett AE (2013) How can we exploit above–belowground interactions to assist in
addressing the challenges of food security? Front Plant Sci 4:432
Pacovsky RS, Fuller G, Paul EA (1985) Influence of soil on the interactions between endomycor-
rhizae and Azospirillum in sorghum. Soil Biol Biochem 17(4):525–531
Paula MA, Urquiaga S, Siqueira JO, Döbereiner J (1992) Synergistic effects of vesicular-arbuscular
mycorrhizal fungi and diazotrophic bacteria on nutrition and growth of sweet potato (Ipomoea
batatas). Biol Fert Soils 14(1):61–66
Pivato B, Offre P, Marchelli S, Barbonaglia B, Mougel C, Lemanceau P, Berta G (2008) Bacterial
effects on arbuscular mycorrhizal fungi and mycorrhiza development as influenced by the bac-
teria, fungi, and host plant. Mycorrhiza 19(2):81–90
Plenchette C, Clermont-Dauphin C, Meynard JM, Fortin JA (2005) Managing arbuscular mycor-
rhizal fungi in cropping systems. Can J Plant Sci 85(1):31–40
org/10.1007/978-81-322-2776-2_4
Rao NSS, Tilak KVBR, Singh CS (1985) Effect of combined inoculation of Azospirillum brasi-
lense and vesicular-arbuscular mycorrhiza on pearl millet (Pennisetum americanum). Plant
Soil 84(2):283–286
296 A. Lies et al.
Ratti N, Kumar S, Verma HN, Gautam SP (2001) Improvement in bioavailability of tricalcium

phosphate to Cymbopogon martinii var. motia by rhizobacteria, AMF and Azospirillum inocu-
lation. Microbiol Res 156(2):145–149
Ravnskov S, Jensen B, Knudsen IMB, Bødker L, Funck Jensen D, Karliński L, Larsen J (2006)
Soil inoculation with the biocontrol agent Clonostachys rosea and the mycorrhizal fungus
Glomus intraradices results in mutual inhibition, plant growth promotion and alteration of soil
microbial communities. Soil Biol Biochem 38(12):3453–3462
Requena N, Jimenez I, Toro M, Barea JM (1997) Interactions between plant-growth-promoting
rhizobacteria (PGPR), arbuscular mycorrhizal fungi and Rhizobium spp. in the rhizosphere of
Anthyllis cytisoides, a model legume for revegetation in mediterranean semi-arid ecosystems.
New Phytol 136(4):667–677
Roesti D, Ineichen K, Braissant O, Redecker D, Wiemken A, Aragno M (2005) Bacteria associated
with spores of the arbuscular mycorrhizal fungi Glomus geosporum and Glomus constrictum.
Appl Environ Microbiol 71(11):6673–6679
pp 127–136. https://doi.org/10.1007/978-81-322-2776-2_9
Sampedro I, Aranda E, Scervino JM, Fracchia S, García-Romera I, Ocampo JA, Godeas A (2004)
Improvement by soil yeasts of arbuscular mycorrhizal symbiosis of soybean (Glycine max)
colonized by Glomus mosseae. Mycorrhiza 14(4):229–234
Sbrana C, Avio L, Giovannetti M (1995) The occurrence of calcofluor and lectin binding polysac-
charides in the outer wall of arbuscular mycorrhizal fungal spores. Mycol Res 99(10):1249–1252
Scervino JM, Gottlieb A, Silvani VA, Pérgola M, Fernández L, Godeas AM (2009) Exudates of
dark septate endophyte (DSE) modulate the development of the arbuscular mycorrhizal fungus
(AMF) Gigaspora rosea. Soil Biol Biochem 41(8):1753–1756
Selim S, Negrel J, Govaerts C, Gianinazzi S, van Tuinen D (2005) Isolation and partial charac-
terization of antagonistic peptides produced by Paenibacillus sp. strain B2 isolated from the
sorghum Mycorrhizosphere. Appl Environ Microbiol 71(11):6501–6507
Selvakumar G, Krishnamoorthy R, Kim K, Sa TM (2016) Genetic diversity and association
characters of bacteria isolated from arbuscular mycorrhizal fungal spore walls. PLoS One
11(8):e0160356
Singh CS, Kapoor A, Wange SS (1991) The enhancement of root colonisation of legumes by
vesicular-arbuscular mycorrhizal (VAM) fungi through the inoculation of the legume seed with
commercial yeast (Saccharomyces cerevisiae). Plant Soil 131(1):129–133
Singh R, Soni SK, Kalra A (2013) Synergy between Glomus fasciculatum and a beneficial pseudo-
monas in reducing root diseases and improving yield and forskolin content in Coleus forskohlii
Briq. under organic field conditions. Mycorrhiza 23(1):35–44
Smith SE, Read DJ (2008) Mycorrhizal symbiosis. Academic, Cambridge, UK
Sreenivasa MN, Krishnaraj PU (1992) Synergistic interaction between VA mycorrhizal fungi and
a phosphate solubilizing bacterium in chilli (Capsicum annuum). ZentralblattfürMikrobiologie
147(1):126–130
Sundram S, Meon S, Seman IA, Othman R (2011) Symbiotic interaction of endophytic bacte-
ria with arbuscular mycorrhizal fungi and its antagonistic effect on Ganoderma boninense.
Thingstrup I, Kahiluoto H, Jakobsen I (2000) Phosphate transport by hyphae of field communi-
ties of arbuscular mycorrhizal fungi at two levels of P fertilization. Plant Soil 221(2):181–187
Tilman D, Cassman KG, Matson PA, Naylor R, Polasky S (2002) Agricultural sustainability and
intensive production practices. Nature 418(6898):671–677
Toro M, Azcón R, Barea JM (1997) Improvement of arbuscular mycorrhiza development by inocu-
lation of soil with phosphate-solubilizing Rhizobacteria to improve rock phosphate bioavail-
ability ((sup32)P) and nutrient cycling. Appl Environ Microbiol 63(11):4408–4412
Trappe JM (1987) Phylogenetic and ecological aspects of mycotrophy in the angiosperms from
an evolutionary standpoint. In: Safir GR (ed) Ecophysiology of VA mycorrhizal plants. CRC
Press, Boca Raton, pp 5–25
Umali-Garcia M, Hubbell DH, Gaskins MH, Dazzo FB (1980) Association of Azospirillum with
grass roots. Appl Environ Microbiol 39(1):219–226
Van Wees SCM, Van der Ent S, Pieterse CMJ (2008) Plant immune responses triggered by benefi-
cial microbes. Curr Opin Plant Biol 11(4):443–448
Vassilev N, Vassileva M, Azcon R, Medina A (2001) Application of free and ca-alginate-entrapped
Glomus deserticola and Yarowia lipolytica in a soil–plant system. J Biotechnol 91(2–3):237–242
Vaz ABM, Sampedro I, Siles JA, Vasquez JA, García-Romera I, Vierheilig H, Rosa CA, Ocampo
JA (2012) Arbuscular mycorrhizal colonization of Sorghum vulgare in presence of root endo-
phytic fungi of Myrtus communis. Appl Soil Ecol 61:288–294
on growth, yield and quality of cabbage (Brassica oleracea var capitata). Indian J Agri Sci
84(8):914–919
298 A. Lies et al.
Vivas A, Marulanda A, Ruiz-Lozano JM, Barea JM, Azcón R (2003) Influence of a Bacillus sp. on
physiological activities of two arbuscular mycorrhizal fungi and on plant responses to PEG-
induced drought stress. Mycorrhiza 13(5):249–256
Vivas A, Barea J, Azcón R (2005) Brevibacillus brevis isolated from cadmium- or zinc-
contaminated soils improves in vitro spore germination and growth of Glomus mosseae under
high cd or Zn concentrations. Microb Ecol 49:416–424
von Alten H, Lindemann A, Schönbeck F (1993) Stimulation of vesicular-arbuscular mycorrhiza
by fungicides or rhizosphere bacteria. Mycorrhiza 2(4):167–173
Vosátka M, Gryndler M (1999) Treatment with culture fractions form Pseudomonas putida modi-
fies the development of Glomus fistulosum mycorrhiza and the response of potato and maize
plants to inoculation. Appl Soil Ecol 11:245–251
Wang YY, Vestberg M, Walker C, Hurme T, Zhang X, Lindström K (2008) Diversity and infectiv-
ity of arbuscular mycorrhizal fungi in agricultural soils of the Sichuan Province of mainland
China. Mycorrhiza 18(2):59–68
Will ME, Sylvia DM (1990) Interaction of rhizosphere bacteria, fertilizer, and vesicular-arbuscular
mycorrhizal fungi with sea oats. Appl Environ Microbiol 56(7):2073–2079
Xavier LJC, Germida JJ (2003) Bacteria associated with Glomus clarum spores influence mycor-
rhizal activity. Soil Biol Biochem 35(3):471–478
Xie ZP, Staehelin C, Vierheilig H, Wiemken A, Jabbouri S, Broughton WJ, Vogeli-Lange R, Boller
T (1995) Rhizobial nodulation factors stimulate mycorrhizal colonization of nodulating and
nonnodulating soybeans. Plant Physiol 108(4):1519–1525
org/10.1007/978-81-322-2776-2_14
org/10.1007/978-81-322-2776-2_12
org/10.1007/978-81-322-2776-2_3
Zangaro W, Rostirola LV, de Souza PB, de Almeida AR, Lescano LEAM, Rondina ABL, Nogueira
MA, Carrenho R (2013) Root colonization and spore abundance of arbuscular mycorrhizal
fungi in distinct successional stages from an Atlantic rainforest biome in southern Brazil.
Mycorrhiza 23(3):221–233
Chapter 12
Sustainable Crop Production and Soil
Health Management Through Plant
Growth-Promoting Rhizobacteria
Hanuman Prasad Parewa, Vijay Singh Meena, Lokesh Kumar Jain,

and Anirudh Choudhary
Abstract Plant growth-promoting rhizobacteria (PGPR) are the heterogeneous

group of soil bacteria that are inhibiting in the rhizosphere, around/on the root sur-
face, which improve the plant growth directly or indirectly via production and
secretion of various regulatory substances. PGPR affect plant growth and develop-
ment either by releasing phytohormones or other biologically active substances,
altering endogenous levels of plant growth regulators (PGR), enhancing availability
and uptake of nutrients through fixation and mobilization, reducing harmful effects
of pathogenic microorganisms on plants and/or employing multiple mechanisms of
action. Nowadays, PGPR have received more attention for its use as a biofertilizer
for sustainability of agroecosystems. Numerous studies have suggested that PGPR
in an integrated nutrient management (INM) system could be used as effective sup-
plements to chemical fertilizers for promoting crop yields and soil health on sus-
tainable basis. In prospect to healthy and sustainable agriculture PGPR approach
revealed as one of the best alternatives.
Keywords PGPR · Mechanisms · Crops · Sustainable · INM
12.1 Introduction
The “Green Revolution” in India, which took place in the 1960s, has increased dra-
matically the crop yield by introducing high-yielding varieties and using huge
amount of chemical fertilizers and pesticides. The grain production has stagnated
H. P. Parewa (*) · L. K. Jain · A. Choudhary

College of Agriculture, Agriculture University, Jodhpur, Pali, Rajasthan, India
V. S. Meena

https://doi.org/10.1007/978-981-10-8402-7_12
300 H. P. Parewa et al.
for both rice and wheat crops (Dawe and Dobermann 1999), due to the degradation
of soil health as a result of continuously imbalance use of fertilizers and multi-
nutritional deficiencies (P, K, S, Zn, Fe, Mn, Cu and B). Long-time studies being
carried out at several locations in India and abroad indicated that application of
imbalance chemical fertilizers has deleterious effect on soil health leading to unsus-
tainable yields (Meena et al. 2017). Therefore, there is an urgent need to improve
nutrient supply system in a sustainable manner for higher crop production without
further deterioration in soil health (Meena et al. 2013a; Bahadur et al. 2014; Maurya
et al. 2014; Kumar et al. 2016b).
Sustainable agriculture is vitally important because it offers the potential to meet
our future agricultural needs, something that conventional agriculture will not be
able to do. Sustainable crop production could be achieved only by the application of
PGPR in an integrated manner without further deterioration in soil health. Beneficial
rhizobacteria can increase plant vigour and soil fertility (Parewa et al. 2014a). PGPR
are the heterogeneous group of soil bacteria that are inhibiting in the rhizosphere,
around/on the root surface, which improve the plant growth directly or indirectly via
production and secretion of various regulatory substances. The term PGPR is first
used by Kloepper and Schroth (1978); these soil bacterial species burgeoning in
plant rhizosphere which grow in, on or around the plant stimulate plant growth by a
plethora of mechanisms that are collectively known as PGPR (Vessey 2003).
PGPR belong to several genera like Agrobacterium, Arthrobacter, Azotobacter,
Bacillus, Pseudomonas sp., Rhizobium, Bradyrhizobium, Erwinia, Enterobacter,
Cellulomonas, Flavobacterium, Streptomyces and Xanthomonas (Weller 1988).
These alter the solubility of mineral nutrient by releasing organic acids and creating
acidity via CO2 (respiration). Production of organic acid was the major mechanism
by which insoluble phosphate compound was converted into more soluble forms.
Activities of these PGPR in the rhizosphere affect rooting patterns and the supply of
available nutrients to plants, thereby modifying the quality and quantity of root
exudates. Over the years, the PGPR have received worldwide importance and
acceptance for agricultural benefits (Jat et al. 2015; Kumar et al. 2015a, b, 2016a;
Ahmad et al. 2016a, b; Meena et al. 2016a; Parewa et al. 2014b; Prakash and Verma
2016; Jaiswal et al. 2016; Jha and Subramanian 2016).
These microorganisms are recognized as the potential tools for sustainable agri-
culture because they not only ensure the availability of essential nutrients to plants
but also enhance the nutrient use efficiency. Commonly, PGPRs facilitate the plant
growth directly by producing growth regulators, accelerating mineralization and
uptake of certain nutrients (Fe, P, Mn, Zn and Cu) (Tinker 1984) or modulating plant
hormone levels, or indirectly by decreasing the inhibitory effects of various patho-
gens on plant growth and development in the forms of biocontrol agents. Several
authors have reported significant increases in growth and yield of agricultural crops
in response to PGPR inoculants under greenhouse, field conditions and stressed
conditions (Kennedy et al. 2004; Gravel et al. 2007; Kumar et al. 2007; Arshad et al.
2008; Mubeen et al. 2008; Naiman et al. 2009).
In recent years, the use of PGPR species Azospirillum, Azotobacter, Pseudomonas,
Enterobacter, Arthrobacter, Burkholderia, Bacillus and others has reported to
enhance efficiency of fertilizers, mitigate abiotic stresses, manage plant pathogens,
12 Sustainable Crop Production and Soil Health Management Through Plant… 301
cause the degradation of xenobiotic compounds and enhance plant growth

dramatically in various parts of the world (Kloepper et al. 1989; Okon and

Labandera-Gonzalez 1994; Glick 1995, 2004; Khan 2005; Arshad et al. 2007;
Ahmad et al. 2008; Kohler et al. 2009). Beneficial rhizobacteria have potential as
part of an overall management system to reduce the use of synthetic compounds and
fertilizer and provide a sustainable agriculture (Meena et al. 2015a, 2015f, 2016b;
Priyadharsini and Muthukumar 2016; Kumar et al. 2017; Dotaniya et al. 2016). In
this chapter, functions, mechanisms, reasons for inconsistency in their performance
and effective ways of PGPR on agricultural crops and supplement to chemical fer-
tilizers are critically reviewed and discussed.
12.2 unctions of Plant Growth-Promoting Rhizobacteria

F
(PGPR)
• PGPR are directly involved in increasing uptake of nitrogen, synthesis of phyto-

hormones and solubilization of minerals such as phosphorus and production of
siderophores that chelate iron and make it available to the plant root (Glick 1995;
Bowen and Rovira 1999).
• Microbial activity in the rhizosphere affects the rooting patterns and the supply
of available nutrients to plants, in a manner that modify the quality and quantity
of root exudates (Gryndler 2000).
• PGPR play an important role in biological activities, such as the biological con-
trol of plant pathogens, nutrient cycling and seedling/plant growth through the
production of various substances (Persello-Cartieaux et al. 2003; Zahir et al.
2004).
• Solubilization of inorganic phosphate and mineralization of organic phosphate
and/or other nutrients (Singal et al. 1994; Jeon et al. 2003; Aslantas et al. 2007).
• PGPR accelerate mineralization and uptake of certain nutrients (Fe, P, Mn, Zn
and Cu) (Tinker 1984).
• Nutrient transfer from dead to living plants may occur.
• It increases crop yield by ~ 10–30% besides reducing the input cost for crop
production.
• They promote plant growth and development via production and secretion of
various regulatory chemicals in the vicinity of rhizosphere; they play a vital role
in nitrogen fixation and help in sequestration of iron for plant by siderophores.
• Production of plant hormones, like auxins, cytokinin and gibberellins, decreases
plant ethylene levels using ACC deaminase that accumulate during biotic and
abiotic stresses (Glick et al. 2007).
• PGPR prevent the deleterious effects of one or more phytopathogenic organisms
by producing antagonistic substances or by inducing resistance to pathogens
(Glick 1995).
• Composite PGPR enhance growth, yield attributes and yield of wheat crop
(Parewa and Yadav 2014).
12.3 Mechanisms of PGPR
PGPR affect growth and development of different plant species either by direct or
indirect mechanisms (Fig. 12.1). Generally, there are several ways by which PGPR
promote plant growth either directly by atmospheric nitrogen fixation, production
of plant growth regulators, production of siderophores that solubilize and sequester
iron, and solubilization of minerals such as phosphorus that enhance plant growth at
various stages of development or indirectly by decreasing the inhibitory effects of
various pathogens on plant growth and development in the forms of biocontrol
agents and also production of antibiotics (i.e. karalicin, oomycin, azomycin) or by
reducing the negative effect of deleterious rhizobacteria. However, the major mech-
anism of PGPR is the suppression of plant pathogens by releasing antibiotics, cya-
nide and enzymes (Kloepper 1993).
The exact mechanisms by which PGPRs promote plant growth are not fully
understood, but the direct mechanisms of plant growth promotion may include:
1. Symbiotic nitrogen fixation, associative symbiosis and asymbiotic nitrogen fixa-
tion (Boddey and Dobereiner 1995).
2. Ability to produce plant growth regulators like auxin, cytokinins, gibberellic
acid, abscisic acid (ABA) and ethylene (Arshad and Frankenberger 1993; Glick
1995; Kloepper et al. 1989; Patten and Glick 2002).
3. PGPR produce siderophores which act as solubilizing agents for iron from min-
erals or organic compounds under conditions of iron limitation and hence
enhance the availability of iron (Indiragandhi et al. 2008). Plants utilize sidero-
phores secreted by PGPR for sequestering iron (Marschner and Romheld 1994).
4. Solubilization of inorganic phosphate and mineralization of organic phosphate
and/or other nutrients (Singal et al. 1994; Jeon et al. 2003; Aslantas et al. 2007).
Fig. 12.1 An overview of PGPR effects on sustainable crop production and soil management
(Adapted and modified from Parewa et al. 2014a)
Fig. 12.2 Representation of various possible direct and indirect pathways of PGPR for enhancing
sustainable agriculture
Indirect growth promotion occurs when PGPR promote plant growth in restrict-
ing conditions (Glick et al. 1999). This can happen directly by producing antagonis-
tic substances or indirectly by inducing resistance to pathogens (Glick 1995). The
indirect mechanism of plant growth promotion includes:
1. Induced systemic resistance (Kloepper et al. 1988; Liu et al. 1995). Interaction
of some rhizobacteria with the plant roots can result in plant resistance against
some pathogenic bacteria, fungi and viruses. This phenomenon is called induced
systemic resistance (ISR) (Lugtenberg and Kamilova 2009).
2. Antagonism against phytopathogens by production of siderophores (Scher and
Baker 1982), antibiotics (Shanahan et al. 1992) and cyanide (Flaishman et al.
1996).
3. Competition for nutrients. An overall mechanism of PGPR is depicted in
Fig. 12.2. In general, competition for nutrients, niche exclusion, induced sys-
temic resistance and antifungal metabolites production are the chief modes of
biocontrol activity in PGPR (Lugtenberg and Kamilova 2009).
Therefore, PGPRs can affect plant growth by one or more of these mechanisms
and also use different abilities for growth promotion at various times during life
cycle of the plant (Glick et al. 1999).The major mechanisms of PGPR action
involved in the improvement of plant growth and development are discussed in the
following sections.
12.3.1 iological Nitrogen Fixation, Solubilization/

B
Mobilization and Nutrient Uptake
Nitrogen is one of the most limiting plant nutrient for plant growth; hence, biologi-
cal nitrogen fixation is considered as one of the major mechanisms by which plants
get benefited from PGPR. Soil microorganisms can provide nutrients to plants either
through fixation of atmospheric nitrogen or by enhancing nutrient mobilization or
uptake through their biological activities, such as mineralization, siderophore,
organic acid and phosphatase production (Khalid et al. 2009; Raghavendra et al.
2016; Zahedi 2016; Meena et al. 2015b; Rawat et al. 2016; Das and Pradhan 2016;
Dominguez-Nunez et al. 2016).
The enhanced mineral uptake in inoculated cereal plant was proposed as a pos-
sible mechanism of PGPR. Some rhizobacteria have the ability to fix nitrogen into
inorganic forms which can be utilized by the plants. PGPR by forming symbiotic
and non-symbiotic associations with plants fix atmospheric nitrogen converting it
into usable form. Numerous studies have shown that different species of bacteria fix
atmospheric N2 and consequently affect growth and yield of various crops (Orhan
et al. 2006; Afzal and Bano 2008; Yadav et al. 2010). Several reports have suggested
that PGPR can stimulate plant growth through their P-solubilizing activity (Khan
et al. 2007; Wani et al. 2007; Afzal and Bano 2008).
Plants require an adequate supply of nutrients for their proper growth and devel-
opment. Plants growing on the soils enriched with nutrients may still exhibit nutri-
ent deficiencies due to unavailability of these mineral nutrients. However, plant
growth-promoting rhizobacteria are actively involved in the solubilization of impor-
tant minerals such as phosphorus and iron by releasing certain organic acids, thereby
enhancing the availability of these essential nutrients to plants (Glick 1995). Singh
and Singh (2012) revealed that dual seed inoculation with PSB + PGPR (Bacillus
polymyxa + Rhizobium + Pseudomonas florencenses) enhanced nutrient uptake,
significantly over single inoculation of PGPR (Rhizobium + Pseudomonas floren-
censes), PSB (Bacillus polymyxa) or control.
12.3.2 Production of Plant Growth Regulators
Plant growth regulators (phytohormones) are naturally occurring organic substances

that influence various physiological or morphological processes in plants, such as
cell elongation and cell division. They perform these functions at concentrations far
below the levels at which nutrients and vitamins normally affect plant processes
(Khalid et al. 2009). PGPR can alter root architecture and promote plant growth
with the production of different phytohormones like indole acetic acid, gibberellic
acid and cytokinins (Kloepper et al. 2007). Several PGPR as well as some patho-
genic, symbiotic and free-living rhizobacterial species are reported to produce IAA
and gibberellic acid in the rhizospheric soil and thereby play a significant role in
increasing the root surface area and number of root tips in many plants (Han et al.
2005; Yasin et al. 2016; Meena et al. 2015e, 2016c; Saha et al. 2016a; Yadav and
Sidhu 2016; Bahadur et al. 2016b).
An experiment was carried out at BHU, Varanasi, in plant growth chamber to
investigate the effect of different strains of PGPR on the growth of chickpea plant.
Isolates of PGPR induced production of plant hormones (indole acetic acid), phos-
phate solubilization and ammonia production to enhance plant growth. Most of iso-
lates of PGPR resulted in a significant increase in shoot length, root length and dry
matter production of shoot and root of chickpea seedlings and suggested that PGPR
isolates, viz. Pseudomonas aeruginosa strain BHUPSB02, Pseudomonas putida
strain BHUPSB04 and Bacillus subtilis strain BHUPSB13, may be used as biofer-
tilizers to enhance the growth and productivity of chickpea (Yadav et al. 2010).
Recently, several authors have documented profound effects of PGPR on produc-
tion of plant growth regulators which are presented in Table 12.1.
12.3.3 Antibiotic Production
In agricultural ecosystems, soilborne plant pathogens are one of the major limiting
factors in the decline of crop production due to their inhibitory effects on plant
health. The increased use of insecticide and pesticide inputs causes several negative
effects, i.e. development of pathogen resistance to the applied agents and their non-
target environmental impacts (Gerhardson 2002). Furthermore, the growing cost of
pesticides, particularly in less affluent regions of the world, and the growing con-
sumer demand for pesticide-free food have led to search substitutes for these prod-
ucts. Currently, biopesticides are receiving worldwide attention and considered
important for the sustainability of the agricultural system.
The utilization of microbial antagonists against plant pathogens in agricultural
crops has been proposed as an alternate to chemical pesticides. PGPR belonging to
Bacillus and Pseudomonas species play an active role in the suppression of patho-
genic microorganisms producing antibiotics. Several studies have reported that bac-
teria including Bacillus subtilis, Pseudomonas fluorescens, P. putida, P. cepacia, P.
aeruginosa, Rhizobium and many other PGPR produce a wide variety of antibiotics
which help in suppression of plant pathogens by synthesizing chitinase; by produc-
tion of hydrogen cyanide, protease, siderophores and cellulase; and/or indirectly by
promoting plant growth and health through any mode of action (Jisha et al. 2002;
Zahir et al. 2004; Hafeez et al. 2006; Narayanasamy 2008).
Table 12.1 Production of plant growth regulators (PGRs) by PGPR

Suggested mechanism(s) of
Crops PGPR action References
Vigna radiata A. chroococcum and Solubilized insoluble P, secreted Ahmad et al.
Bradyrhizobium sp. IAA and produced siderophores (2016)
Fragaria Azospirillum and IAA production and biological Lovaisa et al.
ananassa Burkholderia nitrogen fixation (2015)
Saccharum Group of rhizobacteria Production of IAA, ACC Ghevariya and
officinarum deaminase and nitrogen fixation Desai (2014)
Oryza sativa L. P. fluorescens, B. IAA, gibberellic acid and Sivasakthi et al.
subtilis siderophore production (2013)
Saccharum G. diazotrophicus VI27 N2-fixing, siderophore, IAA, Beneduzi et al.
officinarum P-solubilizing (2013)
Vigna radiata P. aeruginosa IAA, siderophores, HCN, Ahemad and
ammonia, exo-polysaccharides, Khan (2012)
phosphate solubilization
Pennisetum Acinetobacter sp. IAA, phosphate solubilization, Rokhbakhsh-
glaucum siderophores Zamin et al.
(2011)
Cicer arietinum Bacillus species PSB10 IAA, siderophores, HCN, Wani and Khan
ammonia (2010)
Lactuca sativa P. mendocina ACC deaminase activity Kohler et al.
L. (2009)
Solanum Bacillus sp. Auxins Ahmed and
tuberosum Hasnain (2008)
Brassica rapa P. putida UW4 ACC deaminase activity Cheng et al.
(2007)
Triticum B. pumilus Auxin, siderophore Hafeez et al.
aestivum L. (2006)
Glycine max P. fluorescens IAA, siderophore, Gupta et al.
P-solubilization (2005)
Zea mays L. A. chroococcum, B. N2-fixation, P- and Wu et al. (2005)
megaterium, B. K-solubilization
mucilaginous
Triticum Azospirillum lipoferum Indole-3-acetic acid Muratova et al.
aestivum L. strains 15 (2005)
Triticum PGPR isolates Indole-3-acetic acid Khalid et al.
aestivum L. (2004)
Lycopersicon PGPR Auxins Garcia et al.
esculentum (2003)
Brassica rapa P. putida GR12–2 Indole-3-acetic acid Patten and Glick
(2002)
Lycopersicon A. niger, A. awamori Organic acids Khan and Khan
esculentum (2001)
Oryza sativa L. Rhizobium, Indole-3-acetic acid Biswas et al.
Azospirillum (2000)
12.4 Important Microorganisms Used as PGPR
Organisms that are commonly used as PGPR component are nitrogen fixers, P- and
K-solubilizers or combination of synergetic bacteria and fungi. Most of the bacteria
and fungi included in biofertilizer have close relationship with plant roots. The
phosphorus-solubilizing microorganisms (PSMs) mainly bacteria and fungi make
insoluble phosphorus available to the plants. Several soil bacteria and a few species
of fungi possess the ability to bring insoluble phosphate in soil into soluble forms
by secreting organic acids (Gupta 2004). These acids lower the soil pH and bring
about the dissolution of bound forms of phosphate. While Rhizobium, blue-green
algae (BGA) and Azolla are crop specific, bioinoculants like Azotobacter,
Azospirillum, phosphorus-solubilizing bacteria (PSB) and vesicular-arbuscular
mycorrhiza (VAM) could be regarded as broad spectrum biofertilizers (Gupta
2004). Examples of free-living nitrogen-fixing bacteria are Azotobacter,
Azospirillum, Clostridium pasteurianum, Rhodobacter, cyanobacteria and some
methanogens. Example of K-solubilizers is B. mucilaginous while for P-solubilizers
are B. megaterium, B. circulans, B. subtilis and P. striata (Meena et al. 2016d; Saha
et al. 2016b; Verma et al. 2014, 2015b; Teotia et al. 2016).
12.5 Application of PGPR in Agriculture
PGPR are mostly used as seed, soil or foliar application for improving the growth
and yield of agricultural crops. They represent as component of biofertilizer tech-
nology to improve the productivity of agricultural crops in the long way (Zahir et al.
2004; Khalid et al. 2006; Naiman et al. 2009). Various PGPR have shown great
promise as potential inoculants for agriculture uses and environmental protection
and may play very vital roles in maintaining the sustainability of agroecosystems
(Khalid et al. 2009).
The selection of an effective PGPR strain is very critical, and the plant responses
are often variable depending upon the PGPR strain, plant genotypes and experimen-
tal locations. It has also been claimed that the PGPR isolated from a particular crop
or ecological zone are more effective in producing consistent results if reapplied to
the same crop and reused in the same ecological zone (Chanway and Holl 1992;
Nowak 1998). This might be due to a greater adaptability of the introduced PGPR
in the given rhizosphere, while inconsistency in the responses of same crop to same
PGPR could be attributed to (i) the poor quality of inocula, (ii) short shelf life of
PGPR, (iii) lack of standard delivery systems and/or (iv) failure in maintaining a
required density of PGPR on seeds or roots.
Moreover, the nature and composition of the material used as a carrier for a
PGPR also plays a significant role in producing its impact on the inoculated plants
(Khalid et al. 2009). However, the current use of PGPR in agriculture is poor due to
location-specific response, despite numerous reports on their fair performance
under laboratory and field conditions. In this context, significant effects of PGPR
have been observed on various agricultural crops, including cereals, legumes, oil-
seed crops and horticultural crops and other environmentally important plant
species. Furthermore, the impact of PGPR in an integrated manner increased the
soil fertility, microbial activity and water use efficiencies (Arshad et al. 2008; Khalid
et al. 2009; Parewa et al. 2014b). The potential uses and benefits of PGPR in the
improvement of overall performance of agricultural crops and soil health are dis-
cussed in the following sections.
12.5.1 Effect of PGPR on Cereals
Increasing demand for food and improving environmental quality have focused on
the importance of PGPR in agriculture. PGPR have the ability to increase germina-
tion, seedling emergence, growth, vigour, establishment and therefore yield of vari-
ous cereals and noncereal crops (Van et al. 2000; Grichko and Glick 2001; Gravel
et al. 2007) by enhancing the availability of nitrogen (Riggs et al. 2001; Anjum et al.
2007), iron (Masalha et al. 2000) and phosphorus (Villegas and Fortin 2002) to
agricultural crops. They also improve the plant growth and yield by a variety of
ways like the production of phytohormones, nitrogen fixation, phosphate solubiliza-
tion, improvement in root morphology, etc., and are also useful in cutting down the
cost of chemical fertilizers (Meena et al. 2013b, 2014a, 2016e; Sharma et al. 2016;
Verma et al. 2015a; Shrivastava et al. 2016).
The root system is mainly characterized by its total length which is influenced by
a number of factors like soil fertility, soil moisture, physico-chemical properties of
soil and occurrence of numerous PGPR. Enormous PGPR are known to promote
plant growth, crop yield, seed emergence, etc., thus promoting agriculture (Minorsky
2008; Parewa and Yadav 2014). Plant properties like leaf area, chlorophyll content,
total biomass, etc., were enhanced by inoculation of PGPR (Baset Mia et al. 2010).
Enhanced mineral uptake in inoculated cereal plant was proposed as a possible
mechanism of plant growth enhancement by PGPR. The inoculation effect of
Azospirillum sp. on the development of agriculturally important plants was assessed
(Dobbelaere et al. 2001) and observed a noteworthy boost in the dry weight of both
the root system and aerial parts of the PGPR-inoculated plants, resulting in better
progress and flowering. A field experiment was conducted at Banaras Hindu
University, Varanasi, to study the response of fertility levels, FYM and bioinocu-
lants on yield attributes and yield and quality of wheat during 2009–2010 and 2010–
2011. The seed bacterization with the composite PGPR including (Azotobactor
chroococum W5 + Azospirillum brasilense Cd + Pseudomonas fluorescens BHU
PSB06 + Bacillus megaterium BHU PSB14) + Glomus fasciculatum (soil applica-
tion) significantly increased the growth and yield attributes and yield of the wheat
crop as compared to uninoculated control and other treatments (Parewa and Yadav
2014).
Similarly, seed inoculation with Azotobacter (strain AZO-8) significantly

increased the growth and yield attributes of wheat under dryland condition. The
seed bacterization with Azotobacter (strain AZO-8) along with 60 kg N ha−1 (urea)
and 40 kg N ha−1 (FYM) was the most responsive treatment in respect of ~ 23 and
36% increase in shoot fresh and dry weight, ~ 26 and 38% increase in root fresh and
dry weight, ~ 39% increase in test weight of seed and ~ 27% increase in yield as
compared to control. The result clearly indicated that there was a saving of 20 kg N
ha-1, when Azotobacter (strain AZO-8) culture was used along with 60 kg N ha−1
(urea) and 40 kg N ha−1 (FYM) (Singh et al. 2013). Lavakush et al. (2014) con-
ducted a pot experiment at BHU, Varanasi, to study the effect of PGPR and different
phosphorus levels on plant growth, yield and nutrient content of rice (Oryza sativa).
PGPR strains, e.g. Pseudomonas aeruginosa BHUJY16, P. aeruginosa BHUJY20,
Pseudomonas putida BHUJY13, P. putida BHUJY23 and Pseudomonas fluorescens
BHUJY29, were known as combined Pseudomonas culture (CPC). The treatment
combinations of (CPC + Azotobacter chroococcum + Azospirillum brasilense +
60 kg ha−1 P2O5) and (CPC + A. chroococcum + A. brasilense + 30 kg ha−1 P2O5)
showed greater significant grain yield of rice as compared to control. Combination
of (CPC + A. chroococcum + A. brasilense + 30 kg ha−1 P2O5) gave at par results of
plant growth attribute, yield and nutrient contents in grain and straw of rice as com-
pared to PGPR combination with 60 kg ha−1 phosphorus (P2O5). So treatment com-
binations of PGPR (CPC) with 30 kg ha−1 P were found economically cheaper than
the PGPR with 60 kg ha−1 P2O5. The potential use of PGPR for improving growth
and yield of various cereals, pulses and oil seed crops has been extensively pre-
sented (Table 12.2).
12.5.2 Effect of PGPR on Pulse Crops
Pulse crops are an important source of protein in Indian diet. But the cultivation of
pulse is confined to poor and marginal lands resulting in low productivity. Besides
this, minimal application of chemical fertilizers and cultivation as rainfed crops
could be attributed to the poor yield or productivity of pulse crops in India. Since
legume crops could fix atmospheric nitrogen by root nodulating Rhizobium sp., the
augmentation of symbiotic nitrogen-fixing bacteria along with phosphate-
solubilizing bacteria (PSB) will result in increased biomass production and eco-
nomic yield of many legume crops. Hence, the application of combination of PGPR
bacteria consisting of symbiotic nitrogen-fixing bacteria, P-solubilizers and biocon-
trol agents to legume crops would result not only in increased yield but also reduced
incidence of important diseases like root rot and wilt diseases in these crops
(Velazquez et al. 2016; Meena et al. 2014b, 2015c; Sindhu et al. 2016; Bahadur
et al. 2016a; Masood and Bano 2016).
Combined inoculation of Bradyrhizobium, Pseudomonas fluorescens and/or
Pseudomonas striata and Glomus mosseae significantly enhanced root nodulation,
biological nitrogen fixation and yield of soybean (Nishijima et al. 1988; Dubey
Table 12.2 Response of plant growth-promoting rhizobacteria on cereals, pulses and oilseed crops
Crop Bacteria Response References
Vigna radiata A. chroococcum, Bradyrhizobium Enhanced production Ahmad et al.
sp. (2016)
Cyamopsis Klebsiella pneumoniae Increased germination Singh et al.
tetragonoloba percentage and catalase (2015)
and peroxidase enzyme
activity
Arachis Rhizobium + Pseudomonas + Improve the Mathivanan et al.
hypogaea Bacillus germination and (2014)
biochemical content of
groundnut
Triticum A. chroococum W5 + A. Enhanced growth and Parewa and
aestivum brasilense Cd + P. fluorescens yield attributes and Yadav (2014)
BHU PSB06 + B. megaterium wheat yield
BHU PSB14 + G. fasciculatum
Sesamum Azospirillum + AMF + 5 t ha−1 Increased growth Abdullahi et al.
indicum PM parameters, nutrient (2013)
uptake, soil
Azospirillum
population
Glycine max B. japonicum, Enhanced grain yield Zarei et al.
phosphate-solubilizing and oil content in (2012)
soybean
Zea mays Azotobacter and Azospirillum Increased growth and Naserirad et al.
yield attributes and (2011)
protein content
Helianthus Bacillus M-13 Increased yield, oil and Ekin (2010)
annuus protein content
Helianthus Azospirillum, B. polymyxa Increased plant dry Gehan and
annuus weight Abo-Baker
(2010)
Vigna mungo Rhizobium phosphobacteria Increased growth and Selvakumar et al.
yield (2009)
Cicer arietinum Rhizobium, P. striata, B. Increased dry matter, Elkoca et al.
megaterium grain yield and P (2008)
uptake
Cajanus cajan Rhizobium, A. chroococcum, A. Enhanced growth, Tilak et al.
brasilense, P. fluorescens, P. nodulation, nitrogen (2006)
putida, B. cereus fixation and grain yield
Vigna radiate A. chroococcum, G. fasciculatum Enhanced root infection Zaidi et al.
and plant growth and (2004)
increased N and P
uptake
Arachis Fluorescent pseudomonads Enhanced yield and Dey et al. (2004)
hypogaea inhibits fungal
pathogens
Brassica nigra PSM, Azotobacter sp. Seed and stover yield Khafi et al.
(2001)
(continued)

