Future Challenges in Crop Protection 978149391188

Fungal Biology
Aakash Goyal
Chakravarthula Manoharachary Editors
Future Challenges
in Crop Protection
Against Fungal
Pathogens
Fungal Biology
Series Editors:
Vijai Kumar Gupta, PhD
Molecular Glycobiotechnology Group, Department of Biochemistry,
School of Natural Sciences, National University of Ireland Galway,
Galway, Ireland
Maria G. Tuohy, PhD

Molecular Glycobiotechnology Group, Department of Biochemistry,
School of Natural Sciences, National University of Ireland Galway,
Galway, Ireland
For further volumes:

http://www.springer.com/series/11224
Aakash Goyal • Chakravarthula Manoharachary
Editors
Future Challenges in Crop

Protection Against Fungal
Pathogens
Editors
Aakash Goyal, Ph.D., F.I.C.N., F.S.A.B. Chakravarthula Manoharachary, M.Sc.,
Biodiversity and Integrated Gene Ph.D., D.Sc.
Management Program Department of Botany
International Center for Agriculture Osmania University
Research in the Dry Area Hyderabad, Telangana, India
Rabat, Morocco
ISSN 2198-7777 ISSN 2198-7785 (electronic)

ISBN 978-1-4939-1187-5 ISBN 978-1-4939-1188-2 (eBook)
DOI 10.1007/978-1-4939-1188-2
Springer New York Heidelberg Dordrecht London
Library of Congress Control Number: 2014946211
© Springer Science+Business Media New York 2014

This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of
the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation,
broadcasting, reproduction on microfilms or in any other physical way, and transmission or information
storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology
now known or hereafter developed. Exempted from this legal reservation are brief excerpts in connection
with reviews or scholarly analysis or material supplied specifically for the purpose of being entered and
executed on a computer system, for exclusive use by the purchaser of the work. Duplication of this
publication or parts thereof is permitted only under the provisions of the Copyright Law of the Publisher’s
location, in its current version, and permission for use must always be obtained from Springer.
Permissions for use may be obtained through RightsLink at the Copyright Clearance Center. Violations
are liable to prosecution under the respective Copyright Law.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication
does not imply, even in the absence of a specific statement, that such names are exempt from the relevant
protective laws and regulations and therefore free for general use.
While the advice and information in this book are believed to be true and accurate at the date of
publication, neither the authors nor the editors nor the publisher can accept any legal responsibility for
any errors or omissions that may be made. The publisher makes no warranty, express or implied, with
respect to the material contained herein.
Printed on acid-free paper
Springer is part of Springer Science+Business Media (www.springer.com)

Preface
World agriculture has shown phenomenal growth in recent past due to

biotechnological application, innovations in agricultural technologies, development
of disease resistant varieties, adoption of plant protection measures including inte-
grated disease management and adaptation/development of crop varieties to suit
climatic changes. Globally, wheat, rice, maize, other cereals, pulses, oil seed crops,
fiber crops, cash crops, and other such economically important plants have been
offering food and nutritional security to world population. However the growing
population world over and particularly in developing countries require around 50 %
more crop production than the existing food production. Problems of hunger, pov-
erty, malnutrition, and economic crisis arising out of unpredicted growth of world
population are to be solved. It is estimated that more than 800 million people will be
suffering due to inadequate food supply. Approximately 10 % global food produc-
tion is lost due to plant diseases caused by fungi, bacteria, viruses, mycoplasma,
nematodes, and others.
Fungal diseases cause huge losses in crop yields thus affecting world economy
and causing shortage of food. The late blight of potato in 1840 caused by
Phytophthora infestans in Ireland and Europe has been a bolt from the blue, causing
a million deaths of starvation and more than a million tried to migrate. Coffee rust
in Ceylon, Great Bengal famine in 1943 caused by Cochliobolus miyabeanus in rice
and southern corn leaf blight during 1970–1971 in the USA caused by Cochliobolus
heterostrophus have emphasized the role of fungi affecting crops. The control of
plant pathogens has become a problem because their populations are variable in
time and space. Accurate identification of the pathogen, proper estimate of the
severity of disease, impact on crop productivity, recognition of virulence mecha-
nisms, host–pathogen interaction, inoculum, potential, epidemiological aspects,
role of environmental/meteorological conditions, and related issues and challenges
are of utmost importance.
Incidence of crop diseases can be minimized by reducing pathogen inoculum,
inhibition, or inactivation of virulence strategies, and also by prevention of genetic
diversity in the crop and conventional breeding mechanism for resistance, as it is
v
vi Preface
facilitated by marker-assisted selection. The transgenic approach and its modification

with gene that offer resistance will also offer crop protection to disease.
Approximately 700 viruses are reported to cause devastating diseases in crop
plants and often possess wide host range. Pathogenic bacteria belonging to several
genera are reported to infect crop plants and cause huge losses in yield. Pathogenic
Xanthomonads are reported to cause 350 and above plant diseases. Interesting prob-
lems of disease epidemics, distribution of fungal inoculum, failure to combat certain
diseases and related issues or challenges are more in tropics and remain as unsolved.
It is predicted that world’s population will be 8.3 billion by 2030 and it repre-
sents a global challenge to meet the requisite food demand. In this contest crop
protection is a necessity in order to achieve greater crop productivity by the use of
fungicides and pesticides. The future challenges to be taken in this area are as fol-
lows: (1) Concern for environment and public safety. (2) Tackling problem of fun-
gicide resistance. (3) Novel modes of action. However the future success of disease
control using fungicides will depend on maintaining a major commitment to
research and field experiment database. Integrated disease management, through
well-thought disease management practices and IPM to become sustainable
approach in crop protection, it must integrate the rational and environmental friendly
safe use of chemical control products. Modern disease diagnostic tools may also
help in the proper use of fungicides.
A number of microbial and fungal bio-agents, non-fungicidal chemicals, and
many other practices will help in the induction of resistance in the crop plants.
Thermolabile genes have been identified in crop plants and it is essential to evaluate
the effect of such genes in the tolerance of temperatures. Transgenic resistance can
be achieved by modifying the plants with resistance imparting transgenes derived
from either pathogens/host or other sources. Suppression of disease cum disease-
causing pathogens forms the key factor in healthy and vigorous growth of plant.
This can be achieved by enhancing beneficial and antagonistic microbes and fungi
which probably balance the disease resistance and nutrient supply to the host plant.
This has a positive effect on plant’s vitality and resistance level. Exclusion of patho-
gens through plant quarantines is the first step towards reducing the pathogen inocu-
lum followed by healthy and good cultural practices (crop rotation, phytosanitation,
maintaining soil health, etc.) besides judicious use of fungicides, exploiting gene
pools of plants in relation to breeders programme of disease resistance, combating
virulence, improving plant performance, and maintaining genetic diversity in crop
plant which has overriding importance.
Plant pathogens create even more problems, challenges, and issues for achieving
global food security and some are listed below:
1. There is no database of many damaging pathogens that currently exist.
2. Measurement of the severity of disease symptoms is often subjective and quali-
tative rather than objective and quantitative.
3. Prediction of obtainable yields needs to be on scientific basis as the globe has
witnessed many failures.
Preface vii
4. Scientifically accurate data has to be generated in the field of inoculum quality,

its multiplication, virulence, effectiveness, and spread along with innovation of
disease forecasting methodologies and creation of models.
5. It is necessary to know the potentiality of most dangerous plant pathogens that
are genetically variable.
6. Problems in predicting the origin of next generation plant pathogens.
7. To face the unplanned shocks from pathogens which have evolved new
virulence.
8. Minor diseases have become major and one has to know more about them.
9. Strengthening of integrated disease management along with varieties perform-
ing well in all geographic regions of a country or globe along with their toler-
ance to different agroclimatic conditions/soil conditions and levels of disease
tolerance.
10. Expectation on the role of climate change with reference to plant pathogens and
crop protection.
11. Success rate of transgenics in crop protection and global food security.
12. Farmers need to be educated about crop protection practices including IDM and
use of biocontrols agents along with their demonstration in field.
13. More information is essential about abiotic stress upon plant pathogens and
also during process of crop protection.
14. Implications involved in the application of nanotechnology for crop
protection.
15. Positive and negative impacts of organic farming in relation to crop production
and crop protection.
16. Creation of global network of stake holders in crop protection.
17. Creation of proper and modern disease diagnostic tools which are less time
consuming and scientifically accurate.
18. Regular review of plant quarantines and other regulations/legislations of crop
protection.
19. Culturing of non-culturable plant pathogens.
20. Strengthening of studies on biodiversity, conservation, taxonomy, and control
of plant pathogenic fungi.
21. Data strengthening through application of bioinformatic tools including tran-
scriptomics, proteomics, metabolomics, and other aspects of phytopathogens
besides the application of DNA-based assay.
22. Elaborated studies are to be made on immunological and molecular detection
of plant pathogens.
23. Reliable identification of the causal organisms of disease to the level of species,
formae specialis, pathovar, biovar, and races.
Basic and applied/advanced research in the above aspects will pave the way in
understanding intricate problems associated with host–pathogen interaction and
pathogen biology in offering solutions pertaining to crop protection.
This book has got 12 chapters emphasizing the issues and challenges of crop
pathogens and plant protection. Each chapter has been written by experienced and
viii Preface
internationally recognized scientists in the field. The topics have been assembled
with basic and advanced knowledge in such a way that it will be useful to the
beginner as well as to experienced scientists. The need for this kind of books/vol-
ume has become imminent as no such book has been published on these aspects.
The chapters in this volume include new approaches, new knowledge, and worthy
information.
We are grateful to Series Editors-in-Chief Dr. V. K. Gupta and Dr. Maria Tuhoy,
Editor (Botany) Eric Stannard, Developmental Editor Elizabeth Orthmann, and oth-
ers concerned with Springer for their help in various ways. Many minds have helped
in the preparation of this volume to which we are indebted. We are grateful to all the
contributors for their concern and concerted effects in making knowledge volume.
Since the chapters have been independent, written by the author(s), there may be
minor overlap or repetition; it is difficult to avoid at this stage.
It is our earnest hope that information presented in this book/volume will make
a valuable contribution to the science of Plant Pathology. We believe and trust that
it will stimulate further discussions in the pursuit of new knowledge. We also hope
that it will be useful to all concerned.
Rabat, Morocco Aakash Goyal

Hyderabad, Telangana, India Chakravarthula Manoharachary
Contents
1 Fungal Diseases of Groundnut: Control and Future Challenges ....... 1

Kamal Krishna Pal, Rinku Dey, and K.V.B.R. Tilak
2 Plant Growth Promoting Rhizobacteria
in Crop Protection and Challenges........................................................ 31
Rinku Dey, Kamal Krishna Pal, and K.V.B.R. Tilak
3 Understanding the Mechanism Involved in PGPR-Mediated
Growth Promotion and Suppression of Biotic and Abiotic
Stress in Plants ........................................................................................ 59
Siddapura Ramachandrappa Niranjana and Puttaswamy Hariprasad
4 Downy Mildew Disease of Pearl Millet and Its Control ...................... 109
H.S. Prakash, Chandra S. Nayaka, and K. Ramachandra Kini
5 Research on Plant Pathogenic Fungi in the Genomics Era:
From Sequence Analysis to Systems Biology ........................................ 131
Anandaraj Muthuswamy and Santhosh J. Eapen
6 Pre and Post Harvest Diseases of Potato
and Their Management .......................................................................... 149
R.K. Arora and Sanjeev Sharma
7 Host–Pathogen Interaction, Plant Diseases, Disease
Management Strategies, and Future Challenges ................................. 185
Chakravarthula Manoharachary and Indra Kala Kunwar
8 Ug99-Future Challenges ......................................................................... 231
Subhash Chander Bhardwaj, Mohinder Prashar, and Pramod Prasad
9 Increased Virulence of Wheat Rusts and the Threat
to Global Crop Production ..................................................................... 249
Thomas Fetch and Brent McCallum
ix
x Contents
10 Fusarium Diseases of Canadian Grain Crops:

Impact and Disease Management Strategies ........................................ 267
Nora A. Foroud, Syama Chatterton, Lana M. Reid,
T. Kelly Turkington, Sheryl A. Tittlemier, and Tom Gräfenhan
11 Pseudomonas fluorescens: A Potential Biocontrol Agent
for Management of Fungal Diseases of Crop Plants ............................ 317
D. Majumder, J.D. Kongbrailatpam, E.G. Suting,
B. Kangjam, and D. Lyngdoh
12 Oat Fungal Diseases and the Application of Molecular
Marker Technology for Their Control .................................................. 343
Adrian Lester Cabral, Belaghihalli N. Gnanesh,
Jennifer Mitchell Fetch, Curt McCartney, Thomas Fetch,
Robert F. Park, James G. Menzies, Brent McCallum,
Ganapathy Kuyyamudi Nanaiah, and Aakash Goyal
Index ................................................................................................................. 359

Contributors
R.K. Arora, Ph.D. Central Potato Research Station, Jalandhar, Punjab, India
Subhash Chander Bhardwaj, Ph.D. Regional Station, Directorate of Wheat
Research, Shimla, Himachal Pradesh, India
Adrian Lester Cabral, Ph.D. Agriculture and Agri-Food Canada, Morden,
MB, Canada
Syama Chatterton, Ph.D. Lethbridge Research Centre, Agriculture and Agri-
Food Canada, Lethbridge, AB, Canada
Rinku Dey, Ph.D. Microbiology Section, Directorate of Groundnut Research
(ICAR), Junagadh, Gujarat, India
Santhosh J. Eapen, Ph.D. Division of Crop Protection, Indian Institute of Spices
Research, Kozhikode, Kerala, India
Thomas Fetch, Ph.D. Agriculture and Agri-Food Canada, Morden, MB, Canada
Nora A. Foroud, Ph.D. Lethbridge Research Centre, Agriculture and Agri-Food
Canada, Lethbridge, AB, Canada
Belaghihalli N. Gnanesh, Ph.D. Agriculture and Agri-Food Canada, Morden,
MB, Canada
Aakash Goyal, Ph.D. Biodiversity and Integrated Gene Management Program,
International Center for Agriculture Research in the Dry Area, Rabat, Morocco
Tom Gräfenhan, Ph.D. Grain Research Laboratory, Canadian Grain Commission,
Winnipeg, MB, Canada
Puttaswamy Hariprasad, M.Sc., M.Phil., Ph.D. Food Microbiology Department,
Central Food Technological Research Institute, Mysore, Karnataka, India
B. Kangjam, M.Sc. School of Crop Protection, College of Post Graduate Studies,
Central Agricultural University, Shillong, Meghalaya, India
xi
xii Contributors
K. Ramachandra Kini, M.Sc., Ph.D. Department of Studies in Biotechnology,

University of Mysore, Mysore, Karnataka, India
J.D. Kongbrailatpam, M.Sc. School of Crop Protection, College of Post Graduate
Studies, Central Agricultural University, Shillong, Meghalaya, India
Indra Kala Kunwar, M.Sc., D.Phil. Department of Botany, Osmania University,
Hyderabad, Telangana, India
D. Lyngdoh, M.Sc. School of Crop Protection, College of Post Graduate Studies,
D. Majumder, Ph.D. School of Crop Protection, College of Post Graduate Studies,
Chakravarthula Manoharachary, M.Sc., Ph.D., D.Sc. Department of Botany,
Osmania University, Hyderabad, Telangana, India
Brent McCallum, Ph.D. Agriculture and Agri-Food Canada, Morden, MB, Canada
Curt McCartney, Ph.D. Agriculture and Agri-Food Canada, Morden,
MB, Canada
James G. Menzies, B.Sc., M.Sc., Ph.D. Agriculture and Agri-Food Canada,
Morden, MB, Canada
Jennifer Mitchell Fetch, Ph.D. Agriculture and Agri-Food Canada, Brandon,
MB, Canada
Anandaraj Muthuswamy, Ph.D. Indian Institute of Spices Research, Kozhikode,
Kerala, India
Ganapathy Kuyyamudi Nanaiah, Ph.D. Plant Breeding, Directorate of Sorghum
Research, Hyderabad, Andhra Pradesh, India
Chandra S. Nayaka, Ph.D. Department of Studies in Biotechnology, University
of Mysore, Mysore, Karnataka, India
Siddapura Ramachandrappa Niranjana, M.Sc., M.Phil., Ph.D. Department of
Studies in Biotechnology, University of Mysore, Mysore, Karnataka, India
Kamal Krishna Pal, Ph.D. Microbiology Section, Directorate of Groundnut
Research (ICAR), Junagadh, Gujarat, India
Robert F. Park, B.Sc. (Hons.), Ph.D. Plant Breeding Institute, The University of
Sydney, Narellan, NSW, Australia
H.S. Prakash, Ph.D. Department of Studies in Biotechnology, University of
Mysore, Mysore, Karnataka, India
Pramod Prasad, Ph.D. Regional Station, Directorate of Wheat Research, Shimla,
Himachal Pradesh, India
Contributors xiii
Mohinder Prashar, Ph.D. Maharashtra Hybrid Seeds Company Limited, Jalna,

Maharashtra, India
Lana M. Reid, Ph.D. Eastern Cereal and Oilseed Research Centre, Agriculture
and Agri-Food Canada, Central Experimental Farm, Ottawa, ON, Canada
Sanjeev Sharma, Ph.D. Division of Plant Protection, Central Potato Research
Institute, Shimla, Himachal Pradesh, India
E.G. Suting, M.Sc. School of Crop Protection, College of Post Graduate Studies,
K.V.B.R. Tilak, Ph.D. Department of Botany, Osmania University, Hyderabad,
Telangana, India
Sheryl A. Tittlemier, Ph.D. Grain Research Laboratory, Canadian Grain
Commission, Winnipeg, MB, Canada
T. Kelly Turkington, Ph.D. Lacombe Research Centre, Agriculture and Agri-Food
Canada, Lacombe, AB, Canada
Chapter 1
Fungal Diseases of Groundnut:
Control and Future Challenges
Kamal Krishna Pal, Rinku Dey, and K.V.B.R. Tilak
1.1 Introduction
Groundnut (Arachis hypogaea L.) is an important food and oilseed crop. The plants
are approximately 15–60 cm tall and produce pinnate leaves with two opposing
pairs of leaflets, 2–5 cm long (Porter 1997a). The plant produces yellow flowers that
form on non-vegetative branches and withers within 5–6 h after opening (Smith
1950). After pollination, pegs are produced from flowers. At the apex of the peg,
pod production occurs. The mature pod may contain 1–5 seeds. The seed contains
up to 55 % oil and approximately 25 % protein. Groundnut oil is used mainly for
cooking and for producing edible fats and soaps. The cake remaining after extrac-
tion of oil is used mainly as animal and poultry feed. The seeds are consumed whole
as raw, boiled, or roasted kernels or are processed into various confectionery prepa-
rations. The haulm constitutes a nutritious animal feed.
It is a native of South America, originating in central Brazil but is grown widely
in the world between 40°N and 40°S latitudes. Groundnut is grown on over 26.4
million hectares worldwide with annual production of 35.6 million tons (FAO
2007). The yields of groundnut are generally lower in developing countries due to
various constraints like diseases, pests, and erratic rainfall patterns. The application
of crop-protection chemicals is low in these countries because of the high cost and
lack of technical knowledge about the application methods. The crop is susceptible
to various diseases caused by fungi, bacteria, viruses, nematodes, etc. More than 55
pathogens have been reported to affect groundnut crop (Ghewande et al. 2002).
K.K. Pal, Ph.D. (*) • R. Dey, Ph.D.

Microbiology Section, Directorate of Groundnut Research (ICAR), Ivnagar Road, PB No. 5,
Junagadh, Gujarat 362001, India
e-mail: kkpal9426476749@gmail.com
K.V.B.R. Tilak, Ph.D.
Department of Botany, Osmania University, Hyderabad, Telangana 500007, India
A. Goyal and C. Manoharachary (eds.), Future Challenges in Crop Protection 1

Against Fungal Pathogens, Fungal Biology, DOI 10.1007/978-1-4939-1188-2_1,
2 K.K. Pal et al.
Some diseases are widely distributed and cause economic losses while others are
restricted in distribution and are not of much economic importance at the present
time, but they may become major diseases in course of time if situation and climatic
conditions favor. All parts of the groundnut plant are susceptible to diseases.
Diseases in groundnut crops can occur throughout the plant’s life, and therefore,
disease management practices are necessary from emergence to the post-harvest
period. Many diseases can reduce the quantity or quality of pods and seed.
A large number of diseases attack groundnut in India (Mayee and Datar 1988).
The majority are caused by fungi and several of them are yield reducers in certain
regions and seasons (Mayee 1995). Among the foliar fungal diseases, leafspots
(early and late) and rust are economically important and can cause substantial yield
losses in susceptible genotypes. Other foliar fungal diseases like Alternaria leaf
blight, anthracnose, pepper spot and leaf scorch, Phomopsis leaf spot, Phyllosticta
leaf spot, Pestalotiopsis leaf spot, leaf blight, Phoma leaf disease, Myrothecium leaf
blight, Drechslera leaf blight, Zonate leaf spot, Cylindrocladium leaf spot, powdery
mildew and Sclerotium leaf spot are not economically important diseases at present
and hence control schedules are not yet developed for these diseases (Ghewande
et al. 2002).
Among seed- and soil-borne diseases, collar or crown rot, stem rot, and dry root
rot cause severe seedling mortality and reduce pod yields. Other seed- and seedling
diseases like Pythium diseases, aflaroot/yellow mold, Diplodia collar rot,
Rhizoctonia damping-off, Cylindrocladium black rot, Fusarium wilt, pod rot, and
Rhizopus seed and seedling rot and Rhizoctonia limb rot, etc. are reported from
groundnut growing regions (Ghewande et al. 2002). Diseases caused by soil-borne
pathogens especially pose a threat to groundnut production due to similarity of
symptoms, which leads to problems in diagnosis (Thiessen and Woodward 2012).
The problem is compounded by the close association of the pods with the soil. Soil-
borne diseases are especially complicated to manage due to the difficulty of dispers-
ing fungicides through the groundnut canopy to the soil profile (Thiessen and
Woodward 2012). Several soil-borne pathogens that affect groundnut are important
to the Southwest United States, including Botrytis cinerea, Pythium spp., Rhizoctonia
solani, Sclerotinia minor and S. sclerotiorum, Sclerotium rolfsii, and Verticillium
dahlia (Thiessen and Woodward 2012).
1.2 Fungal Diseases of Groundnut
The diseases caused by fungi are more in number and severity as compared to other
disease causing agents. The fungal diseases can be classified into foliar diseases;
seed and seedling diseases; stem, root, and pod diseases.
1 Fungal Diseases of Groundnut: Control and Future Challenges 3
Fig. 1.1 Early leaf spot of groundnut caused by Cercospora arachidicola. (a) Symptom at upper
surface. (b) Symptom at lower surface. (c, d) Symptoms at advanced stage
1.2.1 Foliar Diseases
1.2.1.1 Early Leaf Spot
It is caused by Cercospora arachidicola Hori. This is a very widely seen foliar

disease of groundnut. Early leaf spot is characterized by circular spots that are
brown to reddish brown on the upper surface of leaflet and a lighter shade of brown
on the lower surface of leaflet (Fig. 1.1). The lesions on the upper surface of leaflet
are often surrounded by a yellow halo. The lesions often coalesce under severe
attack of the disease resulting in premature senescence and shedding of leaflets.
Disease development is favored by temperatures between 25 and 30 °C, pro-
longed wetness of leaves and high relative humidity. The conidia are disseminated
by wind and insects leading to secondary infection.
In India, losses in yield due to leaf spots have been estimated to be in the range
of 15–59 % (Ghewande et al. 2002). Besides the loss in pod and kernel yield, the
value of fodder is also adversely affected.
Management of Early Leaf Spot
• Deep burying of crop residues and removal of volunteer plants can reduce the
primary source of inoculum.
4 K.K. Pal et al.
• Intercropping cereals like pearlmillet or sorghum with groundnut is helpful in

reducing intensity of leaf spot.
• Varieties tolerant to early leaf spot like ICGS 44, ICGS 76, Somnath, CSMG
84-1 can be grown in areas where early leaf spot is severe.
• Foliar application of Carbendazim (0.05 %) + Mancozeb (0.2 %) at 2–3 weeks
interval, two or three times starting from the initiation of the disease can be
handy in minimizing the incidence of disease.
1.2.1.2 Late Leaf Spot
The causal agent of Late Leaf Spot is Phaeoisariopsis personata (Berk. &
M.A. Curtis) van Arx or Cercosporidium personatum (Berk. & M.A. Curtis)
Deighton. The symptoms for incidence of late leaf spot are appearance of dark brown
to almost black circular spots on the lower leaflet surface which are darker than early
leaf spots and have a feathery margin. Under severe situation, the affected leaflets
become chlorotic, then necrotic, followed by the coalescence of the lesions resulting
in premature senescence and shedding of the leaflets (Subrahmanyam et al. 1992).
The disease is favored during prolonged wet weather, with high humidity and
temperature in the range of 25–30 °C. Like early leaf spot, the conidia are dissemi-
nated by wind and insects leading to secondary infection.
Early leaf spot and late leaf spot are the most important foliar diseases affecting
groundnut throughout the world (Shokes and Culbreath 1997). The diseases often
occur together or one disease may be more predominant in a given location or year
(Smith 1984).
Management of Late Leaf Spot
• A cereal–cereal–groundnut crop rotation should be followed.

• Deep plowing should be done during land preparation.
• Infected crop residues should be removed and destroyed.
• Volunteer groundnut plants should be eliminated.
• The sowing date should be adjusted so that the most conducive environment for
disease development can be avoided.
• Foliar application of Carbendazim (0.05 %) + Mancozeb (0.2 %) at 2–3 weeks
interval, two or three times starting from the initiation of the disease.
• Cultivars tolerant to late leaf spot like ICGV 87160, ICGV 86590, ICGV 9202,
ICGV 92093, ICGS1, TAG24, DRG12, CSMG84-1 may be cultivated.
For more than a decade now, researchers have focused their studies on the action
of natural substances from yellow oleander and other plants on phytopathogenous
fungi (Ambang et al. 2010). Integrating host resistance and METPS (methanolic
extracts of Thevetia peruviana seeds) was found to efficiently protect groundnut
against Cercospora leaf spots (CLS) (Ambang et al. 2011).
Vasavirama and Kirti (2012) demonstrated the potential of SniOLP and Rs-AFP2
genes in developing late leaf spot disease resistance in transgenic peanut. Peanut
plants were transformed using a double gene construct with SniOLP (Solanum
nigrum osmotin-like protein) and Rs-AFP2 (Raphanus sativus antifungal protein-2)
genes under separate constitutive 35S promoters. Transgenic peanut plants express-
ing these genes showed enhanced disease resistance to late leaf spot based on a
reduction in number and size of lesions on leaves.
1.2.1.3 Rust
The causal organism for rust disease of groundnut is Puccinia arachidis Spegazzini.
Rust is characterized by the appearance of numerous tiny, reddish orange pustules
(uredinia) on the lower surface of leaflets initially and on the upper surface later.
Symptoms mainly appear on the leaflets but pustules can be seen on all the aerial
parts of a plant. The lesions on the stem are elongated in shape. The infected leaves
become necrotic and dry up but remain attached to the plant. When left unchecked,
diseased groundnut plants take on a scorched appearance, quickly die, and shed
most mature pods. Groundnut rust is known to perpetuate, spread, and produce
severe disease outbreaks by means of urediniospores. The rust pathogen may also
survive from season to season on volunteer groundnut plants.
Extended periods of cloudy, wet weather tend to favor the appearance of rust on
groundnut. The disease spreads by wind movement, rains, and by insects. The dis-
ease appears at the same time as that of late leaf spot. These two foliar diseases
prematurely defoliate plants, leading to losses in pod and haulm yield. At ICRISAT,
in Patancheru, India, rust caused losses of over 50 % (Subrahmanyam and McDonald
1983). In addition to direct yield losses, rust can lower seed quality by reducing seed
size and oil content (Ghewande et al. 2002).
Late leaf spot and rust are the two major foliar diseases that together could reduce
pod and haulm yield by 70 % and in vitro digestibility of haulms by 22 % (Pande
et al. 2003). Two genotypes (ICGV 9202 and 92093) were highly resistant to these
foliar diseases maintaining high pod and haulm yield as well as high in vitro digest-
ibility of haulms (>62.3 %) even under highest disease pressure.
Management of Rust
• The buildup of rust inoculum should be avoided by a cereal–cereal–groundnut

crop rotation and eradication of volunteer groundnut plants.
• The sowing time can be adjusted so that the most conducive environment for rust
(cloudy weather, high humidity) can be avoided.
• Suitable spray schedules should be developed for controlling the disease. Sprays
of Bordeaux mixture and Dithiocarbamate have been found effective to control
rust and late leaf spots. Spray of Chlorothalonil 0.2 % at regular intervals of
10–15 days, starting from 30 days after germination till 15 days before harvest,
can be effective against rust and late leaf spot.
• Resistant/tolerant cultivars like ICGV 87160, ICGV 86590, ICGV 86325, TAG
24, ALR 3, VRI 5, CSMG 84-1, and ICGS 5 can be grown.
6 K.K. Pal et al.
Fig. 1.2 (a, b) Alternaria leaf blight of groundnut caused by Alternaria alternata
1.2.1.4 Alternaria Leaf Spot
This disease is caused by Alternaria alternata (Fries) Keissler. The symptoms

include appearance of small, chlorotic, water-soaked lesions on both surfaces of the
leaflets (Subrahmanyam et al. 1992). The lesions are irregular in shape and brown
in color. These lesions dry rapidly. Veins and veinlets adjacent to the lesions become
necrotic. The affected leaflets show chlorosis and premature senescence under
extreme disease severity.
1.2.1.5 Alternaria Leaf Blight
The causal organisms for this disease are Alternaria alternata (Fr.) Keissler,
Alternaria arachidis Kulkarni or Alternaria tenuissima (Kunze ex Pers.) Wiltshire.
The characteristic symptoms include the appearance of brown irregular shaped
spots towards the leaf margins (Fig. 1.2).
1.2.1.6 Cercospora Leaf Blight
The causal organism for this disease is Cercospora canescens Ellis & Martin. The
disease is characterized by the appearance of small lesions which enlarge into irreg-
ular shaped light brown spots (Fig. 1.3). Under long spells of wet weather, the spots
merge resulting in blighting and defoliation.
The prevention and control measures include use of crop rotation and proper
field sanitation practices, removal and destruction of infected plant tissues and
avoiding working when the plants are wet.
Fig. 1.3 Symptom of Cercospora leaf blight. (a) early stage; (b) late stage
Fig. 1.4 (a, b) Symptoms of web blotch
1.2.1.7 Web Blotch
The causal organism for this disease is Didymella arachidicola (Chock.) Taber,
Pettit & Philley. Irregular shaped lesions appear first on the upper surface of the
leaves. The brown or dark brown lesions appear in a web or net-like pattern
(Fig. 1.4). The lesions coalesce to form blotches. Defoliation occurs under severe
disease condition. The disease progresses rapidly under wet weather.
1.2.1.8 Phyllosticta Leaf Spot
The causal organism for this disease is Phyllosticta arachidis-hypogaea Vasant

Rao. The disease starts in the necrotic tissues and subsequently spreads to the living
tissues of the leaves. Circular to irregular light brown lesions with dark brown mar-
gins appear on the leaflets (Fig. 1.5). These lesions may merge into irregular necrotic
patches.
8 K.K. Pal et al.
Fig. 1.5 (a, b) Phyllosticta leaf spot of groundnut
1.2.1.9 Scab
The scab disease of groundnut is caused by Sphaceloma arachidis Bit. & Jenk.
Circular or irregular shaped lesions appear on both surfaces of the leaflets. The
lesions on upper surfaces of the leaflets show tan color with raised margins and
sunken centers while those on the lower surfaces have darker color without raised
margins (Subrahmanyam et al. 1992). Lesions may develop on all parts of the plant.
Lesions on the petioles and branches may develop into scabs giving the plant a burnt
appearance. Under severe disease attack the plants become stunted and the stems
become sinuous.
The disease was reported from Argentina, Brazil, Colombia, and Japan (Xu
2009). Wang et al. (2006) reported it to be a great threat to groundnut (Arachis
hypogaea) production in south China. Wang et al. (2009) constructed a neighbor-
joining tree and a minimum evolution tree based on the 18S rDNA sequences of
S. arachidis and related fungal species. They concluded from their study that the
pathogen was in close relationship with Basidiomycetes species. Kearney et al.
(2002) established that infected residues from the previous peanut crop are a source
of inoculum for onset and development of scab epidemics in the field.
1.2.1.10 Zonate Leaf Spot
Zonate leaf spot of groundnut is caused by Cristulariella moricola (Hino) Redhead.

The disease is characterized by the appearance of small to large necrotic lesions on
the leaflets. The smaller lesions have light brown center with dark brown margins
whereas the larger lesions show zonate pattern on both the surfaces of the leaflets.
1.2.1.11 Powdery Mildew
The Powdery mildew of groundnut is caused by Oidium arachidis Chorin. The dis-
ease is characterized by the appearance of large powdery white patches on the upper
Fig. 1.6 (a, b) Symptom of Myrothecium leaf blight
surface of the leaflets. These patches are covered with sporulating fungal growth,
which gives them a powdery white appearance. At later stages the centers of the
spots become necrotic.
1.2.1.12 Myrothecium Leaf Blight
The causal organism for Myrothecium Leaf Blight is Myrothecium roridum Tode ex
Fries. Appearance of round to irregular shaped lesions with gray or brown centers
and brown margins takes place on both surfaces of the leaflets (Fig. 1.6). The lesions
become large and coalesce to give blighted appearance to the leaves. Abundant
black fruiting bodies, often arranged in concentric rings are formed on both leaf
surfaces.
1.2.1.13 Pepper Spot and Leaf Scorch
This disease is caused by Leptosphaerulina crassiasca (Sechet) Jackson & Bell.

This disease is widespread in many groundnut growing countries. The same fungus
causes two different types of symptoms. In the Pepper Spot phase, very small
necrotic spots appear on the leaflets (Fig. 1.7). The spots are circular to irregular and
dark brown to black in color. Many spots may coalesce to give a net-like appearance
to the leaflets (Subrahmanyam et al. 1992).
Scorching of the leaf is the common symptom of the disease. The symptom
develops as V-shaped lesions starting from the tips of the leaflets mostly and some-
times from the margins. The necrotic lesions are dark brown in color with a yellow
zone around the advancing disease margin (Fig. 1.8) and tend to break away from
the leaflet margins. Leaf scorch is common early in the season. The disease is con-
trolled by spraying fungicides used for other foliar fungal diseases of groundnut.
10 K.K. Pal et al.
Fig. 1.7 Pepper leaf spot of

groundnut
Fig. 1.8 (a, b) Leaf scorch of groundnut
Fig. 1.9 Sclerotium leaf

spot of groundnut
1.2.1.14 Sclerotium Leaf Spot
The causal organism for this disease is Sclerotium rolfsii Saccardo. The disease is
characterized by the appearance of necrotic gray ring spots which may develop
holes (Fig. 1.9). Long periods of leaf wetness may result in the spots coalescing to
Fig. 1.10 (a, b) Anthracnose of groundnut caused by Colletotrichum dematium
give blighted appearance to the leaves. Sclerotia (about 0.5–0.8 mm in diameter)

initially white, but later brownish in color can be seen on both leaflet surfaces. The
other diseases caused by the pathogen are stem, root, and pod diseases which are
more damaging as compared to the leaf disease.
1.2.1.15 Anthracnose
The causal organism of the disease is Colletotrichum dematium (Pers.) Grove. The
disease is characterized by the appearance of wedge-shaped lesions on the tips of
leaflets (Subrahmanyam et al. 1992). The lesions may also develop on the margins
of the leaflets. The margins of the lesions show yellow zone (Fig. 1.10). The necrotic
tissues turn brown and show fragmentation along the margins of the leaflets. The
diseased tissues show abundance of fruiting bodies.
1.2.1.16 Choanephora Wet Blight
The disease is caused by Choanephora cucurbitarum (Berk. & Ravenel) Thaxt. The
disease is characterized by the appearance of water-soaked lesions on the tips of the
leaflets (Fig. 1.11). Later the lesions become necrotic and covered by brown mass
of spores. In case of prolonged wet weather the disease may spread to the young
shoots.
1.2.1.17 Pestalotiopsis Leaf Blight
The causal organism for this disease is Pestalotiopsis arachidis Satya. The disease
appears in the form of dark brown circular lesions surrounded with light yellow
haloes. Subsequently the lesions enlarge and coalesce to form necrotic areas along
the margins of the leaflets (Fig. 1.12). Minute black fruiting bodies can be observed
at the centers of the blighted areas when viewed through a hand lens.
12 K.K. Pal et al.
Fig. 1.11 (a, b) Choanephora wet blight of groundnut
Fig. 1.12 (a, b) Pestalotiopsis leaf blight of groundnut
1.2.2 Seed and Seedling Diseases
1.2.2.1 Seed and Seedling Rots
The rotting of seeds and seedlings are caused by a number of organisms. The major-
ity of these rots are caused by Aspergillus niger, Phythium spp., Macrophomina
phaseolina, Rhizoctonia solani, Sclerotium rolfsii, Rhizopus spp., Fusarium spp.,
Aspergillus flavus, Lasiodiplodia theobromae, and Penicillium spp. (Subrahmanyam
et al. 1992). These fungi are common in most agricultural soils and attack seeds and
seedlings of many crops. Seedling disease in groundnut is favored by cool and wet
soils which slow seed germination and seedling growth.
Failure of seedlings to emerge from the soil or sudden wilt and death of seedling
shortly after emergence is symptom of seedling rot. The infected seeds and seed-
lings turn into black rotten masses and are covered with the fungal mycelia or
spores. These diseases cause severe seedling mortality resulting in poor crop stand
and reduce the yields from 25 to 50 % (Ghewande et al. 2002).
Rhizoctonia solani may cause seed decay prior to emergence. Under favorable
conditions, the pathogen may attack emerged seedlings and dark, sunken lesions
may be formed just below the soil surface.
Fig. 1.13 Collar rot of groundnut caused by Aspergillus niger. (a) Early symptom; (b) drying of
the seedling at later stage
Management of Diseases
• Cultural practices like use of raised bed to promote drainage, planting high
quality seed with good vigor, planting at recommended soil depths, etc. should
be followed.
• Seed treatment with fungicide should be followed.
1.2.2.2 Crown/Collar Rot
The Crown Rot or Collar Rot of groundnut is caused by Aspergillus niger van
Tieghem. The pathogen attacks the seeds and emerging seedlings but may also
affect older plants from mid- to late-season. The diseased seeds fail to emerge and
if they are lifted from the soil show black spore mass on the seed surface.
In postemergence infection, the emerged seedlings dry up rapidly (Fig. 1.13).
The collar region shows black spore mass. Seedling infection occurs in the
cotyledonary-hypocotyl region. The pathogen attacks mature plants also, but the
symptoms are less apparent. In mature plants the branches dry out and break from
the collar region. Black spore masses are also seen on the pod surfaces.
Aspergillus niger is present in most groundnut soils and is a common contaminant
of groundnut seed. Extreme heat or fluctuations in soil moisture during the seedling
stage, poor seed quality, seedling damage from pesticides or cultivation, and feeding
by root and stem boring insects are stresses thought to aggravate the disease.
Management of Collar Rot
• Crop rotation should be followed.

• Deep sowing (more than 2 in.) should be avoided.
• Application of foliar fungicides should be practiced.
• Late sowing of crop should be avoided.
14 K.K. Pal et al.
• High quality seed treated with Carbendazim 1–2 g/kg seed or Mancozeb 2–3 g/kg
seed or Chlorothalonil or Captafol @ 2 g/kg seed should be planted.
• Adequate and uniform soil moisture should be maintained.
• Earthing-up of plants should be avoided.
• Resistant/tolerant varieties like J 11, JCG 88 and OG-52-1 can be grown.
• Seed treatment with Trichoderma harzianum or T. viride @ 4 g/kg seed and their
soil application can be helpful.
1.2.2.3 Rhizoctonia Damping-Off
The disease is caused by Rhizoctonia solani Kuhn. The disease may be seed or
soil-borne. In young seedlings the lesions are usually seen on the hypocotyl in the
form of dark brown patches, below the soil surface. These lesions become dark in
color, enlarge, and girdle the hypocotyl region, leading to typical symptom of
damping-off. The affected areas show brown mycelial growth and dark brown scle-
rotia develop on the dead tissues.
1.2.2.4 Yellow Mold
The causal organism for this condition is Aspergillus flavus Link ex Fries. The
pathogen attacks seeds and non-emerged seedlings and reduce them to shriveled
dried masses covered with yellow or greenish yellow spores. The emerging seed-
lings decay because of rapid infection of the radicle and hypocotyl. Many strains
of this fungus are capable of producing aflatoxins that render the seed unaccept-
able due to high toxicity for human or animal consumption. The production of
aflatoxin by the pathogen strain results in aflaroot disease which is characterized
by highly stunted plants with pale and greatly reduced leaves. Infected plants gen-
erally become stunted with symptoms of vein clearing chlorosis on the leaflets and
lack a secondary root system, a condition known as “aflaroot.” The fungus is capa-
ble of invading groundnut seeds before harvest, during postharvest drying, and
during storage.
Management of Yellow Mold
• Drought stress to the crop should be avoided.

• Nematode infestation should be controlled.
• The crop should be harvested at proper maturity stage.
• The pods should be dried immediately after harvest to 6–8 % moisture content
and damaged, infected pods and seeds should be discarded.
• Damage to the testa should be avoided during decortication.
1.2.2.5 Diplodia Collar Rot
The disease is caused by Lasiodiplodia theobromae (Pat.) Griffon & Maubi. The
pathogen attacks young seedlings and mature plants. The infection takes place at or
near the soil surface. The pathogen invades the stem and the infected plants wilt, dry
and die within a few days. The base and root of the plants become black. Black
pycnidia develop as pimple-like dots on the necrotic tissues.
Management of Diplodia Collar Rot
• Crop rotation with non-related crops lowers the fungal inoculum.

• Foliar diseases should be controlled by the application of fungicides.
• Deep plowing during land preparation is helpful.
1.2.3 Stem, Root, and Pod Diseases
1.2.3.1 Stem Rot
Stem rot of groundnut is caused by the fungus Sclerotium rolfsii Saccardo. This
disease is also known as southern blight, white mold, southern stem rot, and
Sclerotium rot. The fungus is ubiquitous and has a wide host range (Backman and
Brenneman 1997; Shew et al. 1987; Punja 1985). It is a very serious disease of
groundnut worldwide and causes substantial loss to plant stand and thereby yield. In
extreme cases, the disease may cause up to 80 % yield loss; however, losses less
than 25 % are more typical (Backman and Brenneman 1997). Sclerotium rolfsii is a
Deuteromycete, in the group “Mycelia Sterilia.” The fungus is characterized by
white mycelia, and round, brown sclerotia. The mycelia of S. rolfsii survives best in
sandy soils, whereas the sclerotia survive best in moist, aerobic conditions found at
the soil surface (Punja 1985). The fungus spreads through infected soil, wind
splashed rains and sclerotia.
The stem rot pathogen attacks all parts of the plant but the infection of the stem
is the most destructive. The symptoms of the disease are wilting and yellowing of
the main stem, the lateral branches, or entire plant. Disease may also occur in the
early stage at the time of germination. The pathogen can colonize the germinating
seeds and seedlings (Fig. 1.14) and white mycelial growth is seen at later stages at
the base of the plants and in the soil surface surrounding the infected plants. The
mycelia rapidly spread to other branches and plants during favorable weather with
warm temperatures and high humidity. Abundant growth of sclerotia, initially white
and then turning brown is seen in the infected area. The pathogen may infect pegs,
pods, and roots also. In severe cases, the pods become covered with white mycelial
growth. The fungus may infect the pods also. The infected pods show brown, water-
soaked lesions.
16 K.K. Pal et al.
Fig. 1.14 (a–d) Colonization of Sclerotium rolfsii at early seedling stage of groundnut
Management of Stem Rot
• Crop rotation should be followed to avoid groundnut following groundnut.

• Deep plowing with a moldboard plow should be followed during land prepara-
tion. Deep burial of surface organic matter and crop debris is beneficial.
• Growing groundnut on raised beds is helpful.
• High seed rates should be avoided because dense canopy favors the stem rot
fungus.
• Soil should not be thrown on groundnut plants during cultivation.
• Leaf fall due to foliar diseases can be avoided by using fungicides. Fallen leaves
serve as nutritional source for stem rot pathogen.
• Use of tolerant varieties like Dh 8, and ICGV 86590.
• Seed treatment with Trichoderma harzianum or T. viride @ 4 g/kg seed.
• Seed treatment with Carbendazim or Captan @ 2–3 g/kg seed.
1.2.3.2 Sclerotinia Blight
Sclerotinia blight is caused by Sclerotinia minor Jagger, and on rare occasions

may be caused by Sclerotinia sclerotiorum (Lib.) de Bary (Porter and Melouk
1997; Woodward et al. 2006). The disease may cause yield losses of 10 % but in
severe cases may cause losses exceeding 50 % (Porter and Melouk 1997; Butzler
et al. 1998).
Sclerotinia minor and S. sclerotiorum are ascomycetes that produce white aerial
mycelia and black, irregularly shaped sclerotia. The sclerotia produced by S. minor
are smaller in size and more abundant in number as compared to the sclerotia of
S. sclerotiorum (Thiessen and Woodward 2012).
The plants become infected by coming in contact with soil infested with
S. minor. The symptoms of the disease are wilting of lateral branches followed by
the appearance of green water-soaked lesions on the stem. These lesions later turn
darker and sunken. The infection can spread to the main stem later. The foliage on
the infected branches becomes dark brown and withers giving the plant a blighted
appearance. During wet weather, white mycelial growth develops on the infected
tissue. Developing pegs are infected. As a result of this disease severe pod loss takes
place. Black sclerotia develop on the leaflets, branches, pegs, and the pods. Sclerotia
also develop on the seeds inside the pods.
1.2.3.3 Botrytis Blight
Botrytis blight, also known as gray mold of groundnut is caused by Botrytis cinerea
Pers. ex Fries. Botrytis cinerea Pers.: Fr. (anamorph) is a Deuteromycete that colo-
nizes the plant quickly (Thiessen and Woodward 2012). This disease is seen first in
the foliage of plants in contact with the soil surface. The infected tissues are rapidly
decayed. The infected stems and leaves show a thin covering of gray sporulating
fungal growth. The infection spreads to the pegs and pods. Black irregularly shaped
sclerotia develop on the infected stems and pods. The pathogen may cause the wilt
and death of the infected tissue or the entire plant.
1.2.3.4 Cylindrocladium Black Rot
The causal organism for this disease is Cylindrocladium crotalariae (Loos) Bell &
Sobers. This disease is seen to appear in the fields in the form of patches. The plant
symptom includes the chlorosis and wilting of leaves on the main stem. Overall, the
plants appear chlorotic and have stunted growth. The infected branches show dense
clusters of reddish fruiting bodies on the surface of the soil. The disease may infect
pegs, pods, and roots also.
1.2.3.5 Verticillium Wilt
Verticillium wilt of groundnut is caused by the fungus Verticillium dahliae Kleb. or

Verticillium albo-atrum Reinke & Berthier which also cause wilt diseases of many crop
plants. The fungus produces microsclerotia, as overwintering structures, which can sur-
vive in soil for long periods of time, thereby making management practices difficult.
The fungus produces white fluffy mycelia and conidia that are hyaline and
single-cellular (Melouk and Damicone 1997). The microsclerotia develop on plant
debris and may remain dormant for long periods of time. The dormant microsclerotia
18 K.K. Pal et al.
germinate under favorable conditions and stimulation by root exudates. The fungus
enters through the plant roots and spreads through the vascular system (Thiessen
and Woodward 2012). The infection of the vascular system leads to marginal chlo-
rosis, loss of turgidity, and curling in the leaves. This is followed by yellowing of
leaves, necrosis, and defoliation at later stages. The infected plants initially show
temporary wilting during the midday but recover during the night, but later the wilt-
ing becomes permanent (Subrahmanyam et al. 1992). The roots of the infected
plants show brown discoloration of the vascular tissues and show rotting in severe
cases. Drought stress accelerates symptom development. Well-watered plants may
survive for a long period.
Management of Verticillium Wilt
• Fields should be kept clean from soil or crop debris from infested fields.
• Adequate irrigation should be provided to prevent moisture stress.
• Crop rotations with susceptible crops such as cotton and potato should be
avoided.
• Long rotations with nonhosts such as corn, sorghum, etc. may be beneficial.
1.2.3.6 Charcoal Rot
This disease is caused by Macrophomina phaseolina (Tassi) Goidanich. The disease

is seen in the form of water-soaked lesions in the hypocotyl region of the young
plants near the soil surface. Later the lesions enlarge and girdle the hypocotyl and kill
the plant. The disease infects older plants also. In older plants the infection starts near
the soil surface and spreads to the stem and branches and downwards to the roots.
The leaves of infected plants turn yellow and then brown at the margins, and appear
scorched. The plants thus infected die. The disease may be sometimes restricted to
the roots only. The lesions on the roots are initially water-soaked and later become
brown. The lateral roots become black and rotted. The pods may be invaded. The
inner surfaces of the pods become gray because of the production of microsclerotia.
The fungus causes charcoal rot in many agricultural crops. The fungus survives
in soil and crop debris as microsclerotia for many years. Outbreaks of charcoal rot
are sporadic and factors such as high soil temperature and low soil moisture are
conducive to disease development.
Management of Charcoal Rot
• The promotion of healthy growth of plant by adequate irrigation, fertilization,

and pest control may help reduce damage from charcoal rot.
• Seed treatment with Trichoderma polysporum or T. viride or T. harzianum @ 4 g/kg
seed or seed treatment with Carbendazim @ 2 g/kg seed or Captafol or Thiram
@ 3 g/kg seed is helpful.
Fig. 1.15 Pod rot of groundnut. (a) Symptom on pod surface; (b) symptom inside the pod
1.2.3.7 Fusarium Wilt
The disease is caused by Fusarium oxysporum Schiechtend. emend Snyder & Hans.
This disease usually occurs in drought affected plants. The characteristic symptom
of the disease is wilting of the plant which may be sudden or gradual. During sud-
den wilting of the plant the leaves turn grayish-green in color and the plant dries.
During gradual wilting, the leaves become chlorotic followed by defoliation and
drying of the plants. No external symptoms of the disease are seen on the stem or
root. But vascular discoloration is seen if the roots are cut longitudinally. The patho-
gen may infect the pegs and pods resulting in the pink discoloration of the inner
surfaces of the pods.
1.2.3.8 Pod Rot
Pod Rot may be caused by various soil-borne pathogens namely Pythium myrioty-
lum Dreschler, Rhizoctonia solani Kuhn, Fusarium solani (Mart.) Saccardo f. sp.
phaseoli (Burkholder) Snyder & Hans., Fusarium oxysporum Schlechtend. emend
Snyder & Hans., Macrophomina phaseolina (Tassi) Goidanich. The disease is char-
acterized by the development of brown or black lesions on the surface of the pods
(Fig. 1.15). The lesions enlarge and cause discoloration of the pod surface and in
later stages the shells disintegrate and the kernels decay. The color and texture of the
rotting tissues depend on the organism causing the disease. In case of Fusarium rot,
the shells are pink or purple stained. Pod rots are also caused by Sclerotinia spp.,
Verticillium spp., Sclerotium rolfsii, and Botrytis cinerea, in addition to the other
infections caused by them.
A complex of factors, in addition to the fungal pathogens, are probably respon-
sible for severe outbreaks. These factors include excessive soil moisture, wide fluc-
tuations in soil moisture, calcium deficiency, insect and nematode feeding, and
irrigation with poor quality (salty) water. In a survey by Wheeler et al. (2005),
approximately 40 % of fields in West Texas were found to contain Pythium spp.,
primarily P. myriotylum, P. irregular, and P. ultimum, which are capable of causing
20 K.K. Pal et al.
damage to the pod and the kernels and may cause significant yield loss. Pythium spp.
may also cause diseases like damping-off, vascular wilt, and root rot of groundnut.
Groundnut plants exhibiting root rot are generally stunted and may overcome the
disease under favorable growing conditions (Beute 1997). Pythium pod rot is char-
acterized by the browning and water soaking of pods followed by a brown to black
appearance in the final stages of rot (Wells and Phipps 1997). Losses to the tune of
80 % have been reported due to Pythium pod rot (Beute 1997). Pod rot caused by
Pythium spp. may also cause the junction of the peg and pod to become weakened,
which may result in substantial loss at harvest (Lewis and Filonow 1990). The dis-
ease symptoms are more severe during frequent rains during pod development.
Rhizoctonia solani also causes a number of diseases besides pod rot, i.e., seed
decay, damping-off, and root rot. Rhizoctonia solani is a ubiquitous fungus with a
wide host range that may be difficult to differentiate from other seed decaying
pathogens, making the management of R. solani diseases difficult (Thiessen and
Woodward 2012).
Rhizoctonia solani Kuhn (anamorph) is a Deuteromycete that does not produce
asexual spores; the teleomorph, Thanatephorus cucumeris, is a Basidiomycete
(Thiessen and Woodward 2012). Rhizoctonia solani is capable of surviving sapro-
phytically on a wide host range, including rotated crops and various weed species
(Brenneman 1997). Infection of host tissue takes place by germinating sclerotia or
hyphae in the soil. Various anastomosis groups (AG) of Rhizoctonia spp. occur;
however, AG-4 is the most common cause of limb rot and pod rot in groundnut
(Brenneman et al. 1994). Rhizoctonia pod rot is differentiated by a dry, brown rotted
pod as opposed to the dark, greasy-appearing lesions caused by Pythium spp. The
seeds may be infected and will harbor the fungus after drying and storing (Wells and
Phipps 1997).
Management of Pod Rot
• Excessive irrigation and fertilizer application should be avoided.