Oryza sativa Anabaena (Nostoc), Azospirillum Produced greater grain Yanni and
sp., Azotobacter sp. yield El-Fattah (1999)
Cicer arietinum Rhizobium, Pseudomonas sp., Enhanced growth, Parmar and
Bacillus sp. nodulation and nitrogen Dadarwal (1999)
fixation and grain yield
Arachis Rhizobia, Azospirillum, Increased pod yield Balamurugan and
hypogaea phosphobacteria Gunasekaran
(1996)
Glycine max Bradyrhizobium, P. striata Enhanced biological Dubey (1996)
nitrogen fixation
Triticum Azotobacter sp. Increased the grain and Zahir et al.
aestivum straw yield, number of (1996)
tillers
Brassica nigra Azotobacter, Azospirillum Increased seed yield Chauhan et al.
(1995)
1996; Shabayey et al. 1996). Some PGPR strain enhanced legume growth, nodula-
tion and nitrogen fixation, root and shoot biomass, nodule dry weight and grain
yield in chickpea (Parmar and Dadarwal 1999) and pigeon pea (Tilak et al. 2006).
The combined inoculation of PGPR in pulse crops enhanced growth and yield of
Vigna mungo (Selvakumar et al. 2009), dry matter, grain yield and P uptake in Cicer
arietinum (Elkoca et al. 2008); yield and yield attributes, nutrient uptake, gross
returns, net return and B/C ratio (Singh and Singh 2012), dry matter, grain yield and
macro- and micronutrient uptake significantly over the uninoculated control in
legumes (Tanwar et al. 2002; Gull et al. 2004; Selvakumar et al. 2009); germination
percentage of Cyamopsis tetragonoloba; and catalase, peroxidase enzyme activity
(Singh et al. 2015a, b) and yield of Vigna radiata (Ahmad et al. 2016a, b). Thus a
number of studies have been conducted in the above view in various crops and
found that application of composite PGPR to these legume crops resulted
positively.
12.5.3 Effect of PGPR on Oilseed Crops
In the semiarid tropics, the production levels of oilseed crops are hampered due to
foliar and soilborne diseases incited by fungal pathogens. Present management of
these oilseed crop diseases using chemical fungicides has environment-related con-
cerns. Moreover the labelled fungicides are very expensive and are not affordable
by small and marginal farmers, with the utilization of these efficient PGPR as a
viable alternative to enhance the crop production. A synergistic effect in sunflower
(Helianthus annuus) with the triple inoculation of Azotobacter chroococcum,
Penicillium glaucum and Glomus fasciculatum was observed (Gururaj and
Mallikarjunaiah 1995).
Seed inoculation of mustard with Azotobacter or Azospirillum significantly

increased seed yield (Chauhan et al. 1995). Similarly, combined inoculation of
Rhizobia with Azospirillum and phosphobacteria significantly enhanced higher pod
yield in groundnut as compared to individual inoculation (Balamurugan and
Gunasekaran 1996). Desirable effects of combined inoculation with PGPR on
growth parameters, grain yield, oil content and nutrient uptake by oil seed crops
have been reported by many researchers (Galal 1997; Abdalla and Omer 2001;
Khafi et al. 2001; Patil et al. 2004; Basu and Bhadoria 2008; Ekin 2010).
The application of PGPR enhanced pod yield, haulm yield, nodule dry weight
and root length, as well as inhibited fungal pathogens like Aspergillus niger and
Sclerotium rolfsii, causing collar and stem rot in Arachis hypogaea (Dey et al. 2004;
Abdullahi et al. 2013; Mathivanan et al. 2014); increased grain yield and oil and
protein content in sunflower and soybean (Ekin 2010; Zarei et al. 2012).
12.5.4 Effect of PGPR on Spice Crops
Spice crops contribute a major portion in agricultural exports in Indian economy.

Major production constraints of spice crop are low fertility of soils, poor germina-
tion, poor input management, slow initial growth, competition from weeds and high
susceptibility to diseases, insect, pest and frost (Agarwal et al. 2001). Various spice
crops such as black pepper (Piper nigrum), fenugreek (Trigonella foenum-graecum
L.), cumin (Cuminum cyminum L.), coriander (Coriandrum sativum L.) and fennel
(Foeniculum vulgare L.) are cultivated in different agroclimatic zones in India.
These crops require more input than other agricultural crops and sustainability
maintenance is also quite significant. For these reasons, there is a need for different
techniques to increase the input efficiency; PGPR have proved to be a major tool
(Singh et al. 2015a, b, 2016; Meena et al. 2013c, 2015d).
PGPR can affect plant growth by production and release of secondary metabo-
lites, preventing deleterious effects of phytopathogenic organisms in the rhizosphere
and/or facilitating the availability and uptake of certain nutrients like N, P and Fe
from the root environment. Application of N-fixers and P-solubilizers along with
the biocontrol agents for many economically important pests and diseases resulted
in increased productivity, reduced input costs and improvement in the quality of the
products. The potential of PGPR for improving growth and yield of various spice
crops has been extensively presented (Table 12.3).
Since spice crops are cultivated in intensive cropping manner, PGPR organisms
were studied mainly in relation to their disease control or resistance mechanism and
growth promotion by the production of plant growth regulators in spice crops.
Several authors have reported that root and soil inoculation and/or foliar application
of PGPR increased plant height; number of leaves; leaf area; number of roots; bio-
mass production; disease-free rooted cuttings; uptake of N, P, K, Mg, Fe and Mn;
and yield of various spice crops. It is well documented that PGPR are used for dif-
ferent purposes in spice crops to improve plant growth and yield (Anandaraj and
Table 12.3 Response of PGPR on horticultural crops

Fragaria vesca Azotobacter sp. with Increased yield per plant Rueda et al. (2016)
mineral fertilization and soluble solid content
Fragaria Combination of Enhanced growth and yield Kumar et al. (2015a, b)
ananassa vermicompost and attributes, total soluble
PSB solids, vitamin C, total
sugars and juice content
Coriandrum Azotobacter, Increased growth Sahu et al. (2014)
sativum L. Azospirillum, PSB + components and yield traits
75% NP + 100%K
Momordica Azospirillum, PSB, P. Enhanced growth, yield, Kumar et al. (2012)
charantia fluorescens, B. subtilis quality, root length and dry
root weight
Cucurbita P. putida, B. lentus, Produced higher oil, seed Habibi et al. (2011)
pepo Azotobacter, and fruit yield
Azospirillum
Curcuma A. lipoferum, T. viride, Improved plant growth and Sumathi et al. (2011)
longa B. megaterium, P. yield
fluorescens, AM
Fragaria Bacillus, Increased the fruit yield, Esitken et al. (2010)
ananassa Pseudomonas growth and nutrient
contents
Lycopersicon Pseudomonas + Increased K uptake Ordookhani et al. (2010)
esculentum Azotobacter +
Azospirillum + AMF
Lycopersicon B. simplex, B. cereus Increased root length, Hassen and Labuschagne
esculentum shoot fresh and dry weight (2010)
Malus A. rubi, B. subtilis, B. Increased the no. of leaf, Karakurt and Aslantas
domestica gladioli, P. putida leaf area, annual shoots of (2010)
plant and concentration of
P and Zn
Rubus idaeus Bacillus sp. Increased crop yield Orhan et al. (2006)
Piper nigrum P. fluorescens, T. Enhanced height, number Thankamani et al. (2005)
harzianum of leaves, roots, leaf area
and biomass production
and mineral uptake
Piper nigrum Rhizobacteria, T. Enhance growth Anandaraj and Sarma
harzianum (2003)
Zingiber T. harzianum, P. Promoted growth and Jisha et al. (2002)
officinale fluorescens vigour of ginger and
suppressed soilborne
fungal
Piper nigrum P. fluorescens Enhanced nutrient uptake Paul et al. (2001)
Capsicum P. fluorescence Increased germination Ramamoorthy and
annuum percentage, root and shoot Samiyappan (2001)
growth, total biomass of
plants and fruit yield
(continued)

Piper nigrum Trichoderma sp., VAM Produced robust disease- Sarma (2000)
free rooted black pepper
cuttings
Solanum Azospirillum, Increased the yield and Nanthakumar and
melongena phosphobacteria yield components Veeraraghavathatham
(1999)
Solanum Azospirillum, Increased yield Thamizh and Nanjan
tuberosum phosphobacteria and (1998)
VAM
Raphanus B. japonicum Increased the dry matter Antoun et al. (1998)
sativus yield
Lycopersicon Azospirillum sp. Increased growth, fruit Sendur et al. (1998)
esculentum yield and TSS
Lycopersicon Azospirillum sp. and Increased the plant height, Terry et al. (1996)
esculentum Azotobacter root length and fruit yield
chroococcmn
Sarma 2003; Thankamani et al. 2005; Sumathi et al. 2011) and uptake of nitrogen
and potassium, enhance nutrient mobilization in black pepper (Paul et al. 2001),
produce robust disease-free rooted cutting of black pepper (Sarma 2000) and sup-
press soilborne fungal pathogens (Jisha et al. 2002).
12.5.5 Effect of PGPR on Vegetables
PGPR increase not only macro- and microelement composition but also growth of
various vegetable crops by secreting plant growth-promoting substances like growth
hormones and enzymes. Nowadays, the use of PGPR in production plays an impor-
tant role as a supplement to improve the growth and yield of several agricultural,
horticultural and medicinal plants (Rao 2008; Lugtenberg and Kamilova 2009).
There are several reports that PGPR promoted the growth of cereals, ornamentals
and vegetables and medicinal plants (Vessey 2003; Lugtenberg and Kamilova 2009;
Egamberdieva and Hoflich 2003; Egamberdieva 2011; Radha and Rao 2014). The
potential of PGPR increased germination percentage, seedling vigour, emergence,
root and shoot growth, biomass, seed weight, early flowering, grain fodder and fruit
yield of chilli (Ramamoorthy and Samiyappan 2001); root and shoot fresh weight,
root dry weight and total root length of tomato (Hassen and Labuschagne 2010); and
potassium uptake (Ordookhani et al. 2010) and higher oil, seed and fruit yield of
pumpkin (Habibi et al. 2011). Combined use of PGPR with N and P fertilizers sig-
nificantly increased the number of nonwrapper leaves, curd diameter, curd depth and
curd weight of cauliflower and induced IAA production and phosphorus solubiliza-
tion (Kaushal et al. 2011). Similarly, growth, yield, quality, root length and dry root
weight of bitter gourd are enhanced by the application of PGPR (Kumar et al. 2012).
12.5.6 Effect of PGPR on Fruit Crops
Soil-plant-PGPR associations are mediated through an exchange of chemical

metabolites. Root exudates provide energy-rich organic acids, sugars and amino
acids that are metabolized within a short time by soil microorganisms, while spe-
cialized microorganisms generate an array of biologically active compounds that
elicit plant growth promotion. PGPR enhance the growth and nutrient uptake of
fruit crops in a number of ways.
In recent years, the use of PGPR in fruit crops enhance plant growth, develop-
ment and yield in various parts of the world. Several authors have reported that root
inoculation and/or foliar spray with PGPR can result in increased germination,
seedling emergence, modified root architecture and yield of various fruit crops.
PGPR can be used for various purposes such as rooting or cutting, grafting union,
fruit setting and thinning, lateral root formation and increasing tolerance against
abiotic stress as well as growth, development and biological control with root inocu-
lation and/or spraying. In addition, PGPR have been used for different purposes in
horticultural crops like improving grafting union in grape (Kose et al. 2005), fruit
setting (Esitken et al. 2006) and fruit thinning (Esitken et al. 2009). Jeeva (1987)
reported that total soluble solids (TSS), total sugar and sugar to acid ratios were
positively influenced by the inoculation of Azospirillum to banana crop over unin-
oculated control. The potential of PGPR for improving growth and yield of various
fruit crops has been extensively documented (Table 12.3).
12.5.7 Effect of PGPR on Medicinal Plants
The World Health Organization (WHO) has estimated that ~ 80% of global popula-
tions rely on traditional medicines, mostly plant drugs, for their primary health-care
needs. Moreover, modern medicines contain ~ 25% of drugs derived from plants.
Medicinal plants are known to be rich in secondary metabolites and are potentially
useful to produce natural drugs (Pouryosef et al. 2007). Medicinal plants are very
important in modern civilization in order to obtain natural active substances known
as secondary metabolites. An introduction of PGPR and arbuscular mycorrhizal
fungi (AMF) is known to increase the growth of many plant species including
medicinal plants. The leaves of Begonia malabarica are used for the treatment of
respiratory tract infections, diarrhoea, blood cancer and skin diseases (Kiritkar and
Basu 1975). The yield, essential oil and secondary metabolites in many medicinal
plants, i.e. Phyllanthus amarus, Withania somnifera, Mentha piperita, Solanum
viarum and Ocimum basilicum, increased by application of PGPR which were
reported by many researchers (Earanna 2001; Selvaraj et al. 2008; Kaymak et al.
2008; Hemashenpagam and Selvaraj 2011; Ordookhani et al. 2011; Abdullah et al.
2012). Hence, the use of microbial associations for medicinal plants provides a
sustainable approach to improving crop quality and yield (Table 12.4).
Table 12.4 Response of PGPR on medicinal plants

Medicinal plants Bacterial inoculate Response References
Ocimum B. thuringiensis Accelerate the growth rate of Bandopadhyay
tenuiflorum A5-BRSC, B. plants (2015)
megaterium ATCC
9885
Coleus forskohlii Pantoea sp. (Cf 7), Enhanced plant growth and total Damam et al.
Pseudomonas sp. (Te biomass (2014)
1, Av30)
Ocimum VAM + biofertilizer Improve growth and yield of Paramanik and
basilicum plants Chikkaswamy
Tinospora (2014)
cordifolia
Silybum P. extremorientalis Significantly increased the root Egamberdieva et al.
marianum TSAU20 length, shoot length and total (2013)
biomass of plant
Rosmarinus A. chroococcum + B. Maximum plant height, number Abdullah et al.
officinalis megaterium + B. of branches, plant fresh and dry (2012)
circulanse weights, oil percentage and
yield in fresh herb and total
carbohydrates in herb
Sphaeranthus G. walkeri + B. Enhanced growth, biomass, Sumithra and
amaranthoides subtilis + T. viride nutrition and secondary Selvaraj (2011)
metabolites
Ocimum Pseudomonas + Increased root fresh weight, N Ordookhani et al.
basilicum Azotobacter + content and essential oil yield (2011)
Azospirillum
Withania Azospirillum, Increased plant height, root Rajasekar and
somnifera Azotobacter, length and alkaloid content Elango (2011)
Pseudomonas,
Bacillus
Solanum viarum G. aggregatum + B. Increased plant height; dry Hemashenpagam
coagulans + T. weight; P, Fe, Zn, Cu and Mn and Selvaraj (2011)
harzianum content; secondary metabolites;
and enzyme activity
Azadirachta G. fasciculatum Enhanced growth Radhika and
indica Rodrigues (2010)
Withania A. chroococcum, P. Increased the root yield, seed Kumar et al. (2009)
somnifera putida yield, number of off shoots per
plant and plant height
Begonia G. mosseae + B. Enhanced the plant growth, Selvaraj et al.
malabarica coagulans + T. viride biomass yield, nutrients and (2008)
secondary metabolites
Mentha piperita B. megaterium Improved root length and dry Kaymak et al.
matter content of root (2008)
Azadirachta G. fasciculatum, G. Increased height, dry weight, Venkateswarlu
indica mosseae root colonization, phosphorus (2008)
content and azadirachtin content
in seed kernels
Phyllanthus G. fasciculatum + B. Improved growth and yield Earanna (2001)
amarus coagulans + T.
Withania harzianum
somnifera
12.5.8 Effect of PGPR on Soil Health
PGPR communities affect directly or indirectly the plant physiology, nutritional and
physico-chemical properties of rhizospheric soils through their metabolic activities.
PGPR are important components of integrated farming, which help to nourish the
crops through required nutrients. These PGPR help to fix atmospheric nitrogen;
solubilize and mobilize phosphorus; translocate minor elements like Mo, Zn, Cu,
etc. to the plants; produce plant growth-promoting hormones like IAA and GA; and
improve soil structure by production of polysaccharides, thus helps to improve the
soil health and increase crop production. They are reported to increase uptake of
nutrient elements like Ca, K, Fe, Cu, Mn and Zn through proton pump ATPase
(Mantelin and Touraine 2004).
The importance of PGPR on maintaining soil fertility is well studied by many
scientists (Glass et al. 2002; Das and Singh 2014; Parewa et al. 2014b). Inoculation
of seeds with PGPR significantly increased the values of available P, microbial pop-
ulation, acid phosphatase, alkaline phosphatase, dehydrogenase activity in soil and
yields over uninoculated seeds (Hemashenpagam and Selvaraj 2011).
As per the findings of Singh et al. (2012) who studied the effect of integrated
nutrient management on pigeon pea-based intercropping system and soil properties,
results revealed that application of different treatments did not affect the bulk den-
sity and particle density, but porosity significantly increased after harvest of pigeon
pea in both years. Inoculation of seeds with PSB (Bacillus polymyxa) recorded sig-
nificantly higher values of available P, microbial population, dehydrogenase activity
in soil and yields over uninoculated seeds. Application of FYM at 5.0 t ha−1 increased
organic carbon; available N, P and K contents; biological properties of soil, viz.
microbial population and dehydrogenase activity; and yield component of crops and
pigeon pea equivalent over no application of FYM.
Das and Singh (2014) have undertaken a field experiment in the organic farming
plot of the BHU, Varanasi, to study the effects of manures and PGPR on soil proper-
ties. Organic manures such as farm yard manure (FYM), cereal compost, legume
compost and combination of all the manures with or without PGPR (Rhizobium +
Azotobacter + Pseudomonas + Trichoderma) were applied at 5 t ha−1 in each plot.
The combined application of cereal compost and legume compost and FYM along
with PGPR significantly increased organic carbon, available N, P2O5, and K2O and
sulphur as compared to control or individual application. Similarly, Parewa et al.
(2014b) conducted a field experiment during 2009–2010 and 2010–2011 at the
Agricultural Research Farm, Banaras Hindu University, Varanasi (U.P.), to study the
effect of fertilizer levels, FYM and bioinoculants and their interaction effect on soil
properties. The treatments consisted of four levels of recommended dose of fertil-
izer (0, 50, 75 and 100% NPK), two levels of farmyard manure (0, 10 t ha-1) and
four inoculations [no inoculation, PGPR (Azotobactor chroococum W5 +
Azospirillum brasilense Cd + Pseudomonas fluorescens BHU PSB06 + Bacillus
megaterium BHU PSB14), VAM (vesicular-arbuscular mycorrhiza) and
PGPR+VAM]. The results revealed that application of different treatments did not
affect the pH and EC, but decreased bulk density and water holding capacity, organic
carbon and CEC significantly improved after harvest of wheat. The dehydrogenase,
phosphatase enzyme activity, soil microbial biomass carbon (SMBC), available N,
P and K and microbial population of soil after the harvest of wheat were increased
significantly due to the integration of inorganic fertilizers with FYM and bioinocu-
lants. Positive impact of biological and organic manure application has been
recorded with an additional advantage of reduction of chemical fertilizer use.
12.6 Conclusions
Over the years, PGPR have received worldwide importance and acceptance for its
agricultural benefits. These microorganisms are the potential tools for sustainable
agriculture because they not only ensure the availability of essential nutrients to
plants but also enhance the nutrient use efficiency. PGPR are the potential tools for
environmentally sustainable approach to increase crop production and soil fertility.
There is overwhelming evidence in the literature indicating that PGPR can be a true
success story in sustainable agriculture. PGPR enhanced the growth and develop-
ment of plants and soil health directly and indirectly through several mechanisms
and can allow significant reduction in the use of pesticides and chemical fertilizers.
The production of plant growth substances changes root morphology resulting in
greater root surface area for the uptake of nutrients, nitrogen fixation, phosphate
solubilization, siderophore production and antagonism to soilborne root pathogens.
Plant age and the soil chemical, physical and biological properties will greatly influ-
ence the outcome of PGPR inoculation.
Acknowledgments We are thankful to the editors and anonymous reviewers for their productive
comments, which help us to improve the manuscript.
References
Abdalla MH, Omer SA (2001) Survival of Rhizobia/Bradirhizobia and a rock phosphate solubi-
lizing fungus Aspergillus niger on various carriers from some agroindustrial wastes and their
effect on nodulation and growth of faba bean and soybean. J Plant Nutr 24:261–272
Abdullah AT, Hanafy MS, EO EL-G, Ali ZH (2012) Effect of compost and some biofertilizers on
growth, yield, essential oil, productivity and chemical composition of Rosmarinus officinalis L.
plants. J Hortic Sci Ornamental Plant 4(2):201–214
Abdullahi R, Sheriff HH, Lihan S (2013) Combine effect of bio-fertilizer and poultry manure on
growth, nutrients uptake and microbial population associated with sesame (Sesamumindicum
L) in North-eastern Nigeria. IOSR J Environ Sci, Toxicol Food Technol 5(5):60–65
Afzal A, Bano A (2008) Rhizobium and phosphate solubilizing bacteria improve the yield and
phosphorus uptake in wheat (Triticum aestivum). Int J Agric Biol 10:85–88
Agarwal S, Sastry EVD, Sharma RK (2001) Seed spices-production, quality, export. Pointer
Publishers, Jaipur
Ahemad M, Khan MS (2012) Alleviation of fungicide-induced phytotoxicity in greengram [Vigna

radiata (L.) Wilczek] using fungicide tolerant and plant growth promoting Pseudomonas
strain. Saudi J Biol Sci 19:451–459
Ahmad R, Arshad M, Khalid A, Zahir ZA (2008) Effectiveness of organic−/bio-fertilizer supple-
mented with chemical fertilizers for improving soil water retention, aggregate stability, growth
and nutrients uptake of maize (Zea mays L.) J Sustain Agric 31:57–77
Ahmad E, Zaidi A, Khan MS (2016a) Effects of plant growth promoting rhizobacteria on the per-
formance of greengram under field conditions. Jordan J Bio Sci 9(2):79–88
Ahmad M, Nadeem SM, Naveed M, Zahir ZA (2016b) Potassium-solubilizing bacteria and their
https://doi.org/10.1007/978-81-322-2776-2_21
Ahmed A, Hasnain S (2008) Auxin producing Bacillus sp.: auxin quantification and effect on the
growth of Solanum tuberosum. J Biotechnol 136:766–767
Anandaraj M, Sarma YR (2003) The potential of IISR-6 in disease management of spice crops. In:
Reddy MS, Anandaraj M, Eapen SJ, Sarma YR, Kloepper JW (eds) Sixth international work-
shop on plant growth promoting rhizobacteria. Indian Institute, Calicut, pp 27–39
Anjum M, Sajjad M, Akhtar N, Quereshi M, Iqbal A, Jami A, Hassan M (2007) Response of cotton
to plant growth promoting rhizobacteria (PGPR) inoculation under different levels of nitrogen.
J Agric Res 45:135–143
Antoun H, Beauchamp CJ, Goussard N, Chabot R, Lalande R (1998) Potential of Rhizobium and
Bradyrhizobium species as plant growth promoting rhizobacteria on non-legumes: effect on
radishes (Raphanus sativus L.) Plant Soil 204:57–67
Arshad M, Frankenberger WP Jr (1993) Microbial production of plant growth regulators. In:
Metting FB (ed) Soil microbial ecology – application in agricultural and environmental man-
agement. Dekker, New York, pp 307–347
Arshad M, Saleem M, Hussain S (2007) Perspectives of bacterial ACC deaminase in phytoreme-
diation. Trends Biotechnol 25:356–362
Arshad M, Shaharoona B, Mahmood T (2008) Inoculation with Pseudomonas spp. containing
ACCdeaminase partially eliminates the effects of drought stress on growth, yield and ripening
of pea (Pisum sativum L.) Pedosphere 18:611–620
Aslantas R, Cakmakci R, Sahin F (2007) Effect of plant growth promoting rhizobacteria on young
apple tree growth and fruit yield under orchard conditions. Scientia Hortic 111:371–377
219431
Balamurugan S, Gunasekaran S (1996) Effect of combined inoculation on Rhizobium sp.
Azospirillum and phosphobacteria in groundnut. Madras Agric J 83(8):506–508
Bandopadhyay S (2015) Effect of dual inoculation of plant growth promoting rhizobacteria on dif-
ferent non-leguminous plants under pot condition. Indian J Microbiol Res 2(1):20–26
Baset Mia MA, Shamsuddin ZH, Wahab Z, Marziah M (2010) Effect of plant growth promot-
ing rhizobacterial (PGPR) inoculation on growth and nitrogen incorporation of tissue cultured
musa plantlets under nitrogen free hydroponics condition. Aust J Crop Sci 4:85–90
Basu M, Bhadoria PBS (2008) Performance of groundnut (Arachis hypogaea Linn) under nitrogen
fixing and phosphorous solubilizing microbial inoculants with different levels of cobalt in allu-
vial soils of Eastern India. Agron Res 6:15–25
Beneduzi A, Moreira F, Costa PB, Vargas LK, Lisboa BB, Favreto R, Baldani JI, Passaglia LMP
(2013) Diversity and plant growth promoting evaluation abilities of bacteria isolated from sug-
arcane cultivated in the South of Brazil. Appl Soil Ecol 63:94–104
Biswas JC, Ladha JK, Dazzo FB, Yanni YG, Rolfe BG (2000) Rhizobial inoculation influences
seedling vigor and yield of rice. Agron J 92:880–886
Boddey RM, Dobereiner J (1995) Nitrogen fixation associated with grasses and cereals: recent
progress and perspectives for the future. Fert Res 42:241–250
Bowen GD, Rovira AD (1999) The rhizosphere and its management to improve plant growth. Adv
Agron 66:100–102
Chanway CP, Holl FB (1992) Influence of soil biota on Douglas fir (Pseudotsuga menziesii) seed-
ling growth: the role of rhizosphere bacteria. Can J Bot 70:1025–1031
Chauhan DR, Paroda S, Kataria OP, Singh KP (1995) Response of Indian mustard (Brassica jun-
cea) to biofertilizers and nitrogen. Indian J Agron 40:86–90
Cheng Z, Park E, Glick BR (2007) 1-Aminocyclopropane-1-carboxylate (ACC) deaminase
from Pseudomonas putida UW4 facilitates the growth of canola in the presence of salt. Can
Damam M, Gaddam B, Kausar R (2014) Effect of plant growth promoting rhizobacteria (PGPR)
on Coleus forskohlii. Int J Curr Microbiol Appl Sci 3(9):266–274
org/10.1007/978-81-322-2776-2_20
Das I, Singh AP (2014) Effect of PGPR and organic manures on soil properties of organically
cultivated mungbean. The Bioscan 9(1):27–29
Dawe D, Dobermann A (1999) Defining productivity and yield. In: IRRI discussion paper series
no 33 Manila Philippines, pp 13
Dey R, Pal KK, Bhatt DM, Chauhan SM (2004) Growth promotion and yield enhancement of pea-
nut (Arachis hypogaea L.) by application of plant growth-promoting rhizobacteria. Microbiol
Res 159(4):371–394
Dobbelaere S, Croonenborghs A, Thys A, Ptacek D (2001) Responses of agronomically important
crops to inoculation with Azospirillum. Aust J Plant Physiol 28:871–879
pp 77–98. https://doi.org/10.1007/978-81-322-2776-2_6
org/10.1007/978-81-322-2776-2_19
Dubey SK (1996) Combined effect of Bradyrhizobium japonicum and phosphate-solubilizing
Pseudomonas striata on nodulation, yield attributes and yield of rainfed soybean (Glycine
max) under different sources of phosphorus in Vertisols. Indian J Microbiol 33:61–65
Earanna N (2001) VA mycorrhizal association in medicinal plants of South Eastern dry zone of
Karnataka and response of Phyllanthus amarus and Withania somnifera to inoculation with
VAM fungi and plant growth promoting Rhizomicro-organisms. University of Agricultural
Sciences, GKVK, Bangalore
Egamberdieva D (2011) Survival of Pseudomonas extremorientalis TSAU20 and P. chlororaphis
TSAU13 in the rhizosphere of common bean (Phaseolus vulgaris) under saline conditions.
Plant Soil Environ 57:122–127
Egamberdieva D, Hoflich G (2003) The effect of associative bacteria from different climates on
plant growth of pea at different soils and temperatures. Arch Agron Soil Sci 49:203–213
Egamberdieva D, Jabborova D, Mamadalieva N (2013) Salt tolerant Pseudomonas extremorien-