• Crop rotation should be followed with a summer fallow and planting should be
done on raised beds. Drainage should be improved in low-lying areas.
• Application of gypsum during pegging stage is helpful.
• Nematodes and pod-feeding insects should be controlled where they are a
problem.
• Applications of fungicides containing metalaxyl at pegging stage may reduce
levels of pod rot.
1.2.3.9 Blackhull
The causal organism of this disease is Thielaviopsis basicola (Berk. & Broome)
Ferraris (syn. Chalara elegans Nag Raj & Kendrick). The disease is characterized
by the appearance of black lesions on the surface of the pods which enlarge and
coalesce and produce black spore mass, giving black appearance to the pods. The
infection of the pegs leads to pod losses during harvesting. Usually the discoloration
is superficial, but the decay may extend into the pod causing discoloration of the
kernels.
The fungus survives for long periods in soil by producing resistant spores. The
disease is favored by high soil pH (above 7.0), excessive soil moisture, and crop
rotations with susceptible crops.
Management of Blackhull
• Excessive irrigation should be avoided.

• Crop rotation with alfalfa and cotton should be avoided.
1.3 Integrated Disease Management Practices
Integrated disease management (IDM) is an optimum blend of feasible and eco-

nomically viable options of disease management for different agroclimatic
regions depending on the occurrence and importance of the diseases (Ghewande
et al. 2002). It includes use of resistant/tolerant varieties, cultural practices,
use of biopesticides and biocontrol agents, chemical methods for need-based
application, etc.
1.3.1 Cultural Practices
Soil-borne and foliar diseases of groundnut are best managed with the collective
use of both cultural and chemical control measures. The cultural practices help in
reducing the level of inoculums in soil which come in contact with the host plant.
Deep tillage often reduces soil inoculums by burying the pathogen within the soil
to impose anaerobic conditions (Punja 1985). Deep burying of crop residues,
destruction of crop debris by burning, removal of volunteer groundnut plants, early
planting with wider inter row spacing should be followed for managing leaf spots
and rust. Similarly, following cultivation methods that do not pitch soil onto the
crowns of groundnut plants reduces crown rot disease by limiting the contact of
soil inoculum with the plant (Punja 1985). Intercropping with pearlmillet, sor-
ghum, pigeonpea, and maize are beneficial for the management of early and late
leaf spots and rust (Ghewande et al. 2002). Collar rot can be managed by mixed
cropping with moth bean (Phaseolus aconitifolius) in alternate rows. Treating
seeds with seed treatment chemicals reduces the inoculum load. There are many
other cultivation practices which can reduce the incidences of disease, if followed
systematically.
22 K.K. Pal et al.
1.3.1.1 Crop Rotation
Crop rotation is a practice in which different crops are grown in a particular order in
the same field over different seasons. Several benefits accrue from crop rotations,
including limiting the buildup of fungal inoculum, weed control, and promoting
good soil fertility (Peters et al. 2003). Groundnut is grown in rotation with different
crops according to the cropping systems prevailing in different parts of the world.
Rotating groundnut with cotton is practiced widely but is not desirable because of
some of the pathogens which are common to both like V. dahlia, R. solani, and
Pythium spp. Rotating groundnut with cereals or grass species such as corn, grain
sorghum, or other pasture grasses may reduce both R. solani (Brenneman 1997) and
S. rolfsii (Backman and Brenneman 1997). Crop rotation has been shown to reduce
the inoculum density of Pythium spp. but has little effect on disease incidence
(Beute 1997). Crop rotation with cotton, wheat, maize, onion, and garlic may reduce
intensity of stem rot (Ghewande et al. 2002).
1.3.1.2 Irrigation Management
It is important to maintain adequate moisture in groundnut soil to limit the incidence

of soil-borne diseases. Overwatering or flooding may increase the incidence of dis-
eases caused by pathogens such as Pythium spp. which produces motile zoospores
that travel in water (Thiessen and Woodward 2012). Drought should be avoided at
pod formation and maturity stages. Heavy irrigation before harvesting may lead to
pod rot if harvesting is delayed.
1.3.1.3 Host Resistance
Host resistance is an important aspect of managing foliar and soil-borne diseases.

Exploiting the innate resistance in plants for breeding programmes and cultivating
disease resistant cultivars would be the safest and most cost-effective strategy in
disease management.
Until recently, host resistance to Sclerotium rolfsii was unavailable; however,
tolerance to S. rolfsii may aid in management in conjunction with other control
methods (Punja 1985). Groundnut plants with upright growth habits or with com-
pact or open canopies show less incidence of disease than those with a more humid
microclimate or more leaves in contact with the soil (Shew et al. 1987). In the USA,
several partially resistant cultivars are available such as UF-MDR-98, C-99R,
Georgia-07W, Georgia-03L, Georgia-02C, DP-1, and AP-3 (Branch and Brenneman
2009; Brenneman et al. 2005; Gorbet et al. 2004). The varieties tolerant to stem and
pod rot are ICGV 87157 and ICGV 86590.
Control of pod rot through host resistance may be effective. Spanish cultivars,
especially Toalson, may provide resistance to both Pythium spp. and R. solani
(Beute 1997; Brenneman 1997). Resistance to Sclerotinia blight has been shown in
the varieties Virginia 81B, Virginia 93B, Tamspan-90, and Southwest Runner
(Porter and Melouk 1997), and in Tamrun OL07 (Baring et al. 2006).
For resistance of groundnut to other soil-borne diseases not much information is
available. Growing cultivars with an upright growth habit may limit contact of the
canopy with the soil, thereby reducing disease incidence (Backman and Brenneman
1997). According to Shew et al. (1987) employing phenological suppression may be
a viable option when selecting groundnut cultivars due to the lack of resistance
against various pathogens.
1.3.1.4 Soil Fertility
It is the capacity of a soil to provide crops with essential plant nutrients. It is deter-
mined by the physicochemical attributes of the soil and the cultural practices fol-
lowed by the cultivators. Improving soil fertility also improves plant and soil health
and reduces susceptibility to diseases. The concentration of soil nutrients also influ-
ences the incidence and severity of infections caused by soil-borne fungi (Thiessen
and Woodward 2012).
The availability, deficient or excess, of nitrogen to plants is very important from
disease point of view. Application of ammoniacal nitrogen may directly inhibit the ger-
mination and limit the mycelial growth of S. rolfsii (Punja 1985). Soil amendments with
nitrogenous compounds or plant residues may also lead to the increase in population of
antagonistic microbes, such as Trichoderma spp., Gliocladium spp., and Penicillium
spp. (Porter and Melouk 1997) or may cause death of sclerotia (Punja 1985).
The availability of calcium in the soil also influences disease development.
Optimum levels of calcium improve cell wall composition and make them more
resistant to pathogen penetration (Agrios 2005). When disease pressure is low,
higher levels of calcium in groundnut tissue may limit the disease development by
S. rolfsii (Punja 1985). There are reports of calcium being used to prevent pod rot
disease caused by Pythium spp., and R. solani (Beute 1997; Brenneman 1997;
Walker and Csinos 1980). Calcium amendments have been shown to lessen disease
incidence and severity (Csinos 1984).
1.3.2 Chemical Control Practices
Groundnut diseases can be managed best by effective utilization of both cultural and
chemical control measures. Protectant fungicide applications prior to infection and
curative fungicide applications just after infections occur are effective in reducing
losses (Thiessen and Woodward 2012). Fungicides with broad-spectrum activity can
be used for controlling wide range of fungal pathogens causing foliar as well as soil-
borne diseases. Seed rots and seedling diseases of groundnut can be controlled by
treating with Thiram @ 3 g/kg seeds or with Carbendazim @ 2 g/kg seeds. The
Strobilurins, which are beta-methoxy acrylic acid derivatives, have broad-spectrum
24 K.K. Pal et al.
activity and show activity against various foliar and soil-borne pathogens (Bartlett
et al. 2002). These compounds inhibit electron transport by binding to the QoI site of
Cytochrome b. Other broad-spectrum fungicides such as Propiconazole and
Tebuconazole (Triazole fungicides) inhibit sterol demethylation (Brenneman et al.
1994; Baird et al. 1991). There are various other mechanisms by which the fungicides
inhibit the pathogens. Phenylamides, such as metalaxyl, inhibit nucleic acid synthesis
by affecting RNA synthesis via RNA polymerase I while the fungicide flutolanil pre-
vents respiration by inhibiting succinate dehydroginase synthesis (Thiessen and
Woodward 2012). Pentachloronitrobenzene (PCNB), fungicide with aromatic hydro-
carbon, causes lipid peroxidation, which leads to the loss of integrity of the cell mem-
brane (Shim et al. 1998). A pyridinamine fungicide, Fluazinam, is a broad-spectrum
fungicide with multisite activity that inhibits the respiration of fungi (Syngenta 2012).
A number of fungicides are used by groundnut growers. Broad-spectrum fungi-
cides can be used to control a wide range of pathogens. Tebuconazole, a broad-
spectrum systemic fungicide, is used to manage soil-borne Basidiomycetes such as
R. solani and S. rolfsii (Brenneman et al. 1994; Baird et al. 1991). Azoxystrobin is
another broad-spectrum fungicide which is used to control soil-borne Basidiomycetes
and has limited activity on Pythium spp. (Grichar et al. 2000). Flutolanil, a systemic,
curative fungicide, is used to control basidiomycetes such as S. rolfsii and R. solani,
and is especially effective at controlling mycelia growth and infection cushion for-
mation (Csinos 1987; Grichar 1995). Chlorothalonil, a multiaction protectant fungi-
cide, is effective against foliar diseases but ineffective against most soil-borne
pathogens (Porter 1997b). Oomycetes, such as Pythium spp. may be controlled by
Metalaxyl and mefenoxam (Filonow and Jackson 1989). Iprodione inhibits the
germination of spores and limits the fungal growth of B. cinerea, S. minor, and
S. sclerotiorum (Langston et al. 2002). The fungicide Fluazinam has also been used
to manage the Sclerotinia blight in groundnut (Butzler et al. 1998).
The timing of application of fungicides is equally important. The timing of appli-
cation of fungicides should result in minimum loss of yield and minimum usage of
the chemicals. In the United States, the initial applications are typically made 60
days after planting (DAP). Subsequent applications for controlling soil-borne
pathogens are made between 90 and 120 DAP (Rideout et al. 2008). The frequency
of applications may affect the disease development caused by soil-borne pathogens.
In a study by Bowen et al., the number of spray applications was evaluated, and four
applications in the growing season provided the greatest control (Bowen et al.
1997). The residual activity of fungicides affected disease development. The resid-
ual activity of flutolanil at pegging or pod development provided greater disease
control than applications at planting (Csinos 1987).
1.3.3 Biological Control
Awareness about the health hazards and environmental concerns due to the indis-
criminate use of pesticides resulted in the development of biological control agents.
Native microorganisms with biocontrol and plant growth promoting potential are
being tested for controlling fungal pathogens of groundnut. Bacteria isolated from
the rhizosphere and belonging to a wide variety of genera have the potential to sup-
press diseases caused by a diversity of soil-borne plant pathogens. A significant
reduction in the incidence of root rot caused by Rhizoctonia in Rhizobium and
Trichoderma treatment was reported by Jayaraj and Ramabadran (1999). Combined
application of Rhizobium and Trichoderma harzianum (ITCC-4572) successfully
reduced the stem rot incidence and also increased the growth of the groundnut
plants (Ganesan et al. 2007). Spray of neem seed kernel extract (5 %), or crude
neem oil (2 %) is found to be effective against foliar pathogens. Seed treatment with
Trichoderma viride or T. harzianum is found to be effective against seed and soil-
borne pathogens @ 4 g/kg seed. Soil application of Trichoderma viride or T. harzia-
num @ 25–62.5 kg/ha, preferably in conjunction with organic amendments such as
castor cake or FYM can be used effectively against seed and soil-borne diseases
(Ghewande et al. 2002).
1.4 The Future Challenges
The large number of fungal diseases affecting groundnut crop is a serious challenge
to researchers concerned with improving productivity of groundnut. With the
increase in demand for groundnut as food crop and also as oilseeds crop, the pro-
ductivity of groundnut needs to be increased substantially. There is also the urgency
to enhance domestic production of edible oils to lessen the burden of importing oils.
Incidences of major fungal diseases can reduce the productivity to as high as 50 %.
The development of effective control measures can minimize the yield loss and
enhance productivity in a given situation. With the change in the climatic conditions
and reports of incidences of minor diseases becoming virulent, many more diseases
can be potential threats to enhancing the groundnut productivity.
Concerted and multidisciplinary research efforts are needed to develop disease
resistant cultivars, as this is one of the best options. But the task of developing resis-
tant varieties against polyphagous fungal pathogens in groundnut is daunting and
appears a distant dream. Introgression of multiple disease resistant polygenic traits
in agronomic backgrounds would also be difficult. The narrow genetic base of the
present groundnut cultivars has complicated the breeding efforts further. More
sources of resistance need to be identified from different genetic backgrounds.
Groundnut germplasm should be systematically explored for obtaining sources of
resistance. Similarly, wild species, known for resistance to biotic and abiotic
stresses, should be widely utilized in crop improvement programmes to transfer the
resistant traits. Research efforts are also needed to identify existing and future phys-
iological races of the fungal pathogens. An understanding of the life cycles and
taxonomic relationships of the pathogens in the future and emerging climatic change
scenarios will also be essential as ultimately disease is the outcome of the interac-
tion among the host, pathogen, and environment.
High cost of chemical fungicides; pollution to soil, air and water; development
of resistance to these chemicals and detrimental effects of chemicals on plant,
26 K.K. Pal et al.
animal, and human health are drawing the attention of researchers towards
ecologically safer and environment friendly disease management practices. There
has been renewed interest in the use of cultural practices such as intercropping and
crop rotation, tillage, manuring, etc. The effects of changing climatic conditions on
new varieties of groundnut and new strains of pathogens and the cultural practices
needed to manage the host-pathogen-environment interaction needs to be investi-
gated in future.
Besides, new ecologically competent biocontrol agents need to be identified for
managing foliar and soil-borne fungal pathogens of groundnut. Options of using
endophytic microorganisms for management of biotic stresses can also be explored
on evolutionary perspective and on the concept of use of resident antagonists. Of
late, efforts are being made to develop soils naturally suppressive to soil-borne fun-
gal pathogens particularly Aspergillus niger, Sclerotium rolfsii, and Aspergillus
flavus by enhancing the population of DAPG-producing fluorescent pseudomonads.
As having cultivars resistant/tolerant to soil-borne and foliar fungal diseases is a
distant dream using conventional breeding techniques, use of biotechnological tools
to transfer alien genes for developing transgenic cultivars seems to be a promising
option. But with more stringency and less acceptability of GM crops, transgenic
approach will also face uncertain future.
With the limited options available, IDM system consisting of resistant cultivars,
improved tillage practices, and reduced application of fungicides, is well-supported
and likely to continue in future attempts at control of the groundnut pathogens
(Gremillion 2007). Each component of IDM system will have to be effective for
successful disease management. Groundnut germplasm will need to be diversified
to support breeding programmes and the future of host resistance. Efforts like the
diversification of groundnut germplasm will help prevent the potentially serious
threat of host resistance breakdown in pathogen populations (Gremillion 2007). The
genetic diversity of the pathogens will need to be studied in great detail to develop
long-term disease management strategies.
References
Agrios GN (2005) Effect of host-plant nutrition. In: Plant pathology, 5th edn. Elsevier Academic,
Burlington, MA, pp 257–262
Ambang Z, Ngoh Dooh JP, Essono G, Bekolo N, Chewachong G, Asseng CC (2010) Effect of
Thevetia peruviana seeds extract on in vitro growth of four strains of Phytophthora megakarya.
Plant Omics J 3:70–76
Ambang Z, Ndongo B, Essono G, Ngoh JP, Kosma P, Chewachong GM, Asanga A (2011) Control
of leaf spot disease caused by Cercospora sp. on groundnut (Arachis hypogaea) using metha-
nolic extracts of yellow oleander (Thevetia peruviana) seeds. Austr J Crop Sci 5:227–232
Backman PA, Brenneman TB (1997) Stem rot. In: Kokalis-Burelle N, Porter DM, Rodriguez-
Kabana R, Smith DH, Subrahmanyam P (eds) Compendium of peanut diseases, 2nd edn. APS,
St. Paul, MN, pp 36–37
Baird RE, Brenneman TB, Bell DK, Murphy AP (1991) The effects of the fungicide propiconazole
(Tilt) on the groundnut shell mycobiota. Mycol Res 95:571–576
Baring MR, Simpson CE, Burow MD, Black MC, Cason JM, Ayers J, Lopez Y, Melouk HA (2006)
Registration of ‘Tamrun OL07’ peanut. Crop Sci 46:2721–2722
Bartlett DW, Clough JM, Godwin JR, Hall AA, Hamer M, Parr-Dobrzanski B (2002) The
strobilurin fungicides. Pest Manag Sci 58:649–662
Beute MK (1997) Pythium diseases. In: Kokalis-Burelle N, Porter DM, Rodriguez-Kabana R,
Smith DH, Subrahmanyam P (eds) Compendium of peanut diseases, 2nd edn. APS, St. Paul,
MN, pp 27–30
Bowen L, Hagan AK, Weeks JR (1997) Number of tebuconazole applications for maximizing
disease control and yield of peanut in growers’ fields in Alabama. Plant Dis 81:927–931
Branch WD, Brenneman TB (2009) Field evaluation for the combination of white mould and
tomato spotted wilt disease resistance among peanut. Crop Prot 28:595–598
Brenneman TB (1997) Rhizoctonia diseases. In: Kokalis-Burelle N, Porter DM, Rodriguez-
Brenneman TB, Sumner HR, Chandler LR, Hammond JM, Culbreath AK (1994) Effect of applica-
tion techniques on performance of propiconazole for peanut disease control. Peanut Sci
21:134–138
Brenneman TB, Culbreath AK, Holbrook CC (2005) Screening cultivars and advanced germplasm
for multiple disease resistance. In: Proceedings of the American Peanut Research and Education
Society 37: article 30
Butzler TM, Bailey J, Beute MK (1998) Integrated management of Sclerotinia blight in peanut:
utilizing canopy morphology, mechanical pruning, and fungicide timing. Plant Dis 82:
1312–1318
Csinos AS (1984) Evaluation of the insecticide chlorpyrifos for activity against southern stem rot
on peanuts. Peanut Sci 11:98–102
Csinos AS (1987) Control of southern stem rot and Rhizoctonia limb rot of peanut with flutolanil.
Peanut Sci 14:55–58
Filonow AB, Jackson KE (1989) Effect of metalaxyl plus PCNB or metalaxyl plus tolclofos-
methyl on peanut pod rot and soil populations of Pythium spp. and Rhizoctonia solani. Peanut
Sci 16:25–32
Food & Agriculture Organization of the United Nations (2007) Statistical database of Food and
Agriculture Organization of the United Nations (FAO). www.fao.org/waicent/portal/
statistics_en.asp
Ganesan S, Kuppusamy RG, Sekar R (2007) Integrated management of stem rot disease (Sclerotium
rolfsii) of groundnut (Arachis hypogaea L.) using Rhizobium and Trichoderma harzianum
(ITCC-4572)
Ghewande MP, Desai S, Basu MS (2002) Diagnosis and management of major diseases of ground-
nut. Bulletin, National Research Centre for Groundnut, Junagadh, Gujarat, p 36
Gorbet DW, Kucharek TA, Shokes FM, Brenneman TB (2004) Field evaluations of peanut germ-
plasm for resistance to stem rot caused by Sclerotium rolfsii. Peanut Sci 31:91–95
Gremillion (2007) Contributions to management of diseases of peanut (Arachis hypogaea) through
Bolivian-derived host resistance, integrated disease management and knowledge of pathogen
variability. Ph.D. thesis, University of Georgia, Athens, Georgia
Grichar WJ (1995) Management of stem rot of peanuts (Arachis hypogaea) caused by Sclerotium
rolfsii with fungicides. Crop Prot 14:111–115
Grichar WJ, Besler BA, Jaks AJ (2000) Use of azoxystrobin for disease control in Texas peanut.
Peanut Sci 27:83–87
Jayaraj J, Ramabadran R (1999) Rhizobium-Trichoderma interaction in vivo and in vitro. Indian
Phytopathol 52:190–192
Kearney MIT, Marinelli A, Oddino C, March GJ (2002) Transmission and dispersal of Sphaceloma
arachidis by crop debris and seed from infected peanut. Peanut Sci 29:13–17
Langston DB Jr, Phipps PM, Stipes RJ (2002) An algorithm for predicting outbreaks of Sclerotinia
blight of peanut and improving the timing of fungicide sprays. Plant Dis 86:118–126
28 K.K. Pal et al.
Lewis PI, Filonow AB (1990) Reaction of peanut cultivars to Pythium pod rot and their influence
on populations of Pythium spp. in soil. Peanut Sci 17:90–95
Mayee CD (1995) Current status and future approaches for management of groundnut disease in
India. Indian Phytopathol 48:389–401
Mayee CD, Datar VV (1988) Diseases of groundnut in the tropics. Rev Trop Plant Pathol
5:169–198
Melouk HA, Damicone JP (1997) Verticillium wilt. In: Kokalis-Burelle N, Porter DM, Rodriguez-
Pande S, Bandyopadhyay R, Blümmel M, Narayana Rao J, Thomas D, Navi SS (2003) Disease
management factors influencing yield and quality of sorghum and groundnut crop residues.
Field Crop Res 84:89–103
Peters RD, Sturz AV, Carter MR, Sanderson JB (2003) Developing disease-suppressive soils
through crop rotation and tillage management practices. Soil Till Res 72:181–192
Porter DM (1997a) The peanut plant. In: Kokalis-Burelle N, Porter DM, Rodriguez-Kabana R,
MN, pp 1–2
Porter DM (1997b) Botrytis blight. In: Kokalis-Burelle N, Porter DM, Rodriguez-Kabana R,
MN, pp 10–11
Porter DM, Melouk HA (1997) Sclerotinia blight. In: Kokalis-Burelle N, Porter DM, Rodriguez-
Punja ZK (1985) The biology, ecology, and control of Sclerotium rolfsii. Annu Rev Phytopathol
23:97–127
Rideout SL, Brenneman TB, Culbreath AK, Langston DB Jr (2008) Evaluation of weather-based
spray advisories for improved control of peanut stem rot. Plant Dis 92:392–400
Shew BB, Wynne JC, Beute MK (1987) Field, microplot, and greenhouse evaluations of resistance
to Sclerotium rolfsii in peanut. Plant Dis 71:188–191
Shim MY, Starr JL, Keller NP, Woodard KE, Lee TA Jr (1998) Distribution of isolates of Sclerotium
rolfsii tolerant to pentachloronitrobenzene in Texas peanut fields. Plant Dis 82:103–106
Shokes FM, Culbreath AK (1997) Early and late leaf spots. In: Kokalis-Burelle N, Porter DM,
Rodriguez-Kabana R, Smith DH, Subrahmanyam P (eds) Compendium of peanut diseases, 2nd
edn. APS, St. Paul, MN, pp 17–20
Smith BW (1950) Arachis hypogaea. Aerial flower and subterranean fruit. Am J Bot 37:802–815
Smith DH (1984) Early and late leaf spots. In: Porter DM, Smith DH, Rodriguez-Kabana R (eds)
Compendium of peanut diseases. APS, St. Paul, MN, pp 5–7
Subrahmanyam P, McDonald D (1983) Rust disease of groundnut. ICRISAT Information Bulletin
no. 13, Patancheru, AP
Subrahmanyam P, Wongkaew S, Reddy DVR, Demski JW, McDonald D, Sharma SB, Smith DH
(1992) Field diagnosis of groundnut diseases. ICRISAT Information Bulletin no. 36,
Patancheru, AP
Syngenta (2012) Omega fungicide. http://www.syngentacropprotection.com/prodrender/index.
aspx?prodid=632
Thiessen LD, Woodward JE (2012) Diseases of peanut caused by soil-borne pathogens in the
southwestern United States. ISRN Agronomy vol 2012, Article ID 517905, 9 page.
doi:10.5402/2012/517905
Vasavirama K, Kirti PB (2012) Increased resistance to late leaf spot disease in transgenic peanut
using a combination of PR genes. Funct Integr Genomics 12:625–634
Walker ME, Csinos AS (1980) Effect of gypsum on yield, grade and incidence of pod rot in five
peanut cultivars. Peanut Sci 7:109–113
Wang ZR, Wang KC, Fang SM, Guo JM, Wang YS, Xiong WJ, Lin HL, Wang DH (2006) Screening
of peanut germplasm for resistance to peanut scab. Fujian Agric Sci Technol 21(4):313–316
Wang CT, Wang XZ, Tang YY, Chen DX, Zhang JC, Cui FG, Yu SL (2009) Cloning of the 18S
rDNA sequence from Sphaceloma arachidis, the causal pathogen of groundnut scab. J SAT
Agric Res 7:1
Wells JC, Phipps PM (1997) Peanut disease guide North Carolina and Virginia. Center for
Integrated Pest Management. http://ipm.ncsu.edu/peanuts/diseases/guide/contents.html
Wheeler TA, Howell CR, Cotton J, Porter D (2005) Pythium species associated with pod rot on
West Texas peanuts and in vitro sensitivity of isolates to mefenoxam and azoxystrobin. Peanut
Sci 32:9–13
Woodward JE, Brenneman TB, Kemerait RC, Culbreath AK, Clark JR (2006) First report of
Sclerotinia blight caused by Sclerotinia sclerotiorium on peanut in Georgia. Plant Dis 90:
article 111
Xu XJ (ed) (2009) Compendium of diseases, pests and weeds in peanut field in China. China
Agricultural, Beijing, 443 pp
Chapter 2
Plant Growth Promoting Rhizobacteria
in Crop Protection and Challenges
Rinku Dey, Kamal Krishna Pal, and K.V.B.R. Tilak
2.1 Introduction
Plant beneficial microorganisms are increasingly being used in sustainable agriculture.

Beneficial microorganisms are used with the aim of improving crop yields by aug-
menting nutrient availability, enhancing plant growth and providing protection to
plants from diseases and pests. The bacteria residing in the rhizosphere of plants and
which bring about enhancement in growth and yield of crop plants are widely
referred to as plant growth promoting rhizobacteria (PGPR).
PGPR can mediate plant growth by different direct and indirect mechanisms
(Glick 1995). Some of the mechanisms commonly observed are (1) increased avail-
ability of nutrients due to solubilization/mobilization; (2) biological nitrogen fixa-
tion; (3) providing protection to plants from diseases and pests by producing
antibiotics, siderophores, hydrogen cyanide, etc. (Medeiros et al. 2005; Keel and
Maurhofer 2009); (4) production of plant hormones like IAA, cytokinins, gibberel-
lic acid, etc.; (5) improving the tolerance to stresses like salinity, drought, etc.;
(6) lowering of ethylene levels in plants by production of the enzyme
1-aminocyclopropane-1-caroxylate (ACC) deaminase (Glick et al. 1999).
Over the years workers have added newer definitions of PGPR. According to
Vessey (2003), numerous species of soil bacteria which flourish in the rhizosphere
of plants, but which may grow in, on, or around plant tissues, and stimulate plant
growth by a plethora of mechanisms are collectively known as PGPR. Gray and
R. Dey, Ph.D. • K.K. Pal, Ph.D.

Microbiology Section, Directorate of Groundnut Research (ICAR),
Ivnagar Road, PB No. 5, Junagadh, Gujarat 362001, India
K.V.B.R. Tilak, Ph.D. (*)
Department of Botany, Osmania University, Hyderabad,
Telangana 500007, India
e-mail: tilakkvbr@gmail.com

32 R. Dey et al.
Smith (2005) went a step further and separated PGPR into extracellular (ePGPR)
organisms, existing in the rhizosphere, on the rhizoplane, or in the spaces between
cells of the root cortex, and intracellular (iPGPR), which exist inside root cells.
Several PGPR inoculants have been commercialized. These inoculants result in
improvement of crop growth and yield or provide protection to the crop from pests
and diseases. Several microbial inoculants are used as biofertilizers, which improve
the uptake of nutrients like nitrogen, phosphorus, potassium, sulphur, iron, etc.
The genera commonly used as biofertilizers are Rhizobium, Bacillus, Pseudomonas,
etc. The genera commonly used as biocontrol agents are Pseudomonas, Bacillus,
Burkholderia, Agrobacterium, Streptomyces, etc. These organisms suppress plant
disease by production of antibiotics, siderophores, or by induction of systemic resis-
tance or any other mechanism (Tenuta 2003). Biofertilizers have been an alternative
to mineral fertilizers to increase the yield and plant growth in sustainable agriculture
(Canbolat et al. 2006). The current trend is the development of a consortium of
beneficial microorganisms which will offer multiple beneficial effects including
growth promotion, yield enhancement and protection from diseases and pests.
Understanding the interaction between consortium of microbial inoculants and
plant systems will pave way to harness more benefits from microbial inoculants for
improving plant growth and yield (Raja et al. 2006).
2.2 PGPR as Biocontrol Agents of Plant Diseases
There are several mechanisms by which PGPR bring about control of plant diseases.
The most commonly used methods are competition and production of metabolites.
The metabolites include antibiotics, siderophores, HCN, cell wall-degrading
enzymes, etc. (Enebak et al. 1998; Kloepper 1993). Many mechanisms may simul-
taneously act in a single strain towards providing biocontrol of diseases. Kloepper
et al. (1992) mentioned about two types of resistances in plants. Induced systemic
resistance (ISR) or systemic acquired resistance (SAR) is defined as the activation
of chemical and physical defenses of the plant host by an inducer which could be a
chemical or a microorganism, leading to the control of several pathogens.
There are several reports of antagonism of pathogenic fungi by PGPR (Table 2.1).
Pseudomonas strains MRS23 and CRP55b inhibited the growth of pathogenic
fungi, i.e. Aspergillus sp., Fusarium oxysporum f. sp. ciceri and Rhizoctonia solani
under culture condition (Goel et al. 2002).
There are several reports of reduction of disease incidences by application of
PGPR. Bacillus spp. isolated from healthy cabbage, kale, and radish reduced black
rot incidence in kale and cabbage caused by Xanthomonas campestris pv. campestris
(Xcc), in greenhouse and field experiments (Assis et al. 1996). Later, Monteiro et al.
(2005) reported that four of these Bacillus strains produced lipopeptides active
against Xcc during its late growth phase. Lipopeptides can also stimulate ISR in
plants, probably by interacting with plant cell membranes and inducing temporary
2
Table 2.1 PGPR having potential biocontrol properties

PGPR Target pathogen Disease Crop
Pseudomonas fluorescens F113, Pf-5, Pythium ultimum, Pythium aphanidermatum, Damping off Cotton
Q2-87, CHA0, etc. and Pythium sp. Damping off Tomato
Rhizoctonia solani Damping off Tomato
Fusarium oxysporum Root rot Cotton
Pseudomonas fluorescens strain PfA506 Erwinia amylovora strain 153nal super(R) Fire blight Apple
Agrobacterium radiobacter Agrobacterium tumefaciens Crown gall Dicot plants
Bacillus subtilis AU195 Aspergillus flavus Aflatoxin contamination Groundnut
Bacillus amyloliquefaciens FZB42 Fusarium oxysporum Wilt Tomato
Bacillus subtilis 168 Aspergillus niger collar rot Groundnut
Bacillus subtilis QST713 Botrytis cinerea, Rhizoctonia solani Damping off Grape, cotton
Bacillus subtilis BBG100 Pythium aphanidermatum Damping off Papaya
P. fluorescens HV37aR2 Pythium ultimum Damping off Cotton
P. fluorescens HV37aR2 Pythium ultimum Damping off Cotton
Pseudomonas fluorescens 2-79, 30-84 Gaeumannomyces graminis var. tritici Take-all Wheat
Pseudomonas fluorescens Pf-5 Pythium ultimum, Rhizoctonia solani Damping off Cotton
P. cepacia R. solani and Pyricularia oryzae Damping off and rice blast Cotton, rice
Bacillus cereus UW85 Phytophthora medicaginis, Pythium Damping off Alfalfa
aphanidermatum
Pseudomonas fluorescens strain 97 Pseudomonas syringae pv. phaseolicola Halo blight Beans
Pseudomonas cepacea Sclerotium rolfsii Stem rot Beans
Bacillus subtilis Blumeria graminis f. sp. hordei Powdery mildew Barley
Plant Growth Promoting Rhizobacteria in Crop Protection and Challenges
Pseudomonas sp. (WCS 417r) Burkholderia caryophylli Fusarium wilt Carnation

Pseudomonas fluorescens Pythium ultimum Damping off Cotton
Bacillus subtilis Meloidogyne incogita Root knot Cotton
Pseudomonas cepacea Rhizoctonia solani Damping off Cotton
(continued)
33
Table 2.1 (continued)
34
PGPR Target pathogen Disease Crop

Pseudomonas putida (89B-27) Colletotrichum lagenarium Anthracnose Cucumber
Pseudomonas cepacea Pythium ultimum Damping off Cucumber
Pseudomonas sp. Aspergillus sp., Curvularia sp., Fusarium Wilt Green gram
oxysporum, Rhizoctonia solani
Pseudomonas aeruginosa, Meloidogyne javanica Root knot Mung bean
Bacillus subtilis
Pseudomonas fluorescens, Burkholderia sp. Rhizoctonia solani Rice sheath blight Rice
Pseudomonas fluorescens strain Pf1 and Fp7 Rhizoctonia solani Rice sheath blight Rice
S. marcescens 90-1, Bacillus pumilus SE34 Peronospora tabacina Blue mold Rice
Aeromonas caviae Rhizoctonia solani and Fusarium Cotton
oxysporum f. sp. vasinfectum
Rhizoctonia solani Bean
Enterobacter agglomerans, Bacillus cereus Rhizoctonia solani Cotton
Paenibacillus illinoisensis Rhizoctonia solani Cucumber
Serratia marcescens Sclerotium minor Lettuce
Bacillus spp. Sclerotium sclerotiorum
Source: Data from: Pal and Gardener (2006) and Bouizgarne (2013)
R. Dey et al.
2 Plant Growth Promoting Rhizobacteria in Crop Protection and Challenges 35
alterations in the plasma membrane which could raise plant defenses (Ongena et al.
2009). Phenaminomethylacetic acid produced by Bacillus methylotrophicus BC79
was reported to be a new kind of substance never found in Bacillus methylotrophicus
(Shan et al. 2013). Culture filtrate of BC79 showed biocontrol efficiency against
rice blast.
Vegetatively propagated crops like plantation and horticultural crops are often
susceptible to soil-borne diseases which are difficult to control. The Fusarium wilt
of banana caused by Fusarium oxysporum f. sp. cubense is a very destructive dis-
ease worldwide (Figueiredo et al. 2010). Application of endophytic and epiphytic
bacteria, single culture or in mixtures, as root or substrate treatments, significantly
improved the growth of micropropagated banana plantlets and controlled fusarium
wilt (Mariano et al. 2004). Bacillus amyloliquefaciens Ba33 was used as a soil
disinfector and an antiviral agent against tobacco mosaic virus (TMV) (Shen et al.
2012). Application of mixture of PGPR, more than one genera or species, is more
desirable and effective means for controlling plant diseases, as compared to single
cultures. The different members in a mixture will have additive or synergistic effects
and therefore will result in better control of diseases.
Some bacteria reside in arbuscular and ectomycorrhizal systems and either assist
mycorrhiza formation or promote the functioning of their symbiosis (Figueiredo
et al. 2010). These bacteria are known as mycorrhiza helper bacteria (MHB). MHB
present three significant functions: nutrient mobilization from soil minerals, fixation
of atmospheric nitrogen, and plant protection against root pathogens (Frey-Klett
et al. 2007). The MHB mentioned by this group were Pseudomonas fluorescens,
P. monteilii, Bacillus coagulans, B. subtilis, Paenibacillus brasiliensis, Rhizobium
leguminosarum, and Bradyrhizobium japonicum.
Several workers have successfully tried using biocontrol agents along with syn-
thetic pesticides for disease control and yield enhancement. These treatments may
reduce the application of chemical pesticides to crop plants. Corn seeds when
bacterized with Paenibacillus macerans along with the seed-treatment with fludiox-
onil and metalaxyl M reduced incidences of pathogens, promoted germination and
grain yield (Luz 2003). Similarly, Bugg et al. (2009) used Bacillus-based treatments
along with seed-treatment practices.
Biocontrol agents need to be formulated if they have to be commercialized. The
formulation should be cheap and should not pose any threat to human, animal or
plant life or to the environment. Screening for new agents should consider the
biology and ecology of the pathosystem, as well as agricultural practices associated
with the crop (Fravel 2007). Raj et al. (2003a, b) studied the comparative perfor-
mance of formulations of PGPR in growth promotion and suppression of downy
mildew in pearl millet. The formulations contained two different strains of bacilli
with chitosan as a carrier. Formulations LS256 and LS257 besides being the best
growth promoters were also the most efficient resistance inducers. Among the
application methods tested, soil amendment was found to be the most suitable and
desirable way of delivering the formulations. The study demonstrates a potential
role for plant growth promoting rhizobacterial formulations in downy mildew
36 R. Dey et al.
management. A few examples of PGPR and biocontrol products are: Agrobacterium

radiobacter K1026 (Nogall®), Bacillus pumilus QST 2808 (Sonata® TM), B. pumilus
GB34 (YieldShield®), B. subtilis GBO3 (Kodiak®), Pantoea agglomerans C9-1
(BlightBan C9-1®), P. agglomerans E325 (Bloomtime®), Pseudomonas aureofa-
ciens Tx-1(Spot-Less®T), P. syringae ESC-10 and ESC-11 (Bio-save®), P. fluores-
cens A506 (BlightBan®), P. chlororaphis MA 342 (Cedomon®), Streptomyces
griseoviridis K61 (Mycostop®) and S. lydicus WYEC 108 (Actinovate®) (Figueiredo
et al. 2010). B. subtilis has great potential for use in agriculture and has been used
in the formulation of commercial products for agricultural use in several countries
(Lazzareti and Bettiol 1997). Several substances have been used in experimental
formulations such as lactose, peptone, gum Arabic, xanthan, cellulose and others
(Schisler et al. 2004). Formulations based on Bacillus are widely available because
of their longer shelf life and tolerance to heat and desiccation.
2.3 PGPR Induced Systemic Resistance in Crop Plants

Against Pests and Diseases
Plants have developed various strategies to combat aggressors (Van Loon et al.
1998). One of these strategies is the initiation of a defense reaction at the site of
infection, which spreads throughout the plant resulting in the development of resis-
tance. Induced resistance is defined as an enhancement of the plant’s defensive
capacity against a broad spectrum of pathogens and pests that is acquired after
appropriate stimulation. The resulting elevated resistance due to an inducing agent
upon infection by a pathogen is called ISR or SAR (Hammerschmidt and Kuc
1995). The induction of systemic resistance by rhizobacteria, which are nonpatho-
genic, is referred as ISR, whereas that by other agents is called SAR (Van Loon
et al. 1998). SAR is commonly triggered by the elicitors of avirulent pathogens,
such as microbial-associated molecular patterns (MAMPs) (Abramovitch et al.
2006), but it can also be induced by biological (nonmicrobial) and chemical com-
pounds. Typically the ISR by PGPR do not cause any necrotic symptoms on the
host plants, whereas SAR is expressed to a maximum level when the inducing
organism causes necrosis (Cameron et al. 1994). The expression of induced resis-
tance can be local or systemic when it is expressed at sites not directly exposed to
the inducers agent (Stadnik 2000). ISR is quite similar to SAR, making the plant
resistant to subsequent attacks of pathogenic organisms, such as viruses, bacteria
and fungi (Bakker et al. 2007). SAR or ISR do not provide complete resistance to
any particular pathogen, but provide substantial protection to plants for a long time
to a broad range of pathogens. Some chemicals, such as SA or analogues [benzo-
thiadiazole (BTH) and its derivatives, e.g. 2,6-dichloronicotinic acid], are known to
induce SAR (Table 2.2) and have been successfully used in the field to control
diseases (Vallad and Goodman 2004).
Table 2.2 Effect of some SAR elicitors on disease suppression potential

SAR % Disease
Crop Pathogen Disease elicitors reduction
Monocots
Maize Peronosclerospora sorghi Downy mildew BTH −35
Wheat Blumeria graminis Powdery mildew BTH −64
f. sp. tritici
Dicots
Tobacco Pseudomonas syringae Bacterial wildfire BTH −99
pv. tabaci (tox+)
Tomato Pseudomonas syringae Bacterial speck BTH −47
pv. tomato
Pepper Xanthomonas campestris Bacterial spot BTH −64
pv. vesicartoria
Soybean Sclerotinia sclerotiarum White mold INA −46
Cotton Xanthomonas campestris bacterial blight BTH −42
pv. malvacearum
Leguminous Uromyces appendiculatus rust INA −42
bean
Peanut Cercosporidium personatum late leaf spot INA +52
Apple Erwinia amylovora fire blight BTH −73
Source: Data from: Vallad and Goodman (2004)
BTH benzo (1,2,3) thiadiazole-7-carbothiolic acid S-methylester, INA 2,6-dichloro isonicotinic acid
2.3.1 Induction of Systemic Resistance by PGPR Against

Diseases and Pests
The use of PGPR for inducing systemic resistance against diseases has been
demonstrated in field conditions (Vidhyasekaran and Muthamilan 1999;
Viswanathan 1999). PGPR have been reported to induce resistance in plants against
bacterial, fungal and viral diseases (Liu et al. 1995a, b; Maurhofer et al. 1998; Raj
et al. 2003a, b; Halfeld-Vieira et al. 2006), and insect (Zehnder et al. 1997) and
nematode pests (Sikora 1988). This type of induced resistance shows advantages
such as: effectiveness against various pathogens; stability due to the action of differ-
ent mechanisms of resistance, systemicity, energy economy; and metabolic utiliza-
tion of genetic potential for resistance in all susceptible plants (Bonaldo et al. 2005).
Bacillus and Pseudomonas are among the most studied genera of PGPR. Induced
resistance was first analyzed in 1961 by pre-inoculation of tobacco plants with
TMV (Ross 1961). This procedure protected the plant against other viruses and
resulted in the conception of “Systemic Acquired Resistance” (SAR). The activation
of defense mechanisms induced by fungi, bacteria, viruses, and nematodes can be
achieved by different routes, which may occur alone or concomitantly (Bonaldo
et al. 2005). The induction of resistance to disease is an added advantage to the
promotion of plant growth and yield by the application of PGPR. The presence of
the PGPR in the rhizosphere makes the entire plant, including the shoot, more
resistant to pathogens (Figueiredo et al. 2010).
38 R. Dey et al.
2.3.1.1 Diseases
PGPR have been reported to provide protection to plants from diseases by employ-
ing different mechanisms. These mechanisms include production of antibiotics like
pyocyanine, pyrrolnitrin, 2,4- diacetylphloroglucinol (Pierson and Thomashow
1992); production of siderophores (Kloepper et al. 1980); competition for nutrients
and space (Elad and Chet 1987); production of lytic enzymes like chitinases and
β-1,3-glucanases (Potgieter and Alexander 1996; Velazhahan et al. 1999); HCN
production (Defago et al. 1990), fluorescent pigments, etc.
The role of ISR in controlling diseases in plants has been demonstrated by many
studies (Ramamoorthy et al. 2001). Application of PGPR strains as a seed-treatment
resulted in a significant reduction in anthracnose disease caused by Colletotrichum
orbiculare in cucumber (Wei et al. 1991, 1996). They showed that this plant could
be used as a model for ISR. Induction of systemic resistance by Pseudomonas
putida strain 89B-27 and Serratia marcescens strain 90-166 reduced Fusarium wilt
of cucumber incited by Fusarium oxysporum f. sp. cucumerinum (Liu et al. 1995a).
In sugarcane, Viswanathan and Samiyappan (1999a) established PGPR-mediated
ISR against Colletotrichum falcatum causing red rot disease. Pseudomonas fluores-
cens 1-94 (Pf1-94) and Pseudomonas fluorescens (Pf4-92) strains isolated from
rhizosphere soil of chickpea showed ISR against fusarium wilt of chickpea and
charcoal rot (Srivastava et al. 2001).
PGPR induce systemic resistance against bacterial diseases as well. Treatment of
cucumber seed with Pseudomonas putida strain 89B-27 and Serratia marcescens
strain 90-166 decreased the incidence of bacterial wilt disease (Kloepper et al.
1993). Seed-treatment of cucumber with P. putida strain 89B-27, Flavomonas ory-
zihabitans strain INR-5, S. marcescens strain 90-166 and Bacillus pumilus strain
INR-7 provided systemic protection against angular leaf spot caused by Pseudomonas
syringae pv. lachrymans by reducing total lesion diameter compared with non-
treated plants (Liu et al. 1995b; Wei et al. 1996).
There are reports of induction of systemic resistance in plants against viral
diseases by PGPR. Seed-treatment with P. fluorescens strain 89B-27 and S. marces-
cens strain 90-166 reduced the number of cucumber mosaic virus (CMV)-infected
plants and delayed the development of symptoms in cucumber and tomato (Raupach
et al. 1996). Soil application also proved beneficial. Soil application of P. fluores-
cens strain CHAO resulted in induced systemic protection against inoculation with
tobacco necrosis virus (TNV) in tobacco (Maurhofer et al. 1998). Thus, there are
ample reports of PGPR ISRs in plants against bacterial, fungal and viral diseases.
2.3.1.2 Insect Pests
There are few reports on the induction of systemic resistance in crop plants against
insect pests. Fluorescent pseudomonads have been found to influence the growth
and development of different stages of insects. Pseudomonas maltophila affected
the growth of larval stage of Helicoverpa zea, leading to more than 60 % reduction
in adult emergence while pupae and adults that emerged from bacteria-infected
larvae were smaller (Bong and Sikorowski 1991). Certain PGPR strains activate
octadecanoid, shikimate and terpenoid pathways. This in turn alters the production
of volatiles in the host plant leading to the attraction of natural enemies (Bell and
Muller 1993). Qingwen et al. (1998) reported an increase in polyphenol and terpe-
noid content in cotton plants treated with Pseudomonas gladioli, which affected the
relative growth rate, consumption rate and digestibility of feed by Helicoverpa
armigera. Serratia marcescens strain 90-166 was found quite effective in reducing
the populations of striped cucumber beetle, Acalyma vittatum and the spotted
cucumber beetle, Diabrotica undecimpunctata howardi on cucumber and its efficacy
was better than application of the insecticide esfenvalerate (Zehnder et al. 1997).
Attempts have been made to transfer the insecticidal crystal protein from Bacillus
thuringiensis to fluorescent pseudomonads, keeping in view the efficient root colo-
nization ability and endophytic nature of some fluorescent pseudomonads.
Transgenic P. cepacia strain 526 with the crystal protein gene has consistently
shown insecticidal activity against tobacco hornworm (Stock et al. 1990). PGPR
formulations comprising of bacterial strain mixtures having the capability to induce
chitinase in plant play an important role in hydrolyzing chitin, the structural compo-
nent in gut linings of insects and would lead to better control of insect pest (Broadway
et al. 1998). Identification of entomopathogenic PGPR strains that have the capabil-
ity to colonize phylloplane in a stable manner will be a breakthrough in the manage-
ment of foliar pests (Otsu et al. 2004). Pseudomonas fluorescens CHA0 is a
root-associated PGPR that suppresses soil-borne fungal diseases of crops.
Remarkably, the pseudomonad is also endowed with systemic and oral activity
against pest insects which depends on the production of the insecticidal Fit toxin
(Pechy-Tarr et al. 2013). The toxin gene (fitD) is part of a virulence cassette encod-
ing three regulators (FitF, FitG, FitH) and a type I secretion system (FitABC-E).
P. fluorescens CHA0 hence can actively induce insect toxin production in response
to the host environment, and FitH and FitG are key regulators in this mechanism.
Thus, application of PGPR may be useful for management of insect pests as well.
2.3.1.3 Nematodes
Though studies on induction of systemic resistance by PGPR against nematode pests

in crop plants are few, PGPR strains have been used successfully as biological control
agents for sugar beet and potato cyst nematode (Sikora 1992). P. fluorescens induced
systemic resistance against Heterodera schachtii and inhibited early root penetration
in sugar beet (Oostendorp and Sikora 1990). Application of the bacterium P. chitino-
lytica reduced the root-knot nematode infection in tomato crop (Spiegel et al. 1991),
while the level of infestation of root-knot nematode Meloidogyne incognita on tomato
was reduced with fewer galls and egg masses in the soil following root-dipping with
P. fluorescens strain Pf1 (Santhi and Sivakumar 1995).
40 R. Dey et al.
2.4 Application of PGPR Mixtures
Application of mixed cultures are often better suited as biological control agents as
compared to single ones. The mixed cultures closely mimic the natural environment
and might broaden the spectrum of biocontrol activity and enhance the efficacy and
reliability of control (Duffy and Weller 1995). The enhancement in biological
control abilities of mixed cultures may be due to different mechanisms of action and
synergism between the PGPR cultures. Chitinase-producing Streptomyces spp. and
Bacillus cereus isolates used in combination with antibiotic-producing P. fluo-
rescens and Burkholderia (Pseudomonas) cepacia isolates have shown a synergis-
tic effect on the suppression of rice sheath blight caused by Rhizoctonia solani
(Sung and Chung 1997). Similarly, combination of P. fluorescens strains Pf1 and
FP7 gave effective control of rice sheath blight disease when compared to each
strain applied singly (Nandakumar 1998). A combination of two chitinolytic bacte-
rial strains viz., Paenibacillus sp. 300 and Streptomyces sp. 385 in the ratio of 1:1 or
4:1 was more effective than when they were applied individually for the control of
Fusarium wilt of cucumber caused by F. oxysporum f. sp. cucumerinum (Singh
et al. 1999). Biocontrol mixtures should be formulated very carefully. The individual
strains in the mixture should be compatible with each other and should not inhibit
the other strains.
2.5 Broad Spectrum of PGPR Activity
Literature shows many instances of PGPR ISR against a broad range of diseases and
pests. Same PGPR strain may induce resistances against many bacterial and fungal
diseases and sometimes against insect pests as well in the same crop. Seed-treatment
with P. fluorescens strain WCS 417 protected radish through induction of systemic
resistance against the fungal root pathogen F. oxysporum f. sp. raphani, avirulent
bacterial leaf pathogen P. syringae pv. tomato and fungal leaf pathogens Alternaria
brassicicola and F. oxysporum (Hoffland et al. 1996). Seed-treatment of S. marces-
cens strain 90-166 showed ISR in cucumber against anthracnose, CMV, bacterial
angular leaf spot and cucurbit wilt diseases (Kloepper et al. 1993; Liu et al. 1995a, b).
The same strain was also reported to be effective in controlling the striped cucumber
beetle, Acalyma vittatum and spotted cucumber beetle, Diabrotica undecimpunctata
howardi (Zehnder et al. 1997). PGPR can also induce ISR against different patho-
gens in different crops. P. fluorescens strain Pf1 induces resistance against different
pathogens in different crops, viz., Rhizoctonia solani (Nandakumar 1998),
Colletotrichum falcatum in sugarcane (Viswanathan 1999) and Pythium aphanider-
matum in tomato (Ramamoorthy et al. 1999). Thus, it would be prudent to select a
PGPR having a broad spectrum of activity involving plant growth promotion and
induction of resistance against multiple diseases and pests.
2.6 Induction of ISR by Endophytic PGPR
Apart from the colonization of rhizosphere and rhizoplane, some PGPR colonize
the internal tissues of plants and are reported to be endophytes. Endophytic bacteria
reside within the living plant tissues without doing substantive harm or gaining
benefit other than residency (Kado 1992). Endophytic bacteria have the advantage
of the protected environment inside the living plant tissues and are potential candi-
dates for inducing ISR in plants. Endophytic bacteria brought about significant
control against F. solani in cotton and Sclerotium rolfsii in beans (Pleban et al.
1995). Seed-treatment of tomato with endophytic bacterium Bacillus pumilus strain
SE 34 prevented the entry of vascular wilt fungus F. oxysporum f. sp. radicis-
lycopersici into the vascular stele and the mycelial growth was restricted to the
epidermis and outer root cortex (Benhamou et al. 1998). Two endophytic tomato
root colonizing strains, Bacillus amyloliquefaciens CM-2 and T-5 enhanced the
growth of tomato seedlings along with the biocontrol of tomato bacterial wilt caused
by Ralstonia solanacearum (Tan et al. 2013). Biological control of wheat stripe rust
by an endophytic Bacillus subtilis strain E1R-j in greenhouse and field trials was
reported by Li et al. (2013). The biocontrol agent inhibited the germination of
urediniospore and reduced the rate of diseased leaves. The use of endophytic PGPR
for induction of resistance will be more useful in vegetatively propagated crops like
sugarcane, banana, etc. Viswanathan and Samiyappan (1999a) revealed the utility of
endophytic P. fluorescens strain EP1 isolated from stalk tissues of sugarcane in
inducing systemic resistance against red rot caused by Colletotrichum falcatum.
The endophytic bacteria survives in the vegetatively propagated plant parts and
move from one crop to the succeeding crop through vegetative propagation.
2.7 Mechanisms of ISR by PGPR
The PGPR employ several mechanisms for bringing about ISR in plants. These
mechanisms may involve strengthening or fortification of the cell wall or elicitation
of chemicals for defense against the invasion of disease causing agents.
2.7.1 Structural Modification of Cell Wall in Plants
Plant growth promoting rhizobacteria induce structural modification of the cell wall
in response to pathogenic attack (Benhamou et al. 1996b; M’Piga et al. 1997).
Treatment of pea seeds with P. fluorescens strain 63-28 resulted in formation of
structural barriers, viz., cell wall apposition (papillae) and deposition of newly
formed callose and accumulation of phenolic compounds at the site of penetration
42 R. Dey et al.
of invading hyphae of Pythium ultimum and F. oxysporum f. sp. pisi (Benhamou