talis able to stimulate growth of Silybum marianum under salt stress. Med Aromat Plant Sci
Biotechnol 7:7–10
Ekin Z (2010) Performance of phosphate solubilizing bacteria for improving growth and yield of
sunflower (Helianthus annuus L.) in the presence of phosphorous fertilizer. Afr J Biotechnol
9:3794–3800
Elkoca E, Kantar F, Sahin F (2008) Influence of nitrogen fixing and phosphate solubilizing bacteria
on nodulation, plant growth and yield of chickpea. J Plant Nutr 33:157–171
Esitken A, Pirlak L, Turan M, Sahin F (2006) Effects of floral and foliar application of plant growth
promoting rhizobacteria (PGPR) on yield, growth and nutrition of sweet cherry. Sci Hortic
110:324–327
Esitken A, Pirlak L, Ipek M, Donmez MF, Cakmakci R, Sahin F (2009) Fruit bio-thinning by plant
growth promoting bacteria (PGPB) in apple cvs. golden delicious Braeburn. Biol Agric Hortic
26:379–390
Esitken A, Yildiz HE, Ercisli S, Donmez MF, Turan M, Gunes A (2010) Effects of plant growth
promoting bacteria PGPB on yield, growth and nutrient contents of organically grown straw-
berry. Sci Hortic 124:62–66
Flaishman MA, Eyal Z, Zilberstein A, Voisard C, Hass D (1996) Suppression of Septoria trit-
ici blotch and leaf rust of wheat by recombinant cyanide-producing strains of Pseudomonas
putida. Mol Plant-Microbe Interact 9:642–645
Galal YGM (1997) Dual inoculation with strains of Bradyrhizobium japonicum and Azospirillum
brasilense to improve growth and biological nitrogen fixation of soybean (Glycine max L.) Biol
Garci’a JL, Probanza A, Ramos B, Manero FG (2003) Effects of three plant growth promoting
rhizobacteria on the growth of seedlings of tomato and pepper in two different sterilized and
nonsterilized peats. Arch Agron Soil Sci 49:119–127
Gehan GM, Abo-Baker AA (2010) Effect of bio- and chemical fertilization on growth of sunflower
(Helianthus annuus L.) at south valley area. Asian J Crop Sci 2(3):137–146
Gerhardson B (2002) Biological substitutes for pesticides. Trends Biotechnol 20:338–343
Ghevariya KK, Desai PB (2014) Rhizobacteria of sugarcane: in vitro screening for their plant
growth promoting potentials. Res J Recent Sci 3:52–58
Glass ADM, Britto DT, Kaiser BN, Kinghorn JR, Kronzucker HJ, Kumar A, Okamoto M, Rawat
S, Siddiqi MY, Unkles SE, Vidmar JJ (2002) The regulation of nitrate and ammonium transport
systems in plants. J Exp Bot 53:855–864
Glick BR (1995) The enhancement of plant growth by free-living bacteria. Can J Microbiol
41:109–117
Glick BR (2004) Teamwork in phytoremediation. Nat Biotechnol 22:526–527
Glick BR, Patten CL, Holguin G, Penrose DM (1999) Biochemical and genetic mechanisms used
by plant growth promoting bacteria. Imperial College Press, London, pp 1008–1015
Glick BR, Todorovic B, Czarny J, Cheng Z, Duan J, McConkey B (2007) Promotion of plant
growth by bacterial ACC deaminase. Crit Rev Plant Sci 26:227–242
Gravel V, Antoun H, Tweddell R (2007) Growth stimulation and fruit yield of greenhouse tomato
plants by inoculation with Pseudomonas putida or Trichoderma atroviride: possible role of
indole acetic acid (IAA). Soil Biol Biochem 39:1968–1977
Grichko VP, Glick BR (2001) Amelioration of flooding stress by ACC deaminase-containing plant
growth-promoting bacteria. Plant Physiol Biochem 39:11–17
Gryndler M (2000) Interactions of arbuscular mycorrhizal fungi with other soil organisms. In:
Kapulnik Y, Douds DD (eds) Arbuscular mycorrhizas: physiology and function. Kluwer,
Dordrecht, pp 239–262
Gull M, Hafeez FY, Saleem M, Malik KA (2004) Phosphorus uptake and growth promotion of
chickpea by co-inoculation of mineral phosphate solubilizing bacteria and a mixed rhizobial
culture. Aust J Exp Agric 44:623–628
Gupta AK (2004) The complete technology book on biofertilizers and organic farming. National
Institute of Industrial Research Press, New Delhi
Gupta A, Rai V, Bagdwal N, Goel R (2005) In situ characterization of mercury resistant growth
promoting fluorescent pseudomonads. Microbiol Res 160:385–388
Gururaj R, Mallikarjunaiah R (1995) Interactions among Azotobacter chroococcum, Penicillium
glaucum and Glomus fasciculatum and their effect on the growth and yield of sunflower. Helia
18(23):73–84
Habibi A, Heidari G, Sohrabi Y, Badakhshan H, Mohammadi K (2011) Influence of bio, organic
and chemical fertilizers on medicinal pumpkin traits. J Med Plant Res 5(23):5590–5597
Hafeez FY, Yasmin S, Ariani D, Mehboob-ur-Rahman ZY, Malik KA (2006) Plant growth promot-
ing bacteria as biofertilizer. Agron Sustain Dev 26:143–150
Han J, Sun L, Dong X, Cai Z, Sun X, Yang H, Wang Y, Song W (2005) Characterization of a novel
plant growth promoting bacteria strain Delftia tsuruhatensis HR4 both as a diazotroph and a
potential biocontrol agent against various plant pathogens. Syst Appl Microbiol 28:66–76
Hassen AI, Labuschagne N (2010) Root colonization and growth enhancement in wheat and
tomato by rhizobacteria isolated from the rhizoplane of grasses. World J Microbiol Biotechnol
26:1837–1846
Hemashenpagam N, Selvaraj T (2011) Effect of arbuscular mycorrhizal (AM) fungus and plant
growth promoting rhizomicroorganisms (PGPR’s) on medicinal plant Solanum viarum seed-
lings. J Environ Biol 32:579–583
Indiragandhi P, Anandham R, Madhaiyan M, Sa TM (2008) Characterization of plant growth pro-
moting traits of bacteria isolated from larval guts of diamondback moth Plutella xylostella
(Lepidoptera: Plutellidae). Curr Microbiol 56:327–333
9(2):1211–1221
Jeeva S (1987) The effect of Azospirillum on the growth and development of banana. Tamil Nadu
Agricultural University Coimbatore, Coimbatore
Jeon J, Lee S, Kim H, Ahn T, Song H (2003) Plant growth promotion in soil by some inoculated
microorganisms. J Microbiol 41:271–276
Jisha PJ, Paul D, Kumar A, Anandaraj M, Sarma YR (2002) Biocontrol consortium for a cropping
system involving black pepper, ginger and cardamom. Indian Phytopath 55:374
Karakurt H, Aslantas R (2010) Effects of some plant growth promoting rhizobacteria treated twice
on flower thinning, fruit set and fruit properties on apple. Afr J Agric Res 5(5):384–388
Kaushal M, Kaushal R, Thakur BS, Spehia RS (2011) Effect of plant growth promoting rhizobac-
teria at varying levels of N and P fertilizers on growth and yield of cauliflower in mid hills of
Himachal Pradesh. J Farm Sci 1(1):19–26
Kaymak HC, Yarali F, Guvenc I, Figen DM (2008) The effect of inoculation with plant growth
rhizobacteria (PGPR) on root formation of mint (Mentha piperita L.) cuttings. Afr J Biotech
7(24):4479–4483
Kennedy IR, Choudhury ATMA, Kecske’s ML (2004) Non-symbiotic bacterial diazotrophs in crop
farming systems: can their potential for plant growth promotion be better exploited? Soil Biol
Biochem 36:1229–1244
Khafi HR, Mehat AC, Pethani KV, Buhecha KV (2001) Effect of soil enrichment in conjunction
with organic and inorganic fertilizers on pearl millet-mustard crop sequence. International con-
ference on natural farming Eco balance, Hisar, pp 113
Khalid A, Arshad M, Zahir ZA (2004) Screening of plant growth promoting rhizobacteria for
improving growth and yield of wheat. J Appl Microbiol 96:473–480
Khalid A, Arshad M, Zahir ZA (2006) Phytohormones: microbial production and applications. In:
Uphoff N, Ball AS, Fernandes E, Herren H, Husson O, Laing M, Palm C, Pretty J, Sanchez P,
Sanginga N, Thies J (eds) Biological approaches to sustainable soil systems. Taylor & Francis,
Boca Raton, pp 207–220
Khalid A, Arshad M, Shaharoona B, Mahmood T (2009) Plant growth promoting rhizobacteria and
sustainable agriculture. In: Khan MS (ed) Microbial strategies for crop improvement. Springer,
Berlin, pp 133–160
Khan AG (2005) Role of soil microbes in the rhizospheres of plants growing on trace metal con-
taminated soils in phytoremediation. J Trace Elem Med Biol 18:355–364
Khan MR, Khan SM (2001) Biomanagement of fusarium wilt of tomato by the soil application of
certain phosphate-solubilizing microorganisms. Int J Pest Manag 47:227–231
Khan MS, Zaidi A, Wani PA (2007) Role of phosphate solubilizing microorganisms in sustainable
agriculture: a review. Agron Sustain Dev 27:29–43
Kiritkar KR, Basu BD (1975) Indian medicinal plants, 2nd edn. Indological and Oriental
Publishers, Delhi, p 215
Kloepper JW (1993) Plant growth promoting rhizobacteria as biological control agents. In: Metting
FB (ed) Soil microbial ecology: applications in agricultural and environmental management.
Dekker, New York, pp 255–274
Kloepper JW, Schroth MN (1978) Plant growth-promoting rhizobacteria on radishes. Fourth Int
Conf Plant Pathog Bacteria, Angers, France 2:879–882
Kloepper JW, Lifshitz R, Schroth MN (1988) Pseudomonas inoculants to benefit plant production.
ISI Atlas Sci Anim Plant Sci 8:60–64
Kloepper JW, Gutierrez-Estrada A, Mclnroy JA (2007) Photoperiod regulates elicitation of
growth promotion but not induced resistance by plant growth-promoting rhizobacteria. Can
Kohler J, Hernandez JA, Caravaca F, Roldan A (2009) Induction of antioxidant enzymes is involved
in the greater effectiveness of a PGPR versus AM fungi with respect to increasing the tolerance
of lettuce to severe salt stress. Environ Exp Bot 65:245–252
Kose C, Guleryuz M, Sahin F, Demirtas I (2005) Effects of some plant growth promoting rhizobac-
teria (PGPR) on graft union of grapevine. J Sustain Agric 26:139–147
Kumar B, Trivedi P, Pandey A (2007) Pseudomonas corrugata: a suitable bacterial inoculant for
maize grown under rainfed conditions of Himalayan region. Soil Biol Biochem 39:3093–3100
Kumar V, Solanki AS, Sharma S (2009) Yield and economics of Withania somnifera influenced
by dual inoculation of Azotobacter chroococcum and Pseudomonas putida. Turk J Biol
33:219–223
Kumar KSN, Sowmyamala BV, Kumar PGS, Vasudev PN, Kumar RV, Nagaraj HT (2012) Effect
of plant growth promoting rhizobacteria (PGPR) on growth and yield of bitter gourd. Int J Appl
Biol Pharm Technol 3(1):1–7
Kumar N, Singh HK, Mishra PK (2015a) Impact of organic manures and biofertilizers on growth
and quality parameters of Strawberry cv Chandler. Indian J Sci Technol 8(15):1–6
Kumar A, Bahadur I, Maurya BR, Raghuwanshi R, Meena VS, Singh DK, Dixit J (2015b) Does
org/10.1007/s00344-016-9663-5
Lavakush YJ, Verma JP, Jaiswal DK, Kumar A (2014) Evaluation of PGPR and different concen-
tration of phosphorus level on plant growth, yield and nutrient content of rice (Oryza sativa).
Ecol Eng 62:123–128
Liu L, Kloepper JW, Tuzun S (1995) Induction of systemic resistance in cucumber against bacte-
rial angular leaf spot by plant growth promoting rhizobacteria. Phytopathology 85:843–847
Lovaisa NC, Guerrero Molina MF, PGA DQ, Salazar SM (2015) Response of strawberry plants
inoculated with Azospirillum and Burkholderia at field conditions. Rev Agron Noroeste Argent
35(1):33–36
Lugtenberg B, Kamilova F (2009) Plant growth promoting rhizobacteria. Annu Rev Microbiol
63:541–556
Mantelin S, Touraine B (2004) Plant growth-promoting bacteria and nitrate availability: impacts on
root development and nitrate uptake. J Exp Bot 55:27–34. https://doi.org/10.1093/jxb/erh010
Marschner H, Romheld V (1994) Strategies of plants for acquisition of iron. Plant Soil
165(2):261–274
Masalha J, Kosegarten H, Elmaci O, Mengel K (2000) The central role of microbial activity for
iron acquisition in maize and sunflower. Biol Fertil Soils 30:433–439
https://doi.org/10.1007/978-81-322-2776-2_10
Mathivanan S, Chidambaram ALA, Sundaramoorthy P, Baskaran L, Kalaikandhan R (2014) The
effect of plant growth promoting Rhizobacteria on groundnut (Arachis hypogaea L.) seed ger-
mination and biochemical constituents. Int J Curr Res Acad Rev 2(9):187–194
Maurya BR, Meena VS, Meena OP (2014) Influence of inceptisol and alfisol’s potassium solubiliz-
ing bacteria (KSB) isolates on release of K from waste mica. Vegetos 27:181–187
potassium from waste mica. Agric Sustain Dev 1:53–56
mica. Bangladesh J Bot 43:235–237
jclepro.2015.04.044
Meena RK, Singh RK, Singh NP, Meena SK, Meena VS (2016a) Isolation of low temperature
surviving plant growth-promoting rhizobacteria (PGPR) from pea (Pisum sativum L.) and
documentation of their plant growth promoting traits. Biocatalysis Agic Biotechnol 4:806–811
conditions. Biocatalysis Agric Biotechnol 6:68–75
Meena VS, Maurya BR, Meena SK, Meena RK, Kumar A, Verma JP, Singh NP (2017) Can bacil-
lus species enhance nutrient availability in agricultural soils? In: Islam MT, Rahman M, Pandey
Minorsky PV (2008) On the inside. Plant Physiol 146:323–324
Mubeen F, Aslam A, Radl V, Schloter M, Malik KA, Hafeez FY (2008) Role of nature’s fertility
partners with crop protectants for sustainable agriculture. In: Dakora FD et al (eds) Biological
nitrogen fixation: towards poverty alleviation through sustainable agriculture. Springer,
Dordrecht, pp 153–154
Muratova AY, Turkovskaya OV, Antonyuk LP, Makarov OE, Pozdnyakova LI, Ignatov VV (2005)
Oil-oxidizing potential of associative rhizobacteria of the genus Azospirillum. Microbiology
74:210–215
Naiman AD, Latronico A, Garca de Salamone IE (2009) Inoculation of wheat with Azospirillum
brasilense and Pseudomonas fluorescens: impact on the production and culturable rhizosphere
microflora. Eur J Soil Biol 45:44–51
Nanthakumar S, Veeraraghavathatham D (1999) Effect of integrated nutrient management on yield
and yield attributes of brinjal (Solanum melongena). South Indian Hortic 47:42–48
Narayanasamy P (2008) Molecular biology in plant pathogenesis and disease management.
Springer, Dordrecht
Naserirad H, Soleymanifard A, Naseri R (2011) Effect of integrated application of biofertilizer
on grain yield, yield components and associated traits of maize cultivars. American-Eurasian
J. Am-Eurasian J Agric Environ Sci 10(2):271–277
Nishijima F, Evans WR, Vesper SJ (1988) Enhanced nodulation of soybean by Bradyrhizobium in
the presence of pseudomonas fluorescens. Plant Soil 111:149–150
Nowak J (1998) Review benefits of in vitro “bacterization” of plant tissue cultures with microbial
inoculants. In Vitro Cell Dev Biol Plant 34:122–130
Okon Y, Labandera-Gonzalez CA (1994) Agronomic applications of Azospirillum. In: Ryder
MH, Stephens PM, Bowen GD (eds) Improving plant productivity with rhizosphere bacteria.
Commonwealth scientific and industrial research organization, Adelaide, pp 274–278
Ordookhani K, Khavazi K, Moezzi A, Rejali F (2010) Influence of PGPR and AMF on antioxidant
activity, lycopene and potassium contents in tomato. Afr J Agric Res 5(10):1108–1116
Ordookhani K, Sharafzadeh SH, Zare M (2011) Influence of PGPR on growth, essential oil and
nutrients uptake of sweet basil. Adv Environ Biol 5(4):672–677
Orhan E, Esitken A, Ercisli S, Turan M, Sahin F (2006) Effects of plant growth promoting rhizo-
bacteria (PGPR) on yield, growth and nutrient contents in organically growing raspberry. Sci
Hortic 111:38–43
Paramanik RC, Chikkaswamy BK (2014) Effects of VAM and biofertilizers on some medicinal
plants. Int J Curr Microbiol Appl Sci 3(6):1016–1027
Parewa HP, Yadav J (2014) Response of fertility levels, FYM and bioinoculants on yield attributes,
yield and quality of wheat. Agric Sustain Dev 2(1):5–10
Parewa HP, Yadav J, Rakshit A (2014a) Effect of fertilizer levels, FYM and bioinoculants on
soil properties in inceptisol of Varanasi, Uttar Pradesh, India. Int J Agric Environ Biotech
7(3):517–525
Parewa HP, Yadav J, Rakshit A, Meena VS, Karthikeyan N (2014b) Plant growth promoting rhizo-
Parmar N, Dadarwal KR (1999) Stimulation of nitrogen fixation and induction of flavonoid like
compounds by rhizobacteria. J Appl Microbiol 86:36–44
Patil AB, Naik NM, Nirmalnath PJ, Alagawadi AR (2004) Effect of combined inoculations of plant
prowth promoting rhizobacteria (PGPR) on the growth and productivity of soybean (Glycine
max L.) Karnataka J Agric Sci 17(4):731–735
Patten CL, Glick BR (2002) Role of Pseudomonas putida indole-acetic acid in development of the
host plant root system. Appl Environ Microbiol 68:3795–3801
Paul D, Kumar A, Anandaraj M, Sarma YR (2001) Studies on the suppressive action of fluorescent
pseudomonas on Phytophthora capsici, the foot rot pathogen of black pepper. Indian Phytopath
54:515
Persello-Cartieaux F, Nussaume L, Robaglia C (2003) Tales from the underground: molecular
plant rhizobacteria interactions. Plant Cell Environ 26:189–199
Pouryosef M, Chaichi MR, Mazaheri D, Fakhretabatabaii M, Jafari AA (2007) Effect of different
soil fertilizing systems on seed and mucilage yield and seed P content of Isabgol (Plantago
ovata Forsk). Asian J Plant Sci 6(1088):1092
Radha TK, Rao DLN (2014) Plant growth promoting bacteria from cow dung based biodynamic
preparations. Indian J Microbiol. https://doi.org/10.1007/s12088-014-0468-6
Radhika KP, Rodrigues BF (2010) Arbuscular mycorrhizal fungal diversity in some commonly
occurring medicinal plants of Western Ghats, Goa region. J For Res 21:45–52
org/10.1007/978-81-322-2776-2_4
Rajasekar S, Elango R (2011) Effect of microbial consortium on plant growth and improvement of
alkaloid content in Withania somnifera (Ashwagandha). Curr Bot 2(8):27–30
Ramamoorthy V, Samiyappan R (2001) Induction of defense related genes in Pseudomonas fluo-
rescence treated chili plants in response to infection by Colletotrichum capsici. J Mycol Plant
Pathol 31:146–155
Rao DLN (2008) Biofertilizer research progress (2004–07). All India network project on biofertil-
izers. IISS, Bhopal, p 105
Riggs PJ, Chelius MK, Iniguez AL, Kaeppler SM, Triplett EW (2001) Enhanced maize produc-
tivity by inoculation with diazotrophic bacteria. Aust J Plant Physiol 28:829–836. https://doi.
org/10.1071/PP01045
Rokhbakhsh-Zamin F, Sachdev D, Kazemi-Pour N, Engineer A, Pardesi KR, Zinjarde S,
Dhakephalkar PK, Chopade BA (2011) Characterization of plant growth promoting traits
of Acinetobacter species isolated from rhizosphere of Pennisetum glaucum. J Microbiol
Rueda D, Valencia V, Soria N, Rueda BB, Manjunatha B, Kundapur RK, Selvanayagam M
(2016) Effect of Azospirillum spp. and Azotobacter spp. on the growth and yield of strawberry
(Fragaria vesca) in hydroponic system under different nitrogen levels. J Appl Pharma Sci
6(01):48–54
pp 127–136. https://doi.org/10.1007/978-81-322-2776-2_9
Saha M, Maurya BR, Meena VS, Bahadur I, Kumar A (2016b) Identification and characteriza-
tion of potassium solubilizing bacteria (KSB) from Indo-Gangetic Plains of India. Biocatalysis
Agric Biotechnol 7:202–209
Sahu RL, Sahu H, Kumar S (2014) Effect of application of inorganic fertilizers and biofertilizers
on growth components and yield traits of coriander (Coriandrum sativum L.) Int J Agric Sci
10(1):433–436
Sarma YR (2000) Diseases of black pepper and their management. Training manual. Indian
Institute of Spices Research, Calicut
Scher FM, Baker R (1982) Effect of Pseudomonas putida and a synthetic iron chelator on induc-
tion of soil suppressiveness to Fusarium wilt pathogens. Phytopathology 72:1567–1573
Selvakumar G, Lenin M, Thamizhiniyan P, Ravimycin T (2009) Response of biofertilizers on the
growth and yield of blackgram (Vigna mungo L.) Recent Res Sci Technol 1(4):169–175
Selvaraj T, Rajeshkumar S, Nisha MC, Wondimu L, Tesso M (2008) Effect of Glomus mosseae
and plant growth promoting rhizomicroorganisms (PGPR’s) on growth, nutrients and content
of secondary metabolites in Begonia malabarica Lam. Maejo Int J Sci Technol 2:516–525
Sendur KS, Natarajan S, Thamburaj S (1998) Effect of organics and inorganic fertilizers on growth,
yield and quality of tomato. South Indian Hortic 46(3–4):203–205
Shabayey VP, Smolin VY, Mudrik VA (1996) Nitrogen fixation and CO2 exchange in soybeans
inoculated with mixed cultures of different microorganisms. Biol Fertil Soils 23:425–430
Shanahan P, O’Sullivan DJ, Simpson P, Glennon JD, O’Gara F (1992) Isolation of 2, 4-diacetyl
phloroglucinol from a fluorescent pseudomonas and investigation of physiological parameters
influencing its production. Appl Environ Microbiol 58:353–358
Singal R, Gupta R, Saxena RK (1994) Rock phosphate solubilization under alkaline conditions by
Aspergillus japonicus and A. foetidus. Folia Microbiol 39:33–36
Singh S, Singh JP (2012) Effect of organic and inorganic nutrient sources on some soil properties
and wheat yield. J Indian Soc Soil Sci 60(3):237–240
Singh A, Singh VK, Chandra R, Srivastava PC (2012) Effect of integrated nutrient management
on pigeon pea-based intercropping system and soil properties in Mollisols of the Tarai region.
J Indian Soc Soil Sci 60(1):38–44
Singh NK, Chaudhary FK, Patel DB (2013) Effectiveness of Azotobacter bio-inoculant for wheat
grown under dryland condition. J Environ Biol 34:927–932
Singh N, Yadav A, Varma A (2015a) Effect of plant growth promoting activity of rhizobacteria
on cluster bean (Cyamopsis tetragonoloba L.) plant growth and biochemical constituents. Int
J Curr Microbiol Appl Sci 4(5):1071–1082
Singh NP, Singh RK, Meena VS, Meena RK (2015b) Can we use maize (Zea mays) rhizobacteria as
Sivasakthi S, Kanchana D, Usharani G, Saranraj P (2013) Production of plant growth promoting
substance by Pseudomonas fluorescens and Bacillus subtilis isolates from Paddy rhizosphere
soil of Cuddalore District, Tamil Nadu, India. Int J Microbiol Res 4(3):227–233
Sumathi CS, Ramesh N, Balasubramanian V, Rajesh KV (2011) Microbial bioinoculant potential
on turmeric (Curcuma Longa L.) growth improvement under tropical nursery conditions. Asian
J Exp Biol Sci 2(4):612–623
Sumithra P, Selvaraj T (2011) Influence of Glomus walkeri and plant growth promoting rhizo-
microorganisms on growth, nutrition and content of secondary metabolites in Sphaeranthus
amaranthoides (L.) Burm. J Agric Technol 7(6):1685–1692
Tanwar SPS, Sharma GL, Chahar MS (2002) Effect of phosphorus and biefertilizers on the growth
and productivity of black gram. Ann Agric Res 23:491–493
Terry E, Piro-N-De-Los A, Hernandez AN (1996) Contribution of Azospirillum brasilense, UAP-
154 to the quality of tomato seedlings. Cultivar Trop 17(3):56–59
Thamizh VR, Nanjan K (1998) Biofertilizer for potato in the Nilgiris. South Indian Hortic
46(3&4):211–213
Thankamani CK, Sreekala K, Anandaraj M (2005) Effect of Pseudomonas fluorescens (IISR-6)
and Trichoderma harzianum (P-26) on growth of black pepper (Piper nigrum L.) in the nursery.
J Spices Aromat Crops 14(2):112–116
Tilak KVBR, Ranganayaki N, Manoharachari C (2006) Synergistic effects of plant growth promot-
ing rhizobacteria and rhizobium on nodulation and nitrogen fixation by pigeon pea (Cajanus
cajan). Eur J Soil Sci 57:67–71
Tinker PB (1984) The role of microorganisms in mediating and facilitating the uptake of plant
nutrients from soil. Plant Soil 76:77–91
Van VT, Berge O, Ngoke S, Balandreau J, Heulin T (2000) Repeated beneficial effects of rice
inoculation with a strain of Burkholderia vietnamiensis on early and late yield components in
low fertility sulphate acid soils of Vietnam. Plant Soil 218:273–284
Venkateswarlu B (2008) Mycorrhizal inoculation in neem (Azadirachta indica) enhances azadi-

rachtin content in seed kernels. World J Microbiol Biotechnol 24(7):1243–1247
84(8):914–919
Vessey JK (2003) Plant growth promoting rhizobacteria as biofertilizers. Plant Soil 255:571–586
Villegas J, Fortin JA (2002) Phosphorus solubilization and pH changes as a result of the interac-
tions between soil bacteria and arbuscular mycorrhizal fungi on a medium containing NO3− as
nitrogen source. Can J Bot 80:571–576
Wani PA, Khan MS (2010) Bacillus species enhance growth parameters of chickpea (Cicer arieti-
num L.) in chromium stressed soils. Food Chem Toxicol 48:3262–3267
Wani PA, Khan MS, Zaidi A (2007) Synergistic effect of the inoculation with nitrogen-fixing and
phosphate- solubilizing rhizobacteria on performance of field grown chickpea. J Plant Nutr
Soil Sci 70(2):283–287
Weller DM (1988) Biological control of soil borne plant pathogens in the rhizosphere with bacte-
ria. Annu Rev Phytopathol 26:379–407. https://doi.org/10.1146/annurev.py.26.090188.002115
Wu SC, Caob ZH, Lib ZG, Cheunga KC, Wonga MH (2005) Effects of biofertilizer containing
N fixer, P and K solubilizers and AM fungi on maize growth: a greenhouse trial. Geoderma
125:155–166
org/10.1007/978-81-322-2776-2_14
Yadav J, Verma JP, Tiwari KN (2010) Effect of plant growth promoting rhizobacteria on seed ger-
mination and plant growth chickpea (Cicer arietinum L.) under in vitro conditions. Bio Forum
Int J 2(2):15–18
Yanni YG, El-Fattah FKA (1999) Towards integrated biofertilization management with free living
and associative dinitrogen fixers for enhancing rice performance in the Nile Delta. Symbiosis
27:319–331
org/10.1007/978-81-322-2776-2_12
org/10.1007/978-81-322-2776-2_3
Zahir ZA, Arshad M, Hussain A (1996) Response of wheat (Triticum aestivum L.) to Azotobacter
inoculation under fertilized condition. Sarhd J Agric 7:133–138
Zahir ZA, Muhammad A, Frankenberger WT (2004) Plant growth promoting rhizobacteria:
applications and perspectives in agriculture. Adv Agron 81:97–168. https://doi.org/10.1016/
S0065-2113(03)81003-9
Zaidi A, Khan MS, Aamil M (2004) Bioassociative effect of rhizospheric microorganisms on
growth, yield and nutrient uptake of greengram. J Plant Nutr 27:599–610
Zarei I, Sohrabi Y, Heidari GR, Jalilian A, Mohammadi K (2012) Effects of biofertilizers on
grain yield and protein content of two soybean (Glycine max L.) cultivars. Afr J Biotech
11(27):7028–7037
Chapter 13
Bioherbicidal Potential of Rhizosphere
Microorganisms for Ecofriendly Weed
Management
S. S. Sindhu, Aakanksha Khandelwal, Manisha Phour, and Anju Sehrawat
Abstract Weeds pose a serious constraint to agricultural production and usually

result in average ~37% losses of the world’s agricultural output. Thus, weed control
is indispensable in every crop production system. For weed management, chemical
herbicides are usually applied due to uncertainty of effects caused by mechanical
methods, and it also involves more labour. Although these herbicides are quite
effective in controlling the weeds, their indiscriminate use causes environmental
problems and human health hazards; moreover continuous use of herbicides may
lead to evolution of resistant weed biotypes and shift in the weed flora. These prob-
lems necessitated the search for an alternate ecofriendly method of weed manage-
ment through the biological approach, in which microorganisms or their products
could be used to suppress the growth of weed species. Many naturally occurring
microorganisms in the rhizosphere have the potential to suppress the growth of
weeds through the manipulation of rhizosphere ecosystem. These rhizosphere
microorganisms colonize the root surfaces of weed seedlings and suppress the
growth of weed plant by reducing weed density, biomass and its seed production.
Many rhizosphere bacteria such as Pseudomonas aeruginosa, P. fluorescens,
Erwinia herbicola, Alcaligenes sp.; strains of Xanthomonas campestris pv. poan-
nua, Pseudomonas syringae pv. tagetis and P. syringae pv. phaseolicola, Serratia
plymuthica and S. marcescens; and the fungi including Colletotrichum gloeospori-
oides, Aeschynomene virginica, Phomo chenopodicola and Exserohilum monoceras
have been characterized as bioherbicides. The mode of action of each biocontrol
agent is variable, and it may range from simple compounds like cyanide, organic
acids, secondary metabolites (antibiotic 2,4-diacetylphloroglucinol) and plant
growth regulators, such as auxins (indole acetic acid and δ-aminolevulinic acid).
Bacterial and fungal microbes also produce a wide array of phytotoxins that inter-
fere with metabolism of weed plants and cause plant mortality. Thus, there are
S. S. Sindhu (*) · A. Khandelwal · M. Phour · A. Sehrawat

Department of Microbiology, CCS Haryana Agricultural University, Hisar, India

https://doi.org/10.1007/978-981-10-8402-7_13
332 S. S. Sindhu et al.
immense possibilities for developing microbial bioherbicides that could reduce the
application of chemical herbicides for weed control and may increase the produc-
tion of cereal, oil seeds and legume crops.
Keywords Bioherbicide · Weeds · Rhizosphere microorganisms · Antibiotics ·

Auxins
13.1 Introduction
Weeds are underestimated crop pests in agriculture, and they cause significant loss
in the yields of crops. Out of the total annual loss of agricultural produce from vari-
ous pests in India, weeds roughly account ~37%, insects ~29%, diseases ~22% and
other pests ~12% (Yandoc et al. 2006; Ferreira and Reinhardt 2016). Weeds are
unwanted useless plants that compete with crop plants for space, nutrients, water,
sunlight and other elements. These weed plants reduce the biomass and yield of the
main crop. The losses due to weed growth include interference with cultivation of
crops, loss of biodiversity, loss of potentially productive lands, loss of grazing areas
and livestock production, choking of navigational and irrigation canals and reduc-
tion of available water in waterbodies. They decrease quantity and quality of pro-
duce/food, fibre, oil, forage/fodder and animal products (meat and milk) and cause
health hazards to humans and animals. Weeds force the use of large amounts of
human labour and technology to prevent greater crop losses (Fickett et al. 2013).
Recently, labour has become non-available and costly due to intensification, diver-
sification of agriculture and urbanization. Cultural practices are also not always
helpful in controlling the weeds due to high adaptability potential of the weeds
under different agroclimatic ecosystems (Jat et al. 2015).
Therefore, chemical herbicides are applied under field conditions for successful
weed management. The common herbicides used for chemical control of weeds in
wheat include isoproturon, 2,4-dichlorophenoxyacetic acid (2,4-D), clodinafop,
fenoxaprop, sulfosulfuron, tralkoxydim, tribenuron-methyl, etc. (Brar and Walia
1993). Recently, the herbicide component of all pesticides sold has increased ~15%
in the 1950s to ~20%. However, more health and environmental hazards have been
created in nature with application of chemical herbicides than the benefits of yield
they have provided (Soares and Porto 2009; Kumar et al. 2015, 2016; Ahmad et al.
2016; Parewa et al. 2014). Moreover, continuous herbicide use may lead to shift in
weed flora and evolution of resistant weed biotypes (Singh 2007). These problems
necessitated the search for an alternate ecofriendly and cost-effective method of
weed management through the biological approach in which microorganisms or
their products could be used to suppress the growth or population of the weed spe-
cies (Templeton 1988; Kremer and Kennedy 1996; Gnanavel 2015).
13 Bioherbicidal Potential of Rhizosphere Microorganisms for Ecofriendly Weed… 333
In biological control of weeds, use of rhizosphere microorganisms having herbi-

cidal activity provides better alternative for reducing chemical inputs in agriculture.
The microorganisms that specifically inhibit the development of weed seedling
thereby prevent the establishment of weed population. Thus, development of bio-
herbicides provides cheap and target-specific biocontrol agents. Over the past two
decades, there have been significant efforts aimed at the development and
commercialization of microbial bioherbicides (bacteria, fungi and viruses) to con-
trol both pre- and postemergent grass and broad-leaf weeds (Hynes and Boyetchko
2006; Bailey et al. 2010a; Glare et al. 2012; Beckie et al. 2013). Thus, application
of rhizospheric bacteria as weedicides/herbicides has reduced dependence on syn-
thetic herbicides, reduced weed seed bank population through environment-friendly
practices and potentially reduced the costs of weed control in crop production, for-
estry and aquatic systems (Kremer et al. 1990; Kennedy et al. 1991; Bailey et al.
2010a).
Naturally occurring microbial communities in the rhizosphere have the potential
to suppress the weed growth through manipulation of rhizosphere ecosystem
(Charudattan and Dinoor 2000; Mohan Babu et al. 2003; Harding and Riazada
2015; Trognitz et al. 2016). Deleterious rhizosphere bacteria (DRB) or plant growth-
promoting rhizobacteria (PGPR) have been reported that specifically associate with
germinating seeds or seedlings of the weeds in the soil (Suslow and Schroth 1982).
Specific effects of DRB include reduced seed germination, growth inhibition,
reduced root elongation and/or root deformation. These selected rhizosphere micro-
organisms colonize the root surfaces of weed seedlings and suppress the growth of
weed plant by reducing weed density, biomass and its seed production (Kremer and
Kennedy 1996). Sometimes, plants may not be killed, but their competitive ability
is much reduced. Successful establishment of such deleterious rhizosphere bacteria/
plant growth-promoting rhizobacteria in weed rhizosphere would be more economi-
cal than chemical application of the growth-suppressive compounds or herbicides
(Arshad and Frankenberger 1991; Meena et al. 2015c).
Several rhizobacteria such as Pseudomonas, Xanthomonas sp., Enterobacter and
Serratia have been developed as foliar bioherbicides and soil application bioherbi-
cides (Kremer 2000). Currently, 14 fungi and 1 bacterium have been registered as
bioherbicides in Canada, China, Japan, the Netherlands, South Africa and the United
States. The mode of action of each biocontrol agent is as varied as the microorgan-
isms themselves (de Luna et al. 2011). They range from simple compounds like
cyanide (Kremer and Souissi 2001; Owen and Zdor 2001) and organic acids to
complex molecules with tertiary structure (Gurusiddaiah et al. 1994; Bouizgarne
et al. 2006), secondary metabolites (Kroschel and Elzein 2004) and plant growth
regulators such as auxins and ethylene (de Luna et al. 2005). Some deleterious bac-
teria and fungi also produce a wide array of phytotoxins with the potential to be
used as herbicides (Duke et al. 1991). Microbial phytotoxin, bialaphos, was regis-
tered in Japan for agricultural weed control and marketed under the trade name
Herbiace® (Jobidon 1991a, b). AAL-toxin, a natural metabolite of the pathogen

Alternaria alternata f. sp. lycopersici, has been tested on a range of crops and weed
species and has been patented as herbicide (Abbas et al. 1995). Thus, inoculation of
such rhizosphere microorganisms could minimize competition of weeds with crops,
may reduce the use of chemical herbicides and could benefit agriculture by contrib-
uting to increased crop yields (Kumar et al. 2017).
13.2 Common Weeds Prevalent in Cereal and Legume Crops
Majority of the weeds (~107 species) are terrestrial plants, a few (five species) are
aquatic weeds and six of the species are parasitic weeds (Kostov and Pacanoski
2007). Most of the weeds belong to family Gramineae, Leguminosae, Poaceae and
Asteraceae. The broad-leaved weeds make growth during the cool season and com-
pete with wheat crop for nutrition and other inputs. Wheat grain yield losses due to
weed interference accounted ~28% (Nisha et al. 1999; Shaban et al. 2009). El-Bawab
and Kholousy (2003) reported that controlling of weeds by herbicidal treatments
increased grain yield up to ~40 and 14%, compared to unweeded and hand-weeding
treatments, respectively. The competitiveness of broad-leaf weeds with small grain
crops such as wheat depends on the type of weeds growing in the field and on
whether the soil fertility, moisture and temperature favour the crop or the weeds.
Similarly, the losses in oil seed crops due to biotic stresses are ~20%, out of which
weed infestation causes severe yield reduction at different growth stages (Table 13.1).
Table 13.1 Common weeds found in cereal and legume crops