et al. 1996a). Seed-treatment of tomato using Bacillus pumilus strain SE 34 also
induced strengthening of cell walls in tomato against F. oxysporum f. sp. radicis-
lycopersici (Benhamou et al. 1998). This type of rapid defense reaction does not
allow the pathogen to invade and also offers the host plant sufficient time to employ
other defense mechanisms to fight the pathogens.
2.7.2 PGPR-Mediated Biochemical Changes in the Host Plants
Biochemical and physiological changes have been reported in plants upon application
of PGPR. ISR may be due to accumulation of pathogenesis-related (PR) proteins
(M’Piga et al. 1997), synthesis of phytoalexin and other secondary metabolites
(Zdor and Anderson 1992). ISR by P. fluorescens strain CHAO against TNV in
tobacco was associated with accumulation of PR proteins namely β-1,3 glucanases
and endochitinases (Maurhofer et al. 1994). Involvement of these lytic enzymes was
reported by Benhamou et al. (1996b) in the induction of resistance by P. fluorescens
strain 63-28. These lytic enzymes accumulated at the site of penetration of the
fungus, F. oxysporum f. sp. pisi resulting in the degradation of fungal cell wall.
Pathogenesis-related peroxidase and chitinase proteins have been found to induce
systemic resistance. In sugarcane, PGPR-mediated ISR against C. falcatum,
enhanced levels of chitinase and peroxidase and specific induction of two new chi-
tinase isoforms were found when inoculated with C. falcatum (Viswanathan and
Samiyappan 1999a, b).
PGPR induce systemic resistance in plants through means other than the produc-
tion of PR proteins also (Pieterse et al. 1996). The plants produce other enzymes of
the defense including peroxidases, phenylalanine ammonia-lyase (PAL), and
polyphenol-oxidase (PPO). While peroxidase and PPO are catalysts in the formation
of lignin, PAL and other enzymes are involved in the formation of phytoalexins
(Figueiredo et al. 2010). The phytoalexins are secondary metabolites, antibiotics of
low molecular weight produced by plants in response to physical, chemical, or bio-
logical stress. They are able to prevent or reduce the activity of pathogens, the rate of
production dependent on the genotypes of host and/or pathogen (Daniel and
Purkayastha 1995). P. fluorescens strains WCS 417r and WCS 358r induced protec-
tion in both wild type Arabidopsis and transgened Arabidopsis with NahG-gene
(coding for salicylate hydrolase) without activating PR gene expression (Van Wees
et al. 1997). Accumulation of phytoalexin in response to Pseudomonas sp. strain
WCS 417r treatment in carnation resulted in protection of carnation from wilt dis-
ease (Van Peer et al. 1991). Zdor and Anderson (1992) recorded increased peroxi-
dase activity as well as an increase in the level of mRNAs encoding for phenylalanine
ammonia-lyase (PAL) and chalcone synthase in the early stages of interaction
between bean roots and various bacterial endophytes. The enzymes produced by
antagonistic strains have a crucial role to play in disease resistance. The production
of enzymes related to pathogenesis (PR proteins) by strains of rhizobacteria is con-
sidered as one of the most important property of the antagonistic strains (Saikia et al.
2004). These enzymes are chitinases, lipoxygenases, peroxidases, and glucanases.
Plants express the activity of peroxidase during pathogen–host interaction (Saikia
et al. 2006). Peroxidase enzyme has been implicated in the oxidation of phenols,
lignification (Saparrat and Guillen 2005), plant protection (Hammerschmidt et al.
1982), and elongation of plant cells (Goldberg et al. 1986). Similarly, another enzyme
lipoxygenase also contributes to the defense reactions involving the inhibition of
growth of the pathogen and induction of phytoalexins (Li et al. 1991). The extent of
activity and accumulation of these enzymes depends mainly on the inducing agent,
besides the genotype of the plant, physiological conditions, and the pathogen (Tuzun
2001). Certain proteins involved in plant growth and development were up-regulated,
such as xyloglucan endotransglycosylase (Wang et al. 2013). Proteins involved in
defense were also up-regulated, including peroxidases, glutathione S-transferases
and kinases. These proteins associated with disease resistance characteristics were
induced in rice plants after exposure to Bacillus cereus NMSL88. There are reports
of induction of disease resistance by rhizobia also. Hemissi et al. (2013) reported
enhanced defense responses of chickpea plants against Rhizoctonia solani by pre-
inoculation with Rhizobium strains Pch Azm and Pch S.Nsir2. The reduction in
infection was accompanied by enhanced level of defense-related enzymes, PAL and
peroxidase (POX). An increased level of phenol content was also recorded in the
roots of bacterized plants grown in the presence of pathogen.
The defense mechanisms induced by PGPR against insect pests are different.
Treatment with PGPR brings about some physiological changes in the host plant
that prevent the insects from feeding. Due to PGPR treatment, there was a shift in
the metabolic pathway in cucumber plants away from the cucurbitacin synthesis and
towards that of other plant defense compounds, resulting in fewer beetles being
attracted (Zehnder et al. 1997). In controlling nematodes, PGPR induce resistance
by altering root exudates or inducing the host to produce repellents that affect nema-
tode attraction or recognition of the host (Oostendorp and Sikora 1990) and altering
the syncytial development or sex ratio in the root tissue (Wyss 1989). Seed-treatment
with PGPR strains resulted in increased chitinase enzyme activity and phenolic con-
tent in rice, which correlated with the reduced nematode infestation (Swarnakumari
1996). The application of PGPR can thus form an important component of inte-
grated pest management practices in agriculture.
2.7.3 Pathogen-Associated Molecular Patterns
To cause a disease, the invading pathogen must access to the plant interior. But in
the process plant also can sense the presence of the pathogens by recognizing the
several bio-molecules of pathogens called pathogens associated molecular patterns
(PAMPs). Once pathogen penetrates the rigid cell wall of the plant, it comes in
touch with the host plasma membrane wherein they encounter the plant extracellular
surface receptors which in turns recognizes the PAMPs. On the onset of this recep-
tion, activation of plant defenses against the invading pathogens starts with a
44 R. Dey et al.
dramatic cellular reprogramming and initiate PAMP triggered immunity (PTI).

This PTI helps the plant to gain a hold over the pathogen and restricts their further
proliferation. Thus, to cause disease, the pathogenic microbes must suppress PTI,
activated in the plant system. To do so, the pathogens start interfering with the rec-
ognition at the plasma membrane or by secreting the effectors proteins into the plant
cell cytosol that alters the signaling processes leading to manifestation of disease
symptoms. However, if microbes succeeded in subverting the PTI, plant develops
more specialized mechanisms to detect and inactivate invading microbes called
effector-triggered immunity (ETI) (Chisholm et al. 2006). In this mechanism, plant
resistance (R) proteins recognize the bacterial proteins, directly or indirectly,
involved in subverting the PTI system activated earlier. It has been discovered that
there is remarkable similarities between the molecular mode of PAMP perception in
animal and plants. Over the last decades, a number of PAMPs has been identified
including lipopolysaccharides (LPS), harpin and flagellin in Gram-negative bacte-
ria; cold shock protein in both Gram-negative and –positive bacteria; transglutamin-
ase, elicitin, β-glucans in Oomycetes; invertase in yeast; chitin and ergosterol in all
fungi; xylanase in Trichoderma, etc. (Numberger et al. 2004). The role of plasma
membrane receptor proteins in recognizing the PAMs and subsequent immunity has
been studied in details. It has been proposed that PTI is induced on recognition of
the microbial PAMPs and subsequent induction in the transcription of the pathogen-
responsive genes, transcription of MAP kinase, production of reactive oxygen
species along with the deposition of callose at the site of infection (Numberger
et al. 2004).
The recognition of flagellin (protein present in flagella) as PAMP by plant has
been studied in details. Though the central region of the flagellin is variable, the
highly conserved regions at N and C terminals across eubacterial species facilitated
it to become an excellent PAMP. In Arabidopsis, a 22 amino acid peptide (flg22) of
the highly conserved N terminus region triggered the PTI. The flagellin receptor
protein in Arabidopsis, FLS2, is a receptor like kinase (RLK) and mutant plant
lacking this receptor is insensitive to flagellin which demonstrates the importance of
receptors. Besides, flagellin, protein elongation factor Tu (EF-Tu) is one of the most
abundant proteins and acts as PAMP in many plants (Chisholm et al. 2006). The
possible mechanisms of PAMP-mediated disease suppression is shown in Fig. 2.1.
Once pathogenic microbes could overcome the PTI of plant, it secretes the
effector molecules into the cytosol and thereby suppresses the PAMP triggered
immunity. In bacteria, type III secretion system (TTSS) is present and it can directly
deliver the effector protein into the plant cell. A number of effector proteins in dif-
ferent microbes have been identified. In Pseudomonas syringae, 20-30 effector
proteins, including AvrRpt2 (protease), AvrB, AvrRpm1, HopPtoD2 (protein phos-
phatase) and AvrPtoB (E3 ligase), have been found during development of disease
symptoms. These effector molecules inhibit the host defense responses initiated by
PAMP recognition process (Fig. 2.1).
There are three plant-signaling molecules; salicylate (SA), jasmonate (JA)
and ethylene; which regulate the plant defense against the invading microbes. The
SA and JA defense pathways are mutually antagonistic and the bacterial pathogen
takes advantage of this and overcome the SA-mediated defense responses.
Fig. 2.1 Proposed model for the evolution of bacterial resistance in plants. (Source: Data from:
Chisholm et al. 2006)
During infection, Pseudomonas pathogen produces coronatine which is similar to

JA and thus overcome the SA pathway (He et al. 2004). Multiple effector proteins
are found to be involved to manipulate the jasmonate pathway in Pseudomonas
syringae. Majority of the effectors possess enzymatic activity and thus modify a
number of host proteins to induce bacterial virulence. Besides, bacterial effectors,
46 R. Dey et al.
effectors molecule have also been found in fungal and viral pathogenesis like in
Oomycetes pathogen Phytophthora infestans.
The major focus in future would be on identification of novel plant receptors
which would recognize the pathogen effector proteins and inactivate them as a
disease control strategies.
2.8 Determinants of PGPR Imparting ISR
2.8.1 Lipopolysaccharides
The LPS present in the outer membrane of bacterial cells are important determinants
of ISR in many PGPR strains (Table 2.3). The LPS of P. fluorescens strains WCS 374
and WCS 417 induced systemic resistance in radish against F. oxysporum f. sp.
Table 2.3 Bacterial determinants and types of host resistance induced by biocontrol agents
Bacterial strain Plant species Bacterial determinant Type
Pseudomonas aeruginosa strain Tobacco Salicylic acid SAR
7NSK2 Bean Salicylic acid SAR
Tomato Phenazine and Salicylic acid SAR
Bacillus amyloliquifaciens Sugar beet Lipopolysaccharide ISR
Pseudomonas fluorescens Tomato Massetolide A ISR
P. fluorescens strain P3 Tobacco Salicylic acid ISR
Pseudomonas fluorescens
CHAO Tobacco Siderophore SAR
Arabidopsis Antibiotics (DAPG) ISR
WCS374 Radish Lipopolysaccharide ISR
Siderophore ISR
Iron regulated factor ISR
WCS417 Carnation Lipopolysaccharide ISR
Arabidopsis Lipopolysaccharide ISR
Radish Lipopolysaccharide ISR
Iron regulated factor ISR
Tomato Lipopolysaccharide ISR
Pseudomonas putida WCS 358 Arabidopsis Lipopolysaccharide ISR
Siderophore ISR
Pseudomonas putida BTP1 Bean Iron regulated metabolite Cx ISR
Serratia marcescens 90-166 Cucumber Siderophore ISR
Bacillus mycoides strain Bac J Sugar beet Peroxidase, chitinase and ISR
β-1,3-glucanase
Bacillus pumilus 203-6 and 203-7 Sugar beet Peroxidase, chitinase and ISR
β-1,3-glucanase
Bacillus subtilis GB03, IN937a Arabidopsis 2,3-butanediol ISR
Pseudomonas putida Bean Hexenal ISR
Source: Data from: Pal and Gardener (2006)
raphani (Leeman et al. 1995). They further explained that the O-antigen side chain of
the LPS might have triggered the induction of defense mechanism in plants. However,
the LPS of P. putida strain WCS 358 having O-antigen side chain did not induce sys-
temic resistance in radish. Van Wees et al. (1997) also obtained similar results where
he reported that LPS of WCS 417r and mutant of WCS 417r lacking O-antigen side
chain of LPS elicit defense mechanism in Arabidopsis. These studies indicated that
LPS was not the only determining factor in ISR but other factors were also involved
and also elicitation of ISR by LPS was different in different host plants.
2.8.2 Lipopeptides
Some lipopeptides that are produced by bacteria, especially by plant growth promot-
ing rhizobacteria, have been found to induce systemic resistance in plants. Desoignies
et al. (2013) investigated the putative action of Bacillus amyloliquifaciens lipopep-
tides in achieving rhizoctonia biocontrol through the control of the virus vector
Polymyxa betae. Lipopeptides were shown to effectively induce systemic resistance
in both the roots and leaves of sugar beet, resulting in a significant reduction in P.
betae infection. Two classes of bacterial biosurfactant were found to be elicitors of
ISR: rhamnolipids and cyclic lipopeptides (cLPs). Massetolide A from Pseudomonas
fluorescens elicited ISR and enabled Phytophthora infestans on tomato to be con-
trolled (Tran et al. 2007). The ISR activity of surfactin was associated, in treated
plants, with the accumulation of antifungal compounds (phytoalexins) (Adam 2008)
and with the stimulation of the lipoxygenase pathway, leading to the synthesis of
fungitoxic oxylipins (Ongena et al. 2007). The induction of systemic resistance by
cLPs is not yet clear, but a study by Henry et al. (2011) strongly suggests that the
plant cell recognition of surfactin is mediated through interaction with lipids at the
plasma membrane level, rather than through specific protein receptors
2.8.3 Siderophores
Siderophore production is an important feature in the suppression of plant patho-

gens. Siderophores are low molecular weight compounds produced by PGPR under
iron-limited conditions. Siderophores act as determinants of ISR under iron starved
conditions. The LPS of P. fluorescens strains WCS 374 and WCS 417 were the
major determinants of ISR in radish against Fusarium wilt under iron-replete condi-
tions but not under iron-limited conditions (Leeman et al. 1996). It was found that
pyoverdin-type pseudobactin siderophore produced by these bacteria was respon-
sible for ISR. Press et al. (2001) reported the gene for catechol siderophore biosyn-
thesis in Serratia marcescens 90-166 and associated it with induced resistance in
cucumber against anthracnose. Thus, iron availability may determine the type of
PGPR determinant responsible for ISR.
48 R. Dey et al.
2.8.4 Salicylic Acid
Certain PGPR strains are capable of producing salicylic acid and are responsible for
the induction of ISR in plants (Maurhofer et al. 1994). Introduction of pchA and
pchB gene which encode for the synthesis of salicylic acid in P. fluorescens strain
P3, rendered this strain capable of salicylic acid production and significantly
improved its ability to induce systemic resistance in tobacco against TNV. Under
conditions of iron limitation, P. fluorescens strain CHAO, naturally produced
salicylic acid and also induced ISR in tobacco against TNV (Maurhofer et al. 1998).
Apart from these studies, contradictory observations have been also reported by
workers. Mutants of S. marcescens strain 90-166 lacking in salicylic acid produc-
tion were found to induce the same level of resistance in cucumber as the wild strain
in cucumber and tobacco. Press et al. (1997) working with the salicylic acid produc-
ing strain 90-166 of S. marcescens, reported induction of resistance both in wild
type tobacco and NahG-tobacco (tobacco plant transgened with NahG-gene encoding
salicylic acid hydroxylase which converts salicylic acid to catechol). Van Wees et al.
(1997) suggested that ISR induced by P. fluorescens strains WCS 417r and WCS
358r was independent of salicylic acid production in Arabidopsis.
These studies further emphasize the fact that different determinants of PGPR are
involved in the induction of systemic resistance and this resistance varies with
iron-limiting conditions, PGPR strains, host plants and their cultivars.
2.9 Formulation of PGPR
PGPR need to be formulated for large-scale application in crop fields. PGPR formu-
lation helps in enhancing the shelf life, effective application and delivery of the
bacterial cultures to the targeted site. Formulation also aids the packaging, transport
and storage of the microbial product. Suslow (1980) reported the survival of PGPR
in a dried formulation and the effectiveness of methyl cellulose in a powder formu-
lation for coating sugar beet seed. The organic carriers used for formulation devel-
opment include peat, talc, lignite, kaolinite, pyrophyllite, zeolite, montmorillonite,
alginate, press mud, sawdust and vermiculite. Talc and Peat have been used as
traditional carrier materials for effective formulations of PGPR. Vidhyasekaran and
Muthamilan (1995) reported that the population of bacteria had been stable up to
240 days in talc-based and peat-based formulations. PGPR can be effectively for-
mulated for systemic protection of crop plants against diseases. The most com-
monly used formulations of PGPR involve strains of Pseudomonas fluorescens,
P. aeruginosa, P. putida, Bacillus subtilis, B. amyloliquifaciens, etc. P. putida strain
30 and 180 survived up to 6 months in talc-based formulations. The population load
at the end of 6th month was 108 cfu/g of the product (Bora et al. 2004). Shelf life of
P. chlororaphis (PA23) and B. subtilis (CBE4) in peat carriers was retained for more
than 6 months (Nakkeeran et al. 2004).
The formulated products can be delivered through different methods of applica-

tion like seed-treatment, seed-priming, soil application, foliar application, root-dip,
sett-treatment in sugarcane, sucker-treatment in banana. Drum priming of carrot
and parsnip seeds with P. fluorescens Pf CHAO proliferated well on the seeds and
could be explored for realistic scale up of PGPR (Wright et al. 2003). Root-dipping
of seedlings has been found effective for the control of soil-borne pathogens in case
of transplanted plants. Dipping of Phyllanthus amarus seedlings in talc-based for-
mulation of B. subtilis (BSCBE4) or P. chlororaphis (PA23) for 30 min prior to
transplanting reduced stem blight of P. amarus (Mathiyazhagan et al. 2004). Foliar
application of PGPR formulations are used for controlling foliar diseases. However,
the leaf surface microclimate is subjected to frequent changes and should be consid-
ered while designing spray schedules. Preharvest foliar application of talc-based
fluorescent pseudomonads strain FP7 supplemented with chitin at fortnightly inter-
vals (5 g/L; spray volume 20 L/tree) on to mango trees from pre-flowering to fruit
maturity stage induced flowering to the maximum, reduced the latent infection by
Colletotrichum gloeosporioides beside increasing the fruit yield and quality
(Vivekananthan et al. 2004). Application of PGPR formulations with strain mix-
tures perform better than individual strains for the management of pest and diseases
of crop plants, in addition to plant growth promotion (Nakkeeran et al. 2005).
Combination of iron chelating pseudomonad strains and inducers of systemic resis-
tance suppressed Fusarium wilt of radish better than the application of individual
strains (de Boer et al. 2003).
Microencapsulation of rhizobacteria has been tried in recent years as a formula-
tion. Microcapsules of rhizobacteria consist of a cross linked polymer deposited
around a liquid phase, where bacteria are dispersed (Nakkeeran et al. 2005). The
process of microencapsulation involves mixing of gelatin polyphosphate polymer
pair (81:19 w/w) at acidic pH with rhizobacteria suspended in oil (Charpentier et al.
1999). The microencapsulation technique has not picked up in a big way. The cost
factor could be a reason. This formulation needs to be tested in large-scale field tri-
als in order to be adopted for commercial use.
2.9.1 Frequency of Application
The effectiveness of application of PGPR formulation remains for a certain time

followed by a decline over time. This determines the number of applications of
PGPR formulations needed to maintain the resistance levels in crop plants (Dalisay
and Kuc 1995). Different methods of application have different durability. Foliar
sprays of P. fluorescens formulations should be given at every 15 days intervals for
managing rice foliar diseases (Vidhyasekaran et al. 1997). Experiments conducted
by Nayar (1996) indicated that induction of defense mechanisms using P. fluores-
cens persisted up to 60 days by seed-treatment, 30 days by root-dipping and 15 days
by foliar spray. The duration of the induced resistance varies from crop to crop and
strain to strain of PGPR. The induction of resistance by PGPR persisted for 90 days
of crop growth in sugarcane (Viswanathan 1999).
50 R. Dey et al.
2.10 Challenges
Though PGPR have a potential scope in commercialization, the threat of certain

PGPR (P. aeruginosa, P. cepacia and B. cereus) to infect human beings as oppor-
tunistic pathogens has to be clarified before large-scale acceptance (Nakkeeran
et al. 2005). Potential biocontrol agents have to pass through several tests in order
to be commercially viable. After thorough, large-scale field testing at multiple
locations, differing in soil and climatic conditions, these agents can be recom-
mended for registration with the government agencies. The technology must be
transferred to some firms which can take up the mass production of the product and
finally it must be adopted by the end users i.e. the farming community. The biocon-
trol agent should not pose any threat to human and animal health and should not be
an environmental hazard.
The knowledge of ecology of the introduced PGPR strains is sometimes lacking
which may be a serious impediment to the establishment and multiplication of the
PGPR strains. The interaction of the introduced strains with the native flora and
fauna will also be a deciding factor in the success of the biocontrol agent.
PGPR formulations are usually produced at small entrepreneurial levels or at the
fermentation units of research stations, but seldom at very large industrial firms.
Hence, technologies for production of biofertilizers and biopesticides at very large
levels are not suitably developed. Moreover, IPR issues have not been dealt with suit-
ably in case of these bioproducts. Ambiguities prevail with respect to registration/
licensing/patenting of these products with the law differing in different countries.
PGPR have been discovered and researched for last two-three decades, but till
date widespread use of these products is yet to be seen. Availability of good quality
biofertilizers and biopesticides to the farmers is still an issue along with lack of
awareness about the products and their benefits. The available products have less
shelf life and should be used properly because of the biological nature of the prod-
ucts. The issue of quality control should be dealt with stringency to ensure quality
products to the end users. Very often, locally formulated products are available in
the market in plenty but quality of those products cannot be ascertained along with
tangible benefit by the farmers.
2.10.1 Constraints to Commercialization
The success of any biological agents depends on availability of quality formulation

with good shelf life, marketing and perceived acceptability and demand of the end
users. The factors limiting the successful commercialization of biological agents are
as follows:
• Reliability and authenticity of the selection of the biocontrol agent.
• Concerns about the possible ecological consequences of the intended commer-
cialization of the biocontrol PGPR.
• Lack of awareness about the biological agents and their target pathogens.
• Risk associated with the mass multiplication of the biocontrol agents in industrial
scale fermenters.
• Concerns of inconsistent performance of PGPR biocontrol agents in managing
disease and pests.
• Chances of mutation and loss of desirable traits in the biocontrol agents.
• Lack of awareness among the farmers about the potential of the biocontrol agents
in managing diseases and pests.
• Competition from the spurious locally developed biocontrol agents.
• Procedural delays in registration of the products.
• Lack of proper delivery system for biocontrol PGPR.
• Concerns about stability and quality of the products.
• Stiff challenges from environment protection agencies and inherent difficulties
in addressing their concerns.
• Perceived potential threats from few opportunistic human pathogens as bio-
control agents.
2.11 Conclusions
PGPR are beneficial to crop plants in many ways. Inoculation with PGPR results in
improvement of plant growth, control of diseases and induction of systemic resis-
tance. Tikhonovich and Provorov (2011) argued that utilization of appropriate prep-
arations of beneficial microorganisms is the most promising strategy for maintaining
agricultural productivity whilst reducing the inputs of inorganic fertilizers, herbi-
cides and pesticides and that ‘microbiology is the basis of sustainable agriculture’.
Several strains of PGPR have broad spectrum activity against multiple diseases and
also provide protection against insect and nematode pests. Endophytic PGPR have
been found beneficial in growth promotion and disease control in vegetatively prop-
agated crops. With the progress of agriculture towards sustainability, microbes will
find greater use as biocontrol agents.
However, we should be realistic with cautions. Though tall claims have been
made by researchers over the past several decades about the potential applications
of a plethora of PGPR biocontrol agents in managing a number of disease and pests
in many crop species, not much success has been achieved yet for commercializa-
tion and their application at field level. Concerted efforts will be required to demon-
strate the benefits of the PGPR biocontrol agents to the farmers so that the
eco-friendly agents can be popularized. Unless end users are convinced by the ben-
efits of the biocontrol PGPRs by conducting trials of their own, the success stories
will remain in the research laboratories only.
Acknowledgement One of the author’s (KVBRT) is grateful to the National Academy of

Sciences, India for offering financial assistance as Senior Scientist, Platinum Jubilee Fellowship.
Sincere thanks are due to Dr. (Mrs.) I K Kunwar for critically going through the manuscript.
52 R. Dey et al.
References
Abramovitch RB, Anderson JC, Martin GM (2006) Bacterial elicitation and evasion of plant innate
immunity. Nat Rev Mol Cell Biol 7:601–611
Adam A (2008) Elicitation of induced systemic resistance in tomato and cucumber and activation
of the lipoxygenase pathway by non-pathogenic rhizobacteria. PhD Thesis, University of
Liège, Belgium
Assis SMP, Mariano RLR, Michereff SJ, Coelho RSB (1996) Biocontrol of Xanthomonas camp-
estris pv. campestris on kale with Bacillus spp. and endophytic bacteria. In: Tang W, Cook RJ,
Rovira A (eds) Advances in biological control of plant diseases. China Agricultural University
Press, Beijing, pp 347–353
Bakker PAH, Pieterse CMJ, Van Loon LC (2007) Induced systemic resistance by fluorescent
Pseudomonas spp. Phytopathology 97:239–243
Bell E, Muller JE (1993) Characterization of an Arabidopsis lipoxigenase gene responsive to
methyl jasmonate and wounding. Plant Physiol 103:1133–1137
Benhamou N, Belanger RR, Paulitz TC (1996a) Induction of differential host responses by
Pseudomonas fluorescens in Ri T-DNA transformed pea roots after challenge with Fusarium
oxysporumf. sp. pisi and Pythium ultimum. Phytopathology 86:114–178
Benhamou N, Kloepper JW, Quadt-Hallmann A, Tuzun S (1996b) Induction of defense-related
ultrastructural modifications in pea root tissues inoculated with endophytic bacteria. Plant
Physiol 112:919–929
Benhamou N, Kloepper JW, Tuzun S (1998) Induction of resistance against Fusarium wilt of
tomato by combination of chitosan with an endophytic bacterial strain: ultra structure and
cytochemistry of the host response. Planta 204:153–168
Bonaldo SM, Pascholati SF, Romeiro RS (2005) Induçao de resistência: naçoês básicas e perspec-
tivas. In: Cavalcanti LS, di Piero RM, Cia P, Pascholati SF, Resende MLV, Romeiro RS (eds)
Indução de resistência em plantas a patógenos e insetos. FEALQ, Piracicaba, pp 11–28
Bong CFJ, Sikorowski PP (1991) Effects of cytoplasmic polyhedrosis virus and bacterial contami-
nation on growth and development of the corn earworm, Helicoverpa zea. J Invertebr Pathol
57:406–412
Bora T, Ozaktan H, Gore E, Aslan E (2004) Biological control of Fusarium oxysporum f. sp.
melonis by wettable powder formulations of the two strains of Pseudomonas putida. J
Bouizgarne B (2013) Bacteria for plant growth promotion and disease management. In: Maheshwari
DK (ed) Bacteria in agrobiology: disease management. Springer, Heidelberg.
doi:10.1007/978-3-642-33639-3-2
Broadway RM, Gongora C, Kain WC, Sanderson JA, Monroy JA, Bennett KC, Warner JB,
Hoffman MP (1998) Novel chitinolytic enzymes with biological activity against herbivorous
insects. J Chem Ecol 24:985–998
Bugg K, Hairston W, Riggs J (2009) Succeeding in a traditional Ag-chemical company despite the
“snake oil”/“foo-foo dust” concepts of biological-based products. In: Weller D, Thomashow L,
Loper J, Paulitz T, Mazzola M, Mavrodi D, Landa BB, Thompson J (eds) 8th International
PGPR workshop. Portland, p 17
Cameron RK, Dixon R, Lamb C (1994) Biologically induced systemic acquired resistance in
Arabidopsis thaliana. Plant J 5:715–725
Canbolat MY, Barik KK, Cakmarci R, Sabin F (2006) Effects of mineral and biofertilizers on
barley growth on compacted soil. Acta Agric Scand 56:324–332
Charpentier CA, Gadille P, Benoit JP (1999) Rhizobacteria microencapsulation: properties of
microparticles obtained by spray drying. J Microencapsul 16:215–229
Chisholm ST, Coaker G, Day B, Staskawicz BJ (2006) Host-microbe interactions: shaping the
evolution of the plant immune response. Cell 124:803–814
Dalisay RF, Kuc JA (1995) Persistence of induced resistance and enhanced peroxidase and chitinase
activities in cucumber plants. Physiol Mol Plant Pathol 47:315–327
Daniel M, Purkayastha RP (1995) Handbook of phytoalexin metabolism and action. Marcel

Dekker, New York, p 615
de Boer M, Bom P, Kindt F, Keurentjes JJB, van der Sluis I, vanLoon LC, Bakker PAHM (2003)
Control of Fusarium wilt of radish by combining Pseudomonas putida strains that have differ-
ent disease-suppressive mechanisms. Phytopathology 93:626–632
Defago G, Berling CH, Burger U, Hass D, Kahr G, Keel C, Voisard C, Wirthner P, Wuthrich B
(1990) Suppression of black root rot of tobacco and other root diseases by strains of
Pseudomonas fluorescens: potential applications and mechanisms. In: Hornby D (ed) Biological
control of soilborne plant pathogens. CAB International, Wellingford, pp 93–108
Desoignies N, Schramme F, Ongena M, Legreve A (2013) Systemic resistance induced by Bacillus
lipopeptides in Beta vulgaris reduces infection by the rhizomania disease vector Polymyxa
betae. Mol Plant Pathol 14:416–421. doi:10.1111/mpp.12008
Duffy BK, Weller DM (1995) Use of Gaeumannomyces graminis var. graminis alone and in com-
bination with fluorescent Pseudomonas spp. to suppress take-all of wheat. Plant Dis
79:907–911
Elad Y, Chet I (1987) Possible role of competition for nutrition in biocontrol of Pythium damping-
off by bacteria. Phytopathology 77:190–195
Enebak SA, Wei G, Kloepper JW (1998) Effects of plant growth-promoting rhizobacteria on lob-
lolly and slash pine seedlings. Forest Sci 44:139–144
Figueiredo MVB, Seldin L, Araujo FF, Mariano RLR (2010) Plant growth promoting rhizobacteria:
fundamentals and applications. In: Maheshwari DK (ed) Plant growth and health promoting
bacteria. Microbiology monographs 18. Springer, Berlin, pp 21–43. doi:10.1007/978-3-
642-13612-2_2
Fravel D (2007) Commercialization of biocontrol agents for use against plant pathogens. In: IX
Reunião Brasileira sobre Controle Biológico de Doenças de Plantas, Campinas, São Paulo,
Brasil, CD-ROM, pp 1–2
Frey-Klett P, Garbaye J, Tarkka M (2007) The mycorrhiza helper bacteria revisited. New Phytol
176:22–36
Glick BR (1995) The enhancement of plant-growth by free-living bacteria. Can J Microbiol
41:109–117
Glick BR, Patten CL, Holgin G, Penrose DM (1999) Biochemical and genetic mechanisms used
by plant growth promoting bacteria. Imperial College Press, London, p 267
Goel AK, Sindhu SS, Dadarwal KR (2002) Stimulation of nodulation and plant growth of chickpea
(Cicer arietinum L.) by Pseudomonas sp. antagonistic to fungal pathogens. Biol Fertil Soils
36:391–396
Goldberg R, Imberty A, Liberman M, Prat R (1986) Relationships between peroxidatic activities
and cell wall plasticity. In: Greppin H, Peneland C, Gaspar T (eds) Molecular and physiological
aspects of plant peroxidases. University of Geneva, Geneva, pp 208–220
Gray EJ, Smith DL (2005) Intracellular and extracellular PGPR: commonalities and distinctions in
the plant–bacterium signaling processes. Soil Biol Biochem 37:395–412
Halfeld-Vieira BA, Vieira JR Jr, Romeiro RS, Silva HSA, Baract-Pereira MC (2006) Induction of
systemic resistance in tomato by autochthonus phylloplane residente Bacillus cereus. Pesq
Agrop Bras 41:1247–1252
Hammerschmidt R, Kuc J (1995) Induced resistance to disease in plants. Kluwer Academic
Publishers, Dordrecht, p 182
Hammerschmidt R, Nucckles F, Kuc I (1982) Association of enhance peroxidase activity with
induced systemic resistance of cucumber to Colletotrichum largenarium. Physiol Plant Pathol
20:73–82
He P, Chintamanani S, Chen Z, Zhu L, Kunkel BN, Alfano JR, Tang X, Zhou JM (2004) Activation
of a Col1-dependent pathway in Arabidopsis by Pseudomonas syringae type III effectors and
coronatine. Plant J 37:589–602
Hemissi I, Mabrouk Y, Mejri S, Saidi M, Sifi B (2013) Enhanced defense responses of chickpea
plants against Rhizoctonia solani by pre-inoculation with rhizobia. J Phytopathol
161:412–418
54 R. Dey et al.
Henry G, Deleu M, Jourdan E, Thonart P, Ongena M (2011) The bacterial lipopeptide surfactin
targets the lipid fraction of the plant plasma membrane to trigger immune-related defense
responses. Cell Microbiol 13:1824–1837
Hoffland E, Hakulinem J, Van Pelt JA (1996) Comparison of systemic resistance induced by aviru-
lent and nonpathogenic Pseudomonas species. Phytopathology 86:757–762
Kado CI (1992) Plant pathogenic bacteria. In: Balows A, Truper HG, Dworkin M, Harder W,
Schleifer KH (eds) The prokaryotes. Springer, New York, pp 660–662
Keel C, Maurhofer M (2009) Insecticidal activity in biocontrol pseudomonads. In: Weller D,
Thomashow L, Loper J, Paulitz T, Mazzola M, Mavrodi D, Landa BB, Thompson J (eds) 8th
International PGPR workshop. Portland, p 51
Kloepper JW (1993) Plant growth-promoting rhizobacteria as biological control agents. In:
Metting B (ed) Soil microbial technologies. Marcel Dekker, New York, pp 255–274
Kloepper JW, Schroth MN, Miller TD (1980) Effects of rhizosphere colonization by plant growth
promoting rhizobacteria on potato plant development and yield. Phytopathology 70:
1078–1082
Kloepper JW, Tuzun S, Kuc J (1992) Proposed definitions related to induced disease resistance.
Biocontrol Sci Technol 2:349–351
Kloepper JW, Tuzun S, Liu L, Wei G (1993) Plant growth-promoting rhizobacteria as inducers of
systemic disease resistance. In: Lumsden RD, Waughn J (eds) Pest management: biologically
based technologies. American Chemical Society Books, Washington, DC, pp 156–165
Lazzareti E, Bettiol W (1997) Tratamento de sementes de arroz, trigo, feijão e soja com um produto
formulado a base de celulas e de metabolitos de Bacillus subtilis. Sci Agric 54:89–96
Leeman M, Van Pelt JA, Den Ouden FM, Heinsbroek M, Bakker PAHM, Schippers B (1995)
Induction of systemic resistance against Fusarium wilt of radish by lipopolysaccharides of
Pseudomonas fluorescens. Phytopathology 85:1021–1027
Leeman M, Van Pelt JA, Den Ouden FM, Heinsbroek M, Bakker PAHM, Schippers B (1996) Iron
availability affects induction of systemic resistance to Fusarium wilt of radish by Pseudomonas
fluorescens. Phytopathology 86:149–155
Li WX, Kodama O, Akatsuka T (1991) Role of oxygenated fatty acids in rice phytoalexin produc-
tion. Agric Biol Chem 55:1041–1147
Li H, Zhao J, Feng H, Huang L, Kang Z (2013) Biological control of wheat stripe rust by an endo-
phytic Bacillus subtilis strain E1R-j in greenhouse and field trials. Crop Protect 43:201–206
Liu L, Kloepper JW, Tuzun S (1995a) Induction of systemic resistance in cucumber against
Fusarium wilt by plant growth promoting rhizobacteria. Phytopathology 85:695–698
Liu L, Kloepper JW, Tuzun S (1995b) Induction of systemic resistance in cucumber against bacte-
rial leaf spot by plant growth promoting rhizobacteria. Phytopathology 85:843–847
Luz WC (2003) Combinaçaõ dos tratamentos biolo´gico e quı´mico de semente de milho.
Fitopatol Bras 28:37–40
Mariano RLR, Medeiros FHV, Albuquerque VV, Assis SMP, Mello MRF (2004) Growth-promotion
and biocontrol of diseases in fruits and ornamentals in the states of Pernambuco and Rio
Grande do Norte, Northeastern Brazil. In: Kobayashi K, Gasoni L, Terashima H (eds) Biological
control of soilborne plant diseases. JICA, Buenos Aires, pp 70–80
Mathiyazhagan S, Kavitha K, Nakkeeran S, Chandrasekar G, Manian K, Renukadevi P,
Krishnamoorthy AS, Fernando WGD (2004) PGPR mediated management of stem blight of
Phyllanthus amarus (Schum and Thonn) caused by Corynespora cassiicola (Berk and Curt)
Wei. Arch Phytopathol Plant Protect 33:183–199
Maurhofer M, Hase C, Meuwly P, Metraux JP, Defago G (1994) Induction of systemic resistance
of tobacco to tobacco necrosis virus by the root-colonizing Pseudomonas fluorescens strain
CHAO: influence of the gacA gene and of pyoverdine production. Phytopathology 84:
139–146
Maurhofer M, Reimmann C, Sacherer SP, Heeb S, Haas D, Defago G (1998) Salicylic acid biosyn-
thetic genes expressed in Pseudomonas fluorescens strain P3 improve the induction of systemic
resistance in tobacco against tobacco necrosis virus. Phytopathology 88:678–684
Medeiros FHV, Silva G, Mariano RLR, Barros R (2005) Effect of bacteria on the biology of
diamondback moth (Plutella xylostella) on cabbage (Brassica oleraceae var. capitata) cv.
Midori. An Acad Pernamb Ciênc Agronôm 2:204–212
Monteiro L, Mariano RLR, Souto-Maior AM (2005) Antagonism of Bacillus spp. against
Xanthomonas campestris pv. campestris. Braz Arch Biol Technol 48:23–29
M’Piga P, Belanger RR, Paulitz TC, Benhamou N (1997) Increased resistance to Fusarium oxys-
porum f. sp. radicis-lycopersici in tomato plants treated with the endophytic bacterium
Pseudomonas fluorescens strain 63-28. Physiol Mol Plant Pathol 50:301–320
Nakkeeran S, Kavitha K, Mathiyazhagan S, Fernando WGD, Chandrasekar G, Renukadevi P
(2004) Induced systemic resistance and plant growth promotion by Pseudomonas chlororaphis
strain PA-23 and Bacillus subtilis strain CBE4 against rhizome rot of turmeric (Curcuma longa
L.). Can J Plant Pathol 26:417–418
Nakkeeran S, Fernando WGD, Siddiqui ZA (2005) Plant growth promoting rhizobacteria formula-
tions and its scope in commercialization for the management of pests and diseases. In: Siddiqui
ZA (ed) PGPR: biocontrol and biofertilization. Springer, Dordrecht, pp 257–296
Nandakumar R (1998) Induction of systemic resistance in rice with fluorescent pseudomonads for
the management of sheath blight disease. M.Sc. Dissertation. Tamil Nadu Agricultural
University, Coimbatore (Tamil Nadu), India, p 105
Nayar K (1996) Development and evaluation of a biopesticide formulation for control of foliar
disease of rice. Ph.D. Dissertation. Tamil Nadu Agricultural University, Coimbatore (Tamil
Nadu), India, p 223
Numberger T, Brunner F, Kemmerling B, Piater L (2004) Innate immunity in plants and animals:
striking similarities and obvious differences. Immunol Rev 198:249–266
Ongena M, Jourdan E, Adam A, Paquot M, Brans A, Joris B, Aripigny J-L, Thonart P (2007)
Surfactin and fengycin lipopeptides of Bacillus subtilis as elicitors of induced systemic resis-
tance in plants. Environ Microbiol 9:1084–1090
Ongena M, Henry G, Adam A, Jourdan E, Thonart P (2009) Plant defense reactions stimulated
following perception of Bacillus lipopeptides. In: Weller D, Thomashow L, Loper J, Paulitz T,
Mazzola M, Mavrodi D, Landa BB, Thompson J (ed) 8th International PGPR workshop.
Portland, p 43
Oostendorp M, Sikora RA (1990) In vitro interrelationship between rhizosphere bacteria and
Heterodera schachtii. Rev Nematol 13(3):269–274
Otsu Y, Matsuda Y, Mori H, Ueki H, Nakajima T, Fujiwara K, Matsumoto M, Azuma N, Kakutani
K, Nonomura T, Sakuratani Y, Shinogi T, Tosa Y, Mayama S, Toyoda H (2004) Stable phyllo-
plane colonization by entomopathogenic bacterium Pseudomonas fluorescens KPM-018P and
biological control of phytophagous ladybird beetles Epilachna vigintioctopunctata (Coleoptera:
Coccinellidae). Biocontrol Sci Technol 14:427–439
Pal KK, Gardener BM (2006) Biological control of plant pathogens. Plant Health Instructor
2:1117–1142
Pechy-Tarr M, Borel N, Kupferschmied P, Turner V, Binggeli O, Radovanovic D, Maurhofer M,
Keel C (2013) Control and host-dependent activation of insect toxin expression in a root-
associated biocontrol pseudomonad. Environ Microbiol 15:736–750
Pierson LS, Thomashow LS (1992) Cloning and heterologous expression of the phenazine biosyn-
thetic locus from Pseudomonas aureofaciens. Mol Plant Microbe Interact 5:330–339
Pieterse CMJ, Van Wees SCM, Hoffland E, Van Pelt JA, Van Loon LC (1996) Systemic resistance
in Arabidopsis induced by biocontrol bacteria is independent of salicylic acid accumulation
and pathogenesis-related gene expression. Plant Cell 8:1225–1237
Pleban S, Ingel F, Chet I (1995) Control of Rhizoctonia solani and Sclerotium rolfsii in the green-
house using endophytic Bacillus spp. Eur J Plant Pathol 101:665–672
Potgieter H, Alexander M (1996) Susceptibility and resistance of several fungi to microbial lysis.
J Bacteriol 91:1526–1532
Press CM, Wilson M, Tuzun S, Kloepper JW (1997) Salicylic acid produced by Serratia marcescens
90-166 is not the primary determinant of induced systemic resistance in cucumber or tobacco.
Mol Plant Microbe Interact 10:761–768
56 R. Dey et al.
Press CM, Loper JE, Kloepper JW (2001) Role of iron in rhizobacteria mediated induced systemic
resistance of cucumber. Phytopathology 91:593–598
Qingwen Z, Ping L, Gang W, Qingnian C (1998) On the biochemical mechanism of induced resis-
tance of cotton to cotton bollworm by cutting of young seedling at plumular axis. Acta
Phytophylacica Sin 25:209–212
Raj SN, Chaluvaraju G, Amruthesh KN, Shetty HS (2003a) Induction of growth promotion and
resistance against downy mildew on pearl millet (Penninsetum glaucum) by rhizobacteria.
Plant Dis 87:380–384
Raj SN, Deepak SA, Basavaraju P, Shetty SH, Reddy MS, Kloepper JW (2003b) Comparative
performance of formulations of plant growth promoting rhizobacteria in growth promotion and
suppression of downy mildew in pearl millet. Crop Protect 22:579–588
Raja P, Una S, Gopal H, Govindarajan K (2006) Impact of bio inoculants consortium on rice root
exudates, biological nitrogen fixation and plant growth. J Biol Sci 6:815–823
Ramamoorthy V, Raguchander T, Samiyappan R (1999) Isolation, characterization and screening
fluorescent pseudomonads for managing damping-off disease of major vegetable crops. In:
Symposium on plant disease management for sustainable agriculture. Indian Phytopathological
Society, Southern Zone. CPCRI, Kayankulam, Kerala, India, p 26
Ramamoorthy V, Viswanathan R, Raghuchander T, Prakasam V, Samiyappan R (2001) Induction
of systemic resistance by plant growth promoting rhizobacteria in crop plants against pests and
diseases. Crop Protect 20:1–11
Raupach GS, Liu L, Murphy JF, Tuzun S, Kloepper JW (1996) Induced systemic resistance in
cucumber and tomato against cucumber mosaic cucumovirus using plant growth promoting
rhizobacteria (PGPR). Plant Dis 80:891–894
Ross AF (1961) Localized acquired resistance to plant virus infection in hypersensitive hosts.
Virology 14:340–358
Saikia R, Kumar R, Singh T, Srivastava AK, Arora DK, Gogoi DK, Lee MW (2004) Induction of
defense related enzymes and pathogenesis related proteins in Pseudomonas fluorescens-treated
chickpea in response to infection by Fusarium oxysporum f. sp. Ciceri. Mycobiology
32:47–52
Saikia R, Kumar R, Arora DK, Gogoi DK, Azad P (2006) Pseudomonas aeruginosa inducing rice
resistance against Rhizoctonia solani: production of salicylic acid and peroxidases. Folia
Microbiol 51:375–380
Santhi A, Sivakumar V (1995) Biocontrol potential of Pseudomonas fluorescens (Migula) against
root-knot nematode, Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 on
tomato. J Biol Control 9:113–115
Saparrat MCN, Guillen F (2005) Lignolitic ability and potential biotechnology applications of the
South American fungus Pleurotus lacioniatocrenatus. Folia Microbiol 50:155–160
Schisler DA, Slininger PJ, Behle RW, Jackson MA (2004) Formulation of Bacillus spp. for bio-
logical control of plant diseases. Phytopathology 94:1267–1271
Shan H, Zhao M, Chen D, Cheng J, Li J, Feng Z, Ma Z, An D (2013) Biocontrol of rice blast by
the phenaminomethylacetic acid producer of Bacillus methylotrophicus strain BC79. Crop
Protect 44:29–37
Shen L, Wang F, Liu Y, Qian Y, Yang J, Sun H (2012) Suppression of tobacco mosaic virus by
Bacillus amyloliquefaciens strain Ba33. J Phytopathol 161:293–294
Sikora RA (1988) Interrelationship between plant health promoting rhizobacteria, plant parasitic
nematodes and soil microorganisms. Med Fac Landbouww Rijksuniv Gent 53(2b):867–878
Sikora RA (1992) Management of the antagonistic potential in agricultural ecosystems for the
biological control of plant parasitic nematodes. Annu Rev Phytopathol 30:245–270
Singh PP, Shin YC, Park CS, Chung YR (1999) Biological control of Fusarium wilt of cucumber
by chitinolytic bacteria. Phytopathology 89:92–99
Spiegel Y, Cohn E, Galper S, Sharon E, Chet I (1991) Evaluation of a newly isolated bacterium,
Pseudomonas chitinolytica sp. nov., for controlling the root-knot nematode Meloidogyne
javanica. Biocontrol Sci Technol 1:115–125
Srivastava AK, Singh T, Jana TK, Arora DK (2001) Induced resistance and control of charcoal rot
in Cicer arietinum (chickpea) by Pseudomonas fluorescens. Can J Bot 79:787–795
Stadnik MJ (2000) Induçaõ de resisteˆncia a Oı´dios. Summa Phytopathol 26:175–177
Stock CA, Mcloughlin TJ, Klein JA, Adang M (1990) Expression of a Bacillus thuringiensis crys-
tal protein gene in Pseudomonas cepacia 526. Can J Microbiol 36:879–884
Sung KC, Chung YR (1997) Enhanced suppression of rice sheath blight using combination of
bacteria which produce chitinases or antibiotics. In: Ogoshi A, Kobayashim K, Homma Y,
Kodama F, Kondo N, Akino S (eds) Plant growth-promoting rhizobacteria-present status and
future prospects: proceedings of the fourth international workshop on plant growth promoting
rhizobacteria. Nakanishi Printing, Sapporo, Japan
Suslow TV (1980) Growth and yield enhancement of sugar beet by pelleting with specific
Pseudomonas spp. Phytopathol News 12:40
Swarnakumari N (1996) Effect of chitin amendments and Pseudomonas fluorescens (Migula) on
rice-root nematode, Hirschmanniella oryzae (Van Breda de hann, 1902) Luc and Goodey,
1963 in rice cv. ADT 38 (Oryza sativa L.). M.Sc. Dissertation. Tamil Nadu Agricultural
University, Coimbatore, India, p 99
Tan S, Jiang Y, Song S, Huang J, Ling N, Xu Y, Shen Q (2013) Two Bacillus amyloliquefaciens
strains isolated using the competitive tomato root enrichment method and their effects in sup-
pressing Ralstonia solanacearum and promoting tomato plant growth. Crop Protect 43:
134–140
Tenuta M (2003) http://www.umanitoba.ca/afs/agronomists_conf/2003/pdf/tenuta_rhizobac-
teria.pdf
Tikhonovich IA, Provorov NA (2011) Microbiology is the basis of sustainable agriculture: an
opinion. Ann Appl Biol 159:155–168
Tran H, Ficke A, Asiimwe T, Höfte M, Raaijmakers JM (2007) Role of the cyclic lipopeptide mas-
setolide A in biological control of Phytophthora infestans and in colonization of tomato plants
by Pseudomonas fluorescens. New Phytol 175:731–742
Tuzun S (2001) The relationship between pathogen-induced systemic resistance (ISR) and multi-
genic (horizontal) resistance in plants. Eur J Plant Pathol 107:85–93
Vallad GE, Goodman RM (2004) Systemic acquired resistance and induced systemic resistance in
conventional agriculture. Crop Sci 44:1920–1934
Van Loon LC, Bakker PAHM, Pieterse CMJ (1998) Systemic resistance induced by rhizosphere
bacteria. Annu Rev Phytopathol 36:453–483
Van Peer R, Niemann GJ, Schippers B (1991) Induced resistance and phytoalexin accumulation in
biological control of Fusarium wilt of carnation by Pseudomonas sp. strain WCS 417r.
Phytopathology 81:728–734
Van Wees SCM, Pieterse CMJ, Trijssenaar A, Van’T westende Y, Hartog F, Van Loon LC (1997)
Differential induction of systemic resistance in Arabidopsis by biocontrol bacteria. Mol Plant
Microbe Interact 10:716–724
Velazhahan R, Samiyappan R, Vidhyasekaran P (1999) Relationship between antagonistic activi-
ties of Pseudomonas fluorescens isolates against Rhizoctonia solani and their production of
lytic enzyme. J Plant Dis Prot 106:244–250
Vessey JK (2003) Plant growth-promoting rhizobacteria as biofertilizers. Plant Soil 255:571–586
Vidhyasekaran P, Muthamilan M (1995) Development of formulations of Pseudomonas fluores-
cens for control of chickpea wilt. Plant Dis 79:782–786
Vidhyasekaran P, Muthamilan M (1999) Evaluation of powder formulation of Pseudomonas fluo-
rescens Pf1 for control of rice sheath blight. Biocontrol Sci Technol 9:67–74
Vidhyasekaran P, Rabindran R, Muthamilan M, Nayar K, Rajappan K, Subramanian N, Vasumathi
K (1997) Development of powder formulation of Pseudomonas fluorescens for control of rice
blast. Plant Pathol 46:291–297
Viswanathan R (1999) Induction of systemic resistance against red rot disease in sugarcane by
plant growth promoting rhizobacteria. Ph.D. Dissertation. Tamil Nadu Agricultural University,
Coimbatore (Tamil Nadu), India p 175
58 R. Dey et al.
Viswanathan R, Samiyappan R (1999a) Induction of systemic resistance by plant growth promoting

rhizobacteria against red rot disease caused by Colletotrichum falcatum Went in sugarcane.
Proc Sugar Tech Assoc India 61:24–39
Viswanathan R, Samiyappan R (1999b) Identification of antifungal chitinase from sugarcane.
ICAR News 5:1–2
Vivekananthan R, Ravi M, Ramanathan A, Samiyappan R (2004) Lytic enzymes induced by
Pseudomonas fluorescens and other biocontrol organisms mediate defense against the anthrac-
nose pathogen in mango. World J Microbiol Biotechnol 20:235–244
Wang W, Chen L, Wu H, Zang H, Gao S, Yang Y, Xie S, Gao X (2013) Comparative proteomic
analysis of rice seedlings in response to inoculation with Bacillus cereus. Lett Appl Microbiol
56(3):208–215. doi:10.1111/lam.12035
Wei G, Kloepper JW, Tuzun S (1991) Induction of systemic resistance of cucumber to
Colletotrichum orbiculare by select strains of plant growth promoting rhizobacteria.
Wei L, Kloepper JW, Tuzun S (1996) Induced systemic resistance to cucumber diseases and
increased plant growth by plant growth promoting rhizobacteria under field conditions.
Wright B, Rowse HR, Whipps JM (2003) Application of beneficial microorganisms to seeds dur-
ing drum priming. Biocontrol Sci Technol 13:519–614
Wyss U (1989) Video assessment of root cell responses to Dorylaimid and Tylenchid nematodes.
In: Veech JA, Dickson DW (eds) Vistas on nematology. Society of Nematologists, Inc.,
Hyattsville, pp 211–220
Zdor RE, Anderson AJ (1992) Influence of root colonizing bacteria on the defense responses in
bean. Plant Soil 140:99–107
Zehnder G, Kloepper J, Yao C, Wei G (1997) Induction of systemic resistance in cucumber against
cucumber beetles (Coleoptera: Chrysomelidae) by plant growth promoting rhizobacteria.
J Econ Entomol 90:391–396
Chapter 3
Understanding the Mechanism Involved
in PGPR-Mediated Growth Promotion
and Suppression of Biotic and Abiotic
Stress in Plants
Siddapura Ramachandrappa Niranjana and Puttaswamy Hariprasad
3.1 Introduction
Soil is a complex living food web, where a variety of microorganisms such as

bacteria, actinomycetes, fungi, protozoa, and algae reside and are involved in key
environmental processes such as degradation of organic matter and biogeochemical
cycling of nutrients through which they participate in maintaining health and pro-
ductivity of soil (Barea et al. 2004). As the plant depends on soil throughout their
life for anchorage, water, minerals, and nutrition, soil property plays a key role in
determining plant health. Under natural conditions, biotic and abiotic constituents
of rhizosphere are different from that of bulk soil. Rhizosphere is defined by Hiltner
(1904) as volume of soil surrounding the root, influenced chemically, physically,
and biologically by the presence of living plant roots. According to Uren (2000),
rhizosphere is longitudinal and radial gradients occurring with expanding root
growth, nutrient and water uptake, exudation, and subsequent microbial growth.
The extension of rhizospheric zone may vary with soil type, plant species and age,
and other biotic and abiotic factors. Rhizosphere is highly favorable habitat for the
proliferation of microorganisms and exerts a potential impact on plant health and
soil fertility (Sorensen 1997). Root exudates are complex mixtures of carbon con-
taining compounds (Carvalhais et al. 2011), which serve as primary source of nutri-
ents, and support the dynamic growth and activities of various microorganisms
within the vicinity of the roots. Hence, the structure and diversity of microbial pop-
ulation in the rhizosphere differs significantly from that of soil-borne microbial
population (Mavingui et al. 1992; Maloney et al. 1997).
S.R. Niranjana, M.Sc., M.Phil., Ph.D. (*)