Local (English) name Botanical name Family name
Bili booti (shepherd’s clock) Anagallis arvensis Primulaceae
Chabbar (lawn grass) Cynodon dactylon Gramineae
Dubh (deep root grass) Desmostachya bipinnata Gramineae
Jangali Jai (wild oat) Avena fatua Gramineae
Jangali palak (sheep sorrel) Rumex dentatus Leguminosae
Jhil (lamb’s quarter) Chenopodium album Chenopodiaceae
Kabah (sedge nut grass) Cyperus rotundus Cyperaceae
Kanderi (wild safflower) Carthamus oxyacantha Compositae
Kandero (camel thorn) Alhagi camelorum Papilionaceae
Kanki, mandusi (canary grass) Phalaris minor Gramineae
Kurund (nettle leaf weed) Chenopodium murale Chenopodiaceae
Maino (wild medic) Medicago dentatus Leguminosae
Matri (vetch weed) Vicia hirsuta Leguminosae
Naro (bindweed) Convolvulus arvensis Convolvulaceae
Piazi, Basri (wild onion) Asphodelus tenuifolius Liliaceae
Sinjh (white sweet clover) Melilotus alba Leguminosae
The major weeds prevalent in wheat fields are dicot and monocots, viz. bathua
(Chenopodium album), gazari (Fumaria parviflora), krishnneel (Anagallis arven-
sis), chetri (Vicia sativa), senji (Melilotus indicus), matari (Lathyrus aphaca), satya-
nashi (Argemone mexicana), etc. Likewise, monocot weeds, viz. kanki/gullidanda/
mandusi (Phalaris minor), wild oats (Avena ludoviciana), piazi (Asphodelus tenui-
folius), etc., impose serious problem in wheat fields. In addition to these, doob
(Cynodon dactylon) is a major perennial weed. With the introduction of dwarf
wheat, two most serious weeds, namely, kanki and wild oats, have assumed serious
proportions in major wheat-growing areas of India. Since both wild oats and kanki
belong to the grass family and have growth habit and development similar to wheat,
it is very difficult to distinguish them from wheat plants in the vegetative phase.
These weeds also infest several other winter season crops with a potential to cause
significant economic loss (Singh et al. 1999). Moreover, the continuous adoption of
rice-wheat cropping system may further cause yield reduction of wheat to the level
of ~30 to 80% depending upon the weed intensity (Brar and Walia 1993). Many
biotypes have become resistant to isoproturon, with resistant biotypes from Haryana
requiring up to 11 times the pre-susceptible dose of isoproturon to achieve ~50%
weed control (Malik and Singh 1995), and farmers have to use costly herbicides,
namely, clodinafop and sulfosulfuron (Singh 2006; Dhaliwal et al. 2007). The rate
of resistance evolution depends on the soil seed bank dynamics and selection inten-
sity (Singh et al. 2012).
Chenopodium album is a fast-growing weedy annual plant, and its common
names include lamb’s quarters, goosefoot, fat hen and bathua or bathuwa (Randall
2003). C. album is responsible for important economic losses in agriculture around
the world. Each plant can produce over 500,000 seeds, which remain viable in the
soil for up to 40 years (Royer and Dickinson 1999). Herbicide-resistant weeds have
become recently common, and C. album is strongly resistant to many common her-
bicides such as triazine (Llewellyn et al. 2009; Soares and Porto 2009). C. album
has been found to exhibit allelopathic effects on crop plants including soybeans,
maize, cucumbers, carrots, onions, tomatoes, lettuce, squash, sunflowers and oats
(Reinhardt et al. 1994; Ngouagio et al. 1999; Meena et al. 2016a, b).
Asphodelus tenuifolius (onion weed) is native to the Mediterranean region, but it
is widespread, extending from Mediterranean region east through the Arabian
Peninsula to the Indian subcontinent. It is also found in Malaysia, Australia, Chile,
New Zealand, Mexico and the United States (Nasir and Ali 1989). It is a weed of
cultivated fields especially during winter in wheat, mustard, chickpea, tobacco, len-
til and linseed in India and Pakistan (Holm et al. 1997; Poonia et al. 2001; Tiwari
et al. 2001). The weed completes its life cycle with the crop, and a large amount of
weed seed is dispersed before the crop is harvested. If the weed can be removed or
disturbed before seed-set, the crop losses can be minimized. The management of
wild onion is very difficult under field conditions (Sadiq et al. 2011).
The yield losses due to weed competition in rapeseed and mustard have been
estimated to the tune of ~10 to 58% or even beyond ~23 to 70%, depending upon
the type and intensity of weeds (Gill et al. 1989; Banga and Yadav 2001). The com-
mon weeds of mustard are Lathyrus aphaca, Chenopodium album, C. murale,
Cyperus rotundas, Cynodon dactylon, Melilotus alba, Asphodelus tenuifolius,
Orobanche sp. and Anagallis arvensis. Lathyrus aphaca is also known as the yellow
pea or yellow vetchling. It is a dicot and annual herb growing to 0.9 m (3 ft) plant.
It grows in rabi season and found in all parts of the world, especially in Southern
Europe, parts of Asia and North Africa. It is mostly observed in mustard, wheat,
barley and lentil crop fields and waste and fallow lands and requires a well-drained
habitat. Zea mays in China is adversely affected by annual weeds such as Digitaria
sanguinalis, and the classical methods to suppress D. sanguinalis are essentially
chemical and cultural (Yasuor et al. 2008; Mejri et al. 2013).
Spreading dayflower (Commelina diffusa Burm. f.) is a perennial, monocotyle-
donous weed occurring worldwide in tropical and subtropical areas and as annual
weed in temperate climates (Bryson and DeFelice 2009; Boyette et al. 2015).
C. diffusa is problematic, primarily in young crops (2–5 weeks old), but can also be
a problem in mature crops due to its sprawling behaviour. It is a troublesome weed
of cotton, rice and soybean in temperate areas of the United States and other coun-
tries (Webster 2005; Norsworthy et al. 2007). Moreover, it is also reported as a
major weed of bananas in Mexico and Hawaii; beans, oranges, lemons, grapes,
apricots, coffee and cotton in Mexico; papaya in Hawaii; and sorghum in Thailand.
Isaac et al. (2013) reported the occurrence of C. diffusa as a prominent weed in
maize and vegetables in Mexico; bananas, papayas and pineapples in the Philippines;
rice in Colombia; sugarcane in Mexico and Trinidad; pastures in Hawaii; and coffee
in Costa Rica. Parthenium (Parthenium hysterophorus L.) weed poses a substantial
risk as a reservoir of phytoplasmal infection of nearby agricultural crops in China
and India since the ecosystems of Yuanmou are insect-rich, and parthenium weed is
known to attract diverse leafhoppers (Cai et al. 2016; Bajwa et al. 2016).
13.2.1 Classification of Weeds
Based on weed life cycle or ontogeny, weeds have been classified as annual, bien-
nial and perennial.
13.2.1.1 Annual Weeds
Weeds, which usually germinate, grow and produce seeds within a season/year and
then die up, are called annual weeds, for example, Galinsoga parviflora, Amaranthus
viridis/retroflexus, Bidens pilosa, Trianthema portulacastrum, Chenopodium album/
murale, Solanum nigrum and Phalaris minor.
13.2.1.2 Biennial Weeds
Weeds, which complete their life cycle in two seasons/years and normally live more
than one but less than two seasons/years, are biennial weeds. They form rosette and
remain vegetative in the first season/year, produce flowers and set seeds in the sec-
ond season/year, e.g. Daucus carota, Tribulus terrestris, Cichorium intybus, Cirsium
vulgare and Senecio jacobaea.
13.2.1.3 Perennial Weeds
Weeds, which grow for more than 2 years before they wither away or die up, are
perennial weeds. They flower for the first time in the second year of their growth and
then flower each year regularly and grow indefinitely from the same root system.
13.3 Management of Weeds
The manual method of weed control is quite popular and effective in India, and usu-
ally weed management takes away nearly one third of total cost of production of
field crops. Recently, labour has become non-available and costly due to intensifica-
tion of agriculture and urbanization. In elaborating strategies to control weeds, one
must take into account the type of weed in presence and define the most convenient
controlling agent to be used. Usually, four methods of weed control, i.e. physical,
chemical, biological and integrated weed management, are used (Liebman et al.
2001; Harding and Riazada 2015).
13.3.1 Physical Methods
13.3.1.1 Stale Seedbed Preparation
In this technology, seeds of weeds are encouraged to germinate through application

of one to two pre-sowing irrigations. The emerged weed seedlings are then killed
through ploughing or by the use of non-selective herbicides such as paraquat,
glyphosate or glufosinate. This technique is effective not only in reducing weed

emergence during the crop season but also in reducing the weed seed bank (Kumar
and Ladha 2011).
13.3.1.2 Crop Rotations
Monocropping facilitates an increase in weed species that are able to compete effec-
tively with that crop or able to overcome competition through some avoidance
mechanism. Weed species with similar life cycles to that of the crop tend to be the
greatest problem. Winter weeds are predominant in winter crops, and summer
annual weeds proliferate in spring-planted crops (Moyer et al. 1994). The crop rota-
tions which are diverse in nature can cause a shift in weed species composition and
are effective method of integrated weed management (Liebman et al. 2001).
13.3.1.3 Tillage
Tillage affects weed management, weed seed production and pattern of soil distur-
bances. Weed management strategies, like tillage, generally alter soil structure
along with changes in the microbial community. Once a weed population estab-
lishes in the field, the plants build up a close relationship with the available micro-
organisms. Seeds or vegetative organs overwinter in soil and select early in the
season their own microbiome before crop plants start to vegetate. Weed and crop
plants compete for light, nutrition and water but may interact differently with soil
microorganisms. The development of new technologies for analysing soil microbi-
omes under different management systems will help us to understand the functions
of microorganisms involved in crop productivity and plant health, weed establish-
ment and weed prevention. Exploitation of the microbial ecology knowledge offers
the possibility to search for new biocontrol methods against weeds based on soil-
and plant-associated microorganisms (Trognitz et al. 2016). P. minor, which germi-
nates from upper soil layers, can be buried by deep cultivation. Zero tillage technique
integrated with timely planting of wheat (October sowing) has shown promising
results in reducing P. minor infestation and is helpful in reducing the population of
weeds (Chhokar et al. 2007; Franke et al. 2007).
13.3.1.4 Competitive Crop Cultivars
A competitive crop species or cultivar is that which maintains its yield well in the
presence of weeds and also able to reduce weed growth significantly (Olesen et al.
2004). Increasing the ability of crop cultivars to compete with weeds is an attractive
control option for future weed control strategies (Lemerle et al. 2001). Recently,
new wheat variety PBW550 has been reported to be more competitive than DBW17
and PBW502 varieties due to its quick early growth.
13.3.1.5 Sowing Time
Weed species have specific soil temperature and moisture requirements for emer-
gence and establishment. If sufficient differences exist between crops and weeds in
their germination requirements, then seeding date may be manipulated to benefit the
crop. The sowing time of crop should be recommended so that it is more favourable
for crop growth and development, whereas it is least favourable for weed germina-
tion and growth.
13.3.1.6 Crop Fertilization
Fertilizer timing, dose and placement can be manipulated to reduce weed interfer-
ence in crops. Nitrogen fertilizer is known to break weed seed dormancy and thus
may directly affect weed densities. The growth response of many agricultural weeds
to added nitrogen is similar to or greater than that of wheat (Blackshaw et al. 2004).
13.3.2 Chemical Methods
In wheat, chemical weed control is preferred over manual and mechanical methods
because of its better efficiency along with less cost and time involvement. Different
chemical herbicides used are sulfosulfuron, clodinafop, fenoxaprop, tralkoxydim,
pendimethalin, atlantis and pinoxaden (Table 13.2). Sulfosulfuron, atlantis and
pendimethalin are effective against both grass and non-grass weeds, whereas clo-
dinafop, fenoxaprop, tralkoxydim and pinoxaden are specific to grasses. However,
sulfosulfuron and pendimethalin are not effective against Rumex dentatus and Avena
ludoviciana, respectively. For control of broad-leaved weeds in wheat, three major
herbicides used are metsulfuron, 2,4-D and carfentrazone (Chhokar et al. 2013).
Many species of weeds were reported to acquire resistance against commercially
available chemical herbicides. There are ~307 herbicide-resistant weed biotypes
worldwide; 113 of these biotypes occur in the United States alone (Heap 2006).
13.3.3 Biological Methods
The reliance on synthetic agrochemicals to meet the growing food demand has led
to the environment and health hazards. Residual toxicity of these xenobiotics has
resulted in high incidences of cancer, hormonal and immunological disorders and
Table 13.2 List of few common herbicides used to control weeds and their mode of action
Weeds controlled
Herbicide Mode of action and use Toxicity Warnings
Glyphosate, Absorbed through Controls most Low Spray drift must not
roundup, renew foliage and annual and toxicity contact foliage or
translocated to all perennial grasses green bark of
parts of the plant, and broad-leaved desirable trees
including roots. weeds. It can be
Half-life <14 days in used as a
aerobic soil and pre-planting or a
14–22 days in release spray
anaerobic conditions
Simazine Absorbed only Prevents the Poison Spray drift may
through roots of emergence of a cause serious
germinating plants. wide range of damage to other
Half-life varies from annual and plants
27 to 102 days. Low perennial grasses
leaching potential and broad-leaved
weeds
Buster Systemic contact Grasses, broad- Poison Avoid contact with
herbicide (via the leaf) leaved weeds and desirable plants and
clovers immature bark
Gallant NF Emulsifiable Selectively Harmful Immediately after
concentrate controls grasses. It substance use, flush sprayer
Half-life in the soil of can be mixed with several times with
less than 24 h Versatil, clean water
Gardoprim or
Simazine for
controlling clovers
and broad-leaved
weeds
Versatil Absorbed by leaves, Controls thistles, Harmful Remains active on
stems and roots yarrow, clovers substance plant material, don’t
and many difficult use clippings from
flat weeds. It can treated areas for
be mixed with compost or mulch,
other herbicides within 6 months of
for the control of treatment
additional weeds
Terbuthylazine Absorbed through Controls a wide Hazardous Avoid using near
(Gardoprim) roots and leaves. range of annual substance desirable plants
Pre- and postemergent and perennial
half-life in grasses and
biologically active soil broad-leaved
is 30–60 days weeds. Apply
pre-planting or as a
release
Interceptor Emulsifiable, Controls annual Low Spray drift may
(organic spray) non-selective, contact weeds and grasses toxicity damage foliage,
foliage spray. and perennial fruit or unprotected
Penetrates green plant weeds. It can be green bark of
tissue and disrupts used as a desirable plants
cellular physiology pre-planting or
release spray
allergies apart from the effects on reproductive ability. Therefore, an alternative

ecofriendly and cost-effective method of weed control using living organisms or
biocontrol agents is required (Chutia et al. 2006). Biological weed control practices
have been developed for the sustainable use of biodiversity for economic benefit
towards mankind, and microorganisms have been used as a biological control agent
of weeds (Li and Kremer 2006; Kennedy and Stubbs 2007; Mejri et al. 2010; Patil
2013). Rhizosphere microorganisms and their metabolites have been evaluated as
weed control agents in different crop systems (Norman et al. 1994; Mazzola et al.
1995; Gealy et al. 1996). For example, live cultures of Pseudomonas syringae strain
3366 were found to reduce weed root growth in controlled environment (Johnson
and Booth 1983) and in field studies (Kennedy et al. 1991). Biological controls for
weeds can generally be divided into one of the three general types: classical, aug-
mentative or inundative and cultural.
13.3.3.1 Classical Biological Control
Biological control as a general term refers to the introduction of organisms into an

ecosystem with the intention of controlling one or more undesirable species
(Charudattan 2001; Bailey et al. 2010a, b). Within the context of controlling weeds
and invasive plant species, this field has increasingly focused on bacteria and fungi
in the past five decades (Li et al. 2003), although viruses have also been considered
for this purpose in select cases (Ferrell et al. 2008; Elliott et al. 2009; Diaz et al.
2014). Classical biological control refers to the release of a natural predator or
pathogen of a pest species with the anticipation that it will be able to persist in the
environment and provide ongoing reduction of the pest species population through-
out an entire ecosystem (Dane and Shaw 1996; Shaw et al. 2009).
Classical biological control by means of pathogens has been used in several parts
of the world to control exotic weeds (Bruckart and Hasan 1991). This approach
discovers effective and highly host-specific agents from the weed’s native geo-
graphic range and confirms their safety as well as effectiveness by rigorous experi-
mental evaluation. One of the most successful examples of classical biological
control of weeds is the introduction of a rust fungus, Puccinia chondrillina, into
Australia to control rush skeleton weed (Chondrilla juncea) (Barton 2004).
Biocontrol applications also include the use of rust fungi Uromycladium tepperia-
num to control Acacia saligna and the use of foliar smut fungus to control Hamakua
pamakani (Charudattan 2005). In general, foreign pathogens produce better results
if they were released on suitable sites with appropriate moisture content. Following
the introduction and establishment, the fungus disseminated rapidly and controlled
the most common biotype of the weed. It was reported that this highly successful
biocontrol project has resulted in a cost-to-benefit ratio of 1:100 in Australia (Cullen
and Hasan 1988; Singh et al. 2015; Meena et al. 2013c; Bahadur et al. 2016).
13.3.3.2 Augmentative or Inundative Biological Control
Inundative biological control (also referred to as the bioherbicide strategy) refers to

the application of propagation materials such as fungal spores or bacterial suspen-
sions in concentrations that would not normally occur in nature, with the intention
of destroying a pest species within a managed area (Johnson et al. 1996). This type
of biological control refers to repeated application of a foreign agent with the intent
to reduce weed densities to a level where beneficial plant species can compete.
Some agents, particularly plant pathogens (mycoherbicides), can be applied as
sprays in the same way as conventional herbicides. Fungal spores formulated as
mycoherbicides are intended to kill specific weeds within 3–4 weeks of application
(Templeton 1988).
13.3.3.3 Cultural Biological Weed Control
Inoculation with biofertilizers and bioinoculants provides nitrogen, phosphorus and

potassium nutrients to the plants and thereby promotes the growth of crop plants.
For example, inoculation of the Bacillus strain SYB101 on wheat variety WH711
under field conditions caused ~33% increase in seed yield, whereas its inoculation
caused ~23% increase in seed yield in wheat variety Raj 3765, in comparison to
uninoculated control treatment (Sangwan et al. 2012). Subsequently, this Bacillus
strain was found to suppress the growth of Phalaris minor weed species more effec-
tively (Phour 2012). Inoculation of bacterial isolate WHA87 caused 21–81%
decrease in root dry weight and 33–43% decrease in shoot dry weight of
Chenopodium album at 30, 60 and 90 days of plant growth under pot house condi-
tions (Khandelwal 2016) (Fig. 13.1).
Similarly, inoculation of P. fluorescens strain G2-11 was found to suppress the
growth of weeds but promoted the growth of wheat and soybean (Li and Kremer
2006). Inoculation of the Pseudomonas trivialis strain X33d caused the growth sup-
pression of great brome weed and promoted the growth of durum wheat (Mejri et al.
2010). This suppression of the great brome weed and stimulation of plant growth by
the bacterium were attributed to the concentration of indole acetic acid released by
Pseudomonas trivialis strain X33d.
13.3.4 Integrated Weed Management
Integrated weed management (IWM) relies upon multiple chemical, physical or

biological weed management techniques to achieve an acceptable level of weed
control. Agents that selectively suppress weeds but not crops and that can be manip-
ulated in agriculture will be promising components for inclusion in IWM. Recently,
Fig. 13.1 Effect of

microbial inoculation on
growth of Chenopodium
album under pot condition
lower doses of herbicides in combination with rhizosphere microorganisms (having

herbicidal activity) are applied to effectively control the weeds under field condi-
tions. Weissmann et al. (2003) reported that application of Serratia plymuthica
strain A153 in a tank mix with another bacterial isolate or with reduced doses of
herbicide showed good suppression of Chenopodium album in field tests. Li et al.
(2016) reported that weak host plants had consistently lower mycorrhizal growth
responses (MGRs) than strong host crops in both controlled and field conditions.
Moreover, these differences in MGRs between weak host weeds and strong host
crops were more pronounced under mixed arbuscular mycorrhizal fungi (AMF)
inoculum and low N and P nutrient availability. It was suggested that management
practices affecting AMF diversity and crop and weed mycorrhizal responses could
be selected to improve the contribution of AMF to IWM (Li et al. 2016). Better
understanding of crop-weed-AMF interactions and management practices is needed
to enhance weed management.
13.4 haracterization of Microorganisms and Plants Having

C
Bioherbicidal Properties
An attractive approach for improving performance of weed control agents is the use
of rhizosphere microorganisms with deleterious activity towards the seedling
growth of weed (Boyette and Hoagland 2015; Lakshmi et al. 2015). Thus, biologi-
cal control of weeds represents an effective and innovative means to manage trou-
blesome weeds (Harding and Riazada 2015; Trognitz et al. 2016). It utilizes the
naturally occurring phytotoxic secondary metabolites from pathogenic as well as
non-pathogenic microorganisms as a biological herbicide (Khattak et al. 2014;
Sayed et al. 2014; Meena et al. 2014b, 2015a; Sindhu et al. 2016a, b; Singh et al.
2016). These compounds either kill or retard the growth of weeds so that beneficial
plant species can gain a competitive advantage. Some of the naturally occurring
soil/rhizosphere bacteria/fungi suppress the growth of weed plants by colonizing
the root surface and/or by producing effective compounds that act as a biodegrad-
able herbicide (Chon 2003). Various bacteria, fungi and viruses have been charac-
terized as potential weed control agents (Table 13.3 and Fig. 13.2).
13.4.1 Bacteria
The efficient biological weed control using bacteria has been suggested to have
several advantages over the use of fungi, including more rapid growth of the bioher-
bicide agents, relatively simple propagation requirements (Li et al. 2003) and high
Table 13.3 Various microorganisms with herbicidal activity against target weeds
Specificity of Intended
Biological agent Target weed control agent system References
Bacterial
P. fluorescens Downy brome Effect is limited to Field crops Kennedy et al.
strain D7 (Bromus tectorum) downy brome (1991)
P. fluorescens Green foxtail Not identified Not specified Quail et al.
strain BRG100 (Setaria viridis) (2002)
P. fluorescens Inhibits most of the Non-specific Not specified Banowetz et al.
strain WH6 species tested (2008)
Xanthomonas Annual bluegrass Doesn’t affect Turf Imaizumi et al.
campestris pv. Poa annua and Poa Kentucky bluegrass (1997)
poae (JT-P482) attenuata (Poa pratensis) or
creeping bentgrass
(Agrostis
stolonifera)
Fungal
Colletotrichum Northern joint Also affects hemp Field crops: Daniel et al.
gloeosporioides vetch sesbania (Sesbania rice, soybean (1973) and
f. sp. (Aeschynomene exaltata) Boyette et al.
aeschynomene virginica) (2011)
Colletotrichum Round leaf mallow Lethal effect limited Field crops: Mortensen
gloeosporioides (Malva pusilla) to Malvaceae wheat, rye, (1988)
f. sp. malvae family flax, lentil,
barley, canola,
sunflower,
soybean, oats,
mustard, sugar
beet and
buckwheat
Colletotrichum Spiny cocklebur Known pathogen of Pasture and Auld et al.
orbiculare (Xanthium the Cucurbitaceae field crops (1988) and
spinosum) Harata and Kubo
(2014)
(continued)

Colletotrichum Hemp sesbania Pathogenicity Field crops Boyette (1991)
truncatum (Sesbania exaltata) limited to and Hynes et al.
Leguminosae. (2010)
Minor
pathogenicity on
scentless
chamomile
(Matricaria
perforata)
Phoma Lamb’s quarters Not tested on other Field crops Cimmino et al.
chenopodicola (Chenopodium species such as sugar (2013)
album), creeping beet and corn
thistle (Cirsium
arvense), green
foxtail (Setaria
viridis), annual
mercury
(Mercurialis
annua)
Phoma Dandelion Reported as a Turf Neumann and
herbarum (Taraxacum potential control Boland (1999)
officinale) agent for horse and Ray and
purslane Vijayachandran
(Trianthema (2013)
portulacastrum)
Phoma Dicot plants Affects most Turf Graupner et al.
macrostoma monocots but not (2003) and
dicots Bailey et al.
(2011)
Sclerotinia Dandelion Also reported to Turf Riddle et al.
minor (Taraxacum affect broad-leaf (1991) and
officinale), white plantain (Plantago Abu-Dieyeh and
clover (Trifolium major), bird’s-foot Watson (2007)
repens) trefoil (Lotus
corniculatus) and
common ragweed
(Ambrosia
artemisiifolia)
Viruses
Tobacco mild Tropical soda apple Also affects peppers Pastures Ferrell et al.
green mosaic (Solanum viarum) (Capsicum sp.) and (2008), Font
tobamovirus tobacco (Nicotiana et al. (2009) and
sp.) EPA (2015)
Araujia mosaic Moth plant Also affects Ecosystem Elliott et al.
virus (Araujia hortorum) Morrenia odorata, management (2009)
Oxypetalum
coeruleum and
Gomphocarpus sp.
(continued)

Unspecified Impatiens Also affects species Ecosystem Kollmann et al.
virus resembling glandulifera within management (2007)
tobacco rattle Chenopodium and
virus Nicotiana
Óbuda pepper Solanum nigrum Wide host range Ecosystem Kazinczi et al.
virus (Tobias et al. 1982) management (2006)
Microorganisms influence on
Growth
Plant tralts
Abiotic stress tolerance
Plant-microbe interactions
Fig. 13.2 Plant-microbe interactions in the rhizosphere of Chenopodium album (weed) and
Triticum aestivum (wheat crop)
suitability for genetic modification through either mutagenesis or gene transfer

(Johnson et al. 1996). Deleterious rhizospheric bacteria (DRB) that are associated
with plant roots have the ability to inhibit the plant growth (Kremer and Kennedy
1996).
DRB usually cause reduced seed germination, growth inhibition and reduced
root elongation by producing phytotoxins, phytohormones or cyanides. DRB can
also reduce plant growth directly by competing with the weed plant for nutrients or
indirectly by reducing the colonization of weed plants by beneficial rhizobia or
mycorrhiza. Selection of those rhizospheric bacterial isolates that specifically colo-
nize and inhibit growth of weeds but not that of crop plants can be considered in the
development of biological control technologies. This could benefit agriculture by
contributing to increased crop yields, by reducing weed competition and by reduc-

ing the use of chemical herbicides (Li and Kremer 2006; Patil 2014).
Fluorescent and nonfluorescent pseudomonads, Erwinia herbicola, Alcaligenes
sp. and Flavobacterium sp., were frequently isolated from rhizosphere soil (Kremer
et al. 1990), and only ~18% of isolates were found potentially phytopathogenic,
based on an Escherichia coli indicator bioassay. However, the proportion of isolates
that inhibited growth in seedling assays ranged from ~35% to 65%, depending on
the weed host. Antibiosis was most prevalent among isolates of fluorescent
Pseudomonas sp., the activity of which was due to siderophore production in over
75% of these isolates. Kennedy et al. (1991) screened 1000 isolates of pseudomo-
nads for differential inhibition of downy brome (Bromus tectorum) and winter
wheat. When filtrates of bacterial-free culture were tested on agar, 8% isolates
inhibited root growth of downy brome, but did not affect root growth of winter
wheat. However, when applied to soil (108 CFU mL−1) under nonsterile conditions,
only six isolates (~1%) inhibited growth of downy brome. In the field, when sprayed
(108 CFU m−2), two isolates (0.2%) suppressed downy brome by ~31–53%, and this
treatment increased winter wheat yield by ~18–35%. It suggested that specificity for
weed growth inhibition does exist. P. fluorescens strain D7, originally isolated from
the rhizosphere of winter wheat (T. aestivum) and downy brome (Bromus tectorum)
in Western Canada, was found to selectively inhibit growth and germination of a
number of grassy weeds (Kennedy et al. 1991, 2001; Gealy et al. 1996). Conversely,
P. fluorescens strain WH6 has been observed to significantly inhibit germination of
all species tested (21 monocot species and 8 dicot species) with the exception of a
modern corn (Zea mays) hybrid.
Several cover crop species alone or with DRB were evaluated for growth sup-
pression of annual weeds (Kremer 2000). DRB were detected on roots of cover
crops, and seed inoculation with DRB further reduced weed biomass and enhanced
the weed suppression in 7 of the 12 cover crops. The release of specific allelochemi-
cals by the cover crops may promote proliferation of naturally occurring weed-
suppressive microorganisms that may contribute to weed suppression. Cardina et al.
(1999) and Adam and Zdor (2001) demonstrated that bacteria isolated from Abutilon
theophrasti Medik suppressed the growth of different weeds. Weissmann and
Gerhardson (2001) observed that the growth-suppressive effects of Serratia plymu-
thica strain A153 sprinkled over greenhouse Chenopodium album plants lasted from
10 to 14 days; however, in field experiments, this effect was absent after 2 months,
requiring multiple foliar applications to maintain or re-establish the control effect.
Pseudomonas fluorescens and P. syringae pv. tobaci and tagetis have also been
reported to be potential biological agents for weeds (Daigle et al. 2002; Zidack and
Quimby 2002; Zdor et al. 2005). The other bacterial species found to act as biologi-
cal weed control agent is Xanthomonas campestris. The strain X. campestris pv.
poae (JT-P482) was registered in Japan in 1997 for control of annual bluegrass (Poa
annua) under the product name Camperico (Imaizumi et al. 1997; Tateno 2000).
Weissmann et al. (2003) showed that soil bacterium Serratia plymuthica strain
A153 showed strong growth-suppressing activities against a range of broad-leaved
weeds after foliar spraying. In field tests of this S. plymuthica strain in spring wheat,
spring barley and potatoes, variable effects were achieved on a range of weeds
including Chenopodium album, Stellaria media, Polygonum convolvulus and
Galeopsis speciosa. At one site, good suppression of C. album was observed when
the strain was applied in a tank mix with another bacterial isolate or with reduced
doses of herbicide. Li and Kremer (2006) demonstrated that Pseudomonas fluores-
cens strain G2-11 inoculated to wheat and soybean crops suppressed the growth of
Ipomea sp. and Convolvulus arvensis weeds, among others, while promoted the
growth of agricultural crops. Zermane et al. (2007) reported that P. fluorescens has
potential for controlling Orobanche crenata and O. foetida (broomrape) in Northern
Tunisia.
Patil (2014) characterized 15 potential deleterious rhizospheric bacteria from the
rhizosphere of Sida acuta. Five bacterial isolates significantly reduced the root and
shoot lengths of weed seedlings compared to the crop plants on agar plate bioassay.
In a laboratory screening, bacterial isolate 1 (later identified as Xanthomonas sp.)
inhibited root and shoot length of crop plants in a range ~25 to 36% and 8–34%,
respectively. Sayed et al. (2014) isolated actinobacterium strain from cultivated soil,
and it was found to produce extracellular metabolite that exhibited effective antibac-
terial, antifungal and herbicidal activity against some weeds associated with the
winter wheat (Triticum aestivum L.) and maize (Zea mays). This strain was identi-
fied as Streptomyces levis strain LX-65, based on phylogenetic analysis of 16S
rRNA gene (accession number KJ938645). The discovery, virulence, host range and
epidemiology of a bacterial pathogen, Xanthomonas campestris (isolate LVA987),
were evaluated as a bioherbicide against Xanthium strumarium L. (common cockle-
bur) (Boyette and Hoagland 2013a, b). The effects of environmental parameters on
bioherbicidal activity of the bacterium Xanthomonas campestris, against glyphosate-
resistant and susceptible Conyza canadensis (horseweed), were studied under
greenhouse conditions (Boyette and Hoagland 2015). Rosette leaf stage plants were
found more susceptible than older plants, and increasing inoculum from 105 to 109
cells mL−1 caused significantly greater plant mortality and biomass reduction of
plants in both the rosette and bolting growth stages. A dew period at 25 °C was
required to cause ~80% and 60% mortality of plants in the rosette and bolting
growth stages, respectively. Results indicated that X. campestris isolate LVA-987
can infect and kill horseweed demonstrating its bioherbicidal potential.
A total of 479 bacterial strains were isolated from brine in Bohai, China (Juan
et al. 2015). Bioassay results indicated that four strains named Ha1, Ha17, Ha38 and
Ha384 had herbicidal activity and strain Ha1 had the highest effective herbicidal
activity. Ha1 was identified as Serratia marcescens based on 16S rDNA sequencing.
Both the suppression of Digitaria sanguinalis and the cell viability of the Ha1 for-
mulation in ‘pesta’ were higher when stored at 4 °C than at 25 ± 2 °C. The inhibi-
tory concentration (IC50) of the crude extracts to Digitaria sanguinalis radicula and
coleoptile were 3.332 and 2.828 mg mL−1, respectively. These results indicated that
S. marcescens Ha1 can potentially be used as a biocontrol agent against D. sangui-
nalis (Juan et al. 2015).
13.4.2 Fungi
Most commercial biological weed control products characterized in North America

have been based on formulations of fungal species. Examples include BioMal, a
formulation of Colletotrichum gloeosporioides f. sp. malvae, introduced for the con-
trol of round leaf mallow (Malva pusilla) (Mortensen 1988; PMRA 2006), and C.
gloeosporioides f. sp. aeschynomene, which was released for control of northern
joint vetch (Aeschynomene virginica) in the United States in 1982 as Collego
(Menaria 2007) and again in 2006 as LockDown (Bailey 2014). Additionally,
Sarritor, a formulation of Sclerotinia minor, was introduced for the control of dan-
delion (Taraxacum officinale), white clover (Trifolium repens) and broad-leaf plants
Plantago major in turf (PMRA 2010). Colletotrichum truncatum showed the ability
to control hemp sesbania (Sesbania exaltata) (Schisler et al. 1991) and C. orbiculare,
for its potential to control spiny cocklebur (Xanthium spinosum) (Auld et al. 1990).
Phoma herbarum, a fungal pathogen originally isolated from dandelion leaf lesions
in Southern Ontario, has been investigated for control of dandelions in turf (Stewart-
Wade and Boland 2005). Phoma chenopodicola has been investigated as a potential
control agent for lamb’s quarters (Chenopodium album). A phytotoxic diterpene,
chenopodolin, has been isolated from this species, which was found to cause necrotic
lesions on lamb’s quarters, creeping thistle (Cirsium arvense), green foxtail (Setaria
viridis) and annual mercury (Mercurialis annua) (Cimmino et al. 2013).
Echinochloa crus-galli is among the three most serious weeds of rice in many
countries in Asia. In Malaysia, yield loss by E. crus-galli was ~41%. Several fungal
pathogens have been reported to attack barnyard grass (E. crus-galli complex) in
various parts of the world. A total of 82 isolates from 12 fungus genera were isolated
from diseased barnyard grass in paddy field. Fungal species were identified as E.
monoceras, E. longirostratum and Curvularia lunata. The fungus, E. monoceras,
was consistently found associated with the disease (Tosiah et al. 2009, 2011). In
Korea, Colletotrichum graminicola showed strong pathogenicity in a wide range of
growth stages of E. crus-galli var. praticola and E. crus-galli var. caudata (Yang
2000). Exserohilum monoceras was also reported as potential bioherbicide and not
pathogenic on planted rice varieties in China. Kadir et al. (2003) reported that E.
longirostratrum has good control on Rottboellia cochinchinensis (itch grass) and E.
crus-galli in Malaysia.
Khattak et al. (2014) isolated two fungi Aspergillus and Penicillium species from
the rhizosphere of Mentha piperita. These fungi were checked against weeds Lemna
minor and Silybum marianum L. for herbicidal effect. The extract of both fungi pos-
sessed potential agrochemical constituents which inhibited the growth of test weed.
Greenhouse and field experiments showed that conidia of the fungal pathogen,
Phoma commelinicola, exhibited bioherbicidal activity against spreading dayflower
(Commelina diffusa) seedlings when applied at concentrations of 106–109 conidia
mL−1. A dew period of 12 h was required to achieve 60% control of cotyledonary-
first leaf growth stage seedlings when applications of 108 conidia mL−1 were applied.
Maximal control (~80%) required longer dew periods (21 h), and ~90% plant dry
weight reduction occurred at this dew period duration. More efficacious control
occurred on younger plants (cotyledonary-first leaf growth stage) than older and
larger plants. Mortality and dry weight reduction values in field experiments were
~70% and >80%, respectively, when cotyledonary-third leaf growth stage seedlings
were sprayed with 108 or 109 conidia mL−1. These results indicated that this fungus
has potential as a biological control agent for controlling this problematic weed that
is tolerant to the herbicide glyphosate (Boyette and Hoagland 2015).
13.4.3 Viruses
Viruses that affect weed species have also been considered as bioherbicide candi-
dates. However, viruses have been suggested to be inappropriate candidates for
inundative biological control due to their genetic variability and lack of host speci-
ficity (Kazinczi et al. 2006). Viruses having the potential to control invasive or unde-
sirable species include tobacco mild green mosaic tobamovirus for control of
tropical soda apple (Solanum viarum) in Florida (Ferrell et al. 2008; Diaz et al.
2014) and Araujia mosaic virus for control of moth plant (Araujia hortorum) in
New Zealand (Elliott et al. 2009). A virus resembling tobacco rattle virus has also
been proposed as a control agent for Impatiens glandulifera, an invasive weed of
Central and Western Europe (Kollmann et al. 2007). Similarly, obuda pepper virus
(ObPV) and pepino mosaic virus (PepMV) have been proposed as viral agents to
reduce overall populations of the weed Solanum nigrum (Kazinczi et al. 2006). The
biological activities of viruses are very distinct from pathogenesis caused by bacte-
ria or fungi and may present additional opportunities for biological weed control in
some situations.
13.4.4 Plant Extract
Methanol, acetone and ethanol extracts prepared from Zygophyllum coccineum L.

(family Zygophyllaceae) leaves showed antibacterial activity and expressed anti-
fungal activities. The aqueous leaf extract of Z. coccineum from both desert and
coastal areas also inhibited seed germination and radical growth of Chenopodium
album at 50 and 100 μg mL−1 concentration. Due to higher contents of bioactive
compounds, the inhibition of C. album was more significant with the extracts
obtained from the desert plants as compared to that of coastal plants (El-Shora et al.
2016). The application of allelopathic water extracts at high concentrations may
interfere with the cell division, hormone biosynthesis and mineral uptake and trans-
port (Rizvi et al. 1992), membrane permeability (Harper and Balke 1981), stomatal
oscillations, photosynthesis (Einhelling and Rasmussen 1979), respiration, protein
metabolism (Kruse et al. 2000) and plant water relations (Rice 1984), which may
cause substantial growth reduction. This phytotoxic activity of allelochemicals is
responsible for growth suppression of weeds (Farooq et al. 2013).
Brassicas produce the allelopathic compound glucosinolate throughout their

plant parts (Fahey et al. 2001). After the release, glucosinolate is decomposed into
several biologically active compounds, such as isothiocyanate (Morra and Kirkegaard
2002), and suppresses the growth and development of weeds (Petersen et al. 2001).
Recent studies indicated that allelopathic plants not only suppress weeds but can
have positive effects on the soil environment, that is, improved nutrient availability
to crop plants through enhanced soil microbial activities (Wang et al. 2013; Zeng
2014). The allelopathic wheat cultivar 22 Xiaoyan was found to have higher popula-
tion of microorganisms and enzyme (catalase and urease) activity, and also exuded
carbon and nitrogen, which improved the allelopathic effects of soil microorganisms
in the rhizosphere. Moreover, the allelochemicals excreted from the microorganisms
further helped to suppress crop weeds and diseases (Zuo et al. 2014).
13.5 Mechanisms Involved in Providing Herbicidal Activity
A wide range of rhizosphere microorganisms have been identified that possess her-
bicidal activity, and their application reduces the need of agrochemicals (herbicides)
for control of weeds under field conditions. These rhizosphere microorganisms
inhibit the growth of weeds by a variety of mechanisms (Fig. 13.3) including (i)
colonization of roots and leaves, (ii) antibiotic production, (iii) IAA production, (iv)
Rhizobia
O
C O PGPR
R N H
H Fungi Antibiotics
Siderophores
ALA
IAA
H-C=N OH
N
O
Lytic enzymes Biocidal volatiles Phytotoxins
Fig. 13.3 Mechanisms involved in the biological control of plant diseases

ALA production, (v) production of secondary metabolites, (vi) hydrogen cyanide

production and (vii) phytotoxin production.
13.5.1 Colonization of Roots and Leaves
Some biological control agents attach to roots of weeds, live on root surfaces and
release toxins that stunt root growth. Many fungi infect roots and disrupt water
transport system, which reduces leaf growth. Beneficial insects and nematodes feed
directly on the weed roots causing injury which allows bacteria and fungi to pene-
trate. Insects that feed on leaves reduce the leaf surface available for energy capture.
Similarly, fungi and bacteria that infect leaves reduce the ability of the leaf to make
sugars. In either case, there is less energy available for weed growth. Whether
through damage on roots or leaves, severe infestations of biological control agents
can actually kill weeds and reduce their adverse effects on desirable crop plants.
Many weed species survive from year to year by producing seeds. Fungi or insects
that attack seeds can reduce the number of weed seeds stored in the soil, which in
turn can reduce the size of future weed populations.
13.5.2 Antibiotic Production
Soil bacteria have been reported to produce antibiotics in culture media under labo-
ratory conditions, which are effective in inhibiting growth of bacteria and fungi
(Adesina et al. 2007). Kataryan and Torgashova (1976) reported that besides the
inhibition of phytopathogenic bacteria and fungi, the antibiotic
2,4-diacetylphloroglucinol also showed phytotoxic activity resembling to that of
2,4-dichlorophenoxyacetate (2,4-D). Geldanamycin and nigericin, phytotoxic
metabolites obtained from a strain of Streptomyces hygroscopicus, were tested for
herbicidal activity. Geldanamycin showed significant pre-emergence activity on
proso millet, barnyard grass, garden cress and giant foxtail. It had no postemergence
herbicidal effect on any of the species tested.
Saccharothrix sp. ST-888 produced phosphinothricin that inhibited the germina-
tion of gramineous and broad-leaved weeds (Takahashi et al. 1995). Lee et al. (2003)
reported that methoxyhygromycin antibiotic produced by Streptomyces sp. showed
higher activity in the range of 90% at 0.25 kg ha−1 against monocotyledonous weeds
such as large crab grass (D. sanguinalis) and barnyard grass (E. crus-galli) than
dicotyledonous weeds.
13.5.3 Indole Acetic Acid Production
The capacity to produce indole acetic acid (IAA) is widespread among plant-
associated bacteria (Malik and Sindhu 2011; Jangu and Sindhu 2011). Population of
IAA-producing organisms range as high as ~80% of total soil bacteria, highlighting
the enormous contribution potential of these organisms to plant’s endogenous pool
of IAA. Indole-3-acetic acid stimulates plant growth in lower concentrations, and in
contrast, if the concentration becomes higher, the effect reverses and elongation of
root and shoot is inhibited. Natural auxins have modes of action similar to many
herbicides that interfere with plant growth such as 2,4-dichlorophenoxyacetic acid
(2,4-D) and 2,4,5-trichlorophenoxyacetic acid (2,4,5-T) (Patten and Glick 1996).
Serwar and Kremer (1995) reported that auxins produced in high concentrations
in the rhizosphere by deleterious rhizobacteria may contribute to reduced root
growth of weeds. An Enterobacter taylorae isolate with high auxin-producing
potential (72 mg L−1 IAA equivalents) was found to inhibit root growth of field
bindweed (Convolvulus arvensis L.) by ~91% when combined with 10−5 M
L-tryptophan compared with non-treated control. Suzuki et al. (2003) isolated IAA
low-producing spontaneous mutant HP72LI after several repeated subculturing of
P. fluorescens HP72.
IAA production in Bacillus japonicum isolate GD3 was found to give suppres-
sive effect on morning glory growth (Kim and Kremer 2005). Mejri et al. (2010)
studied the effect of rhizobacterial Pseudomonas trivialis strain X33d on growth
suppression of weed great brome (Bromus diandrus Roth.). The specificity assay,
performed on a mixture of soil/sand/peat, highlighted the suppressive activity of P.
trivialis X33d against great brome, and it showed growth-promoting effect on most
of the considered crops, especially durum wheat (Triticum durum Desf.). Great
brome plants inoculated with X33d and co-seeded with durum wheat showed low
root biomass, short root systems and low surface area, volume and number of tips.
The production of indole acetic acid by P. trivialis X33d was suggested to cause
growth suppression of great brome and growth promotion of durum wheat.
Considering the relationship between IAA production and ethylene precursor
ACC (Dimkpa et al. 2009), the positive effects of IAA on root growth can be either
direct or indirect through the reduction of ethylene levels (Lugtenberg and Kamilova
2009). Park et al. (2015) observed that two bacterial strains, I-4-5 and I-3, signifi-
cantly reduced the seedling growth of radish when compared to their controls. The
highest rate of seedling growth inhibition was observed in I-3 bacterial isolate treat-
ment in lettuce and radish. The mechanism of an effective bioherbicide I-3 to plant
growth inhibition was determined by analysing IAA in their culture medium. In
vitro study revealed that culture exudate obtained from I-3 bacterial isolate and
combined with tryptophan significantly decreased leaf length, leaf width and root
length and increased the number of lateral roots of lettuce.
Seventy-one bacterial cultures were isolated from wheat rhizosphere soil, and
ten rhizobacterial isolates, i.e. HWM1, HWM7, HWM9, HWM11, HWM17,
HWM30, HWM37, HWM47, HWM54 and CP43, showed maximum retardation on
fifth and tenth of seed germination of Phalaris minor on 0.8% water agar plates
(Phour 2012). At tenth day of seed germination, ~15% bacterial isolates showed
retardation of shoot growth and ~19% bacterial isolates retarded root growth.
Screening of rhizobacterial isolates for production of indole acetic acid showed that
two isolates HWM49 and HWM35 produced 11.10 and 14.07 μg mL−1 IAA, respec-
tively, and maximum production of IAA (> 25 μg mL−l) was observed in isolates
CPS67, CP43 and HWM13.
13.5.4 Aminolevulinic Acid Production
5-Aminolevulinic acid (ALA) is a key intermediate in the biosynthesis of tetrapyr-

roles, such as porphyrins, vitamin B12, chlorophyll (bacteriochlorophyll) and heme.
ALA is a natural photodynamic compound effective as a biodegradable herbicide
(Sasikala et al. 1994) as well as having a promoting effect on the growth and photo-
synthesis of crops and vegetables (Sasaki et al. 1993). In plants, the ALA concentra-
tion is strictly controlled at less than 50 nmol g−1 fresh weight (Stobart and Bukhari
1984). Herbicidal activity has been reported to increase accumulation of several
chlorophyll intermediates, such as protochlorophyllide, protoporphyrin IX and
Mg-protoporphyrin IX, when plants are treated with exogenous ALA at relatively
high concentrations (5–40 mM). The accumulated chlorophyll intermediates may
act as photosensitizers for the formation of singlet oxygen, triggering photodynamic
damage of ALA-treated plants (Chakraborty and Tripathy 1992). However, low
ALA concentrations, within the range of 0.06–0.6 mM, were found to promote the
plant growth rather than damage by increasing nitrate reductase activity, increasing
fixation of CO2 in the light and suppressing the release of CO2 in darkness (Hotta
et al. 1997a).
ALA has recently drawn increasing attention as a photodynamic chemical, which
can be used as a favourable biodegradable herbicide and insecticide, which is harm-
less to crops, humans and animals (Chon 2003; Beck et al. 2007; Bhowmick and
Girotti 2010; Mikolajewska et al. 2010; Kang et al. 2012). However, herbicidal
activity of ALA on several plants was affected by the application methods. At low
concentration (0.01–10 mg L−1), ALA showed growth-promoting effects on yield of
several crops (Hotta et al. 1997b), whereas it suppressed plant growth at higher
concentrations (>2 mM). Zhang et al. (2006) reported that ALA at low concentra-
tions of 0.3–3 mg L−1 promoted development and growth of potato microtubers
in vitro and enhanced protective functions against oxidative stresses, but ALA at
30 mg L−1 and higher concentrations may induce oxidative damage.
One hundred sixty-two bacterial isolates were obtained from mustard rhizo-
sphere soil, and significant ALA production (>15 μg ml−1) was observed in bacterial
isolates HMM21, HMM22, HMM80, HMM86, HMM92, HMM97, HMM115,
JMM11, JMM15 and JMM35 (Phour 2016). Other 84 isolates produced ALA rang-
ing from 10.1 to 15.0 μg ml−1. Eleven isolates, i.e. HMM21, HMM57, HMM76,
HMM83, HMM92, HMM109, HMM116, JMM4, JMM24, JMM35 and CPS67,
showed maximum retardation effect on seedling growth of Lathyrus aphaca.

Bacterial isolates JMM24 and HMM92 were identified as Bacillus flexus and
Pseudomonas entomophila, respectively, by the 16S rRNA sequence analysis.
Khandelwal (2016) isolated 250 rhizosphere bacteria from the rhizosphere of wheat
and mustard. Among these isolates, 96 rhizobacterial isolates showed significant
stimulation or retardation effect on seed germination of weed Chenopodium album
and Asphodelus tenuifolius on 0.8% water agar plates. Forty-five isolates showed
root growth inhibition on the fifth day of seed germination in C. album. Nine rhizo-
bacterial isolates caused shoot growth inhibition on the fifth day, and seven bacterial
isolates caused shoot growth inhibition at the tenth day of seed germination of C.
album. In Asphodelus tenuifolius, 34 isolates showed root growth inhibition on the
fifth day, and 27 rhizobacterial isolates showed root growth inhibition at the tenth
day of seed germination. Twenty-four rhizobacterial isolates caused shoot growth
retardation at the tenth day of seed germination. Rhizobacterial isolates WSA38,
MSA57, WSA68, WSA56, MSA42, MSA39, WHA98 and MSA11 showed
>11.0 μg ml−1 production of δ-aminolevulinic acid and contributed to growth retar-
dation of C. album and A. tenuifolius.
13.5.5 Production of Secondary Metabolites
A polyketide secondary metabolite herboxidiene produced by Streptomyces chro-

mofuscus showed potent and selective herbicidal activity against weeds but not
against wheat (Miller-Wideman et al. 1992). Three herbicidal metabolites,
3-hydroxybenzylalcohol, 2-methyl hydroquinone and epiepoformin, were isolated
from a soil-borne fungus Scopulariopsis brumptii. Similarly, a phytotoxic metabo-
lite trans-4-aminoproline isolated from culture filtrates of Ascochyta caulina was
found to be very effective in controlling Chenopodium album (L.) (Evidente et al.
2000). A new phytotoxic trisubstituted naphthofuroazepinone was isolated from the
culture filtrates of Drechslera siccans, named drazepinone (Evidente et al. 2005).
Assayed at 2 μg μL−1 solution, the novel metabolite showed broad-spectrum herbi-
cidal properties. Javaid and Adrees (2009) reported that metabolites of Alternaria
alternata, Fusarium oxysporum, F. solani, Drechslera hawaiiensis, D. australiensis
and D. rostrata were highly effective in controlling the growth of the noxious weed
Parthenium hysterophorus.
The production of extracellular metabolites with phytotoxic effects has also been
observed in P. fluorescens strain BRG100, which showed suppressive activity on the
grassy weed green foxtail (Setaria viridis) (Quail et al. 2002; Caldwell et al. 2012).
The herbicidal compounds produced by this species, referred to as pseudophomin A
and B, have been characterized through chromatography. The metabolite coronatine
is a jasmonate analog produced by Pseudomonas coronafacience (Gerwick et al.
1997). It upregulated the jasmonate-controlled signalling pathways (Ichihara et al.
1977) and thereby deregulated many essential processes. The typical symptom of
this toxin is chlorosis of developing tissues. Cinnacidin, a product of the fungus
Nectria sp. DA060097, has a similar mode of action to coronatine (Block et al.
2005). Gostatin, a product of Streptomyces sumanensis (Amagasa et al. 1994), is a
potent aminotransferase inhibitor that is phytotoxic (Nishino et al. 1984).
Pyridazocidin, a cationic compound from soil Streptomyces species, caused rapid
plant necrosis and chlorosis, much like that of bipyridinium herbicides like paraquat
(Oettmeier et al. 1990).
The germination-inhibiting activity of P. fluorescens strain WH6 has been attrib-
uted to the production of a compound originally referred to as germination-arrest
factor (GAF) (Banowetz et al. 2008). The active component of GAF was identified
through nuclear magnetic resonance spectroscopy and mass spectrometry as
4-formylaminooxy-L-vinylglycine (McPhail et al. 2010), and its biosynthesis has
been proposed to begin with the amino acid homoserine (Halgren et al. 2013). This
class of compounds, the oxyvinylglycines, has been shown to interfere with enzymes
that utilize pyridoxal phosphate as a cofactor, including enzymes involved in nitro-
gen metabolism and biosynthesis of the plant hormone ethylene. The effects of cell-
free supernatants (S) and anionic fractions (Q) from three different strains of
Bacillus subtilis were evaluated on weed seed germination (Mendoza et al. 2012).
PGPR strains DN and Car13 as well as a non-promoting strain PY79 were tested on
pigweed (Amaranthus hybridus L.) and Johnson grass (Sorghum halepense L. pers).
The application of anionic fractions QCar13, QDN and QPY caused a drastic
decrease in the germination rates of both pigweed and Johnson grass seeds in com-
parison to controls (Mendoza et al. 2012). These results suggested the presence of
one or several metabolites capable of inhibiting germination in both weeds while
acting more effectively on dicotyledonous seeds.
13.5.6 Hydrogen Cyanide Production
Majority of rhizobacteria with potential as biological control agents are

pseudomonads-like bacteria, which are common producers of cyanide (DeCoste
et al. 2010; Lanteigne et al. 2012; Ramyasmruthi et al. 2012). The hydrogen cyanide
(HCN) production is found to be a common trait of Pseudomonas (~89%) and
Bacillus (~50%) in the rhizospheric soil and plant root nodules (Ahemad and Kibret
2014). Hydrogen cyanide effectively blocks the cytochrome oxidase pathway and is
highly toxic to all aerobic microorganisms at picomolar concentrations. Hydrogen
cyanide forms metal complexes with functional groups of various enzymes, inhibit-
ing processes like CO2 and nitrate assimilation, disruption of reduction of oxygen in
the cytochrome respiratory chain and electron transport in photosynthesis. The pos-
sible phytotoxic mechanism leading to significant growth reduction in plants has
been reported in Lactuca sativa and Echinochloa crus-galli (Kremer and Souissi
2001; Zeller et al. 2007).
Bacterial isolate KC1 was isolated from the rhizosphere of castor plants (Ricinus
communis) indigenous to agricultural fields of Bihar (Lakshmi et al. 2015). The
strain was validated as Pseudomonas aeruginosa (HM195190) based on sequencing

of 16S rDNA. The strain KC1 was found to produce cyanide (4.78 nmol L−1) over a
period of 36 h. Seed bacterization with strain KC1 exhibited reduction in root length
and shoot length of weed seedlings (Amaranthus spinosus and Portulaca oleracea),
which was significant in both laboratory and glasshouse experiments. Biomass was
significantly reduced for the weed seedlings in glasshouse experiments. However,
KC1 inoculated crop seedlings (Triticum aestivum) were found to be less inhibitory
as compared to weed seedlings.
13.5.7 Phytotoxin Production
Plant pathogens produce a variety of phytotoxins that interfere with plant metabo-
lism, ranging from subtle effects on gene expression to plant mortality (Walton
1996). The mode of action of a phytotoxin can be either direct interaction with a
specific plant component (either enzyme or membrane receptor), but if that compo-
nent is absent or altered, there is no phytotoxic effect. Bacterial and fungal microbes
were found to produce various phytotoxins with the potential to be used as herbi-
cides (Duke et al. 1991). The isolated phytotoxins may exhibit similar host and
non-host specificity to the pathogen. AAL-toxin, a hydroxylated long-chain alkyl-
amine containing a tricarboxylic acid moiety, is produced by Alternaria alternata f.
sp. lycopersici and has been found to act as an effective herbicide on a range of crop
and weed species (Abbas et al. 1995).
Rhizobitoxine is a phytotoxin produced by some Bradyrhizobium strains (Duke
et al. 2011). It inhibits β-cystathionase, which is required for methionine synthesis.
This toxin is phytotoxic enough to act as a commercial herbicide (Giovanelli et al.
1973). Since synthesis of the essential plant hormone ethylene is dependent on
methionine, one could assume that ethylene synthesis would be greatly inhibited in
plants treated with rhizobitoxine. Bender et al. (1999) reported that coronatine,
syringomycin, syringopeptine, tabtoxin and phaseolotoxin are the most intensively
studied phytotoxins of Pseudomonas syringae.
The phytopathogenic fungus, Bipolaris euphorbiae, is the causal agent for the
major disease of E. heterophylla within Brazil (Barreto and Evans 1998) and has
been reported to be highly efficient and promising as a biological control agent for
this weed as the best postemergence herbicides (Yorinori and Gazziero 1989). This
fungus produced host-specific phytotoxin(s) that elicits its effect during germina-
tion and affects the leaves of susceptible E. heterophylla plants causing defoliation,
but does not affect soybeans (Barbosa et al. 2002). Pedras et al. (2003) isolated
toxins from Pseudomonas fluorescens strain BRG100. One of the toxins, pseudo-
phomin A, showed greater inhibition of green foxtail than did the other, pseudopho-
min B, which showed greater activity against several plant pathogens. P. syringae
pv. tagetis (Pst), which causes symptom of apical chlorosis in infected plants, is
caused by the phytotoxin tagetitoxin. P. syringae strain CT99 isolated from Cirsium
arvense (Canada thistle) was evaluated as a biological control agent for this invasive
weed and other weeds in the family Asteraceae. P. syringae strain caused apical
chlorosis and produced tagetitoxin as well. The utility of this pathogen as a biologi-
cal control agent may be limited to controlling annual weeds. Alternatively, tageti-
toxin may be of value as a natural herbicide because of its impact on chloroplasts
(Lydon et al. 2011). Several pathogens, including Stagonospora cirsii and Ascochyta
sonchi, were found commonly on Cirsium arvense and Sonchus arvensis, and these
fungi also produced phytotoxic metabolites. Phyllosticta cirsii and Phomopsis cir-
sii, belonging to two well-known toxin-producing genera, have also been proposed
for biocontrol of C. arvense (Evidente et al. 2011).
LT-toxin from Lasiodiplodia theobromae was reported to act as an effective her-
bicide to control Parthenium hysterophorus, duckweeds, jimson weed, prickly sida
and Euphorbia hirsuta. Phytotoxins which could control the weeds Lantana camara
and Parthenium hysterophorus were isolated from Alternaria alternata f. sp. lanta-
nae and patented for use as herbicide. Phyllostictine A is a powerful toxin produced
by a mycoherbicide Phyllosticta cirsii, which is used for the biological control of
Cirsium arvense (Zonno et al. 2008). Mevalocidin is another mobile phytotoxin,
produced by Fusarium DA056446 and Roselliana strain DA092917. It is a broad-
spectrum postemergence herbicide against grasses and broad-leaved plants (Gerwick
et al. 2013). Antibiotic 1233A is a phytotoxin (also known as hymeglusin) or
L-659699 produced by several fungal plant pathogens (e.g. Cephalosporium sp.,
Fusarium sp., etc.). It inhibits 3-hydroxy-3-methylglutaryl coenzyme A (HMG-
CoA) synthetase, an intermediate in the mevalonate pathway in plants (Duke et al.
2011). Tentoxin phytotoxin has the potential as herbicide development because this
cyclic tetrapeptide produced by Alternaria alternata caused phytotoxic damage to
both monocot and dicot weed species (Saxena 2014). Tabtoxin, phaseolotoxin and
coronatine produced by Pseudomonas sp. were also found to exhibit good herbi-
cidal activity.
13.6 Development of Commercial Bioherbicides
Bioherbicide DeVine, containing a Florida isolate of Phytophthora palmivora, is

used for the control of Morrenia odorata (strangler vine or milkweed vine) for cit-
rus plants in Florida. Collego, based on Colletotrichum gloeosporioides f. sp.
aeschynomene, is used to control Aeschynomene virginica (Northern joint vetch), a
leguminous weed in rice and soybean crops in Arkansas, Mississippi and Louisiana.
The fungal pathogen Alternaria destruens strain 059 was registered in the United
States in 2005 for control of dodder (Cuscuta sp.) in field crops and ornamental
plants. A stump-treatment product based on the wood-infecting basidiomycete,
Cylindrobasidium laeve, under the commercial name Stumpout, is registered in
South Africa to control resprouting of cut trees in tree plantations and in natural
areas. Majority of bioherbicides are mycoherbicides with the exception of Camperico
which is a bacterial bioherbicide. An isolate of Xanthomonas campestris pv. poae
isolate JT-P482, a wilt-inducing bacterium, isolated in Japan from Poa annua
Table 13.4 Various bioherbicides developed on commercial scale

Bioherbicide trade
name Active microorganism Target weed
Biochon Chondrostereum purpureum Woody weeds
BioMal Colletotridium gloeosporioides f. sp. nalvae Round-leaved mallow
Camperico Xanthomonas campestris pv. poae Annual bluegrass
CASST Alternaria cassia Sickle pod, coffee senna
Chontrol Chondrostereum purpureum Alders and other
hardwoods
Collego Colletotridium gloeosporioides f. sp. Northern joint vetch
aeschynomene
DeVine Phytophthora palmivora Strangler vine
DrBioSedge Puccinia canaliculata Yellow nut sedge
Hakatak Colletotridium acutatum Hakea sericea
Lubao Colletotridium gloeosporioides Dodder
Myco-Tech Chondrostereum purpureum Deciduous tree species
Organo-Sol Lactobacillus sp. Leguminous weeds
Phoma Phoma macrostoma Broad-leaf weeds
Smolder Alternaria destruens Dodder
Woad Warrior Puccinia thlaspeos Dyer’s woad
(annual bluegrass or winter grass) has been registered in Japan as the bioherbicide
Camperico to control annual bluegrass in golf courses (Imaizumi et al. 1999). The
product is applied after mowing and infects the cut surfaces. Worldwide about 15
bioherbicide products have been developed and used commercially to manage
weeds in various crops, including several horticultural crops (Table 13.4).
Charudattan and Dinoor (2000) modified the host range to improve virulence of
Xanthomonas campestris pv. campestris (host Poa annua) by using gene encoding
bialaphos production to control weed as some biotypes have developed resistance to
a number of herbicides. Currently, bioherbicides are being developed to manage
weeds in citrus, vegetables, pastures and natural areas, targeting pigweeds
(Amaranthus sp.), purple nutsedge (Cyperus rotundus L.), several invasive grasses,
dodder (Cuscuta sp.) and tropical soda apple (Solanum viarum Dunal) (Charudattan
2005). Loretta et al. (2006) described that seven species of Amaranthus had become
resistance to a number of herbicides. But the combined application of Phomopsis
amaranthicola and Microsphaeropsis amaranthi as a mixture significantly decreased
the weed species in the field and caused 100% mortality.
Generally, pathogens that can be industrially mass-produced could be manipu-
lated to manage epidemics and are suited for the bioherbicide approach. Out of
hundreds of bioherbicides, a few of them are commercially available. Stumpout
(Cylindrobasidium leave), Ecoclear™ (Chondrostereum purpureum) and Myco-
Tech™ paste are three commercially available bioherbicides (Barton 2005).
Smolder, a bioherbicide from Alternaria destruens, has been registered. One herbi-
cide agent, Colletotrichum gloeosporioides f. sp. aeschynomene, has been regis-
tered (previously Collego) under the commercial name LockDown for use in the
rice in Arkansas, Lousiana and Mississippi (Yandoc et al. 2006). All these herbi-
cides have potential weed control capacity up to 100% in field condition though its
efficacy is regulated by inoculum’s concentration, formulation, spray parameters,
target weed plant age, nontarget plant species, micro- and macroorganisms in the
phyllosphere or rhizosphere and pesticides applied in the area.
13.7 ormulations to Improve Efficacy of Microbial

F
Herbicides
Indiscriminate and continuous use of herbicides has resulted in development of her-

bicide-resistant weeds, which are managed only with application of biocontrol
agents (Table 13.5). In order to overcome the obstacles associated with development
of a microbial herbicide, numerous researchers have investigated the combining of
biological control organism with a formulation designed to improve application, sur-
vivability and efficacy. Appropriate temperatures and length of dew period are criti-
cal to the success of fungal bioherbicides. Adjuvants such as unrefined corn oil and
Silwet L-77 may improve chances for success of mycoherbicides (Abbas et al. 2004;
Boyette et al. 2006, 2007). Zhao and Shamoun (2005) tested combinations of gelatin
and potato dextrose broth concentrations for optimum efficacy of Phoma exigua to
control salal (Gaultheria shallon), a perennial evergreen shrub. Fusarium oxyspo-
rum f. sp. orthoceras (FOO) is known to suppress the root parasitic weed broomrape
(Orobanche cumana) in sunflower. Chittick and Auld (2001) examined the use of
hydrophilic polymers as a formulation for a mycoherbicide to improve efficacy of
Colletotrichum orbiculare on Xanthium spinosum (Bathurst burr) in Australia.
Hoagland et al. (2007) studied formulation, application method and growth
media for control of kudzu (Pueraria lobata) using Myrothecium verrucaria fungi.
Table 13.5 Control of herbicide-resistant weeds with biocontrol agents

Herbicide-resistant weed Herbicide Biocontrol agent
Avena fatua (wild oat) Glyphosate Drechslera avenacea
Chenopodium album Triazine; nitriles Ascochyta caulina, Alternaria
(common lamb’s quarters) alternata
Cyperus (purple nutsedge) Sulfonylurea Phyllachora cyperi, Dactylaria
higginsii
Echinochloa crus-galli Dinitroaniline (trifluralin), Exserohilum longirostratum,
(barnyard grass) pretilachlor, quinclorac Cochliobolus lunatus
Eichhornia crassipes (water 2,4-D, glyphosate Alternaria alternata, A.
hyacinth) eichhorniae, Cercospora piaropi
Salsola kali (Russian thistle) Sulfonylurea, sulfometuron Uromyces salsolae
Senecio vulgaris (common Triazine (atrazine) Puccinia lagenophorae
groundsel)
Sesbania exaltata (hemp Glyphosate (roundup) Colletotrichum truncatum
sesbania)
Zdor et al. (2005) studied effects of deleterious rhizosphere bacteria Pseudomonas

fluorescens strain G2-11 in combination with corn gluten meal and semolina flour
in soil assays using weed and crop species. Elzein et al. (2006) studied seed coatings
containing Fusarium oxysporum isolates to control Striga and found that a ~40%
gum arabic seed coating combined with dried chlamydospores as the most effective
combination for causing disease in Striga. Zhang et al. (2010) studied the stability
of pyoluteorin, a polyketide metabolite produced by fluorescent pseudomonads that
has shown potential to control weeds, among other pests.
The success of applying bioherbicidal agents against weeds relies on the ability
of the biological control agents to persist after its application and to remain viable
after exposure to different environmental conditions. The persistence of bioherbi-
cide formulated from multi-combination of the wild and mutant strain of
Lasiodiplodia pseudotheobromae and Pseudomonas aeruginosa under field condi-
tion was determined (Oluwaseun et al. 2016). The viability of the formulated bio-
herbicides was in the following orders: BH4 > BH2 > BH6 > BH3 > BH1 > BH5 >
control. BH4 showed the maximum number of viability with 4.0 × 105 CFU g−1 and
4.2 × 105 CFU g−1 at the two field trials for Lasiodiplodia pseudotheobromae and
18.3 × 102 CFU g−1 and 23.4 × 102 CFU g−1 for Pseudomonas aeruginosa, respec-
tively, after 12 weeks of application. The results revealed that multi-combination of
Lasiodiplodia pseudotheobromae and Pseudomonas aeruginosa into different
‘pesta’ formulation greatly enhanced the viability of the bioherbicidal agent at the
two trial fields. Many mycoherbicides and bacteria have been processed to ‘pesta’
formulations, such as Fusarium oxysporum (Shabana et al. 2003; Kohlschmid et al.
2009), Pseudomonas fluorescens (Daigle et al. 2002), Pseudomonas aeruginosa
(Yang et al. 2014), Lasiodiplodia pseudotheobromae and Pseudomonas aeruginosa
(Adetunji and Oloke 2013). A modified pesta granule was developed for
Pseudomonas fluorescens BRG100, a bioherbicidal bacterium for grass weeds,
green foxtail (Setaria viridis) and wild oat (Avena fatua) (Hynes and Boyetchko
2011). Both the suppression of Digitaria sanguinalis and the cell viability of the
Ha1 formulation in ‘pesta’ were higher when stored at 4 °C than at 25 ± 2 °C (Juan
et al. 2015). These results indicated that S. marcescens Ha1 can potentially be used
as a biocontrol agent against D. sanguinalis.
Conventionally bred and genetically modified herbicide-tolerant crops have
changed weed management practices and made an important contribution to the
global production of some commodity crops. However, a concern is that farm man-
agement practices associated with the cultivation of herbicide-tolerant (HT) crops
further depleted farmland biodiversity and accelerated the evolution of herbicide-
resistant (HR) weeds. Diversification in crop systems and weed management prac-
tices can enhance farmland biodiversity and reduce the risk of weeds evolving
herbicide resistance. Therefore, HT crops are most effective and sustainable as a
component of an integrated weed management (IWM) system. IWM advocates the
use of multiple effective strategies or tactics to manage weed populations in a man-
ner that is economically and environmentally sound.
13.8 I noculation Effect of Microorganisms

with Bioherbicidal Activity on Plant Growth
Beneficial effects of bacterial inoculation on crops have most often been based on
increased plant growth and seedling emergence, inhibition of weeds, enhanced nod-
ulation and nitrogen fixation in leguminous crops and suppression of diseases.
Recently, various bacteria including species of Azospirillum, Azotobacter,
Pseudomonas, Enterobacter, Arthrobacter, Burkholderia and Bacillus have been
reported to enhance plant growth (Kloepper et al. 1989; Maurya et al. 2014; Meena
et al. 2014b; Sindhu et al. 2016a, b). Indigenous soil microorganisms in the soil
habitat play key roles in ecosystem functioning through controlling nutrient cycling
reactions essential for maintaining soil fertility and also contributing to the genesis
and maintenance of soil structure (Kirk et al. 2004; Wani et al. 2008; Khan et al.
2009).
Pseudomonas strains isolated from the rhizosphere of different crops have
emerged as effective plant growth-promoting rhizobacteria because they exhibit a
wide range of beneficial properties, viz. production of phytohormones like indole
acetic acid (IAA), gibberellic acid and cytokinins, solubilization of phosphate and
other nutrients (Vyas and Gulati 2009), siderophore production and production of
antibiotics such as 2,4-diacetylphloroglucinol (2,4-DAPG), phenazines, pyrrolnitrin
and pyoluteorin and biocides such as hydrogen cyanide (Raaijmakers et al. 2002)
and cell wall lytic enzymes (Haas and Défago 2005). Wani et al. (2007) tested the
rhizosphere isolates for HCN producing ability in vitro and found that most of the
isolates produced HCN and stimulated the plant growth. The bacterium Pseudomonas
entomophila produced HCN with biocontrol properties (Ryall et al. 2009). The
Pseudomonas fragi CS11RH1 (MTCC 8984), a psychrotolerant bacterium, pro-
duced hydrogen cyanide, and the seed bacterization with the isolate significantly
increased the percent germination, rate of germination, plant biomass and nutrient
uptake of wheat seedlings (Selvakumar et al. 2009).
Kennedy et al. reported that two Pseudomonas isolates suppressed downy brome
by 31–53% and increased the yield of winter wheat by ~18 to 35% under field con-
ditions. Li and Kremer (2006) showed that inoculation of P. fluorescens strain G2-11
on wheat and soybean roots promoted the growth of these crops and suppressed the
growth of Ipomea sp. and Convolvulus arvensis weeds. Mejri et al. (2010) reported
the production of indole acetic acid by Pseudomonas trivialis strain X33d that
caused growth suppression of great brome weed and promoted the growth of durum
wheat. Twelve rhizobacterial isolates were tested for their effect on growth of wheat
and weed under pot house conditions. Rhizobacterial isolates, i.e. SYB101, CPS67
and HWM11, were found to stimulate growth of wheat and inhibited the growth of
Phalaris minor (Phour 2012).
Khandelwal (2016) reported that inoculation of bacterial isolate WHA87 caused
94–182% increase in root dry weight (RDW) and 30–340% increase in shoot dry
weight (SDW) of wheat, whereas its inoculation caused 21–81% decrease in RDW
and 33–43% decrease in SDW of Chenopodium album at 30, 60 and 90 days of
Fig. 13.4 Effect of inoculation with bacterial isolates on the growth of wheat and weed (Asphodelus
tenuifolius) plants with different treatments at 60 days after sowing. T2, Control (uninoculated soil
+ N, P fertilizers) + wheat; T20, T2 + weed (A. tenuifolius); T32, T2 + wheat + MSA56; T33, T2 +
weed + MSA56; T34, T2 + wheat + weed + MSA56
plant growth under pot house conditions. In case of Asphodelus tenuifolius, inocula-
tion of bacterial isolate MSA56 showed 94–368% increase in RDW and 38–412%
increase in SDW of wheat, whereas its inoculation caused 40–85.7% decrease in
RDW and 53–54.3% decrease in SDW of A. tenuifolius (Fig. 13.4). Rhizobacterial
isolates, i.e. WHA87, MSA39, MHA75 and MSA56, were found to stimulate
growth of wheat, whereas isolates MSA39 and WHA87 inhibited the growth of
Chenopodium album, and isolates MHA75, MHA93 and MSA56 inhibited the
growth of Asphodelus tenuifolius.
In another study, rhizobacterial isolates HMM76, HMM92, JMM24, JMM35
and SYB101 were found to stimulate growth of mustard and inhibited the growth of
Lathyrus aphaca under pot house conditions (Phour 2016). At 75 days after sowing,
inoculation of two bacterial isolates HMM92 and JMM24 showed 54–191%
increase in RDW and SDW of mustard, whereas they caused 36–92% decrease in
RDW and SDW of Lathyrus aphaca. These rhizobacterial isolates could be further
tested for suppression of weed growth under field conditions for their subsequent
application as bioherbicide. A better understanding of the molecular biology of
plant-microbe interactions could lead to designing of strategies in which specific
microorganism may act as PGPR along with suppressive effects on the growth of
weeds.
13.9 Concluding Remark and Future Prospective
Plant rhizosphere is a rich source of nutrients for different microorganisms present