Department of Biotechnology, University of Mysore, Mysore 570 006, Karnataka, India
e-mail: niranjanasr@rediffmail.com
P. Hariprasad, M.Sc., M.Phil., Ph.D.
Food Microbiology Department, Central Food Technological Research Institute,
Mysore, Karnataka, India

60 S.R. Niranjana and P. Hariprasad
Root-colonizing microorganisms could be free-living, parasitic, or saprophytic

and their diversity remains dynamic with a frequent shift in community structure and
species abundance (Kunc and Macura 1988) and is mainly attributed to the quantity
and composition of root exudates. An important group of bacterial communities that
exert beneficial effects on plant growth upon root colonization were first defined by
Joseph Kloepper and Milton Schroth and termed as plant growth-promoting rhizo-
bacteria (PGPR) (Kloepper and Scroth 1978). These free-living and root-colonizing
bacteria, when applied to seeds or roots, enhance the growth of the plant, reduce the
damage from phytopathogens, and impart resistance against abiotic stress. Hence
the possible way of utilizing these rhizobacteria to enhance agricultural productivity
is exploited (Kloepper et al. 1991). Basically, PGPR are defined by three intrinsic
characteristics (Barea et al. 2005): (1) they must be able to colonize the root; (2) they
must survive and multiply in microhabitats associated with the root surface, in com-
petition with other microbiota, at least for the time needed to express their plant
promotion/protection activities; and (3) they must promote plant growth.
Strains of the genera such as Aeromonas, Agrobacterium, Alcaligens, Azoarcus,
Azospirillum, Azotobacter, Arthrobacter, Bacillus, Cellulomonas, Clostridium,
Enterobacter, Erwinia, Flavobacterium, Gluconacetobacter, Klebsiella,
Microbacterium, Micromonospora, Panibacillus, Pseudomonas, Rhizobia, Serratia,
Streptomyces, and Xanthomonas have been identified as PGPR, while the search for
additional strains is still continued (Kloepper et al. 1989; Okon and Labandera-
Gonzalez 1994; Glick et al. 1999; Murphy et al. 2003; Cezon et al. 2003; Lucy et al.
2004; Dey et al. 2004; Raj et al. 2004; Jaizme-Vega et al. 2004; Joo et al. 2004;
Tripathi et al. 2005; Tahmatsidou et al. 2006; Aslantas et al. 2007; Hariprasad and
Niranjana 2009; Hariprasad et al. 2009, 2013; Niranjana and Hariprasad 2012;
Kumar et al. 2014). Each plant may harbor more than one type of PGPR at the same
time and the same niche or at different time and different niche during its growth
period (Tilak et al. 2005; Czaban et al. 2007; Kumar et al. 2014). Among the diverse
range of PGPR identified, species of Pseudomonas and Bacillus have a wide distri-
bution and are the most extensively studied group. Recent developments in metage-
nomics, i.e., the study of collective genome of an ecosystem provide insights of
bacterial diversity in the rhizosphere including the cultivable and non-culturable
rhizobacteria which revealed the involvement of non-culturable rhizobacteria in
affecting plant health (Van Overbeek 2013).
Application of PGPR in agriculture improves plant performance under various
kinds of stress environments and consequently, enhance yield by exerting various
beneficial traits, also reduces the need for chemical fertilizers and pesticides, and
contribute for sustainable agricultural production. Several mechanisms have been
postulated to explain how PGPR stimulate plant growth which includes (Fig. 3.1)
(1) the ability to produce or change the concentration of the plant hormones, indole
acetic acid (IAA) (Mordukhova et al. 1991; Vessey 2003), gibberellic acid
(Gutierrez-Mannero et al. 2001), cytokinins (Tien et al. 1979), ethylene (Arshad
and Frankenberger 1991; Glick et al. 1995), and volatiles (Ryu et al. 2004); (2)
asymbiotic nitrogen fixation (Boddey and Dobereiner 1995; Kennedy et al. 1997);
(3) antagonism against phytopathogenic microorganisms by the production of
3 Understanding the Mechanism Involved in PGPR-Mediated Growth Promotion… 61
Fig. 3.1 Different mechanisms involved in PGPR-mediated growth promotion and suppression of
biotic and abiotic stress in plants
siderophore (Wang et al. 1993; Raaijmakers et al. 1995), antibiotics (Ongena et al.
1999; Raaijmakers et al. 1997, 2002), Chitinase (Hallmann et al. 1999; Manjula and
Podile 2001), β-1,3-glucanase (Tanaka and Watanabe 1995), and cyanide (Voisard
et al. 1989); and (4) solubilization of mineral phosphate and other nutrients (de
Freitas et al. 1997; Gyaneshwar et al. 2002). Induced systemic resistance (ISR) is
one of the most studied mechanisms through which the rhizobacteria suppress the
infection and disease development by elevating the host resistance mechanism
against wide range of phytopathogens (Dobbelaere et al. 2003). Similarly, induced
systemic tolerance (IST) has been proposed for PGPR-induced physiological and
biochemical changes in plants that result in enhanced tolerance to abiotic stress
(Yang et al. 2009). PGPR-mediated improvement of plant health is through express-
ing one or more traits individually or simultaneously which depends on various
biotic and abiotic variables at rhizosphere (Glick et al. 1999; Rana et al. 2011;
Hariprasad et al. 2011, 2013).
3.2 Root Colonization and Competition

for Space and Nutrition
As the name indicates, only those bacteria residing in rhizosphere and rhizoplane
are considered as rhizobacteria. Hence, it is reasonable to assume that at first PGPR
must colonize the rhizosphere of the host plant to exhibit its beneficial effect
efficiently. This basic stage in early life of PGPR is crucial which determines its fate
in rhizosphere and also its effectiveness in improving plant health. Recent research
has indicated that some of these PGPR entered the root and established endophytic
association in stem, root, tubers, and other organs (Bell et al. 1995; Compant et al.
2005; Gray and Smith 2005). Researchers conducted various experiments under
laboratory, greenhouse, and field conditions by using different techniques to reveal
the mechanism of root colonization and factors affecting on it. According to their
findings, colonization of rhizosphere by PGPR is not uniform and the size, compo-
sition, and distribution of PGPR community are determined by several abiotic and
biotic factors such as soil pH, mineral, nutrient, and water content; species, geno-
type, and physiological state of the plant; difference in composition and amount of
root exudates; and the presence of other microbial species (Yang and Crowley 2000;
Goddard et al. 2001; Marschner and Timonen 2006; Albareda et al. 2006).
The amount and composition of exudates is largely affected by multiple factors
such as plant species, plant age, root region, pH, temperature, surrounding microbes,
and others (Rovira 1969; Baker 1987; Meharg and Killham 1995). About 49 % of
photosynthetically fixed C is released into external environment in rhizosphere as
root exudates (Kennedy 1999) which offers a carbon-rich diet to the rhizosphere
microorganisms which includes organic acids (citrate, malate, succinate, pyruvate,
fumarate, oxalate, and acetate) and sugars (glucose, xylose, fructose, maltose,
sucrose, galactose, and ribose) constitute the main course, whereas variable amounts
of α-aminoacids, nucleobases and vitamins (thiamin and biotin), fatty acids,
enzymes, and sloughed off cells are also reported in root exudates (Rovira 1969;
Baker 1987; Lugtenberg and Dekkers 1999). Some root exudates can also be effec-
tive as antimicrobial agents and some bacteria can utilize the compound of root
exudates better than others, thus give ecological niche advantage to organisms that
have adequate mechanism to survive in such environment (Walker et al. 2003; Bais
et al. 2004, 2006; Barriuso et al. 2008).
Rhizobacteria may colonize the rhizosphere uniformly or its distribution may be
restricted to certain regions of root. In naturally grown wheat plant, Pseudomonas
spp. were relatively evenly distributed along the length of the root (Fig. 3.2), whereas
filamentous bacteria occurred mostly in the area of the root cap and the mature zone
of the root (Watt et al. 2006), and free-living diazotrophic bacteria colonize on root
elongation zones and root hairs followed by the formation of biofilm (Assmus et al.
1995). Kluyvera ascorbata failed to colonize the growing tips of canola seedlings
and was found only in upper two-third part of root surface (Ma et al. 2001).
Paenibacillus polymyxa preferentially colonizes the young growing root tips of
Arabidopsis thaliana seedlings (Timmusk et al. 2005). Bacillus sp. was reported to
colonize spermosphere; on germination of seeds bacteria moved to the emerging
radical and colonized the basal portion of the roots close to the seed-root junction,
but they failed to colonize the growing root tips. Scanning electron microscope
(SEM) observations revealed that the bacterial cells were arranged linearly and lat-
erally on the growing root axis (Ugoji et al. 2005).
Chemotaxis of the bacteria towards root exudates plays a major role in the colo-
nization of roots (Lugtenberg et al. 1996). According to Scher et al. (1985), only
Fig. 3.2 Root colonization

bioassay—aggressive root
colonization by Pseudomonas
aeruginosa strain 2apa (left
side) and Control (right side)
motile strains of rhizobacteria in the presence of root exudates are able to colonize
roots. Further, this phenomenon was evidenced by studies with CheA mutants of
Pseudomonas fluorescens, defective in flagella-driven chemotaxis but still motile
appeared to be impaired in competitive root tip colonization on tomato (de Weert
et al. 2002). Irrespective of their motility, rhizobacteria can also move along the root
by adhering to the expanding root surface (Mawdsley and Burns 1994), they are
assisted by water percolation at the rhizosphere (Bowers and Parke 1993).
Specificity of the root exudates towards the rhizobacteria was studied by
Mandimba et al. (1986). They demonstrated that bacterial strains isolated from
maize rhizosphere showed chemotaxis towards maize root exudates but rhizobacte-
rial isolates from rice did not respond to maize root exudates. Similarly, root exu-
dates induce stronger chemotactic responses of PGPR as compared to other bacteria
present in the rice rhizosphere (Bacilio-Jimenez et al. 2003). Our early experiments
revealed that the rhizobacteria isolated from tomato rhizosphere are able to colonize
similar group of plants such as chilli and brinjal (unpublished). Also, rhizobacteria
isolated from the rhizospheric soil of Raulwolfia spp. from Western Ghat regions of
Karnataka, India successfully colonized the tomato roots improved plant growth
(Kumar et al. 2014).
It is now well established that rhizobacteria in its natural environment persist by
forming biofilms. A number of microbial cell structures such as flagella or type IV
pili, membrane polysaccharides, lipopolysaccharides (LPS) in particularly the
O-antigen chain, and outer membrane proteins including adhesins are important in
root colonization and biofilm formation (Vesper 1987; Skvortsov and Ignatov 1998;
Dekkers et al. 1998; Vande Broek and Vanderleyden 1995; Lugtenberg et al. 2001;
Tans-Kersten et al. 2001; Hinsa et al. 2003). Bacterial cells adhere and proliferate
on the surface of root as a colony and subsequently form biofilm as an extracellular
polysaccharide matrix. Biofilm is a highly structured surface attached communities
of cells encased in a self-produced extracellular matrix (Costerton et al. 1995). This
process of colonization consists of the following steps: (1) transport of microbes to
the surface, (2) initial attachment, (3) formation of microcolonies, and (4) biofilm
maturation (de Weert and Bloemberg 2006). In the case of Bacillus subtilis, biofilm
formation was induced by chemical signal released by plant root to which bacteria
respond by stimulating biofilm synthesis. Strains with reduced ability or mutants
for biofilm formation showed poor root colonization property and also reduced
biocontrol activity (Chen et al. 2012). High levels of surfactin (antimicrobial agent)
production were observed during colonization and biofilm formation (Nihorimbere
et al. 2012). Surfactin produced by rhizobacteria act as biosurfactant and help in
bacterial motility and root colonization (Bais et al. 2004). Bacillus subtilis mutants
lacking surfactin were severely defective in swarming motility and showed poor
root colonization in comparison with wild type (Kearns et al. 2004; Angelini et al.
2009).
In addition to the above said factors, density-dependent signalling in bacteria,
i.e., “quorum sensing,” also plays a major role in determining the density of root-
colonizing bacteria in rhizosphere and regulate biofilm formation (Pierson et al.
1998). Acyl homoserine lactones (AHLs) are frequently reported as quorum sens-
ing molecules produced by Gram-negative bacteria (Whitehead et al. 2001). In the
case of Gram-positive bacteria it is protein/polypeptides, and c-butyrolactone in
actinomycetes (Yamada and Nihira 1998). Plant roots are also reported to be capa-
ble of secreting compounds that may be structurally similar to Gram-negative AHLs
(Toth et al. 2004; Teplitski et al. 2000) which evidenced that plants are also able to
regulate the bacterial density at rhizosphere.
Apart from root colonization, PGPR should be able to compete with native
microbial populations for space and available nutrients in the rhizosphere, through
which it limits the growth and multiplication of other saprophytic and pathogenic
microbes (Fig. 3.3) (Walsh et al. 2001; Whipps 2001; Bashan and de-Bashan 2005).
Broadly, PGPR—other microbes competition at rhizosphere could be categorized
as direct and indirect way. Indirect way involves occupying the space in the rhizo-
sphere with some special aid such as biofilm formation, utilization of available
nutrients efficiently (siderophore production for iron uptake), and breakdown of
some complex form of nutrition into simple form and its uptake (phosphate solubi-
lization). Direct way includes suppression of growth and multiplication of other
microbes by producing antibiotics, lytic enzymes, etc. These direct and indirect
mechanisms may express differentially which depends on various biotic and abiotic
factors at rhizosphere, through which they successfully colonize the host roots and
compete with other saprophytic or pathogenic microbes (Radjacommare et al. 2004;
Yasmin et al. 2009; Sayyed and Chincholkar 2009; Chaiharn et al. 2009; Ramos-
Solano et al. 2010; Hariprasad et al. 2011).
Fig. 3.3 Root colonization
PGPR
and competition for space
and nutrition between PGPR
and phytopathogens at
PGPR PGPR PGPR PGPR

rhizosphere
Phytopathogen
ROOT
Food and Nutrition
3.3 Phytohormones
Promotion of root growth is one of the major markers by which the beneficial effect
of PGPR is measured. Phytohormones produced by PGPR within the vicinity of
root stimulate profuse root growth, whether by elongation of primary roots or by
proliferation of lateral and adventitious roots. The increased surface area of root
improves the water, minerals, and nutrition-uptake capacity of plant from a large
volume of soil, strengthens anchorage capacity thus establishing the chance of
greater survival. Most of the PGPRs are known to produce IAA (Gaudin et al. 1994;
Asghar et al. 2002), cytokinins (Vessey 2003), and gibberellins (Glick et al. 1998;
Khan et al. 2006).
3.3.1 Indole Acetic Acid
The most common, best characterized, and physiologically most active auxin in
plants is IAA. More specifically, IAA is a phytohormone controlling many impor-
tant physiological process such as cell division, cell enlargement, tissue differentia-
tion, apical dominance, root initiation, response to light and gravity in plants,
initiation of adventitious and lateral roots, and both cell and vascular differentiation
(Salisbury 1994; Taize and Zeiger 2006). Bacterial auxin production was normally
associated with pathogenesis, especially with bacterial gall formation as observed
in Agrobacterium tumefaciens (Kaper and Veldstra 1958). However it became
apparent that many of the phytopathogens (not only gall inducing) as well as PGPR
have the ability to synthesize IAA and through which it alters the architecture of
root in beneficial way.
Fig. 3.4 Expression of

rhizobacterial ipdC gene by
lower concentration of IAA
released from root and
biosynthesis of IAA by
rhizobacteria using
tryptophan as precursor
present in the root exudates
It has been estimated that 80 % of bacteria isolated from the rhizosphere can
produce IAA (Patten and Glick 1996) and are more active in producing IAA than
those from root-free soil because of rich supplies of substrates exuded from roots
(especially tryptophan) (Kampert et al. 1975; Strzelczyk and Pokojska-Burdziej
1984; Martens and Frankenberger 1994; Kravchenko et al. 2004). Further, a positive
correlation between L-tryptophan concentration and IAA production by different
PGPR strains and their ability to increase the plant growth was reported (Asghar
et al. 2002; Idris et al. 2007; Hariprasad et al. 2011).
The host plant can take an active part in the regulation of microbial IAA biosyn-
thesis (Brandl and Lindow 1997). Low concentration of IAA released from plant in
root exudates is sufficient to induce the expression of ipdC gene, which increases
the rhizobacterial synthesis of IAA (Fig. 3.4) (Dobbelaere et al. 1999; Vande Broek
et al. 1999). IAA biosynthesis in diverse bacteria is also related to environmental
stress including acidic pH, somotic and matrix stress, and carbon limitation (Brandl
and Lindow 1997; Patten and Glick 2002; Vande Broek et al. 2005).
There have been at least five different IAA biosynthetic pathways proposed
using tryptophan as precursor (Patten and Glick 1996) which are as follows: (1)
Indole-3-acetamide pathway (Morris 1995; Theunis et al. 2004), (2) Indole-3-
pyruvate pathway (Patten and Glick 2002), (3) Tryptamine pathway (Hartmann
et al. 1983; Perley and Stowe 1966), (4) Tryptophan side chain oxidase pathway
(Oberhansli et al. 1991), and (5) Indole-3-acetonitrile pathway (Nagasawa et al.
1990; Kobayashi et al. 1993). Tryptophan-independent pathway was demonstrated
in case of Azospirillum brasilense in the absence of tryptophan (Prinsen et al. 1993),
but the enzymes involved in this pathway is yet to be identified. Indole-3-pyruvate
pathway is described in a wide range of bacteria including pathogenic and beneficial
bacterial group such as PGPR.
Several earlier research studies indicate that the IAA producing rhizobacteria
had the potential to improve plant health which includes root growth, shoot
growth, biomass, branches/tillers, flowering, pods/grains, and (Xie et al. 1996;
Asghar et al. 2002; Patten and Glick 2002; Vessey 2003; Araujo et al. 2005; Kaymak
et al. 2008). Up to 50 % increase in root growth was reported in plants treated with
IAA producing strains in comparison with mutants defective in IAA production
(Patten and Glick 2002; Idris et al. 2007).
The impact of exogenous auxin on plant development ranges from positive to
negative effects. The consequence for the plant is usually a function of the amount
of IAA produced that is available to the plant and the sensitivity of the plant tissue
to changes in IAA concentration. Exogenously supplied IAA above certain limit is
known to suppress the root growth (Mulkey et al. 1982). Higher inoculum of IAA
producing bacteria and IAA overproducing mutants were found to be suppressing
growth of host root by activating ethylene biosynthesis pathway, and is achieved by
inducing the expression of 1-aminocyclopropane-1-carboxylate acid (ACC) syn-
thase enzyme in roots (Xie et al. 1996; Glick et al. 1998; Glick 2005; Spaepen et al.
2008). However few strains of rhizobacteria also have the ability to produce ACC
deaminase which degrades ACC at normal IAA production level besides converting
ACC to ammonia and α-ketobutyrate and utilize ACC as nitrogen source (discussed
in Sect. 3.11.3).
3.3.2 Gibberellins
Gibberellins (GA) are tetracyclic diterpenoid acids that are involved in a number of
developmental and physiological processes in plants. Gibberellins induced inter-
node elongation in certain types of plants, such as dwarf and rosette species and
grasses. Other physiological effects of gibberellins include changes in juvenility
and flower sexuality, promotion of fruit set, fruit growth, and seed germination
(Davies 1995; Crozier et al. 2000; Taize and Zeiger 2006). Gibberellins are also
reported to be produced by several bacteria (Atzorn et al. 1988; Dobert et al. 1992;
Janzen et al. 1992; Bastian et al. 1998; Gutierrez-Mannero et al. 2001).
The production of GA-like substances by rhizobacteria, as revealed by bioassay,
was first described in Azospirillum brasilense (Tien et al. 1979). Further in 1988, it
was confirmed by GC-MS analysis (Atzorn et al. 1988). Pectobutrazol-induced
dwarf phenotype in alder (Alnus glutinosa) is reversed by spraying culture filtrate of
PGPR containing GA (Gutierrez-Mannero et al. 2001). Involvement of rhizobacterial
produced GA in enhancing plant growth was further evidenced by studies of Cassan
et al. (2001). Where, A. lipoferum USA5b and A. brasilense Cd promoted sheath
elongation of GA-deficient dwarf rice, when supplied with GA precursors.
Application of GA-positive rhizobacterial strain also was found to increase the
endogenous level GA in plants. Measurement of GA content using deuterated inter-
nal standards, and GCMS analysis, showed increased levels of GA1, GA19, GA20,
and GA44 in nodules formed by the rhizobacterial strains that enhanced growth
(Dobert et al. 1992).
3.3.3 Cytokinins
Cytokinins are N6-substituted aminopurines which, when applied to plants,

influence their physiological and developmental processes (Salisbury and Ross
1992). Cytokinins control the cell division, cell cycle, and stimulate developmental
processes in plants (Srivastava 2002), also affect leaf senescence, nutrient mobiliza-
tion, apical dominance, the formation and activity of shoot apical meristems, floral
development, breaking of bud dormancy, and seed germination. Cytokinins also
appear to mediate many aspects of light-regulated development, including chloro-
plast differentiation, the development of autotrophic metabolism, and leaf and coty-
ledon expansion (Werner et al. 2001; Taize and Zeiger 2006; Oldroyd 2007).
Cytokinin production by rhizobacteria was reported by several researchers (Ali
et al. 2009; Horemans et al. 1986; Nieto and Frankenberger 1989; Taller and Wong
1989; Senthil Kumar et al. 2009; de Salamone et al. 2001). It has been reported that
cytokinins produced by these microorganisms that live in close proximity to the
roots also influence plant growth and development (Arshad and Frankenberger
1993). These microorganisms produce and secrete substantial amounts of cytoki-
nins and/or cause the plant cells to synthesize plant hormones, including cytokinins
(Akiyoshi et al. 1987).
Azospirillum brasilense, a cytokinin producing strain has been reported to
enhance cell division in root tips of inoculated wheat (Molina-Favero et al. 2007).
Application of bacterial extracts containing cytokinins (zeatin and zeatin riboside)
enhanced cell division, fresh weight, and cotyledon size in dark as well as light
grown cucumber cotyledons (Hussain and Hasnain 2009). Studies with cytokinin
mutant strains CNT1 and CNT2 to promote the growth of radish plants was impaired
compared to wild strain Pseudomonas fluorescens G20-18, which evidenced the
involvement of bacterial produced cytokinin in plant growth promotion (Gracia de
Salamone 2001).
3.3.4 Abscisic Acid
Abscisic acid (ABA) is a 15-carbon compound that resembles the terminal portion of
some carotenoid molecules which plays primary regulatory roles in the initiation and
maintenance of seed and bud dormancy and in the plant’s response to stress, particu-
larly water stress. In addition, ABA influences many other aspects of plant develop-
ment by interacting, usually as an antagonist, with auxin, cytokinin, gibberellin,
ethylene, and brassinosteroids (Ferguson and Lessenger 2006; Taize and Zeiger 2006).
Rhizobacteria such as Corynebacterium sp. (Hasegawa et al. 1984) and
Azospirillum brasilense (Cohen et al. 2008) are reported to be capable of synthesiz-
ing ABA in defined culture media. Although these bacteria are known to synthesize
ABA, but the biochemical mechanism involved is yet to be investigated completely,
as only the presence of carotenoid cleavage oxygenase homologues was reported
(Marasco and Schmidt-Dannert 2008). Azospirillum spp. isolated from water-stressed

conditions produced more ABA than strains isolated from well-watered plants.
Further, rhizobacterial ability to produce ABA was increased, especially when
exposed to osmotic stress (Cohen et al. 2008; Ilyas and Bano 2010).
Application of ABA producing PGPR can potentially alter the plant ABA con-
centration (Cohen et al. 2009). This change in ABA concentration may be due to
bacterial ABA or plants are induced to produce ABA. Alleviated level of ABA in
plant can also enhance the tolerance of plants to adverse environmental conditions
like drought, salinity, and temperature and stimulate stomatal closure to limit tran-
spirational water loss (Boiero et al. 2007; Cohen et al. 2009).
3.3.5 Ethylene
Ethylene, a gaseous plant hormone, acts as a messenger of biotic and abiotic stresses,
acting as a negative regulator of plant growth. Ethylene also affects ripening and
senescence in plants (Ferguson and Lessenger 2006; Taize and Zeiger 2006). Some
bacteria are also able to produce ethylene when grown in medium supplemented
with methionine (Boiero et al. 2007). But studies regarding rhizobacterial produced
ethylene in suppressing plant growth are yet to be done. Although rhizobacteria are
known to produce ethylene, recent attention has focused on rhizobacterial mediated
decrease in plant ethylene level via the enzyme ACCd that degrades the ethylene
precursor ACC. But none of the rhizobacteria known to produce ACCd activity was
found to produce ethylene (Glick et al. 1998).
3.4 Volatiles in Growth Promotion
Plant growth promotion by volatiles produced by PGPR is the most recently identi-
fied mechanism. Ryu et al. (2003) demonstrated that PGPR strains release different
volatile blends which stimulate plant growth. Volatiles produced by Bacillus subtilis
and B. amyloliquefaciens were identified as 3-hydroxy 2-butanone and 2,
3-butanediol, which stimulated the growth of Arabidopsis thaliana in in vitro exper-
iments as observed by an increase in the total leaf surface area. As evidenced by the
studies of Lee et al. (2012), growth promotion elicited by bacterial volatiles is medi-
ated by the ET and or cytokinin signalling pathways.
3.5 Biological Nitrogen Fixation
Nitrogen is an essential component of all life forms and is a paradox of nature