in the soil. These microorganisms provide the different nutrients and hormones for
the plant growth, and some of the microbes produce the metabolites which suppress
the pathogenic fungi and also suppress the growth of weeds. The interactions
between the biocontrol agent, the microbial population in the rhizosphere, and the
plant and the environment are responsible for the variability observed in disease
suppression, retardation of the growth of weeds and plant growth promotion. The
persistence and survival of biocontrol agents/bioherbicides is a major constraint to
their widespread use in commercial agriculture. The application of microbial strains
having better colonization, the capability to suppress the growth of weeds and the
ability to promote the growth of crops will provide the pesticide-free food to ever-
expanding human population. Therefore, more emphasis is required on the develop-
ments of bioherbicides and biofertilizers for their application in sustainable
agriculture.
Acknowledgements The authors thank all the faculty members working in the Biocontrol
Laboratory for their valuable suggestions in preparation of this manuscript. We also thank the col-
leagues in the Agronomy Department (Weed Control Unit) for their valuable inputs regarding the
prevalence of resistant weeds and the weedicides/herbicides used in control of weeds.
References
Abbas HK, Tanaka T, Duke SO, Boyette CD (1995) Susceptibility of various crop and weed spe-
cies to AAL-toxin, a natural herbicide. Weed Technol 9:125–130
Abbas H, Johnson B, Pantone D, Hines R (2004) Biological control and use of adjuvants against
multiple seeded cocklebur (Xanthium strumarium) in comparison with several other cocklebur
types. Biocontrol Sci Tech 14:855–860
Abu-Dieyeh M, Watson A (2007) Efficacy of Sclerotinia minor for dandelion control: effect of
dandelion accession, age and grass competition. Weed Res 47:63–72
Adam O, Zdor R (2001) Effect of cyanogenic rhizobacteria on the growth of velvetleaf (Abutilon
theophrasti) and corn (Zea mays) in autoclaved soil and the influence of supplemented glycine.
Soil Biol Biochem 33:801–809
Adesina MF, Lembke A, Costa R, Speksnijder A, Smalla K (2007) Screening of bacterial isolates
from various european soils for in vitro antagonistic activity towards Rhizoctonia solani and
Fusarium oxysporum site-dependent composition and diversity revealed. Soil Biol Biochem
39:2818–2828
Adetunji C, Oloke J (2013) Efficacy of freshly prepared pesta granular formulations from the mul-
ticombination of wild and mutant strain of Lasiodiplodia pseudotheobromae and Pseudomonas
aeruginosa. Agric Univ Tirana 12:555–563
Ahemad M, Kibret M (2014) Mechanisms and applications of plant growth promoting rhizobacte-
ria: current perspective. J King Saud Univ Sci 26:1–20
https://doi.org/10.1007/978-81-322-2776-2_21
Amagasa T, Paul RN, Heitholt JJ, Duke SO (1994) Physiological effects of cornexistin on Lemna
paucicostata. Pestic Biochem Physiol 49:37–52
Arshad M, Frankenberger JWT (1991) Microbial production of plant hormones. Plant Soil 133:1–8
Auld BA, McRae CF, Say MM (1988) Possible control of Xanthium spinosum by a fungus. Agric
Ecosyst Environ 21:219–223
Auld BA, Say MM, Ridings HI, Andrews J (1990) Field applications of Colletotrichum orbiculare
to control Xanthium spinosum. Agric Ecosyst Environ 32:315–323
Bahadur I, Maurya BR, Meena VS, Saha M, Kumar A, Aeron A (2016) Mineral release dynamics
219431
Bailey KL (2014) The bioherbicide approach to weed control using plant pathogens. In: Abrol DP
(ed) Integrated Pest management: current concepts and ecological perspective. Elsevier, San
Diego, pp 245–266
Bailey K, Boyetchko S, Langle T (2010a) Social and economic drivers shaping the future of bio-
logical control: a Canadian perspective on the factors affecting the herbicides environmental
impact studies and management approaches 154: development and use of microbial biopesti-
cides. Biol Control Theory Appl Pest Manag 52:221–229
Bailey KL, Boyetchko SM, Langle T (2010b) Social and economic drivers shaping the future of
biological control: a Canadian perspective on the factors affecting the development and use of
microbial biopesticides. Biol Control 52:221–229
Bailey KL, Pitt WM, Falk S, Derby J (2011) The effects of Phoma macrostoma on non-target plant
and target weed species. Biol Control 58:379–386
Bajwa AA, Chauhan BS, Farooq M, Shabbir A (2016) What do we really know about alien plant
invasion? A review of the invasion mechanism of one of the world’s worst weeds. Planta
244:39–57
Banga RS, Yadav A (2001) Evaluation of herbicides against complex weed flora in Indian mustard.
Haryana J Agron 17:48–51
Banowetz GM, Azevedo MD, Armstrong DJ, Halgren AB, Mills DI (2008) Germination-Arrest
Factor (GAF): biological properties of a novel, naturally-occurring herbicide produced by
selected isolates of rhizosphere bacteria. Biol Control 46:380–390
Barbosa AM, Souza CGM, Dekker RFH, Fonseca RC, Ferreira DT (2002) Phytotoxin produced by
Bipolaris euphorbiae in-vitro is effective against the weed Euphorbia heterophylla. Braz Arch
Biol Technol 45:233–240
Barreto RW, Evans HC (1998) Fungal pathogens of Euphorbia heterophylla and E. hirta in Brazil
and their potential as weed biocontrol agents. Mycopathologia 141:21–36
Barton J (2004) How good are we at predicting the field host-range of fungal pathogens used for
classical biological control of weeds? Biol Control Theory Appl Pest Manag 31:99–122
Barton J (2005) Bioherbicides: all in a day’s work… for a superhero. Manaaki Whenua, Landcare
Research Ltd, New Zealand, pp 4–6
Beck TJ, Kreth FW, Beyer W, Mehrkens JH, Obermeier A, Stepp H, Stummer W, Baumgartner R
(2007) Interstitial photodynamic therapy of nonresectable malignant glioma recurrences using
5- aminolevulinic acid induced protoporphyrin IX. Lasers Surg Med 39:386–393
Beckie HJ, Lozinski C, Shirriff S, Brenzil CA (2013) Herbicide-resistant weeds in the Canadian
prairies: 2007 to 2011. Weed Technol 27:171–183
Bender CL, Alarcon-Chaidez F, Gross DC (1999) Pseudomonas syringae phytotoxins: mode of
action, regulation, and biosynthesis by peptide and polyketide synthetases. Microb Mol Biol
Rev 63:266–292
Bhowmick R, Girotti AW (2010) Cytoprotective induction of nitric oxide synthase in a cellu-
lar model of 5-aminolevulinic acid-based photodynamic therapy. Free Radic Biol Med
48:1296–1301
Blackshaw RE, Brandt RN, Janzen HH, Entz T (2004) Weed species response to phosphorus fer-
tilization. Weed Sci 52:406–412
Block A, Schmelz E, Jones JB, Klee HJ (2005) Coronatine and salicylic acid: the battle between
Arabidopsis and Pseudomonas for phytohorome control. Mol Plant Pathol 6:79–83
Bouizgarne B, El-Maarouf-Bouteau H, Madiona K, Biligui B, Monestiez M, Pennarun A, Amiar Z,
Rona J, Ouhdouch Y, El Hadrami I, Bouteau F (2006) A putative role for fusaric acid in biocon-
trol of the parasitic angiosperm Orobanche ramosa. Mol Plant Microbe Interact 19:550–556
Boyette CD (1991) Host range and virulence of Colletotrichum truncatum, a potential mycoherbi-
cide for hemp sesbania (Sesbania exaltata). Plant Dis 75:62–64
Boyette CD, Hoagland RE (2013a) Bioherbicidal potential of a strain of Xanthomonas spp. for
control of common Cocklebur (Xanthium strumarium). Biocontrol Sci Tech 23:183–196
Boyette CD, Hoagland RE (2013b) Influence of epidemiological factors on the bioherbicidal effi-
cacy of a Xanthomonas campestris spp. for control of common Cocklebur (Xanthium stru-
marium). J Expert Biol Agric Sci 1:209–216
Boyette CD, Hoagland RE (2015) Bioherbicidal potential of Xanthomonas campestris for control-
ling Conyza canadensis. Biocontrol Sci Tech 25:229–237
Boyette CD, Reddy KN, Hoagland RE (2006) Glyphosate and bioherbicide interaction for con-
trolling kudzu (Pueraria lobata), redvine (Brunnichia ovata) and trumpet creeper (Campsis
radicans). Biocontrol Sci Tech 16:1067–1077
Boyette CD, Gealy D, Hoagland RE, Vaughn KC, Bowling AJ (2011) Hemp sesbania (Sesbania
exaltata) control in rice (Oryza sativa) with the bioherbicidal fungus Colletotrichum gloeospori-
oides f.sp. aeschynomene formulated in an invert emulsion. Biocontrol Sci Tech 21:1399–1407
Boyette CD, Hoagland RE, Stetina KC (2015) Biological control of spreading dayflower
(Commelina diffusa) with the fungal pathogen Phoma commelinicola. Agronomy 5:519–536
Brar LS, Walia US (1993) The biefficiency of sulphony urea against Phalaris minor in wheat.
Indian J Weed Sci 25:1–5
Bruckart WL, Hasan S (1991) Options with plant pathogens intended for classical control of
range and pasture weeds. In: TeBeest DO (ed) Microbial control of weeds. Chapman and Hall,
New York, pp 69–79
Bryson CT, DeFelice MS (2009) Weeds of the South. University of Georgia, Athens, p 325
Cai H, Wang LC, Yang ZX, Wan QL, Wei W, Davis RE, Zhao Y (2016) Evidence for the role of an
invasive weed in widespread occurrence of phytoplasma diseases in diverse vegetable crops:
implications from lineage-specific molecular markers. Crop Prot 89:193–201
Caldwell CJ, Hynes RK, Boyetchko SM, Korber DR (2012) Colonization and bioherbicidal
activity on green foxtail by Pseudomonas fluorescens BRG100 in a pesta formulation. Can
Cardina J, Webster TM, Herms CP, Regnier EE (1999) Developments of weed IPM: levels of inte-
gration for weed management. J Crop Prod 2:239–267
Chakraborty N, Tripathy BC (1992) Involvement of singlet oxygen in 5-aminolevulinic acid
induced photodynamic damage of cucumber chloroplast. Plant Physiol 98:7–11
Charudattan R (2001) Biological control of weeds by means of plant pathogens: significance for
integrated weed management in modern agro-ecology. BioControl 46:229–260
Charudattan R (2005) Ecological, practical and political inputs into selection of weed targets: what
makes a good biological control target? Biol Control 35:183–196
Charudattan R, Dinoor A (2000) Biological control of weeds using plant pathogens: accomplish-
ments and limitations. Crop Prot 19:691–695
Chhokar RS, Sharma RK, Jat GR, Pundir AK, Gathala MK (2007) Effect of tillage and herbicides
on weeds and productivity of wheat under rice-wheat growing system. Crop Prot 26:1689–1696
Chhokar RS, Sharma RK, Gill SC (2013) Compatibility of herbicides against grassy weeds in
wheat. Indian J Weed Sci 45:239–242
Chittick A, Auld B (2001) Polymers in bioherbicide formulation: Xanthium spinosum and
Colletotrichum orbiculare as model system. Biocontrol Sci Technol 11:691–702
Chon SU (2003) Herbicidal activity of δ-aminolevulinic acid on several plants as affected by appli-
cation methods. Kor J Crop Sci 48:50–58
Chutia M, Mahanta JJ, Saikia R, Boruah AKS, Sarma TC (2006) Effect of leaf blight disease on
yield of oil and its constituents of Java citronella and in vitro control of the pathogen using
essential oils. World J Agric Sci 2:319–321
Cimmino A, Andolfi A, Zonno MC, Avolio F, Santini A, Tuzi A (2013) Chenopodolin: a phytotoxic
unrearranged entpimaradiene diterpene produced by Phoma chenopodicola, a fungal pathogen
for Chenopodium album biocontrol. J Nat Prod 76:1291–1297
Cullen JM, Hasan S (1988) Pathogens for the control of weeds. Philos Trans R Soc Lond
318:213–224
Daigle DJ, Connick JWJ, Boyetchko SM (2002) Formulating a weed suppressive bacterium in
‘pesta’. Weed Technol 16:407–413
Dane F, Shaw JJ (1996) Survival and persistence of bioluminescent Xanthomonas campestris pv.
campestris on host and non-host plants in the field environment. J Appl Bacteriol 80:73–80
Daniel JT, Templeton GE, Smith RJ, Fox WT (1973) Biological control of northern joint vetch in
rice with an endemic fungal disease. Weed Sci 21:303–307
org/10.1007/978-81-322-2776-2_20
de Luna L, Stubbs T, Kennedy A, Kremer R (2005) Deleterious bacteria in the rhizosphere. In:
Zobel R, Wright S (eds) Roots and soil management: interactions between roots and the soil.
American Society of Agronomy, Madison, pp 233–261. Monograph no. 48
de Luna L, Kennedy A, Hansen J, Paulitz T, Gallagher R, Fuerst E (2011) Mycobiota on wild oat
(Avena fatua L.) seed and their caryopsis decay potential. Plant Health Prog 10:1–8
DeCoste NJ, Gadkar VJ, Filion M (2010) Verticillium dahliae alters Pseudomonas spp. popula-
tions and HCN gene expression in the rhizosphere of strawberry. Can J Microbiol 56:906–915
Dhaliwal HS, Singh R, Brar LS (2007) Impact analysis of factors affecting Phalaris minor infesta-
tion in wheat in Punjab. Indian J Weed Sci 39:66–73
Diaz R, Manrique V, Hibbard K, Fox A, Roda A, Gandolfo D (2014) Successful biological control
of tropical soda apple (Solanales: Solanaceae) in Florida: a review of key program compo-
nents. Florida Entomol 97:179–190
Dimkpa C, Weinan T, Asch F (2009) Plant–rhizobacteria interactions alleviate abiotic stress condi-
tions. Plant Cell Environ 32:1682–1694
https://doi.org/10.1007/978-81-322-2776-2_6
Duke SO, Abbas HK, Boyette CD, Gohbara M (1991) Microbial compounds with the potential
for herbicide use. Proceeding Brighten Crop Protection Confenence Weeds, Brighton, UK.
pp 155–164
Duke SO, Evidente A, Fiore M, Rimando AM, Vurro M, Chistiansen N, Looser R, Grossmann K
(2011) Effects of the aglycone of ascaulitoxin on amino acid metabolism in Lemna paucico-
stata. Pestic Biochem Physiol 100:41–50
Einhellig FA, Rasmussen JA (1979) Effects of three phenolic acids on chlorophyll content and
growth of soybean and grain sorghum seedlings. J Chem Ecol 5:815–824
El-bawas AMO, Kholousy AO (2003) Effect of seeding rate and method of weed control on the
productivity of Giza 2000, a promising barley line, under new lands condition. Egypt J Agric
Res 81:1085–1098
Elliott MS, Massey B, Cui X, Hiebert E, Charudattan R, Waipara N (2009) Supplemental host
range of Araujia mosaic virus, a potential biological control agent of moth plant in New
Zealand. Australas Plant Pathol 38:603–607
El-Shora HM, El-Amier YA, Awad MH (2016) Antimicrobial activity and allelopathic potential of
Zygophyllum coccineum L. on Chenopodium album L. Br J Appl Sci Technol 15:1–10
Elzein A, Kroschel J, Leth V (2006) Seed treatment technology: an attractive delivery system for
controlling root parasitic weed Striga with mycoherbicide. Biocontrol Sci Tech 16:3–26
EPA (2015) Biopesticides registration action document: tobacco mild green mosaic tobamo virus
strain U2. PC Code: 056705. United States Environmental Protection Agency. Available at:
http://www.regulations.gov/#! Document Detail; D-EPA-HQ-OPP-2013-0759-0017
Evidente A, Andolfi A, Vurro M, Zonno MC, Motta A (2000) Trans-4 aminoproline, a phyto-
toxic metabolite with herbicidal activity produced by Ascochyta caulina. Phytochemistry
53:231–237
Evidente A, Andolfi A, Vurro M, Zonno MC, Motta A (2005) Drazepinone, a trisubstituted
tetrahydro-naphthofuroazepinone with herbicidal activity produced by Drechslera siccans.
Phytochemistry 66:715–721
Evidente A, Andolfi A, Cimmino A (2011) Relationships between the stereochemistry and biologi-
cal activity of fungal phytotoxins. Chirality 23:674–693
Fahey JW, Zalcmann AT, Talalay P (2001) The chemical diversity and distribution of glucosino-
lates and isothiocyanates among plants. Phytochemistry 56:45–51
Farooq M, Bajwa AA, Cheema SA, Cheema ZA (2013) Application of allelopathy in crop produc-
tion. Int J Agric Biol 15:1367–1378
Ferreira MI, Reinhardt CF (2016) Allelopathic weed suppression in agroecosystems: a review of
theories and practices. Afr J Agric Res 11(6):450–459
Ferrell J, Charudattan R, Elliott M, Hiebert E (2008) Effects of selected herbicides on the efficacy
of Tobacco mild green mosaic virus to control tropical soda apple (Solanum viarum). Weed Sci
56:128–132
Fickett ND, Boerboom CM, Stoltenberg DE (2013) Predicted corn yield loss due to weed competi-
tion prior to postemergence herbicide application on Wisconsin farms. Weed Technol 27:54–62
Font MI, Cordoba-Selles MC, Cebrian MC, Herrera-Vasquez JA, Alfaro-Fernandez A, Boubaker A
(2009) First report of tobacco mild green mosaic virus infecting Capsicum annuum in Tunisia.
Plant Dis 93:761–761
Franke AC, Singh S, McRoberts N, Nehra AS, Godara S, Malik RK, Marshall G (2007) Phalaris
minor seed bank studies: longevity, seedling emergence and seed production as affected by
tillage regime. Weed Res 47:73–83
Gealy DR, Gurusiddah S, Ogg AGJ, Kennedy AC (1996) Metabolites from Pseudomonas fluo-
rescens strain D7 inhibits downy brome (Bromus tectorum) seedling growth. Weed Technol
10:282–287
Gerwick BC, Fields SS, Graupner PR, Gray JA, Chapin EL, Cleveland JA, Heim DR (1997)
Pyridazocidin, a new microbial phytotoxin with activity in the Mehler reaction. Weed Sci
45:654–657
Gerwick BC, Brewster WK, Deboer GJ, Fields SC, Graupner PR, Hahn DR, Pearce CJ, Schmitzer
PR, Webster JD (2013) Mevalocidin, a novel phloem mobile phytotoxin from Fusarium DA
056446 and Rosellina DA092917. J Chem Ecol 39:253–261
Gill HS, Sandhu KS, Mehra SP, Singh T (1989) Efficacy of some herbicides for control of weeds
in Indian mustard. Indian J Weed Sci 16:171–175
Giovanelli J, Owens LD, Mudd SH (1973) β-cystathionase. In vivo inactivation by rhizobitoxins
and role of the enzyme in methionine biosynthesis in corn seedlings. Plant Physiol 51:492–503
Glare T, Caradus J, Gelernter W, Jackson T, Keyhani N, Köhl J, Marrone P, Morin L, Stewart A
(2012) Have biopesticides come of age? Trends Biotechnol 30:250–258
Gnanavel I (2015) Eco-friendly weed control options for sustainable agriculture. Sci Int 3:37–47
Graupner PR, Carr A, Clancy E, Gilbert J, Bailey KL, Derby JA (2003) The macrocidins: novel
cyclic tetramic acids with herbicidal activity produced by Phoma macrostoma. J Nat Prod
66:1558–1561
Gurusiddaiah S, Gealy D, Kennedy A, Ogg AJ (1994) Isolation and characterization of metabolites
from Pseudomonas fluorescens strain D7 for control of downy brome (Bromus tectorum L.)
Weed Sci 42:492–501
Haas D, Défago G (2005) Biological control of soil-borne pathogens by fluorescent pseudomo-
nads. Nat Rev Microbiol 3:307–319
Halgren A, Maselko M, Azevedo M, Mills D, Armstrong D, Banowetz G (2013) Genetics of

germination-arrest factor (GAF) production by Pseudomonas fluorescens WH6: identification
of a gene cluster essential for GAF biosynthesis. Microbiology 159:36–45
Harata K, Kubo Y (2014) Ras GTPase activating protein CoIra1 is involved in infection-related
morphogenesis by regulating cAMP and MAPK signaling pathways through CoRas2 in
Colletotrichum orbiculare. PLoS One 9:e109045
Harding DP, Riazada MN (2015) Controlling weeds with fungi, bacteria and viruses: a review.
Front Plant Sci 6:659–667
Harper JR, Balke NE (1981) Characterization of the inhibition of K+ absorption in oat roots by
salicylic acid. Plant Physiol 68:1349–1353
Heap I (2006) International survey of herbicide resistant weeds
Hoagland R, Boyette C, Abbas H (2007) Myrothecium verrucaria isolates and formulations as
bioherbicide agents for kudzu. Biocontrol Sci Tech 17:721–731
Holm R, Jeny D, Holm E, Pancho J, Harberger J (1997) World weeds, natural histories and distri-
bution. Wiley, New York
Hotta Y, Tanaka T, Takaoka H, Takeuchi Y, Konnai M (1997a) New physiological effects of
5-aminolevulinic acid in plants: the increase of photosynthesis, chlorophyll content and plant
growth. Biosci Biotechnol Biochem 61:2025–2028
Hotta Y, Tanaka T, Takaoka H, Takeuchi Y, Konnai M (1997b) Promotive effects of 5- aminolevu-
linic acid on the yield of several crops. Plant Growth Regul 22:109–114
Hynes RK, Boyetchko SM (2006) Research initiatives in the art and science of biopesticide formu-
lations. Soil Biol Biochem 38:845–849
Hynes RK, Boyetchko SM (2011) Improvement to the “pesta” formulation to promote survival
and dispersal of Pseudomonas fluorescens BRG100 green foxtail bioherbicide. Pest Technol
5:80–87
Hynes RK, Chumala PB, Hupka D, Peng G (2010) A complex coacervate formulation for delivery
of Colletotrichum truncatum 00-003B1. Weed Technol 24:185–192
Ichihara A, Shiraishi K, Sato H, Sakamura S, Nishiyama K, Sakai R, Furusaki A, Matsumotu T
(1977) The structure of coronatine. J Chem Soc 99:636–637
Imaizumi S, Nishino T, Miyabe K, Fujimori T, Yamada M (1997) Biological control of annual
bluegrass (Poa annua L.) with a Japanese isolate of Xanthomonas campestris pv. poae (JT-
P482). Biol Control 8:7–14
Imaizumi S, Honda M, Fujimori T (1999) Effect of temperature on the control of annual bluegrass
(Poa annua L.) with Xanthomonas campestris pv. poae (JT-P482). Biol Control 16:13–17
Isaac WA, Gao Z, Li M (2013) Managing Commelina species: prospects and limitations. Herbic
Curr Res Case Stud Use:543–561
Jangu OP, Sindhu SS (2011) Differential response of inoculation with indole acetic acid producing
Pseudomonas sp. in green gram (Vigna radiata L.) and black gram (Vigna mungo L.) Microbiol
J 1:159–173
9(2):1211–1221
Javaid A, Adrees H (2009) Parthenium management by cultural filtrates of phytopathogenic fungi.
Nat Prod Res 23:1541–1551
Jobidon R (1991a) Some future directions for biologically based vegetation control in forest
research. For Chron 67:524–539
Jobidon R (1991b) Potential use of bialaphos, a microbially produced phytotoxin, to control red
raspberry in forest plantations and its effect on black spruce. Can J Res 21:489–497
Johnson A, Booth C (1983) Plant pathologist’s pocket book. 2nd edn. Surrey, Commonwealth
Agricultural Bureaux, UK
Johnson DR, Wyse DL, Jones KJ (1996) Controlling weeds with phytopathogenic bacteria. Weed
Technol 10:621–624
Juan Y, Wei W, Peng Y, Bu T, Zheng Y, Li-hui Z, Jin-gao D (2015) Isolation and identification of
Serratia marcescens Ha1 and herbicidal activity of Ha1 ‘pesta’ granular formulation. J Integr
Agric 14:1348–1355
Kadir J, Ahmad A, Sariah M, Juraimi AS (2003) Potential of Drechslera longirostrata as bioher-
bicide for itch grass (Rottboellia cochinchinensis), Proceedings of the 19th Asian-Pasific Weed
Science Society Conference, 17–21 March 2003. Weed Science Society of the Philippines,
Manila, pp 450–455
Kang Z, Zhang J, Zhou J, Qi Q, Du G, Chen J (2012) Recent advances in microbial production of
δ-aminolevulinic acid and vitamin B12. Biotechnol Adv 30:1533–1542
Kataryan BT, Torgashova GG (1976) Spectrum of herbicidal activity of 2, 4-diacetyl phloroglu-
cinol. Dokl Akadmy Nauk Armyan SSR 63:109–112
Kazinczi G, Lukacs D, Takacs A, Horvath J, Gaborjanyi R, Nadasy M (2006) Biological decline of
Solanum nigrum due to virus infections. J Plant Dis Protect 32:325–330
Kennedy A, Stubbs T (2007) Management effects on the incidence of jointed goatgrass inhibitory
rhizobacteria. Biol Control Theory Applic Pest Manag 40:213–221
Kennedy AC, Elliott LF, Young FL, Douglas CL (1991) Rhizobacteria suppressive to the weed
downy brome. Am J Soil Sci Soc 55:722–727
Kennedy AC, Johnson BN, Stubbs TL (2001) Host range of a deleterious rhizobacterium for bio-
logical control of downy brome. Weed Sci 49:792–797
Khan AA, Jilani G, Akhtar MS, Naqvi SMS, Rasheed M (2009) Phosphorus solubilizing bacteria:
occurrence, mechanisms and their role in crop production. Res J Agric Biol Sci 1:48–58
Khandelwal A (2016) Evaluation of herbicidal potential of rhizosphere bacteria against bathu
(Chenopodium album) and piazi (Asphodelus tenuifolius) weeds. Ph. D. thesis. Chaudhary
Charan Singh Haryana Agricultural University, Hisar, Haryana
Khattak SU, Iqbal Z, Lutfullah G, Bacha N, Khan AA, Saeed M, Ali M (2014) Phytotoxic and
herbicidal activities of Aspergillus and Penicillium species isolated from rhizosphere and soil.
Pak J Weed Sci Res 20:293–303
Kim SJ, Kremer RJ (2005) Scanning and transmission electron microscopy of root colonization of
morning glory (Ipomoea spp.) seedlings by rhizobacteria. Symbiosis 39:117–124
Kirk JL, Beaudette LA, Hart M, Moutoglis P, Klironomous JN, Lee H, Trevors JT (2004) Methods
of studying soil microbial diversity. J Microbiol Methods 58:169–188
Kohlschmid E, Sauerborn J, Muller-stover D (2009) Impact of Fusarium oxysporum on the holo-
parasitic weed Phelipanche ramosa: biocontrol efficacy under field-grown conditions. Weed
Res 49:56–65
Kollmann J, Banuelos MJ, Nielsen SL (2007) Effects of virus infection on growth of the invasive
alien Impatiens glandulifera. Preslia 79:33–44
Kostov T, Pacanoski Z (2007) Weeds with major economic impact on agriculture in Republic of
Macedonia. Pak J Weed Sci Res 13:227–239
Kremer RJ (2000) Growth suppression of annual weeds by deleterious rhizobacteria integrated
with cover crops. In: Spencer NR (ed) Proceedings of the X international symposium on bio-
logical control of weeds. Montana State University, Bozeman, pp 931–940
Kremer RJ, Kennedy AC (1996) Rhizobacteria as biocontrol agents of weeds. Weed Technol
10:601–609
Kremer R, Souissi T (2001) Cyanide production by rhizobacteria and potential for suppression of
weed seedling growth. Curr Microbiol 43:182–186
Kremer RJ, Begonia MFT, Stanley L, Lanham ET (1990) Characterization of rhizobacteria associ-
ated with weed seedlings. Appl Environ Microbiol 56:1649–1655
Kroschel J, Elzein A (2004) Bioherbicidal effect of fumonisin B1, a phytotoxic metabolite natu-
rally produced by Fusarium nygamai, on parasitic weeds of the genus Striga. Biocontrol Sci
Tech 14:117–128
Kruse M, Strandberg M, Strandberg B (2000) Ecological effects of allelopathic plants- a review.
National Environmental Research Institute, Technical report no. 315, Silkeborg
Kumar V, Ladha JK (2011) Direct seeding of rice: recent developments and future research needs.
Adv Agron 111:299–413
Kumar A, Meena R, Meena VS, Bisht JK, Pattanayak A (2016) Towards the stress management
org/10.1007/s00344-016-9663-5
Lakshmi V, Kumari S, Singh A, Prabha C (2015) Isolation and characterization of deleterious
Pseudomonas aeruginosa KC1 from rhizospheric soils and its interaction with weed seedlings.
J King Saud Univ Sci 27:113–119
Lanteigne C, Gadkar VJ, Wallon T, Novinscak A, Filion M (2012) Production of DAPG and HCN
by Pseudomonas sp. LBUM300 contributes to the biological control of bacterial canker of
tomato. Phytopathology 102:967–973
Lee HB, Kim CJ, Kim JS, Hong KS, Cho KY (2003) A bleaching herbicidal activity of methoxy-
hygromycin (MHM) produced by an actinomycete strain Streptomyces sp. 8E-12. Lett Appl
Lemerle D, Verbeek B, Orchard B (2001) Ranking the ability of wheat varieties to compete with
Lolium rigidum. Weed Res 41:197–209
Li J, Kremer RJ (2006) Growth response of weed and crop seedlings to deleterious rhizobacteria.
Biol Control 39:58–65
Li YQ, Sun ZL, Zhuang XF, Xu L, Chen SF, Li MZ (2003) Research progress on microbial herbi-
cides. Crop Prot 22:247–252
Li M, Jordan NR, Koide RT, Yannarell AC, Davis AS (2016) Meta-analysis of crop and weed
growth responses to arbuscular mycorrhizal fungi: implications for integrated weed manage-
ment. Weed Sci 64:642–652
Liebman M, Mohler CL, Staver CP (2001) Ecological management of agricultural weeds.
Cambridge University Press, Cambridge, p 532
Llewellyn RS, Demden FH, Owen MJ (2009) Herbicide resistance in rigid ryegrass (Lolium rigi-
dum) has not led to higher weed densities in western Australian cropping fields. Weed Sci
57:61–65
Loretta OR, Martin M, Williams II (2006) Conidial germination and germ tube elongation of
Phomopsis amaranthicola and Microsphaeropsis amaranthi on leaf surfaces of seven
Amaranthus species: implications for biological control. Biol Control 38:356–362
Lugtenberg B, Kamilova F (2009) Plant growth promoting rhizobacteria. Annu Rev Microbiol
63:541–556
Lydon J, Kong H, Murphy C, Zhang W (2011) The biology and biological activity of Pseudomonas
syringae pv. tagetis. Pest Technol 5:48–55
Malik DK, Sindhu SS (2011) Production of indole acetic acid by Pseudomonas sp.: effect of coin-
oculation with Mesorhizobium sp. Cicer on nodulation and plant growth of chickpea (Cicer
arietinum). Physiol Mol Biol Plants 17:25–32
Malik RK, Singh S (1995) Little seed canary grass (Phalaris minor Retz.) resistance in India.
Weed Technol 9:419–425
Mazzola M, Stahlman PW, Leach JE (1995) Application method affects the distribution and effi-
cacy of rhizobacteria suppressive of downy brome (Bromus tectorum). Soil Biol Biochem
27:1271–1278
McPhail KL, Armstrong DJ, Azevedo MD, Banowetz GM, Mills DI (2010) 4-formylaminooxyvinyl
glycine, an herbicidal germination-arrest factor from Pseudomonas rhizosphere bacteria. J Nat
Prod 73:1853–1857
Meena VS, Maurya BR, Bohra JS, Verma R, Meena MD (2013a) Effect of concentrate manure
Meena VS, Maurya BR, Verma R, Meena RS, Jatav GK, Meena SK, Meena SK (2013b) Soil
inorganic fertilizer in alluvium soil of Varanasi. BioScan 8(3):931–935
Meena VS, Maurya BR, Verma JP (2014) Does a rhizospheric microorganism enhance K+ avail-
Meena VS, Verma JP, Meena SK (2015a) Towards the current scenario of nutrient use efficiency in
Meena RS, Meena VS, Meena SK, Verma JP (2015b) The needs of healthy soils for a healthy
Meena RS, Meena VS, Meena SK, Verma JP (2015c) Towards the plant stress mitigate the agricul-
Meena RS, Bohra JS, Singh SP, Meena VS, Verma JP, Verma SK, Sihag SK (2016a) Towards the
Meena VS, Meena SK, Bisht JK, Pattanayak A (2016b) Conservation agricultural practices in
Mejri D, Gamalero E, Tombolini R, Musso C, Massa N, Berta G, Souissi T (2010) Biological
control of great brome (Bromus diandrus) in durum wheat (Triticum durum): specificity, physi-
ological traits and impact on plant growth and root architecture of the fluorescent pseudomonad
strain X33d. BioControl 55:561–572
Mejri D, Gamalero E, Souissi T (2013) Formulation development of the deleterious rhizobacte-
rium Pseudomonas trivialis X33d for biocontrol of brome (Bromus diandrus) in durum wheat.
J Appl Microbiol 114:219–228
Menaria BL (2007) Bioherbicides: an eco-friendly approach to weed management. Curr Sci
92:10–11
Mendoza EKM, Violante HGM, Inocencio CM, Salcedo GO, Madrigal HC, Portugal VO, Pérez
MVA (2012) Effects of Bacillus subtilis extracts on weed seed germination of Sorghum
halepense and Amaranthus hybridus. Afr J Microbiol Res 6:1887–1892
Mikolajewska P, Donnelly RF, Morrow DI, Singh TRR, Iani V, Moan J, Juzeniene A (2010)
Microneedle pre-treatment of human skin improves 5-aminolevulininc acid (ALA) and
5-aminolevulinic acid methyl ester (MAL)-induced PpIX production for topical photodynamic
therapy without increase in pain or erythema. Pharm Res 27:2213–2220
Miller-Wideman M, Makkar N, Tran M, Isaac B, Biest N, Stonard R (1992) Herboxidiene, a new
herbicidal substance from Streptomyces chromofuscus A7847. Taxonomy, fermentation, isola-
tion, physio-chemical and biological properties. J Antibiot 45:914–921
Mohan Babu R, Sajeena A, Seetharaman K, Vidhyasekaran P, Rangasamy P, Som Prakash H,
Senthil Rajab A, Bijib KR (2003) Advances in bioherbicides development – an overview. Crop
Prot 22:253–260
Morra MJ, Kirkegaard JA (2002) Isothiocyanate release from soil-incorporated Brassica tissues.
Soil Biol Biochem 34:1683–1690
Mortensen K (1988) The potential of an endemic fungus, Colletotrichum gloeosporioides, for bio-
logical control of round-leaved mallow (Malva pusilla) and velvetleaf (Abutilon theophrasti).
Weed Sci 36:473–478
Moyer J, Roman E, Lindwall C, Blackshaw R (1994) Weed management in conservation tillage
systems for wheat production in North and South America. Crop Prot 13:243–259
Nasir E, Ali SI (1989) Flora of Pakistan. eds. no.132–190. P. A. R.C. Islamabad
Neumann S, Boland GJ (1999) Influence of selected adjuvants on disease severity by Phoma her-
barum on dandelion (Taraxacum officinale). Weed Technol 13:675–679
Ngouagio MC, Lemieux C, Leroux GD (1999) Prediction of corn (Zea mays) yield loss from early
observations of the relative leaf area and the relative leaf cover of weeds. Weed Sci 47:297–304
Nisha C, Harpal S, Tripathi HP, Chopra N, Singh H (1999) Critical period of weed crop competi-
tion in wheat (Triticum aestivum L). Indian J Weed Sci 31:151–154
Nishino T, Murao S, Wada H (1984) Mechanism of inactivation of pyridoxal phosphate-linked
aspartate transaminase by gostatin. J Biochem 95:1283–1288
Norman MA, Patten KD, Gurusiddaiah S (1994) Evaluation of a phytotoxin(s) from Pseudomonas
syringae for weed control in cranberries. Hortic Sci 29:1475–1477
Norsworthy JK, Burgos NR, Scott RC, Smith KL (2007) Consultant perspectives on weed man-
agement needs in Arkansas rice. Weed Technol 21:832–839
Oettmeier W, Dostatni R, Majewski C, Hoefle G, Fecker T, Kunze B, Reichenbac H (1990) The
aurachins, naturally occurring inhibitors of photosynthetic electron flow through photosystem
II and cytochrome b6/f-complex. Z Natureforsch 45:322–328
Olesen JE, Hansen PK, Berntsen J, Christensen S (2004) Simulation of above-ground suppres-
sion of competing species and competition tolerance in winter wheat varieties. Field Crop Res
89:263–280
Oluwaseun AC, Kola OJ, Isaac A (2016) Persistence of bioherbicidal agents formulated from
the multi-combination of the wild and mutant strain of Lasiodiplodia pseudotheobromae and
Pseudomonas aeruginosa. Am Eurasian J Agric Environ Sci 16:1406–1416
Owen A, Zdor R (2001) Effect of cyanogenic rhizobacteria on the growth of velvetleaf (Abutilon
theophrasti) and corn (Zea mays) in autoclaved soil and the influence of supplemental glycine.
Soil Boil Biochem 33:801–809
Park J, Radhakrishnan R, Kang S, Lee I (2015) IAA producing Enterobacter sp. I-3 as a potent
bio-herbicide candidate for weed control: a special reference with lettuce growth inhibition.
Indian J Microbiol 55:207–212
Patil VS (2013) Rhizospheric bacteria with the potential for biological control of Parthenium hys-
terophorus. J Chem Biol Phys Sci 3:2679–2686
Patil VS (2014) Isolation, characterization and identification of rhizospheric bacteria with the
potential for biological control of Sida acuta. J Environ Res Dev 8:411–417
Patten CL, Glick BR (1996) Bacterial biosynthesis of indole-3-acetic acid. Can J Microbiol
42:207–220
Pedras M, Ismail N, Quail J, Boyetchko S (2003) Structure, chemistry and biological activity of
pseudophomins A and B, new cyclic lipodepsipeptides isolated from the biocontrol bacterium
Pseudomonas fluorescens. Phytochemistry 62:1105–1114
Petersen J, Belz R, Walker F, Hurle K (2001) Weed suppression by release of isothiocyanates from
turnip-rape mulch. Agron J 93:37–43
Phour M (2012) Biological control of Phalaris minor in wheat (Triticum aestivum L.) using rhi-
zosphere bacteria. M. Sc. thesis. Chaudhary Charan Singh Haryana Agricultural University,
Hisar, Haryana
Phour M (2016) Aminolevulinic acid production by rhizobacteria: its role in salt tolerance and
weed control in mustard [Brassica juncea (L.)]. PhD thesis. Chaudhary Charan Singh Haryana
Agricultural University, Hisar, Haryana
PMRA (2006) “Re-evaluation of Colletotrichum gloeosporioides f.sp. malvae [CGM]”
REV2006-10. Health Canada, Ottawa
PMRA (2010) “Sclerotinia minor strain IMI344141” RD2010-08. Health Canada. Health Canada,
Ottawa
Poonia BL, Jain NK, Singh SK (2001) Weed management in wheat (Triticum aestivum) with spe-
cial reference to Asphodelus tenuifolius. Ind J Weed Sci 33:100–103
Quail JW, Ismail N, Pedras SC, Boyetchko SM (2002) Pseudophomins A and B, a class of cyclic
lipodepsipeptides isolated from a Pseudomonas species. Acta Crystallogr C 58(5):268–271
Raaijmakers JM, Vlami M, de Souza JT (2002) Antibiotic production by bacterial biocontrol
agents. Antonie Van Leeuwenhoek 81:537–547
Ramyasmruthi S, Pallavi O, Pallavi S, Tilak K, Srividya S (2012) Chitinolytic and secondary

metabolite producing Pseudomonas fluorescens isolated from Solanaceae rhizosphere effec-
tive against broad spectrum fungal phytopathogens. Asian J Plant Sci Res 2:16–24
Randall RP (2003). A global compendium of weeds. In Richardson FJ (ed). Melbourne, p 903
Ray P, Vijayachandran LS (2013) Evaluation of indigenous fungal pathogens from horse purslane
(Trianthema portulacastrum) for their relative virulence and host range assessments to select a
potential mycoherbicidal agent. Weed Sci 61:580–585
Reinhardt CF, Meissner R, Labuschagne N (1994) Allelopathic interaction of Chenopodium album
L. and certain crop species. S Afr J Plant Soil 11:45–49
Rice EL (1984) Allelopathy, 2nd edn. Academic, New York
Riddle GE, Burpee LL, Boland GJ (1991) Virulence of Sclerotinia sclerotiorum and S. minor on
dandelion (Taraxacum officinale). Weed Sci 39:109–118
Rizvi SJH, Haque H, Singh VK, Rizvi VB (1992) A discipline called allelopathy. In: Allelopathy
basic and applied aspects. Chapman & Hall, London, pp 1–8
Royer F, Dickinson R (1999) Weeds of the Northern U.S. and Canada. The University of Alberta
Press, Edmonton, p 434
Ryall B, Mitchell H, Mossialos D, Williams HD (2009) Cyanogenesis by the entomopathogenic
bacterium Pseudomonas entomophila. Lett Appl Microbiol 49:131–135
Sadiq M, Rahman H, Ullah K, Khan MA (2011) Impact of weed management practices on wild
onion (Asphodelus tenuifolius cav.) and chickpea (Cicer arietinum L). Pak J Weed Sci Res
17:135–141
Sangwan VP, Sindhu SS, Dahiya OS, Kharb RPS (2012) Improvement of wheat (Triticum aesti-
vum L.) yield under field conditions by inoculation of microbial strains. Microbiol J 2:86–95
Sasaki K, Tanaka T, Nishio N, Nagai S (1993) Effect of culture pH on the extracellular production
of 5-aminolevulinic acid by Rhodobacter sphaeroides from volatile fatty acid. Biotechnol Lett
15:859–864
Sasikala C, Ramana CV, Rao PR (1994) 5-aminolevulinic acid: a potential herbicide/insecticide
from microorganisms. Biotechnol Prog 10:451–459
Saxena S (2014) Microbial metabolites for development of ecofriendly agrochemicals. Allelopathy
33:1–24
Sayed MHE, Aziz ZKA, Abouzaid AM (2014) Efficacy of extracellular metabolite produced by
Streptomyces levis strain LX-65 as a potential herbicidal agent. J Am Sci 10:169–180
Schisler DA, Howard KM, Bothast RJ (1991) Enhancement of disease caused by Colletotrichum
truncatum in Sesbania exaltata by coinoculating with epiphytic bacteria. Biol Control
1:261–268
Selvakumar G, Lenin M, Thamizhiniyan P, Ravimycin T (2009) Response of biofertilizers on the
growth and yield of blackgram (Vigna mungo). Recom Res Sci Technol 1:169–175
Serwar M, Kremer RJ (1995) Enhanced suppression of plant growth through production of
L-tryptophan-derived compounds by deleterious rhizobacteria. Plant Soil 172:261–269
Shaban SA, Soliman S, Yehia ZR, Elattar MH (2009) Weed competition effects on some Triticum
aestivum quality and quantity components. Egypt J Agron 31:135–147
Shabana YM, Müller-Stöver D, Sauerbornb J (2003) Granular pesta formulation of Fusarium oxy-
sporum f. sp. orthoceras for biological control of sunflower broomrape: efficacy and shelf-life.
Biol Control 26:189–201
Shaw RH, Bryner S, Tanner R (2009) The life history and host range of the Japanese knot weed
psyllid, Aphalara itadori Shinji: potentially the first classical biological weed control agent for
the European Union. Biol Control 49:105–113
Sindhu SS, Sehrawat A, Sharma R, Dahiya A (2016a) Biopesticides: use of rhizosphere bacteria
for biological control of plant pathogens. Def Life Sci J 1:135–148
Sindhu SS, Parmar P, Phour M, Sehrawat A (2016b) Potassium-solubilizing microorganisms
Singh S (2006) Herbicide resistance mechanism in Phalaris minor and its consequences on man-
agement strategies. Indian J Weed Sci 38:183–193
Singh S (2007) Role of management practices on control of isoproturon resistant little seed canary
grass (Phalaris minor) in India. Weed Technol 21:339–346
Singh R, Kirkwood RC, Marshall G (1999) Biology and control of Phalaris minor Retz. (little seed
canary grass) in wheat. Crop Prot 18:1–16
Singh A, Kaur R, Kang JS, Singh G (2012) Weed dynamics in rice- wheat cropping system. Glob
J Biol Agric Health Sci 1:7–16
Soares WL, Porto MFS (2009) Estimating the social cost of pesticide use: an assessment from
acute poisoning in Brazil. Ecol Econ 68:2721–2728
Stewart-Wade SM, Boland GJ (2005) Oil emulsions increase efficacy of Phoma herbarum to con-
trol dandelion but are phytotoxic. Biocontrol Sci Tech 15:671–681
Stobart AK, Bukhari JA (1984) Regulation of δ-aminolevulinic acid synthesis and protochlo-
rophyllide regeneration in the leaves of dark-grown barley (Hordeum vulgare) seedlings.
Biochemical 222:419–426
Suslow TV, Schroth MN (1982) Role of deleterious rhizobacteria as minor pathogens in reducing
crop growth. Phytopathology 72:111–115
Suzuki S, Yuxi H, Oyaizu H (2003) Indole-3-acetic acid production in Pseudomonas fluorescens
HP72 and its association with suppression of creeping bentgrass brown patch. Curr Microbiol
47:138–143
Takahashi E, Kimura T, Nakamura K, Arahira M, Iida M (1995) Phosphonothrixin, a novel herbi-
cidal antibiotic produced by Saccharothrix sp. ST 888, I. Taxonomy, fermentation isolation and
biological properties. J Antibiot 48:1124–1129
Tateno A (2000) Herbicidal composition for the control of annual bluegrass. U.S. Patent No
6162763A. U.S. Patent and Trademark Office, Washington, DC
Templeton GE (1988) Biological control of weeds. Am J Altern Agric 3:69–72
Tiwari AN, Tiwari SN, Rathi JPS, Verma RN, Tripathi AK (2001) Crop weed competition studies
in chickpea having Asphodelus tenuifolius dominated weed community under rain fed condi-
tion. Indian J Weed Sci 33:198–199
Tobias I, Rast ATB, Maat DZ (1982) Tobamo viruses of pepper, eggplant, and tobacco–compara-
tive host reactions and serological relationships. Neth J Plant Pathol 88:257–268
Tosiah S, Kadir J, Sariah M, Juraimi AS, Lo NP, Soetikno S (2009) Survey and evaluation of native
fungal pathogens for biocontrol of barnyard grass (Echinochloa crus-galli complex). J Trop
Agric Food Sci 37:119–128
Tosiah S, Kadir J, Sariah M, Juraimi AS, Soetikno S (2011) Efficacy of Exserohilum monoceras,
a potential fungi for biocontrol of Echinochloa species. J Trop Agric Food Sci 39:117–124
Trognitz F, Hackl E, Widhalm S, Sessitsch A (2016) The role of plant microbiome interactions in
weed establishment and control. FEMS Microbiol Ecol 92:1–15
84(8):914–919
Verma JP, Jaiswal DK, Meena VS, Kumar A, Meena RS (2015a) Issues and challenges about sus-
Verma JP, Jaiswa DK, Meena VS, Meena RS (2015b) Current need of organic farming for enhanc-
Vyas P, Gulati A (2009) Organic acid production in vitro and plant growth promotion in maize
under controlled environment by phosphate-solubilizing fluorescent Pseudomonas. BMC
Microbiol 22:1–15
Walton JD (1996) Host-selective toxins: agents of compatibility. Plant Cell 8:1723–1733
Wang P, Zhang X, Kong C (2013) The response of allelopathic rice growth and microbial feedback
to barnyard grass infestation in a paddy field experiment. Eur J Soil Biol 56:26–32
Wani PA, Khan MS, Zaidi A (2007) Co-inoculation of nitrogen-fixing and phosphate solubi-
lizing bacteria to promote growth, yield and nutrient uptake in chickpea. Acta Agron Hung
55:315–323
Wani PA, Khan MS, Zaidi A (2008) Impact of zinc-tolerant plant growth promoting rhizobacteria
on lentil grown in zinc amended soil. Agron Sustain Dev 28:449–455
Webster TM (2005) Weed survey—southern states: broadleaf crops subsection (cotton, peanut,
soybean, tobacco and forestry). Proc South Weed Sci Soc 58:291–306
Weissmann R, Gerhardson B (2001) Selective plant growth suppression by shoot application of
soil bacteria. Plant Soil 234:159–170
Weissmann R, Uggla C, Gerhardson B (2003) Field performance of a weed-suppressing Serratia
plymuthica strain applied with conventional spraying equipment. Biol Control 48:725–742
Yandoc CB, Rosskopf EN, Pitelli A, Charudattan R (2006) Effect of selected pesticides on conidial
germination and mycelia growth of Dactylaria higginsii, a potential bioherbicide for purple
nutsedge (Cyperus rotundus). Weed Technol 20:255–260
Yang Z (2000) Maximum likelihood analysis of molecular adaptation in abalone sperm lysin
reveals variable selective pressures among lineages and sites. Mol Biol Evol 17:1446–1455
Yang J, Cao HZ, Wang W, Zhang LH, Dong JG (2014) Isolation, identification and herbicidal activ-
ity of metabolites produced by Pseudomonas aeruginosa CB-4. J Integr Agric 13:1719–1726
Yasuor H, Tenbrook PL, Tjeerdema RS, Fischer AJ (2008) Responses to clomazone and
5-ketoclomazone by Echinochloa phyllopogon resistant to multiple herbicides in Californian
rice fields. Pest Manag Sci 64:1031–1039
Yorinori JT, Gazziero LP (1989) Control of milk weed (Euphorbia heterophylla) with
Helminthosporium sp. In: Delfosse ES (ed) Proceedings 7th international symposium on bio-
logical control of weeds, 6–11 Mar 1988, Rome, Italy, pp 571–576
Zdor R, Alexander C, Kremer R (2005) Weed suppression by deleterious rhizobacteria is affected
by formulation and soil properties. Commun Soil Sci Plant Anal 36:1289–1299
Zeller S, Brandl H, Schmid B (2007) Host-plant selectivity of rhizobacteria in a crop weed model
system. PLoS One 2:1–7
Zeng RS (2014) Allelopathy-the solution is indirect. J Chem Ecol 40:515–516
Zermane N, Souissi T, Kroschel J, Sikora R (2007) Biocontrol of broom rape (Orobanche crenata
Forsk. and Orobanche foetida Poir.) by Pseudomonas fluorescens isolate Bf7-9 from the faba
bean rhizosphere. Biocontrol Sci Tech 17:487–497
Zhang ZJ, Li HZ, Zhou WJ, Takeuchi Y, Yoneyama K (2006) Effect of 5-aminolevulinic acid on
development and salt tolerance of potato (Solanum tuberosum L.) microtubers in vitro. Plant
Growth Regul 49:27–34
Zhang J, Wang W, Lu X, Xu Y, Zhang X (2010) The stability and degradation of a new biological
pesticide, pyoluteorin. Pest Manag Sci 66:248–252
Zhao S, Shamoun S (2005) Effects of potato dextrose broth and gelatin on germination and effi-
cacy of Phoma exigua, a potential biocontrol agent for salal (Gaultheria shallon). Can J Plant
Pathol 27:234–244
Zidack NK, Quimby PC (2002) Formulation of bacteria for biological control using the stabilize
method. Biocontrol Sci Tech 12:67–74
Zonno MC, Vurro M, Luceretti S, Andolfi A, Perrone C, Evidente A (2008) Phyllostictine A,
potential herbicide produced by Phyllosticta cirsii: in vitro production and toxicity. Plant Sci
175:818–828
Zuo S, Li X, Ma Y, Yang S (2014) Soil microbes are linked to the allelopathic potential of different
wheat genotypes. Plant Soil 378:49–58
Chapter 14
Biofertilizers and Biopesticides
in Sustainable Agriculture
Vankayalapati Vijaya Kumar
Abstract Green revolution has revolutionized the world agriculture by increasing

the yields of food crops by the development of high-yielding varieties, chemical
fertilizers, synthetic herbicides, and pesticides. The continuous and excess use of
chemical fertilizers has changed the soil characteristics to acidic/alkaline leading to
the reduction in the naturally occurring microorganisms in soil that resulted in the
stagnation/reduction in crop yields. Use of microorganisms (biofertilizers and
biopesticides) as an alternate to synthetic fertilizers and pesticides to increase the
soil fertility and disease and pest control in agriculture is gaining prominence.
Biofertilizers and biopesticides are environmental friendly products and can be used
in integrated nutrient management (INM) and integrated pest management (IPM)
techniques. This chapter reviews the microorganisms and their role in enhancing
soil fertility and disease and pest control for sustainable agriculture.
Keywords Green revolution · Biofertilizers · Biopesticides · Soil fertility ·

Sustainable agriculture
14.1 Introduction
In the first half of the twentieth century, the world has witnessed many famines
(widespread shortage of food that may apply to any faunal species, a phenomenon
which is usually accompanied by regional malnutrition, starvation, epidemic, and
increased mortality) resulted in the mortality of millions of people (World Ecology
Report 2008). Due to the tireless efforts of Norman Borlaug (considered as “Father
of Green Revolution”) in the 1940s, Mexico became self-sufficient in wheat produc-
tion and saved millions of lives in India, Pakistan, and elsewhere from starvation
through high-yielding wheat varieties. By his efforts Mexico became the exporter of
wheat by 1963, and in India and Pakistan, wheat yields were doubled between 1965
V. V. Kumar (*)
Core Green Sugar and Fuels Private Limited, Tumkur, Karnataka, India
e-mail: vijayakumarv@coregreen.in

https://doi.org/10.1007/978-981-10-8402-7_14
378 V. V. Kumar
and 1970. The miracle rice developed by Hank Beachell and colleagues at
International Rice Research Institute (IRRI) has significantly increased the rice
yields and benefitted poor people across Asia (Philips 2013). The green revolution
relied on crops with high-yielding varieties, response of crops to chemical fertilizers
and water, and synthetic herbicides and pesticides, for weed, disease, and insect
control. The tolerance of the wheat to biotic and abiotic stresses has made it possible
to double the food grain production worldwide. The green revolution (first “wave”)
in India was started in the late 1960s, and by the late 1970s, India became self-
sufficient in wheat production, and the impact of green revolution was confined to
Northern India. The second “wave” of green revolution covered almost all the crops
including rice covering the whole country, enabling the rise in rural income and
alleviating rural property (Fujita 2010; Meena et al. 2013a; Bahadur et al. 2014;
Maurya et al. 2014; Jat et al. 2015; Kumar et al. 2016b).
The green revolution relied on the package of inputs such as high-yielding variet-
ies (HYVs) developed through breeding techniques; chemical fertilizers and irriga-
tion; chemicals to control weeds, diseases, and pests; and mechanization. These
HYV were irrigated using canals or tube wells. Tube wells have been made by the
farmers wherever the electricity was available. Canals received water from the
dams/reservoirs made by the government. The chemical fertilizers supplied nutri-
ents such as nitrogen (N), phosphorus (P), potash (K), etc. which increased the
productivity. The monoculture has resulted in the increase in pest incidences in
HYV, and pesticides (synthetic chemicals) were used to control the pests. Even
though green revolution had fed the world by increasing the crop productivity
worldwide, the use of chemical fertilizers had reduced the soil fertility. It increased
the soil salinity. Salinity reduces the availability of micronutrients to the crops
(Kumar et al. 2015, 2016a; Ahmad et al. 2016; Meena et al. 2016a; Parewa et al.
2014; Prakash and Verma 2016; Jaiswal et al. 2016; Jha and Subramanian 2016).
The continuous use of chemical pesticides had reduced the naturally occurring
organisms which control the pests. It also resulted in environmental pollution. The
use of excess chemical fertilizers and pesticides have reached streams through run-
off water from the fields causing the eutrophication. Intensive commercial irrigation
resulted in soil erosion from irrigation on slope land, reduced soil nutrient content,
and compaction of soil by the use of heavy machinery (Moore and Parai 1996). The
chemical fertilizers are not used fully by the plants. When urea is used as nitrogen
fertilizer, some of it will be evaporated, a part will be utilized by the plants, and the
remaining will reach the streams through runoff water. Similarly when single super-
phosphate (SSP) and muriate of potash (MOP) are used as phosphate and potash
fertilizers, part of phosphate and potash are utilized by the plants, and the remaining
will be fixed in the soil through various chemical reactions making these fertilizers
unavailable to plants. Even though the soils are rich in phosphorus and potash, due
to their unavailability, the farmers are adding these fertilizers continuously to the
soil making the soils saline/alkaline (Meena et al. 2017).
At the same time, the continuous use of chemical pesticides is making the insects
resistant to the pesticides. To control these pests, the more powerful pesticides are
being developed and used. These pesticides are not biodegradable and are causing
14 Biofertilizers and Biopesticides in Sustainable Agriculture 379
environmental pollution. Substituting/supplementing the use of chemical fertilizers

and pesticides with biofertilizers and biopesticides along with organic manure can
make the agriculture sustainable by maintaining the soil fertility and alleviating the
various abiotic and biotic stresses.
14.2 Biofertilizers
Biofertilizers (also called as “bioinoculants”) are the living organisms of bacterial,

fungal, or algal origin. They are not the nutrients by themselves, but they help in
plant nutrition by various biochemical processes like nitrogen fixation, phosphate
solubilization, potash mobilization, zinc solubilization, phosphate and micronutri-
ent mobilization, etc. (Kumar 2013b; Meena et al. 2015a, 2016b; Priyadharsini and
Muthukumar 2016; Kumar et al. 2017; Raghavendra et al. 2016; Dotaniya et al.
2016; Meena et al. 2015f). The partial list of different biofertilizers with their func-
tion are given below (Table 14.1).
Apart from the above functions, the above bacteria and fungi are useful in plant
growth promotion by secretion of hormones such as auxins, cytokinins, gibberellins,
and abscisic acid which directly promote growth of the plants. These bacteria also
promote the plant growth by (a) antibiotic production, (b) siderophore secretion, (c)
production of low molecular weight metabolites such as hydrocyanic acid (HCN),
(d) production of lytic enzymes, (e) successfully competing with plant pathogens for
nutrients and colonizing surfaces on the roots, and (f) induced systemic resistance
(ISR) in plants (Gopalakrishnan et al. 2015; Zahedi 2016; Meena et al. 2015b; Rawat
et al. 2016; Yasin et al. 2016; Bahadur et al. 2016b; Das and Pradhan 2016;
Table 14.1 Partial list of biofertilizer organisms and their functions

Name of bacteria Function
Bacterial biofertilizers
Rhizobium, Azotobacter, Azospirillum, Acetobacter Nitrogen fixation
(Gluconacetobacter), Frankia, etc.
Bacillus megaterium, Pseudomonas sp., Rhodococcus, Phosphate solubilization
Arthrobacter, Serratia, Phyllobacterium, Paenibacillus,
Xanthomonas, Micrococcus, etc.
Frateuria aurantia, Bacillus mucilaginosus, etc. Potash solubilization
Bacillus sp., Pseudomonas sp., Xanthomonas sp., Zinc solubilization
Enterobacter sp., Mycobacterium sp., Stenotrophomonas sp.,
etc.
Fungal biofertilizers
Mycorrhiza (arbuscular mycorrhizal fungus – AMF) Phosphate solubilization,
mobilization, and micronutrient
mobilization
Penicillium Phosphate solubilization
Piriformospora indica Phosphate solubilization
380 V. V. Kumar
Dominguez-Nunez et al. 2016). Due to their potential in improving the plant growth
by nutrition, as well as alleviating biotic and abiotic stresses, these microorganisms
are called as plant growth-promoting microorganisms (PGPM). The bacteria and
fungi having potential in improving the plant growth are called as plant growth-
promoting rhizobacteria (PGPR) and plant growth-promoting fungi (PGPF).
14.2.1 Bacterial Biofertilizers
14.2.1.1 Nitrogen Fixation
Nitrogen is the essential element in the growth and development of all living organ-
isms, as it is a constituent of DNA, RNA, ATP, and proteins. In plants it is an essen-
tial constituent in chlorophyll, growth hormones, alkaloids, and glucosinolates. It is
present ~78% in the atmosphere in gaseous form making it the largest pool of nitro-
gen. But this nitrogen gas can’t be utilized by plants and animals. For nitrogen to be
available to make proteins, DNA, and other biologically important compounds, first
it must be converted into a different chemical form. The nitrogen is converted to
ammonia by reaction with hydrogen by catalytic reaction. Urea is produced by the
reaction of ammonia with carbon dioxide in industrial process that can be used in
agriculture as nitrogen fertilizer for increasing the crop yields (Meena et al. 2015e,
2016c, d; Saha et al. 2016a; Yadav and Sidhu 2016; Teotia et al. 2016).
The atmospheric nitrogen is also reduced to ammonia in the presence of nitroge-
nase by a process known as biological nitrogen fixation. Nitrogenase is an oxygen-
sensitive enzyme (a biological catalyst) found naturally in certain microorganisms.
The oxygen sensitivity is overcome by compartmenting in cyanobacteria (hetero-
cysts in Anabaena azollae), active respiration (Azotobacter), and synthesis of leghe-
moglobin (Rhizobium).
The NFR are either free living or symbiotic or associative symbiotic. Azotobacter
is an example of free living NFR. Rhizobium, Bradyrhizobium, and Sinorhizobium
are the symbiotic NFR forming the root nodules in leguminous plants. Similarly
actinomycete filamentous bacteria, Frankia, form root nodules in actinorhizal plants
in the genus Alnus (Alder, whereas Azospirillum, Klebsiella, etc. are the associative
symbiotic NFR living on the surface of the plant roots or sometimes invade the outer
cortical cells of the roots. The PGPR strains Acetobacter (Gluconacetobacter) are a
root-endophytic NFR isolated from sugarcane. Application of A. brasilense in
wheat in a greenhouse experiment, isolated from the rhizosphere soil, has promoted
sheath elongation, root depth, fresh weight of roots, fresh and dry weight of shoots,
total nitrogen, and bacterial counts in soil. In the absence of supplemented nitrogen
source, the wheat plants inoculated with Azospirillum had higher growth, mineral,
and chlorophyll (Sayed et al. 2015; Saha et al. 2016b; Verma et al. 2014, 2015b;
Meena et al. 2014a, 2016e; Masood and Bano 2016).
Molina et al. (2012) reported the colonization of Azospirillum brasilense from
inoculated mother plants to new daughter uninoculated plants via stolons by
c olonizing the inner tissues of roots and stolons in strawberry plants. Inoculation of
corn with Azospirillum and Azotobacter at 1, 2, and 3 kg/ha has increased the grain
yield, 1000 grain weight, grains/corn, and grains/row compared to the various doses
of nitrogen fertilizer application (Amiri and Rafiee 2013). The seed biopriming by
efficient PGPR strains leaf-sprayed inoculation of Azospirillum brasilense at V4
stage in maize has shown increased height and shoot and root dry mass. Also it
increased the ear size, chlorophyll content, 1000 grain weight, and grain yield (Costa
et al. 2015; Sharma et al. 2016; Verma et al. 2015a; Meena et al. 2013b, c; Singh et al.
2015; Bahadur et al. 2016a). Inoculation of Azospirillum brasilense in Cymbopogon
winterianus with 2,4-D increased the N-fixation and contributed to higher chloro-
phyll content and NR activity leading to higher yield and oil content compared to the
control treatment. Nitrogen content of stem, leaves, and roots increased compared to
control (Saikia et al. 2014). The application of Azotobacter in tomato has increased
the germination, shoot height, no. of leaves per plant, and length and width of leaves
compared to the control treatment (Mahato et al. 2009). The three Rhizobium isolates
YSY-25, YSY-26, and YSY-27 isolated from the rhizosphere soil of pigeon pea have
shown the production of IAA, YSY-25, and YSY-27 produced NH3 and YSY-26 pro-
duced HCN (Singh et al. 2013). The efficient NFR strains Gluconacetobacter diazo-
trophicus have been isolated from sugarcane roots. It is also isolated from the roots,
root hair, stem tuber, fruits, and rhizosphere of coffee, sweet potato, tea, pineapple,
mango, and banana. It is also found in the internal environment of VAM spores and
mealybugs (Muthukumarasamy et al. 2002; Shrivastava et al. 2016; Velazquez et al.
2016; Meena et al. 2015c, d; Singh et al. 2016). Acetic acid-producing NFR isolated
from four different rice varieties are identified as Gluconacetobacter diazotrophicus
on the basis of phenotypic characteristics and PCR assay using specific primers for
that species (Muthukumarasamy et al. 2005).
14.2.1.2 Phosphate Solubilization
Phosphorus is the second important essential macro-element required next to nitro-

gen in plants. It is required for various metabolic processes such as biosynthesis of
macromolecules, energy transfer, signal transduction, photosynthesis, and respira-
tion. Phosphorus is present in the soils both in organic and inorganic forms (Sindhu
et al. 2016; Meena et al. 2014b). Of these, organic form, as found in humus and
other organic materials including decayed plant, animal, and microbial tissues, is an
important reservoir of immobilized P accounting ~20 to 80% of total soil P. A part
of the phosphorus fertilizer on application to soil will be utilized by the plants, and
the rest will be fixed/forms complex with other chemicals in soil, making it unavail-
able to plants. The bacteria have the potential of mineralization and solubilization of
organic and inorganic phosphorus, respectively. Inorganic P is solubilized by the
action of organic and inorganic acids secreted by PSB in which hydroxyl and car-
boxyl groups of acids chelate cations (Al, Fe, Ca) and decrease the pH in basic soils
(Khan et al. 2009).
382 V. V. Kumar
Bacillus megaterium is the most widely used bacterium for P solubilization.

Pseudomonas is another important PSB. The other bacteria having P-solubilizing
potential are Arthrobacter sp. (Banerjee et al. 2010), Pantoea (Castagno et al. 2011),
Serratia (Farhat et al. 2009), Paenibacillus (Zhang et al. 2013), Xanthomonas
(Sharan et al. 2008), and Micrococcus and Bacillus sp. (Chatli et al. 2008). The
Bradyrhizobium isolated from the roots of soybean growing in Latur has shown the
phosphate solubilization efficiency. Out of the ten isolates, three isolates of
Bradyrhizobium (RSB02, RSB04, and RSB08) have shown the phosphate solubili-
zation ability (Jadhav 2013). The principal mechanism in soil for mineral phosphate
solubilization is lowering of soil pH by microbial production of organic acids and
mineralization of organic P by acid phosphatases. Inorganic P is solubilized by the
action of organic and inorganic acids secreted by PSB in which hydroxyl and car-
boxyl groups of acids chelate cations (Al and Fe) and decrease the pH in basic soils.
The PSB dissolve soil P through production of low molecular weight organic acids
mainly gluconic and ketogluconic acids, in addition to lowering the pH of rhizo-
sphere. pH of the rhizosphere is lowered through biotical production of proton/
bicarbonate release (anion/cation balance) and gaseous exchanges.
Phosphorus solubilization ability of PSB has direct correlation with the pH of the
medium (Khan et al. 2009). Release of root exudates such as organic ligands can
also alter the concentration of P in the soil solution. Organic acids produced by PSB
solubilize insoluble phosphates by lowering the pH, chelation of cations, and com-
peting with phosphate for adsorption sites in the soil (Nahas 1996). Inorganic acids,
e.g., hydrochloric acid, can also solubilize phosphate, but they are less effective
compared to organic acids at the same pH. An enzyme glucose dehydrogenase
(GDH) was induced fivefold by phosphate starvation by the bacterium Enterobacter
asburiae, isolated from alkaline Indian vertisol soils.
Concomitant with the release of GDH, glucose was converted to gluconic acid,
causing the reduction in soil pH and release of phosphate and iron (Gyaneshwar
et al. 1999). Phosphate ions readily precipitate with metal cations forming a range
of P minerals. In neutral or alkaline soils, P ions will precipitate as Ca phosphate,
dicalcium or octacalcium phosphates, hydroxyapatite, and eventually least soluble
apatites. Under acidic conditions P ions will precipitate as Fe and Al phosphates
such as strengite, vivianite, variscite, and various minerals of the plumbogummite
group. The Fe and Al phosphates have an increasing solubility with increasing pH,
while Ca phosphates have a decreasing solubility with increasing pH, except for pH
values above 8 (Hinsinger 2001).
Mineralization of soil organic P (Po) plays an imperative role in P cycling of a
farming system, which may constitute about 4–90% of the total soil P. Alkaline and
acid phosphatases secreted by the soil microorganisms use organic phosphate as a
substrate to convert it into inorganic form. Principal mechanism for mineralization
of soil organic P is the production of acid phosphatases. Release of organic anions
and production of siderophores and acid phosphatase by plant roots/microbes or
alkaline phosphatase enzymes hydrolyze the soil organic P or split P from organic
residues. The largest portion of extracellular soil phosphatases is derived from the
microbial population. Mixed cultures of PSMs (Bacillus, Streptomyces,
Pseudomonas, etc.) are most effective in mineralizing organic phosphate

(Mohammadi 2012).
Inoculation of phosphate-solubilizing and phytohormone-producing mutants of
Azotobacter chroococcum in wheat increased the grain, straw, biological yield,
spike length, spikelets spike−1, 1000 grain weight, and root biomass over control
(Kumar et al. 2001). Inoculation of alfalfa seedlings with phosphate-solubilizing
and nitrogen-fixing bacteria, Klebsiella pneumonia and Rhizobium meliloti, has
increased the survival rate of seedlings, shoot height, root length, root volume, leaf
area, individual number of leaves per plant, and biomass, and P uptake percentage
of the two Medicago sativa varieties were found remarkably increased than control
group (Li et al. 2013).
14.2.1.3 Potassium Solubilization
Potassium (K) is the very important mineral required for plant growth next to nitro-
gen and phosphorus. The K exists in several forms in soil such as mineral K, non-
exchangeable K, exchangeable K, and dissolved or solution K (K+ ions). Soil has
abundant reserves of K, among which only 1–2% can be directly absorbed by the
plants. However, ~90 to 98% of the soil K exists in silicate minerals such as K feld-
spar and mica, which only release K slowly (Zhang and Kong 2014). The dissolu-
tion of organic matter in soil produces organic acids such as citric acid, formic acid,
malic acid, and oxalic acid. These organic acids enhance the dissolution of K com-
pounds by supplying protons and by complexing Ca2+ ions (Shanware et al. 2014).
Potassium-solubilizing bacteria (KSB) Bacillus mucilaginosus solubilize potas-
sium by secreting organic acids from rock K mineral powders such as mica, illite, and
orthoclases. Wild type and mutant strain of Bacillus edaphicus solubilized the fixed
form of K by producing organic acids and capsular polysaccharides. Oxalic acid
seemed to be more effective with the Nanjing feldspar, whereas oxalic and tartaric
acids were responsible for mobilizing K in the Suzhou illite (Sheng and He 2006).
Biopriming through KSB strains Bacillus edaphicus in cotton and rape has
increased the potassium content by ~30% and 26%, respectively, in soils supple-
mented illite as potassium source. Shoot and root growth and N, P, and K uptake
were improved in both cotton and rape (Sheng 2005). Out of the seven KSB isolated
from potash-rich soil samples nearby ceramic industries, two isolates, KSB-1 and
KSB-7, are able to solubilize potash under in vitro conditions. The KSB-7 released
~33 mg/L from feldspar and KSB-1 released ~31 mg/L under control condition.
Inoculation of these isolates in mung bean has increased the plant growth and K
uptake compared to the control. KSB-1 is identified as a gram-negative bacterium
and KSB-7 is a gram-positive Bacillus sp. (Prajapathi 2016).
Inoculation of KSB in tea (Camellia sinensis) at 75% K fertilizer has recorded
the high chlorophyll, carotenoid, N, P, and K contents in the crop shoots. All the
quality parameters of tea such as theaflavin, thearubigin, highly polymerized sub-
stances, total liquor color, caffeine, briskness, and color and flavor indexes were
384 V. V. Kumar
greatly improved in KSB-treated plants, which in turn improve the tea quality as
well (Bagyalakshmi et al. 2012).
14.2.1.4 Zinc Solubilization
Zinc is an essential micronutrient for prokaryotic and eukaryotic organisms. It is

present in the enzyme systems as cofactor and metal activators of many enzymes.
Exogenous application of soluble zinc sources, similar to fertilizer application, has
been advocated to various crops. This causes transformation ~96 to 99% of applied
available zinc to various unavailable forms (Saravanan et al. 2003). High pH and
high content of CaCO3, organic matter, phosphate, and copper can fix zinc in the
soil giving rise to the reduction of available Zn. These efficient rhizospheric micro-
organisms play a key role in solubilization of unavailable form of Zn to available
forms. This Zn solubilization was due to the production of organic acids and pH
drop by the organisms. The release of organic acids that sequester cations and acid-
ify the microenvironment near root is thought to be a major mechanism of Zn
solubilization.
A number of organic acids such as acetic, citric, lactic, propionic, glycolic,
oxalic, gluconic acid, etc. have been considered due to its effect in pH lowering by
microorganisms. Organic acid secreted by microflora increases soil Zn availability
in two ways; they are probably exuded both with protons as counterions and, conse-
quently, reduce rhizospheric pH. In addition, the anions can chelate Zn and increase
Zn solubility which results in the conversion of available form (Zn2+) to plants.
Bacillus and Pseudomonas sp. are widely used bacteria for Zn solubilization.
Aspergillus sp. is also studied for zinc solubilization potential (Kumari et al. 2014).
The endophytic bacteria (Klebsiella, Bacillus, Pseudomonas, Paenibacillus, and
Enterococcus sp.) isolated from soybean and mung bean have shown zinc-
solubilizing potential. Klebsiella and Pseudomonas sp. has solubilized both the
inorganic sources of Zn supplemented in Tris mineral medium and P solubilization
and IAA production (Sharma et al. 2014). Application of Azospirillum, Pseudomonas,
and Rhizobium to wheat along with various concentrations of N and P has consider-
ably increased zinc content in different parts of wheat plant at different growth
stages.
Zinc concentration was increased in all the microbial treatments compared to
controls in wheat shoot, flag leaves, straw, grain, and roots compared to chemical
fertilizer treatments (Naz et al. 2016). Burkholderia (one strain) and Acinetobacter
(two strains) isolated from the Zn-deficient rice-wheat field, when applied to rice
either individually or in combination, have significantly increased the mean dry
matter yield/pot (~13%), productive tillers/plant (~15%), number of panicles/plant
(~13%), number of grains/panicle (~13%), grain yield (~17%), and straw yield
(~12%) over the control and Zn fertilizer treatment, respectively.
The bacterial inoculations also significantly enhanced the total Zn uptake/pot
(~53%) as well as grain methionine concentration ~39% (Vaid et al. 2014). Different
strains of Pseudomonas sp. (P. putida, P. fluorescens, P. aeruginosa) have shown the
Zn-solubilizing ability by forming clearing zone in medium with zinc oxide and
zinc carbonate in plate assay. The shift in the pH of the medium from 7.0–7.2 to
4.5–6.5 is the clear indication of secretion of acids by the Pseudomonas sp. which
solubilized the Zn in the medium (Bapiri et al. 2012).
14.2.2 Fungal Biofertilizers
Mycorrhiza (arbuscular mycorrhizal fungus – AMF), Penicillium, Aspergillus,

Chaetomium, Fusarium, Mucor ramosissimus, and Trichoderma sp. are the fungi
having good P-solubilizing potential and can be used as biofertilizer.
14.2.2.1 Mycorrhiza
The mycorrhiza (commonly called as “fungus root”) is the symbiotic association

between plant roots and soil fungus. Seven types of mycorrhiza were identified so
far. They are (a) ectomycorrhiza, (b) endomycorrhiza (AMF), (c) ectendomycor-
rhiza, (d) ericoid mycorrhiza, (e) arbutoid mycorrhiza, (f) monotropoid mycorrhiza,
and (g) orchidoid mycorrhiza.
Out of the seven types, endomycorrhiza is the most important one as AMF asso-
ciations were found in the roots ~85% of the land plant families. An AMF fungus
lives within the plant roots. The hyphae of the fungi extend outside into the soil
beyond the nutrient depletion zone for exploration of mineral nutrients in a greater
volume of the soil (Habte 2000). The AMF hyphae enter into the cortical cells of the
root forming arbuscules, which are dichotomously branched structures. Arbuscules
are the sites of nutrient exchange. In the intercellular spaces of root cortical cells,
deeply stained bodies formed by hyphae are called as vesicles. They are the storage
organs. They store lipids and phosphorus in the form of polyphosphate granules.
This polyphosphate is converted into inorganic phosphate by enzymatic action and
will be utilized by the plants under phosphate deficient conditions.
The primary function of AMF is phosphate nutrition (Whitman 2009). The fol-
lowing are the benefits of AMF: increased phosphorus and micronutrients uptake
(zinc, copper, iron, sulfur, manganese, cobalt, molybdenum, etc.); increased water
uptake; increased resistance to pathogens and pests; enhanced tolerance to soil
stress, viz., high salt levels, heavy metal toxicity, drought, high temperatures, etc.;
improved seedling survival on transplantation; and enhanced beneficial microbial
population in the root zone.
The soil phosphorus levels are critical for obtaining the benefits of mycorrhizal
inoculation; these benefits of mycorrhizae are greatest when soil phosphorus levels
are at or below ~50 ppm. Mycorrhizal infection of roots declines above this level.
Little infection occurs above ~100 ppm P even when soil is inoculated with a mycor-
rhizal mix (Swift 2004). The AMF hyphae, due to their smaller diameter of 2–5 μm,
can penetrate soil pores inaccessible to root hairs (~10 to 20 μm diameter) and
386 V. V. Kumar
absorb water that is not available to non-mycorrhizal plants. The rate of water trans-
port by extraradical hyphae to the root was 0.28 ng/s per entry point, a level suffi-
cient to modify plant water relations (Lozano 2003).
Inoculation of AMF Glomus and Acaulospora sp. in tomato seedlings in the
presence or absence of pathogen (Fusarium oxysporum f.sp. lycopersici) increased
the stem diameter, leaf area, and shoot and root dry weight. Percent colonization
was decreased in the presence of pathogen from ~82% to 64% in Glomus fascicula-
tum and from ~90% to 78% in Acaulospora laevis (Manila and Nelson 2013). AMF
has densely colonized the roots of Lotus glaber Mill (~90%) and Stenotaphrum
secundatum. The percentage of colonized root length in L. glaber was higher (90%)
than in S. secundatum (73%) at high values of soil pH of 9.2 and at an exchangeable
sodium percentage (65%). The arbuscular colonization fraction increased at the
beginning of the growing season and was positively associated with increased P
concentration in both shoot and root tissue.
The vesicular colonization fraction was high in summer when plants suffer from
stress imposed by high temperatures and drought periods and negatively associated
with P in plant tissue (Garcia and Mendoza 2007). Silva et al. (2008) had studied the
effect of AMF isolates (Scutellospora heterogama SCT120E, Gigaspora decipiens
SCT304A, Acaulospora koskei SCT400A, Entrophospora colombiana SCT115)
individually or mix and by the addition of P on the development and oleoresin pro-
duction in micropropagated Zingiber officinale. In all the mycorrhizal treatments,
oleoresin production was high compared to control except in the treatment with Ec.
Oleoresin production was 3.48 and 1.58% higher in the treatments with S. herogama
and G. decipiens compared to control after 210 days. The higher fresh biomass was
recorded in all the treatments except Sh compared to control; higher oleoresin and
higher content of total extracted oils were recorded in all treatments except Ec com-
pared to control after 210 days.
Among 62 fungal isolates, 253 bacterial isolates obtained from heavy metal soils
of Orissa were screened for P-solubilizing ability. Among the fungal isolates of
Penicillium sp. 21 have solubilized tricalcium phosphate (TCP) and released ~82 μg
P mL−1; Aspergillus sp. MNF1 has produced ~37 μg P mL−1 from TCP. Penicillium
sp. 2 isolate has solubilized rock phosphate (RP) and released ~5 μg P mL−1 in liquid
culture medium. These rhizobacterial cultures were poor solubilizers of phosphate
in both solid and liquid media (Gupta et al. 2007). The 47 fungal isolates were col-
lected from the mangrove and screened for P-solubilizing ability. Among these iso-
lated MPF-8 showed maximum P solubilization, and it was identified as Aspergillus
niger based upon molecular identification using 16S rDNA sequencing.
Supplementing Pikovskaya’s broth with glucose and ammonium sulfate as car-
bon and nitrogen source recorded maximum P solubilization of ~401 and 427 μg
mL−1, respectively. At optimum pH (7.0) and temperature (30 °C), A. niger solubi-
lized and liberated ~443 and 468 μg mL−1 of soluble phosphate (Bhattacharya et al.
2015). The P-solubilizing fungi Penicillium expansum, Mucor ramosissimus, and
Candida krissii isolated from phosphate mines of People’s Republic of China pro-
moted growth, soil available phosphorus, and phosphorus and nitrogen uptake in
wheat seedlings in field soil containing rock phosphate under pot culture conditions
(Xiao et al. 2009).
Cane yield and sugar yield (t/ha) were increased by the application of mycor-
rhiza at 12.5 kg/ha at 75% P + 100% NK at the time of planting in sugarcane. The
cane yield and sugar yield were increased from ~79 to 94 t/ha and 10–12 t/ha in
control and mycorrhiza-applied plot, respectively. Available P content was increased
in mycorrhiza applied plots compared to control (Rani et al. 2011).
Biofertilizers are synergistic to each other and can be applied as consortia to
obtain maximum benefits. The application of NPK biofertilizers and AMF together
will improve the nutrient uptake, yield, and quality of the produce. The coinocula-
tion of Bacillus megaterium var. phosphaticum (PSB) and Bacillus mucilaginosus
(KSB) in pepper and cucumber in nutrient limited soil has resulted in higher P and
K availability than in control (Han et al. 2006). Similarly coinoculation of Bacillus
sphaericus and Pseudomonas sp. in rice at half dose of inorganic fertilizer input has
recorded enhanced shoot biomass, leaf chlorophyll content, and N, P, K, Ca, and Mg
content (Adzmi et al. 2014).
Inoculation of Azotobacter and AMF either singly or in combination in wheat
has increased spike as compared to control. Azotobacter + mycorrhiza treatment
increased grain protein by ~13% than control. The significantly higher kernel weight
was found in Azotobacter and Azotobacter + mycorrhiza and minimum in control
and mycorrhiza treatments. Ammonium nitrate and Azotobacter + mycorrhiza treat-
ments gave significantly higher grain yield than the other N sources and biofertil-
izers (Bahrani et al. 2010). The list of commonly used biofertilizers is given below
(Table 14.2).
14.2.3 Advantages of Biofertilizers
The following are the advantages of biofertilizers:

1. Improvement in nutrient uptake (up to ~25%).
2. Reduction in fertilizer usage (up to ~25%).
3. Improvement in crop yield (up to ~15%).
4. Improvement in the quality of the produce.
5. Tolerance to biotic and abiotic stresses.
6. Better acclimatization of transplants.
7. Reclamation of degraded soils, sodic soils, habitat restorations, etc.
8. Improves the soil fertility.
388 V. V. Kumar
Table 14.2 List of commonly used biofertilizers

Name of Bacteria/
biofertilizer fungi Useful for crops Benefits Remarks
Rhizobium Bacteria Leguminous crops like 10–35% yield Leaves residual
ground nut, soybean increase, nitrogen in soil
50–200 kg N ha−1
Azotobacter Bacteria Non-leguminous crops, 10–15% yield Also controls
useful for soils increase, improve certain diseases
containing high organic 20–25 kg N ha−1
matter
Azospirillum Bacteria Soil treatment for 10–20% yield Produces growth-
non-leguminous crops increase promoting
and maize, barley, oats, substances
sorghum, sugarcane,
millets
P-solubilizers Bacteria/ Soil application for all 5–30% yield Can be applied with
fungi crops increase NFB along with
rock phosphate
AMF Fungi Many trees, some crops, 30–50% yield Can be applied in
and some ornamental increase, enhances combination with
plants uptake of P, Zn, S, bacterial
and water biofertilizers
9. Reduces environmental pollution.

10. They are cost-effective, eco-friendly, and easy to handle and apply.
11. No residues are left in the soil.
14.3 Biopesticides
Biopesticides or biological pesticides are a form of pesticides based on microorgan-

isms or natural products. They are categorized into (a) microbial biopesticides con-
taining microorganisms in controlling diseases and insects, (b) botanical
biopesticides, and (c) plant-incorporated protectants.
The microbial biopesticides are the formulations containing bacteria, fungi, or
viruses for controlling disease-causing fungi/bacteria and insects. The biofungicides
control the fungal pathogens by various mechanisms such as competition, myco-
parasitism, antibiosis, and lysis. Bacillus thuringiensis control the insect larvae
belonging to the orders Coleoptera, Diptera, and Lepidoptera by secretion of crystal
proteins also known as δ-endotoxins (Mathew et al. 2014). The primary action of
crystal proteins (toxins) is to lyse midgut epithelial cells in the target insect by form-
ing pores in the gut cell membrane, followed by destruction of the epitherlial cells.
B. thuringiensis subsp. israelensis is highly toxic to Aedes, Culex, and Anopheles
mosquito species that are vectors of human diseases (Bravo et al. 2007). The toxin-
producing genes from Bacillus thuringiensis are introduced into cotton, corn,
brinjal, and other economically important crops through genetic engineering

techniques. The plants have the inherent capacity to produce crystal proteins in all
the plant parts. When insects feed on the leaves and other plant parts, the crystal
proteins act on the insects and the insects will be killed.
Beauveria bassiana and Metarhizium anisopliae are the entomopathogenic
fungi. B. bassiana spores upon contact with the body of an insect host; they germi-
nate, penetrate the cuticle, and grow inside the host killing the insect. Afterward, a
white mold emerges from the cadaver and produces new spores. M. anisopliae
spores when come into contact with the body of an insect host, they germinate, and
the hyphae that emerge penetrate the cuticle. The fungus then develops inside the
body eventually killing the insect after a few days. Trichoderma and Pseudomonas
are the most widely used biopesticides for controlling the soilborne diseases
(Handelsman and Stabb 1996).
Trichoderma is a filamentous fungus isolated from soil, dead woods and organic
matter. Different species of Trichoderma such as T. viride, T. harzianum, and T.
virens have the good biocontrol potential (Kumar 2016). The biocontrol abilities
have been attributed to various mechanisms such as competition for nutrients;
mycoparasitism by secretion of cell wall-degrading enzymes chitinase, glucanases,
proteases, etc.; and antibiosis by production of antibiotic compounds such as harzi-
anic acid, alamethicins, tricholin, peptaibols, antibiotics, 6-pentyl-α-pyrone, mas-
soilactone, viridin, gliovirin, glisoprenins, heptelidic acid, etc. (Benítez et al. 2004).
Trichoderma successfully controls the pathogenic fungi such as Fusarium,
Phytophthora, Sclerotia, etc. by the above mechanisms. Pseudomonas sp. has con-
trolled the Fusarium sp. causing wilt in carnation and Pythium sp. and Rhizoctonia
sp. causing damping-off in cotton. It induced resistance to anthracnose disease
caused by Colletotrichum sp. in cucumber. Pseudomonas suppressed pathogens by
secretion of antibiotics such as phenazine-1-carboxylic acid (PCA) and other deriv-
atives, 2,4-diacetylphloroglucinol (DAPG), pyrrolnitrin (Prn), and/or pyoluteorin
(Plt), and by induced systemic resistance (ISR) (Weller 2007). The following is the
partial list of important categories of biopesticides and their target organisms
(Table 14.3).
Other categories of biopesticides include the following (Kumar 2013a).
14.3.1 Predators
Chrysopa carnea and Chrysopa rufilabris are found abundantly in the fields. They
lay eggs on foliage. After hatching in a day or 2, they feed on aphids, larvae, eggs,
small worms, mites, thrips, and immature whitefly.
390 V. V. Kumar
Table 14.3 Important biopesticides and target pathogens/pests

Name of organism Target pathogens/pests
Bacterial biopesticides
Bacillus sp. Fusarium, Verticillium, Pythium, Cercospora, Colletotrichum,
Alternaria, Ascochyta, Macrophomina, Myrothecium, Ramularia,
Xanthomonas, Erysiphe polygoni, Rhizoctonia, Phytophthora,
Botrytis, Sclerotiana, Erwinia, etc.
Bacillus thuringiensis Caterpillars, weevils, leafhoppers, bugs, leaf-feeding insects, etc.
Gliocladium sp. Alternaria, Chaetomium, Penicillium, Aspergillus, Rhizopus,
Fusarium, etc.
Pseudomonas sp. Penicillium, Botrytis cinerea, Mucor, Helminthosporium,
Colletotrichum, Pythium, Sclerotiana, etc.
Agrobacterium Agrobacterium tumefaciens
radiobacter strain 84
Alcaligenes sp. Aspergillus, Fusarium, Alternaria, etc.
Serratia sp. Sclerotium, etc.
Trichoderma sp. Sclerotinia, Rhizoctonia, Phytophthora, Fusarium, Pythium,
Cercospora, Colletotrichum, Alternaria, Ascochyta, Macrophomina,
Myrothecium, Ralstonia, etc.
Beauveria bassiana Termites, thrips, beetles, whiteflies, mealybugs, grasshoppers, stem
borers, etc.
Metarhizium anisopliae Root weevils, plant hoppers, Japanese beetle, black vine weevil, white
grubs, termites, etc.
Verticillium lecanii Thrips, whiteflies, aphids, mealybugs, etc.
Viral biopesticides
Granulosis virus and Alfalfa looper, corn earworm, imported cabbageworm, cabbage looper,
nuclear polyhedrosis cotton bollworm, cotton leafworm, tobacco budworm, armyworms,
virus (NPV) European corn borer, almond moth, spruce budworm, Douglas-fir
tussock moth, pine sawfly, and gypsy moth
Botanical biopesticides
Azadirachtin Thrips, jassids, aphids and whiteflies, flea beetles, Helicoverpa
armigera, Helicoverpa zea, Spodoptera litura, Spodoptera exigua,
Earias spp., Achaea janata, bunch caterpillars, leaf folders,
armyworm, cutworm
Squamocin Helicoverpa armigera, Helicoverpa zea, Spodoptera litura,
Spodoptera exigua, bunch caterpillar, green leafhopper, leaf folder,
armyworm, cutworm, aphid
14.3.2 Parasitoids
Trichogramma is an exclusive egg parasitoid. It lays eggs in the eggs of various

Lepidopteron pests (moths, butterflies). After hatching the larvae feed on the host
egg and destroy it. Being an egg parasitoid, it destroys the pest population before it
causes any damage to the crops. It is used against sugarcane, paddy, fruits, and veg-
etable pests.
14.3.3 Entomopathogenic Nematodes
Heterorhabditis is an entomopathogenic nematode used for control of different

beetle larvae in soil. It searches the host in the soil, and after active penetration into
the larval body through the cuticle, the nematode releases a symbiont pathogenic
bacterium (Photorhabdus) that multiplies rapidly and kills the host, within 24–72 h.
Heterorhabditis and Photorhabdus then feed upon the insect. Spawned juvenile
nematodes then search for new hosts.
14.3.4 Pheromones
These are the biochemical biopesticides. Pheromones are chemical signals that trig-
ger a natural response in another member of the same species. Insects release phero-
mones to serve many functions. Pheromones are secreted to indicate the location of
food sources, to warn others around about potential dangers, or to locate a potential
mate for reproduction. Synthetic pheromones can be used to disrupt pest ecology and
reduce crop damage. Small amounts of synthetic female pheromone are used to attract
males into traps; by measuring trap counts, the data can be used to predict the insect
population; and a decision on appropriate pest control measures can be initiated.
14.3.5 Advantages of Biopesticides
1. They are less harmful than chemical fertilizers.

2. They are often effective in small quantities.
3. They give protection throughout the crop period.
4. They multiply easily in soil and leave no residual problem and eliminate the
pathogens/pests from the site of infection. The target organisms are only killed/
suppressed.
5. They are highly effective against specific diseases/pests and can be used in com-
bination with biofertilizers.
6. They do not cause toxicity to plants and are eco-friendly and easy to handle.
They are safe to the environment and the person who applies them.
7. Along with controlling the plant diseases and pests, they can be used as a com-
ponent in IPM (integrated pest management) and greatly reduce the use of con-
ventional pesticides, while the crop yields remain high.
392 V. V. Kumar
14.4 Concluding Remarks and Future Prospects
The use of chemical fertilizer and pesticides in agriculture is increasing alarmingly

that are causing adverse effect on human health, groundwater quality, and soil fertil-
ity. To overcome these adverse effects, there is an urgent need to adopt eco-friendly
fertilizers and pesticides. Biofertilizers contain microbial inoculant, which supplies
macro- and micronutrients, secretes plant hormones, and increases the soil organic
matter, thus restoring the soil fertility. Biopesticides will control the pests without
causing any adverse effect to the nontarget pests. The use of biofertilizers in agricul-
ture maintains healthy soils which is a key factor in sustainable agriculture that
produces healthy crop plants with optimum vigor and less susceptibility to pests.
Availability of quality bioproducts and creating awareness among farmers for using
biofertilizers and biopesticides are the key to achieve success in making the agricul-
ture sustainable.
Acknowledgments The author is thankful to the Management of Core Green Sugar and Fuels
Pvt. Ltd. for giving an opportunity and encouragement in preparation of this chapter.
References
Adzmi F, Saud HM, Ismail MR, Othman R, Habib SH, Kausar H (2014) Effect of co-inoculation
of nitrogen fixing and phosphate solubilizing microorganisms in combination with chemical
fertilizers on growth and development of rice. Crop Res 47:1–6
https://doi.org/10.1007/978-81-322-2776-2_21
Amiri A, Rafiee M (2013) Effect of soil inoculation with Azospirillum and Azotobacter bacteria on
nitrogen use efficiency and agronomic characteristics of corn. Ann Biol Res 4:77–79
Bagyalakshmi B, Ponmurugan P, Marimuthu S (2012) Influence of potassium solubilizing bacteria
on crop productivity and quality of tea (Camellia sinensis). Afr J Agric Res 7:4250–4259
451.2016.1219431
Bahrani A, Pourreza J, Hagh Joo M (2010) Response of winter wheat to co-inoculation with
Azotobacter and Arbuscular mycorrhizal fungi (AMF) under different sources of nitrogen fer-
tilizer. Am-Euras J Agric Environ Sci 8:95–103
Banerjee S, Palit R, Sengupta C, Standing D (2010) Stress induced phosphate solubilization by
Arthrobacter sp. and Bacillus sp. isolated from tomato rhizosphere. Aust J Crop Sci 4:378–383
Bapiri A, Asgharzadeh A, Mujallali H, Khavazi K, Pazira E (2012) Evaluation of zinc solubiliza-

tion potential by different strains of fluorescent Pseudomonads. J Appl Sci Environ Manage
16:295–298
Benítez T, Rincón AM, Limón MC, Codón AC (2004) Biocontrol mechanisms of Trichoderma
strains. Int Microbiol 7:249–260
Bhattacharya S, Das A, Bharajwad S, Rajan SS (2015) Phosphate solubilizing potential of
Aspergillus niger MPF-8 isolated from Muthupettai mangrove. J Sci Ind Res 74:499–503
Bravo A, Gill SS, Soberón M (2007) Mode of action of Bacillus thuringiensis cry and Cyt toxins
and their potential for insect control. Toxicon 49(4):423–435
Castagno LN, Estrella MJ, Sannazzaro AI, Grassano AE, Ruiz OA (2011) Phosphate-solubilization
mechanism and in vitro plant growth promotion activity mediated by Pantoea eucalypti iso-
lated from Lotus tenuis rhizosphere in the Salado river basin (Argentina). J Appl Microbiol
110:1151–1165
Chatli AS, Beri V, Sidhu BS (2008) Isolation and characterisation of phosphate solubilising
microorganisms from the cold desert habitat of Salix alba Linn. in trans Himalayan region of
Himachal Pradesh. Indian J Microbiol 48:267–273
Costa RRGF, Quirino GSF, Naves DCF, Santos CB, Rocha AFS (2015) Efficiency of inoculant
with Azospirillum brasilense on the growth and yield of second-harvest maize. Pesq Agropec
Trop Goiânia 45:304–311
org/10.1007/978-81-322-2776-2_20
pp 77–98. https://doi.org/10.1007/978-81-322-2776-2_6
org/10.1007/978-81-322-2776-2_19
Farhat MB, Farhat A, Bejar W, Kammoun R, Bouchaala K, Fourati A, Antoun H, Bejar S,
Chouayekh H (2009) Characterization of the mineral phosphate solubilizing activity of
Serratia marcescens CTM 50650 isolated from the phosphate mine of Gafsa. Arch Microbiol
191:815–824
Fujita K (2010) The green revolution and its significance for economic development: the Indian
experience and its implications for Sub-Saharan Africa. JICA–RI working paper. no.17,
pp 1–27
Garcia IV, Mendoza RE (2007) Arbuscular mycorrhizal fungi and plant symbiosis in a saline-sodic
soil. Mycorrhiza 17:167–174
Gopalakrishnan S, Sathya A, Vijayabharathi R, Varshney RK, Lakshmipathi Gowda CL, Krishna
ML (2015) Plant growth promoting rhizobia: challenges and opportunities. 3 Biotech 5:355–377
Gupta N, Sabat J, Parida R, Kerkatta D (2007) Solubilization of tricalcium phosphate and rock
phosphate by microbes isolated from chromite, iron and manganese mines. Acta Bot Croat
66:197–204
Gyaneshwar P, Parekh LJ, Archana G, Poole PS, Collins MD, Hutson RA, Kumar GN (1999)
Involvement of a phosphate starvation inducible glucose dehydrogenase in soil phosphate solu-
bilization by Enterobacter asburiae. FEMS Microbiol Lett 171:223–229
Habte M (2000) Mycorrhizal fungi and plant nutrition. In: Silva JA, Uchida R (eds) Plant nutrient
management in Hawaii’s soils, approaches for tropical and subtropical agriculture. College
of Tropical Agriculture and Human Resources, University of Hawaii at Manoa, Honolulu,
pp 127–131
394 V. V. Kumar
Han HS, Supanjani D, Lee KD (2006) Effect of co-inoculation with phosphate and potassium
solubilizing bacteria on mineral uptake and growth of pepper and cucumber. Plant Soil Environ
52:130–136
Handelsman J, Stabb EV (1996) Biocontrol of soil borne plant pathogens. Plant Cell 8:1855–1869
Hinsinger P (2001) Bioavailability of soil inorganic P in the rhizosphere as affected by root induced
chemical changes: a review. Plant and Soil 237:173–195
Jadhav RN (2013) Isolation of rhizobia from soybean cultivated in latur area and study of its phos-
phate solubilization activity. Biosci Discov 4:100–103
9(2):1211–1221
Khan AA, Jilani G, Akhtar MS, Saqlan Naqvi SM, Rasheed M (2009) Phosphorus solubilizing
bacteria: occurrence, mechanisms and their role in crop production. J Agric Biol Sci 1:48–58
Kumar VV (2013a) Biopesticides: ecofriendly pesticides. Life Sci India 1(5):51–54
Kumar VV (2012/2013b). Biofertilizers: poised for growth. Life Sci India 1(3): 44–45
Kumar VV (2016) Plant growth-promoting microorganisms: interaction with plants and soil.
Plant, soil and microbes. In: Hakeem KR et al (eds). Springer International Publishing, Cham,
pp 1–16
Kumar V, Behl RK, Narula N (2001) Establishment of phosphate-solubilizing strains of
Azotobacter chroococcum in the rhizosphere and their effect on wheat cultivars under green
house conditions. Microbiol Res 156:87–93
https://doi.org/10.1007/s00344-016-9663-5
Kumari SK, Devi SNP, Vasandha S, Anitha S (2014) Microbial inoculants-a boon to zinc deficient
constraints in plants: a review. Int J Sci Res Publ 4:1–4
Li JF, Zhang SQ, Huo HP, Shi SL, Miao YY (2013) Effect of phosphate solubilizing Rhizobium
and nitrogen fixing bacteria on growth of alfalfa seedlings under P and N deficient conditions.
Pak J Bot 45:1557–1562
Lozano JMR (2003) Arbuscular mycorrhizal symbiosis and alleviation of osmotic stress. New
perspectives for molecular studies. Mycorrhiza 13:309–317
Mahato P, Badoni A, Chauhan JS (2009) Effect of Azotobacter and nitrogen on seed germination
and early seedling growth in tomato. Researcher 1:62–66
Manila R, Nelson R (2013) Nutrient uptake and promotion of growth by arbuscular mycorrhizal
fungi in tomato and their role in bio-protection against the tomato wilt pathogen. J Microbiol
Biotech Res 3:42–46
https://doi.org/10.1007/978-81-322-2776-2_10
Mathew IL, Singh D, Singh RP, Tripathi CPM (2014) Bacillus thuringiensis: the biocontrol agent
in a food web perspective. Biolife 2:348–362
Meena VS, Maurya BR, Verma R, Meena RS, Jatav GK, Meena SK, Meena R, Meena SK (2013c)
Soil microbial population and selected enzyme activities as influenced by concentrate manure
and inorganic fertilizer in alluvium soil of Varanasi. Bioscan 8(3):931–935
growth and yield of wheat (Triticum aestivum L.) Bangladesh. J Bot 44(1):143–146
jclepro.2015.04.044
396 V. V. Kumar
Mohammadi K (2012) Phosphorus solubilizing bacteria: occurrence, mechanisms and their role in
crop production. Resour Environ 2:80–85
Molina MFG, Winic BC, Pedraza RO (2012) More than rhizosphere colonization of strawberry
plants by Azospirillum brasilense. Appl Soil Ecol 61:205–212
Moore FJ, Parai BJ (1996) The green revolution. Green:1–17. http://people.ucalgary.ca/~pfitzger/
green.pdf
Muthukumarasamy R, Revathi G, Seshadri S, Lakshminarasimhan C (2002) Gluconacetobacter
diazotrophicus (syn. Acetobacter diazotrophicus), a promising diazotrophic endophyte in trop-
ics. Curr Sci 83:137–145
Muthukumarasamy R, Cleenwerck I, Revathi G, Vadivelu M, Janssens D, Hoste B, Gum KU, Park
KD, Son CY, Sa T, Caballero-Melladoe J (2005) Natural association of Gluconacetobacter
diazotrophicus and diazotrophic Acetobacter peroxydans with wetland rice. Syst Appl
Nahas E (1996) Factors determining rock phosphate solubilization by microorganism isolated
from soil. World J Microbiol Biotechnol 12:567–572
Naz I, Ahmad H, Khokhar NS, Khan K, Shah AH (2016) Impact of zinc solubilizing bacteria on
zinc contents of wheat. Am-Euras J Agric Environ Sci 16:449–454
Philips RL (2013) Norman E. Borlaug 1914–2009 biographical memoir. National Academy of
Sciences, Washington, DC, pp 1–16. www.nasonline.org/memoirs
Prajapathi K (2016) Impact of potassium solubilizing bacteria on growth and yield of mung bean
Vigna radiata. Indian J Appl Res 6:390–392
org/10.1007/978-81-322-2776-2_4
Rani TU, Naidu NV, Ramalakshmi CS, Kumar VV, Sreelatha T (2011) Bioefficacy of mycorrhizae
on yield and quality of sugarcane. J Soils crops 21:1–8
Rawat J, Sanwal P, Saxena J (2016) Potassium and its role in sustainable agriculture. In: Meena
VS, Maurya BR, Verma JP, Meena RS (eds) Potassium solubilizing microorganisms for sus-
tainable agriculture. Springer, New Delhi, pp 235–253. https://doi.org/10.1007/978-81-322-
2776-2_17. root-induced chemical changes: a review. Plant soil :173–195
pp 127–136. https://doi.org/10.1007/978-81-322-2776-2_9
Saikia SP, Goswami A, Mudoi KD, Gogoi A, Kotoky R, Lekhak H, Handique N (2014) Effect
of 2,4-D treatment and Azospirillum inoculation on growth of Cymbopogon winterianus. Afr
J Microbiol Res 8:955–960
Saravanan VS, Subramoniam SR, Raj SA (2003) Assessing in vitro solubilization potential of dif-
ferent zinc solubilizing bacterial (ZSB) isolates. Braz J Microbiol 34:121–125
Sayed E, Hameda EA, Althubiani AS (2015) Enhancement of plant growth by soil inoculation with
Azospirillum brasilense HM1 isolated from soil of Saudi Arabia. Int J Curr Microbiol App Sci
4:238–248
Shanware AS, Kalkar SA, Trivedi MM (2014) Potassium solubilisers: occurrence, mechanism and
their role as competent biofertilizers. Int J Curr Microbiol App Sci 3:622–629
Sharan A, Shikha, Darmwal NS, Gaur R (2008) Xanthomonas campestris, a novel stress tolerant,
phosphate-solubilizing bacterial strain from saline–alkali soils. World J Microbiol Biotechnol
24:753–759
Sharma P, Kumawat KC, Kaur S, Kaur N (2014) Assessment of zinc solubilization by endophytic
bacteria in legume rhizosphere. Indian J Appl Res 4(6):439–441
Sheng XF (2005) Growth promotion and increased potassium uptake of cotton and rape by a potas-
sium releasing strain of Bacillus edaphicus. Soil Biol Biochem 37:1918–1922
Sheng XF, He LY (2006) Solubilization of potassium-bearing minerals by a wild-type strain of
Bacillus edaphicus and its mutants and increased potassium uptake by wheat. Can J Microbiol
52:66–72
Silva MF, Pescador R, Rebelo RA, Stürmer SL (2008) The effect of arbuscular mycorrhizal fungal
isolates on the development and oleoresin production of micropropagated Zingiber officinale.
Braz J Plant Physiol 20:119–130
Singh Y, Ramteke PW, Shukla PK (2013) Characterization of Rhizobium isolates of pigeon pea
rhizosphere from allahabad soils and their potential PGPR characteristics. Int J Res Pure Appl
Microbiol 3:4–7
Swift CE (2004) Mycorrhiza and soil phosphorus levels. http://www.colostate.edu/Depts/CoopExt/
TRA/PLANTS/mycorrhiza.html
Vaid SK, Kumar B, Sharma A, Shukla AK, Srivastava PC (2014) Effect of zinc solubilizing bacte-
ria on growth promotion and zinc nutrition of rice. J Soil Sci Plant Nutr 14(4):889–910
398 V. V. Kumar

84(8):914–919
Weller DM (2007) Pseudomonas biocontrol agents of soilborne pathogens: looking back over 30
years. Phytopathology 97:250–256
Whitman M (2009) Mycorrhizae and plants. Wild ones March/April, pp 1–3
World Ecology Report (2008) Famine: natural or man made? XX:1–5
Xiao C, Chi R, He H, Qiu G, Wang D, Zhang W (2009) Isolation of phosphate-solubilizing fungi
from phosphate mines and their effect on wheat seedling growth. Appl Biochem Biotechnol
159:330–342
org/10.1007/978-81-322-2776-2_14
org/10.1007/978-81-322-2776-2_12
crop species. In: Meena VS, Maurya BR, Verma JP, Meena RS (eds) Potassium solubilizing
microorganisms for sustainable agriculture. Springer, New Delhi, pp 31–42. https://doi.
org/10.1007/978-81-322-2776-2_3
Zhang C, Kong F (2014) Isolation and identification of potassium solubilizing bacteria from
tobacco rhizospheric soil and their effect on tobacco plants. Appl Soil Ecol 82:18–25
Zhang A, Zhao GY, Gao TG, Wang W, Li J, Zhang SF, Zhu BC (2013) Solubilization of insoluble
potassium and phosphate by Paenibacillus kribensis CX-7: a soil microorganism with biologi-
cal control potential. Afr J Microbiol Res 7:41–47

GHOSH Et Al., 2018, Role of Rhizospheric Microbes in Soil

Uploaded by

Copyright:

Available Formats

GHOSH Et Al., 2018, Role of Rhizospheric Microbes in Soil

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

GHOSH Et Al., 2018, Role of Rhizospheric Microbes in Soil

Uploaded by

Copyright:

Available Formats

Vijay Singh Meena Editor

ISBN 978-981-10-8401-0 ISBN 978-981-10-8402-7 (eBook)

Library of Congress Control Number: 2018938099

© Springer Nature Singapore Pte Ltd. 2018

Printed on acid-free paper

1 Rhizospheric Microbes for Sustainable Agriculture:

8 Plant Growth-Promoting Rhizobacteria: A Biological

P. V. Bramhachari Department of Biotechnology, Krishna University,

Alejandro Jiménez-Gómez Departamento de Microbiología y Genética,

Mona Nagargade Department of Agronomy, Institute of Agricultural Sciences,

Vishal Tyagi Department of Agronomy, Institute of Agricultural Sciences, Banaras

Ashok Kumar, Jai Singh Patel, and Vijay Singh Meena

Abstract Agriculture is a complex network interaction among soil-plant-microbes.

Keywords Growth · Nutrients · PGPMs · Phytohormones · Productivity

© Springer Nature Singapore Pte Ltd. 2018 1

1.1.1 Plant and Soil Microbiome Root Exudation

mycorrhiza, and biodegrading and stress-tolerant endophytes (Singh et al. 2011;

1.2 Plant Growth-Promoting Character of Microbes

1.2.1 Indole-3-Acetic Acid Production

1.2.2 Production of Hydrogen Cyanide (HCN)

Hydrogen cyanide is a volatile, secondary metabolite compound that suppresses the

1.2.3 Production of Siderophores

Siderophores are small high-affinity iron-chelating compounds secreted by plant

1.2.4 Other Phytohormones

Some of the studies reported production of plant growth hormones by diazotrophic

1.2.5 Nitrogen Fixation

1.2.6 Phosphate Solubilizers

1.2.7 Potassium Solubilizers

1.2.8 Zinc Solubilizers

The Zn-solubilizing potential of Thiobacillus thiooxidans and Thiobacillus fer-

1.3  ffect of Plant Growth-Promoting Microbes for Crop

1.4  ffect of PGPR on Maintenance of Soil Fertility, Soil

1.5 Future Prospectuses

Nowadays it is a major challenge to understand the rhizosphere zone modification

Ayres E, Steltzer H, Berg S, Wall DH (2009) Soil biota acceleratedecomposition in high-elevation

Potassium solubilizing microorganisms for sustainable agriculture. Springer, New Delhi,

Megali L, Glauser G, Rasmann S (2013) Fertilization with beneficialmicroorganisms

P. V. Bramhachari, Ganji Purnachandra Nagaraju, and E. Kariali

Abstract Rhizobacterial exopolysaccharides (EPSs) are the active constituents of

© Springer Nature Singapore Pte Ltd. 2018 33

Keywords Exopolysaccharides (EPS) · Plant growth-promoting rhizobacteria

production of EPSs by plant-associated microbes can also play an imperative role in

2.2 I mportance of PGPR-EPSs in Sustainable Agricultural

An intensive agricultural production is indispensable to satisfy food requirements

been a great upsurge in eco-friendly and sustainable agriculture with emphasis on

2.3  hizobacterial Exopolysaccharides (EPSs) in Crop

Bacterial EPS that constitutes homo- or heteropolysaccharides attached to the cell

2.4  unctions of PGPR-Exopolysaccharides in Sustainable

There are numerous potential biological functions of rhizobacterial EPSs which

2.4.1  lleviation of Plant Pathogen Stress

Biofilm formation, Quorum Nitrogen fixation, IAA, Siderophore

Fig. 2.1 Rhizobacterial-exopolymeric substances (EPS) interactions and alleviation of stress

EPSs produced by rhizobacteria are known to have antagonist properties

2.4.2 Alleviation of Salt Stress by Rhizobacterial EPSs

2.4.3  lleviation of EPS-Drought Stress by Rhizobacterial

2.4.4 Alleviation of Other Stressors by Rhizobacterial EPSs

Other innumerable functions performed by EPS-producing microbes constitute

2.5  hizobial EPS-Metal Interactions for Sustained Crop

Extracellular polymeric substances (EPSs) of microbial origin are complex bio-

2.6 Future Perspectives and Conclusions

1 Rhizospheric Microbes for Sustainable Agriculture:

8 Plant Growth-Promoting Rhizobacteria: A Biological

1.1.1 Plant and Soil Microbiome Root Exudation

1.2 Plant Growth-Promoting Character of Microbes

1.2.1 Indole-3-Acetic Acid Production

1.2.2 Production of Hydrogen Cyanide (HCN)

1.2.3 Production of Siderophores

1.2.4 Other Phytohormones

1.2.5 Nitrogen Fixation

1.2.6 Phosphate Solubilizers

1.2.7 Potassium Solubilizers

1.2.8 Zinc Solubilizers

1.3 ffect of Plant Growth-Promoting Microbes for Crop

1.4 ffect of PGPR on Maintenance of Soil Fertility, Soil

1.5 Future Prospectuses

2.2 I mportance of PGPR-EPSs in Sustainable Agricultural

2.3 hizobacterial Exopolysaccharides (EPSs) in Crop

2.4 unctions of PGPR-Exopolysaccharides in Sustainable

2.4.1 lleviation of Plant Pathogen Stress

2.4.2 Alleviation of Salt Stress by Rhizobacterial EPSs

2.4.3 lleviation of EPS-Drought Stress by Rhizobacterial

2.4.4 Alleviation of Other Stressors by Rhizobacterial EPSs

2.5 hizobial EPS-Metal Interactions for Sustained Crop

2.6 Future Perspectives and Conclusions

3.2 Biochemical Characteristics of ACC Deaminase Enzyme

3.3 ACC Deaminase Gene Distribution

3.4 Mechanism of Action

3.5 ole of Bacterial ACC Deaminase in Agriculture

3.5.1 Heavy Metal Stress

3.5.2 Salinity Stress

3.5.3 Drought Stress

3.5.4 Waterlogging or Flood Stress

3.5.5 Temperature Stress

3.6 ole of Bacterial ACC Deaminase in Agriculture

3.7 Role of ACC Deaminase in Legume-Rhizobia Symbiosis

3.8 ole of ACC Deaminase-Producing PGPR in Sustainable

Ganesan V (2008) Rhizoremediation of cadmium soil using a cadmium-resistant plant growth-

4.1.1 The Limitations of Pure Culture

4.2.1 Metagenomics and Plant Growth Promotion

4.2.2 Microbiology of Crops Explored by Metagenomics

4.3 Our Leads