because it cannot be assimilated by plants unless it is reduced to ammonia by diazo-
trophic microorganisms. PGPR strains are reported to fix atmospheric N2 in soil
(Antoun et al. 1998; Riggs et al. 2001) and further it can be supplied to the associated
host plant (Barbara and Thomas 1998). The process involves nitrogenase enzymes
that reduce gaseous nitrogen into ammonia (NH3) and ammonium (NH4+) (Chatterjee
et al. 1997). Biological N2 fixation by rhizobia and associative diazotrophic bacteria
is a spontaneous process and one of the widely studied mechanisms by which plants
benefit from the interacting partners. The bacteria benefit the plants by fixing N2 in
exchange for fixed carbon either provided directly to the bacteria or indirectly by
releasing carbon as root exudates.
Symbiotic N2 fixation to legume crops with the inoculation of effective PGPR is
well known (Dobereiner 1997; Barea et al. 2005; Esitken et al. 2006). Various rhi-
zobacterial species like Azotobacter spp. Bacillus spp. and Beijerinckia spp. have
the capacity to fix atmospheric N2 symbiotically. It is well established that N2 is the
major nutrient which determines the life in a particular region and N2 fixed by the
microbes is the only known mode of biological nitrogen fixation. Hence, the phe-
nomenon of biological nitrogen fixation is well studied and many review articles
and monographs are published which cover specific area (Gualtieri and Bisseling
2000; Schultze and Kondorosi 1998; Sessitsch et al. 2002; Franche et al. 2009).
On the other hand, nonsymbiotic biological N2 fixation is basically carried out by
free-living diazotrophs, belonging to the genera like Azoarcus (Reinhold-Hurek
et al. 1993), Azospirillum (Bashan and de-Bashan 2010), Burkholderia (Estrada-de
los Santos et al. 2001), Gluconacetobacter (Fuentes-Ramírez et al. 2001), and
Pseudomonas (Mirza et al. 2006). Also even many PGPR showed their ability to fix
N2, but there is little evidence that these PGPR stimulate the growth of a specific
host plant using nitrogenase activity (Vessey 2003). As our review is focused
towards the mechanisms, this section is not included here as its mechanism is poorly
understood.
3.6 Phosphate Solubilization
Phosphorus (P) is the second most important plant nutrient available in soil after
nitrogen. Phosphate in the soil solution is readily absorbed by plant roots via an
H+–HPO42− symporter and incorporated into a variety of organic compounds, includ-
ing sugar phosphates, phospholipids, and nucleotides (Taize and Zeiger 2006).
Though soils usually contain high amount of total phosphorous, most of the phos-
phorous occurs in an insoluble form as iron and aluminum phosphates in acidic soils
and as calcium phosphates in alkaline soils (Goldstein 1986). However, organic
matter on the other hand, is an important reservoir of immobilized phosphate that
accounts for 20–80 % of soil phosphorous (Richardson 2001) and only a small
portion is available to plants. Other organic P compounds in soil are in the form of
phosphomonoesters, phosphodiesters including phospholipids and nucleic acids,
and phosphotriesters.
Many of these P compounds are high molecular-weight material which must first
be bioconverted to soluble ionic phosphate (HPO42− and H2PO4−) which can be
assimilated by plants (Beever and Burns 1980; Glass 1989; Goldstein 1994). The
ability of soil bacteria to solubilize complex form of P is frequently reported and
common in the rhizosphere than in the bulk non-rhizospheric soil (Reyes et al. 2006).
Inorganic P is solubilized by the action of rhizobacterial produced organic and
inorganic acids in which hydroxyl and carboxyl groups of acids chelate cations (Ca,
Al, and Fe) and decrease the pH in basic soils (Kpomblekou and Tabatabai 1994).
Carboxylic acids solubilize Al-P and Fe-P through direct dissolution of mineral
phosphate as a result of anion exchange of PO43+ by carboxylic anions, or by chela-
tion of both Fe and Al ions associated with phosphate (Khan et al. 2007; Henri et al.
2008). Phosphate from Ca-P complex results from the combined effect of pH
decrease and carboxylic acids synthesis. Carboxylic anions produced have high
affinity to calcium, solubilize more phosphorus than acidification alone (Staunton
and Leprince 1996). Proton release can also decrease P sorption upon acidification
which increases H2PO4− in relation to HPO42− having higher affinity to reactive soil
surfaces (Goldstein 1994; Illmer and Schinner 1995; Omar 1998; Whitelaw 2000;
Villegas and Fortin 2002).
Also, different organic acids such as gluconic, 2-keto gluconic, lactic, isovaleric,
isobutyric, acetic, oxalic, and citric acid were reported to be produced by rhizobac-
teria (Omar 1998; Rodriguez and Fraga 1999; Alikhani et al. 2006; Islam et al.
2007) and known to solubilize insoluble phosphates by lowering the pH, chelation
of cations, and competing with phosphate for adsorption sites in the soil (Nahas
1996). Phosphorus desorption potential of different carboxylic anions lowers with
decrease in stability constants of Fe- or Al-organic acid complexes (log KAl or log
KFe) in the order: citrate > oxalate > malonate/malatefaces > tartarate > lactate > glu-
conate > acetate > formiate (Ryan et al. 2001).
Soil with Ca-P as a major phosphorous source also has high buffering capacity
(Ae et al. 1991). But several early reports suggest that the low buffering capacity of
the screening media would lead to the isolation and designation of any bacteria that
can lower the pH of the medium as phosphate solubilizing microorganisms do. But
the bacteria probably will not be able to do this in soil because the soil is buffered.
To resolve this problem, we added one more step in screening methodologies which
includes estimation of available P in rhizosphere after treatment with selected rhi-
zobacteria (Hariprasad and Niranjana 2009). However, acidification does not seem
to be the only mechanism of P solubilization, as the ability to reduce the pH in some
cases does not correlate with the ability to solubilize mineral phosphates (Subba
Rao 1982). For instance, a genomic DNA fragment from Enterobacter agglomerans
showed mineral phosphate solubilization activity in Escherichia coli JM109,
although the pH of the medium was not altered (Kim et al. 1997).
Mineralization of organic to inorganic phosphate involves processes catalyzed
by three groups of enzymes. (1) Nonspecific phosphatase, which performs dephos-
phorylation of phosphor-ester or phosphoanhydride bonds in organic matter; (2)
Phytase, which specifically causes P release from phytic acid; and (3) Phosphonatase
and C-P lyase enzymes that perform C-P cleavage in organophosphonates (Hilda
and Fraga 1999; Yadav and Verma 2012). Our studies (Hariprasad and Niranjana
2009) revealed that phosphate solubilizing PGPR can be endowed with more than
one mechanism and with it can degrade different forms of phosphate complex in
nature. Hence, usage of PGPR with multiple mechanisms for P solubilization is
advantageous over the PGPR with single mechanism.
3.7 Siderophore
Iron has an important role as a component of enzymes involved in the transfer of

electron (redox reaction), such as cytochromes and also required for the synthesis of
some of the chlorophyll-protein complexes in the chloroplast (Taize and Zeiger
2006). Iron is most commonly present in soils in the Fe3+ state contained in clays,
oxides, and hydroxides, a form in which it is extremely insoluble (Tisdale et al.
1993), which is a limiting factor for the growth of plants and microorganisms even
in iron-rich soils. The availability of iron in soil solutions is 10−18 M (Neiland 1981),
a concentration which even cannot sustain the microbial growth. But several
microbes overcome this problem by producing ferric ion-specific chelating agents
widely known as siderophores (Lankford 1973).
Siderophores can be defined as small peptidic molecules containing side chains
and functional groups that can provide a high-affinity set of ligands to coordinate
ferric ions (Crosa and Walsh 2002). Most of the siderophores are water soluble and
can be secreted extracellularly or produced inside bacterial cell which scavenge iron
from the environment and to make the mineral available to the microbial cell
(Winkelmann et al. 1987; Winkelmann 1991). Many bacteria are capable of produc-
ing more than one type of siderophore or have more than one iron-uptake system to
take up multiple siderophores (Neiland 1981; Bultreys et al. 2003). According to iron
coordinating functional group, structural features, and types of ligands, bacterial sid-
erophore can be grouped into four types as follows: (1) Carboxylate, (2) Hydroxamates,
(3) Phenol catecholates, and (4) Pyoveridines (Crowley 2006; Essen et al. 2007).
Pseudomonads are among the most widely studied of the rhizobacteria that pro-
duce abundant siderophores (Hofte et al. 1994). Fluorescent pseudomonads are
known to produce a yellow-green, fluorescent, water-soluble pigment, which has a
very high affinity for ferric iron known as pyoverdin (Leong et al. 1991). Each
pyoverdin has three Fe-binding ligands, one of which is always ano-dihydroxy aro-
matic group derived from quinoline located in the chromophore. The other two are
located in the peptide chain and are hydroxamic acids derived from ornithine
(Budzikiewicz 1993). The structure of pyoverdines is variable among Pseudomonas
spp. and even between strains of same species (Meyer et al. 2002; Visca et al. 2007).
Other important siderophore produced by Pseudomonas are pyochelin, pseudomo-
nine, and its precursor salicylic acid (Cox et al. 1981; Buysens et al. 1996; Mercado-
Blanco et al. 2001; Sattely and Walsh 2008). Quinolobactin are known to be
produced by certain Pseudomonas spp. when pyoverdin production was repressed
and is utilized for iron acquisition (Mossialos et al. 2000). Wide arrays of other
beneficial plant-associated bacterial genera, e.g., Azotobacter, Bacillus,
Enterobacter, Serratia, Azospirillum, and Rhizobium secrete various types of
siderophores (Glick et al. 1999).
Fig. 3.5 Competition for iron between plant, PGPR, and phytopathogens. PGPR secreted sidero-
phore complexes with available iron in rhizosphere. Siderophore-iron complex can be taken up by
PGPR and plant, but phytopathogens are unable to use this complex
The synthesis of siderophores is repressed under conditions where iron is not

limiting. But, under iron-limited conditions, the enzymes for synthesis of sidero-
phores and the receptor protein in the outer membrane of PGPR are synthesized,
and the siderophore is released. After the iron-siderophore complexes have formed,
these soluble complexes are internalized via active transport into the cells by spe-
cific membrane receptors. The sensitivity of membrane transporter receptor varies
with some only recognizing a self-synthesized molecule while others allow trans-
port of siderophore complexes of different origins and structure (Dowling et al.
1994). Further, assimilation of iron from ferri-siderophore complex in cytoplasm
involves the reduction of Fe3+ to Fe2+ for which the siderophore has no affinity
(Crichton and Charloteaux-Wauters 1987; Glick et al. 1999).
A great deal of evidence exists that a number of plant species can absorb bacte-
rial Fe3+-siderophore complexes (Bar-Ness et al. 1991; Wang et al. 1993; Masalha
et al. 2000). The rate and amount of iron taken up in this manner tends to be low, the
concentrations utilized can be significant in sustaining plant growth (Glick et al.
1999). But according to the studies of Bar-Ness et al. (1992), two bacterial sidero-
phores (pseudobactin and ferrioxamine B) were inefficient as iron sources for plants
and rhizobacteria may compete for limited iron with the host plant.
Kloepper et al. (1988) for the first time reported that PGPR exert their plant
growth-promoting activity by depriving native microflora. It has been suggested that
siderophores act antagonistically by sequestering iron from the environment, restrict-
ing growth of the pathogen (Fig. 3.5) (Bashan and de-Bashan 2005). As evidenced
by the work of Jagadeesh et al. (2001) increased concentration of siderophore is
inversely proportional to the population of phytopathogen in rhizosphere, thus

reducing the probability of infection and subsequent disease development.
Phytopathogens in the rhizosphere may be unable to use siderophore produced by
PGPR for iron acquisition, also PGPR produced siderophore may be having higher
sensitivity and specificity for iron than that of phytopathogens derived.
Also several siderophores are known to induce ISR which suppresses the
disease development in host plants which is independent of direct antagonistic
activity (Bashan and de-Bashan 2005). In the case of Serratia marcescens strain
90-166, ISR inducing ability is reduced with increasing concentration of iron in
the rhizosphere (Press et al. 1997) which is evidenced by the involvement of sid-
erophores in inducing ISR. Possible involvement of rhizobacterial produced SA in
inducing ISR was ruled out when Serratia marcescens strain 90-166 entA mutant
defective in siderophore production but able to produce SA failed to induce ISR
(Press et al. 2001). But in radish, iron-regulated metabolites are involved in induc-
ing ISR. But the same strain failed to induce ISR in Arabidopsis (Leeman et al.
1995; Van Wees et al. 1997; Ran et al. 2005). Whereas, Pseudomonas mutants
which were defective in the biosynthesis of iron-regulated metabolites were found
to be as effective as wild type in inducing ISR, suggesting these metabolites are not
required in this interaction (Djavaheri 2007). Thus, the extent of disease suppres-
sion as a consequence of bacterial siderophore production is affected by several
factors (Bashan and de-Bashan 2005), including the specific pathogen, PGPR, soil
type, the crop, availability of iron, and the affinity of the siderophore for iron. For
instance, siderophore-mediated suppression should be greater in neutral and alka-
line soils than in acid soils (Baker et al. 1986). Thus, disease suppression under
controlled laboratory conditions is only an indication of the efficacy of the biocon-
trol agent in the field.
3.8 Lytic Enzymes
Chitinase and β-1,3-glucanase are two major lytic enzymes produced by PGPR
which are involved in degrading chitin and β-1,3-glucan, major constituent of cell
wall in the case of fungi and oomycetes, respectively (Agrios 2005). Chitinase and
β-1,3-glucanase enzymes produced by rhizobacteria have been postulated to play an
important role in the biocontrol of fungal diseases (Kishore and Pande 2007; Kamil
et al. 2007; Leelasuphakul et al. 2006) and was evidenced by in vitro studies where
fungal/oomycetes growth was inhibited by rhizobacteria producing hydrolytic
enzymes (Chet et al. 1990; Vaidya et al. 2003; Huang et al. 2005; Siwayaprahm
et al. 2006). Also, antifungal and lysozyme activity of purified chitinase and β-1,3-
glucanase from rhizobacteria revealed its potential to inhibit the fungal/oomycetes
growth (Wang and Chang 1997; Vaidya et al. 2003; Huang and Chen 2004;
Siwayaprahm et al. 2006; Khiyami and Masmali 2008; Chang et al. 2010; Hariprasad
et al. 2011).
Antifungal properties of chitinolytic soil bacteria may enable them to effectively

suppress the growth of fungi/oomycetes and colonize the specific niche and utilize
the available nutrition. Additionally, the production of chitinase may be part of a
lytic system that enables the bacteria to use living hyphae as the actual growth sub-
strate. The antagonists were capable of growing on the expense of the hyphae of
fungi/oomycetes indicating their potential for pathogen suppression. Where the
antagonism takes place outside the limit of the rhizosphere. Once cell wall damage
has occurred, the pathogen is more likely to be susceptible to attack by other bio-
logical, physical, and chemical agents. Scope of the chitinolytic microorganisms in
management of phytopathogenic fungi has grown as chitin and crude fungal cell
wall-supplemented applications were observed to increase the attainable levels of
disease protection (Bell et al. 1998). The rationale of using chitin with chitinolytic
isolates is a logic approach because bacterial isolates multiply and increase in their
numbers by using chitin as a carbon source; meanwhile the chitinase produced
inhibits the fungal pathogen growth at the rhizosphere (Kokalis-Burelle et al. 1992;
Kishore et al. 2005; Hariprasad et al. 2011). Also, isolates of Bacillus circulans, B.
subtilis, and Serratia marcescens that have been pre-induced for chitinase produc-
tion by multiplication in chitin-supplemented peat formulations showed enhanced
disease control activities in the rhizosphere and phylloplane of groundnut (Manjula
and Podile 2001; Kishore et al. 2005). On the other hand, β-1,3-glucanase produced
by PGPR is reported to degrade β-1,3-glucan a major cell wall constituent of oomy-
cetes which is evidenced by the studies of Fridlender et al. (1993), where β-1,3-
glucanase producing strain of Pseudomonas cepacia inhibited the rhizosphere
proliferation of various soil-borne phytopathogens. Further, monomer or oligomer
of chitin or β-1,3-glucan released from pathogen cell wall by the action of lytic
enzymes may act as an elicitor which initiates transcription of the plant genes that
encode the various components of the defense response (Fig. 3.6) (Takeuchi et al.
1990; Wu et al. 1997).
3.9 Antibiotics
From the past three decades, various plant root-colonizing bacterial species have
been shown to be potent biological control agents in various plant pathogen systems
and this is achieved by producing a set of chemically heterogeneous group of
organic, low-molecular weight compounds (Fravel 1988; Thomashow et al. 1997;
Duffy et al. 2003). Antibiotics produced by microbes are the key component of
PGPR-mediated disease protection in plants especially soil-borne and seed-borne
pathogens. Production of antibiotics has been described as a powerful mode of
action which is exhibited by PGPR at rhizosphere through suppression and/or
developmental activity of the phytopathogen (Handelsman and Stabb 1996; Glick
et al. 2007).
PGPR are well known to produce diverse antimicrobial secondary metabolites
responsible for their biocontrol activity which includes ammonia, butyrolactones,
Fig. 3.6 Lytic enzymes such as chitinase and β-1,3-glucanase produced by PGPR lyses fungal or
oomycetes cell wall by releasing monomers or oligomers which can be used by PGPR as C source,
on the other hand degraded cell wall component acts as elicitor molecules which induce host
defense response
2,4-diacetyl phloroglucinol, kanosamine, oligomycin A, oomycin A, phenazine,

pyoluteorin, phloroglucinols, pyrrolnitrin, viscosinamide, xanthobaccin, zwitter-
mycin A, HCN, polymixin, circulin, colistin, herbicolin-like compounds, thuricin,
and volatile organic compounds (VOCs) (Lambert et al. 1987; Silo-Suh et al. 1994;
He et al. 1994; Whipps 2001; Kumar et al. 2005; Rane et al. 2007; Maksimov et al.
2011). Cyclic lipopeptides (CLP) include surfactin, iturin A, and fengycins (Banat
et al. 2000; Singh and Cameotra 2004). The above said antibiotics are known to
possess antiviral, antimicrobial, insect and mammalian antifeedant, antihelmin-
thic, phytotoxic, antioxidant, cytotoxic, antitumor, and plant growth-promoting
activities. Under certain conditions, pyoverdin (siderophore) functions as diffus-
ible biostatic or fungistatic antibiotics, whereas ferripyoverdin does not (Scher and
Baker 1982).
Among the antibiotics named above, the six classes of antibiotic compounds for
which the experimental evidence most clearly supports a function in their biocontrol
activity are phenazines, phloroglucinols, pyoluteorin, pyrrolnitrin, CLPs (all of
which are diffusible), and hydrogen cyanide (HCN, which is volatile). Mode of
action of these antibiotics against phytopathogens is well established (Table 3.1).
Fluorescent pseudomonads have been shown to produce broad spectrum antibiot-
ics. Pyoluteorin is an aromatic polyketide antibiotic consisting of a resorcinol ring,
which is derived through polyketide biosynthesis (Nowak-Thompson et al. 1999).
Table 3.1 Antibiotics produced by PGPR and their mode of action against phytopathogens
PGPR Antibiotics Mode of action References
Pseudomonas O O− The antimicrobial activity of phenazine depends on the Hassett et al. (1993),
Actinobacteria N
rate of oxidative reductive transformation of the Chin-A-Woeng et al.
Streptomyces compound coupled with the accumulation of toxic (2003), Mavrodi et al.
N superoxide radicals in the target cells, and damages the (2006)
Phenazine lipid and other macromolecules
Pseudomonas Mupirocin is bacteriostatic at low concentrations and Hughes and Mellows
bactericidal at high concentrations. It inhibits (1980), Kate and
isoleucyl-tRNA synthetase and prevents incorporation Bryant (2007)
of isoleucine into newly synthesized proteins
Mupirocin
Cl
Pseudomonas Pyrrolnitrin is a chlorinated phenylpyrrole antibiotic most Arima et al. (1964),
Burkholderia active against dermatophytic fungi. The primary site of Tripathi and Gottlieb
NH action of pyrrolnitrin on Saccharomyces cerevisiae was (1969)
Cl NO2 the terminal electron transport system between
Pyrrolnitrin succinate or reduced nicotinamide adenine dinucleotide
(NADH) and coenzyme Q
Pseudomonas OH Pyoluteorin (4,5-dichloropyrrol-2-yl Howell and Stipanovic
CI 2,6-dihydroxyphenyl), a polyketide antibiotic, which 1980; Maurhofer et al.
HO effectively inhibits phytopathogenic fungi, and 1992; Maurhofer et al.
O N CI
H suppresses plant diseases. No mode of action has been 1994; Nowak-
Pyoluteorin published for pyoluteorin. Thompson et al. 1999
O OH O
Pseudomonas Phloroglucinol causes disorganization in hyphal tips, de Souza et al. (2003),
H3C CH3 including alteration (proliferation, retraction, and Keel et al. (1992),
disruption) of the plasma membrane, vacuolization, Iavicoli et al. (2003),
HO OH
and cell content disintegration (studied in Pythium Bottiglieri and Keel
Phloroglucinol ultimum var. sporangiiferum). At higher concentration (2006)
it acts as phytotoxic (exact mode of action yet to be
determined). In addition it also acts as inducing ISR
(continued)
Pseudomonas HC N HCN is a powerful inhibitor of many metal enzymes, Bakker and Schippers
Hydrogen cyanide especially copper containing cytochrome C oxidase of (1987), Bashan and
cytochrome oxidase pathway and is highly toxic to all de-Bashan (2005)
aerobic microorganisms at picomolar concentrations
Pseudomonas O− There are three different states in which pyocyanin can Caltrider (1967), Hassan
N exist: oxidized, monovalently reduced, or divalently and Fridovich (1980)
+
reduced. Mitochondria play a huge role in the cycling
N of pyocyanin between its redox states. Due to its
CH3 redox-active properties, pyocyanin generates reactive
Pyocyanine oxygen species which target a wide range of cellular
components and pathways. Pathways which are
affected by pyocyanin include the electron transport
chain, vesicular transport, and cell growth
Pseudomonas Volatile organic compounds VOCs’ action could be related to the ability of some Zhang et al. (2007)
Bacillus volatiles to interfere with the levels and ratios of
Azospirillum phytohormones known to be important factors in crown
gall formation in agrobacterium-mediated gall
formation
Bacillus Transported into fungal cells by glucose transport system Janiak and Milewski
and subsequently phosphorylated. The product is of (2001)
intracellular metabolism; kanosamine-6-phosphate is
inhibitor of enzyme glucosamine-6-phosphate synthase
Kanosamine
competitively with D-fructose 6-phosphate which leads
to the morphological changes, inhibition of septa
formation and cell agglutination
Stenotrophomonas H A new tetramic acid-containing macrocyclic lactam Nakayama et al. (1999),
N 14
exhibits a novel mode of action by disrupting Lou et al. (2011)
Xanthomonas 12 13
11
15 OH sphingolipids important to the polarized growth of
16
10 O filamentous fungi
H 6 9 21 17 H
4 H HO
7
3 5 8 18 NH
2 20
25 19
1 24 22
HH 23 O
27 26 O
O
Xanthobaccin
O OH NH2 NH2
Bacillus H
Zwittermicin A is a linear aminopolyol that inhibits the Haiyin et al. (1994),
N OH growth of a variety of Gram-positive and Gram- He et al. (1994), Stabb
H2N N
H negative eubacteria as well as certain ascomycete and and Handelsman
O OH OH OH
O NH2 basidiomycete fungi. The unique structure of (1998), Silo-Suh
Zwittermicin A zwittermicin A may reflect a novel mechanism of et al. (1998)
inhibition in target organisms (yet to be identified)
OH
Pseudomonas Rhamnolipids are a class of glycolipid frequently cited as Sotirova et al. (2008),
Bacillus O O the best characterized of the bacterial surfactants. Haba et al. (2003),
O O
Rhamnolipids have long been reported to have Itoh et al. (1971)
O
antimicrobial properties (antifungal, antibacterial, and
HO
antiviral). Rhamnolipids have been suggested as
HO O antimicrobials able to remove Bordetella
O bronchiseptica biofilms. The mode of killing has been
HO
HO shown to result from intercalation of rhamnolipids into
OH
the cell membrane causing pores to form which result
Rhamnolipids
in cell lysis
Pseudomonas Oomycin A Heat stable amphipathic molecule of 700–800 Da effective Kim et al. (2000)
against Pythium ultimum
(continued)
O 18
-
Pseudomonas ,
2s
H H Cepaciamide A is 3-amino-2-piperidinone-containing Jiao et al. (1996),
O S R Me
O lipid, fungitoxic compound from Pseudomonas Toshima et al. (1999)
3R OH
HN , cepacia D-202, has been recognized as a biological
1 N 1’ 3s Me, Cepa
O H 16 control agent
Cepaciamide A
Pseudomonas Ecomycins A novel family of peptide antimycotics. The ecomycins Miller et al. (1998)
have significant bioactivities against a wide range of
human and plant pathogenic fungi
Streptomyces The butyrolactones bind to cytoplasmic receptor proteins Horinouchi (2002),
O O
and inhibit their binding to specific DNA targets. Most Yamada (1999)
Butyrolactones of these receptor proteins act as repressors, so that
binding to g-butyrolactones induces expression of the
target genes. Each receptor protein is highly specific
for its cognate g-butyrolactone
Paenibacillus Cyclic lipopeptide Cyclic lipopeptide (CLP) antibiotics consist of acyl side Koch et al. (2002),
chains and peptides of various kinds, some including Nielsen et al. (2000),
unusual amino acids. These characteristics confer a Hashizume et al.
wide variety of biological activities and structural (2008)
diversity on CLP antibiotics. Insert into plasma
membrane and perturb their function which results in
broad antibacterial and antifungal activities
Pseudomonas Antibiotic resulting in increased branching, swelling, and Thrane et al. (2000)
septation of hyphae, and reduced intracellular activity.
The changes were suggested to be caused by altered
intracellular ion (H+ and Ca2+) contents, possible due to
channel formation in the cell membrane
Viscosinamide
Phenazines are N-containing heterocyclic pigments synthesized by Bravibacterium,

Burkholderia, Pseudomonas, and Streptomyces (Budzikiewicz 1993; Stevens et al.
1994). 2,4-diacetyl pholoroglucinol, a phenolic molecule is produced by many fluo-
rescent pseudomonads and exhibits antifungal, antibacterial, antihelmenthic, and
phytotoxic activities (Bangera and Thomashow 1996; Abbas et al. 2002). On the
other hand, some metabolites, such as bacteriocins, are effective only against a spe-
cific group of closely related microorganisms (Riley and Wertz 2002).
Antagonists that produce antibiotics have a competitive advantage in occupying
a particular niche and securing substrates as food sources because their antibiotics
suppress the growth, multiplication, and other activities of other microorganisms. In
some cases, antibiotics produced by rhizobacteria act as a determinant of ISR
(Audenaert et al. 2002). Indeed, the first clear-cut experimental demonstration that
a bacteria produced antibiotic could suppress plant disease in an ecosystem was
made by Thomashow and Weller (1988).
As reviewed by Haas and Défago (2005), the contribution of antibiotic com-
pounds to the biological control of root diseases has been documented through five
experimental steps.
1. Diffusible or volatile secondary metabolites that are produced by biocontrol
strains in vitro are purified and chemically identified. The inhibition of sensitive
microorganisms by the pure compounds is then confirmed and quantified in vitro.
2. The antibiotic compound of interest is detected and quantified in the rhizosphere,
which has been inoculated with the producer strain, through extraction and
HPLC purification.
3. The structural and principal regulatory genes controlling the expression of the
antibiotic compounds are identified and characterized. Non-producing and over-
producing strains are constructed using molecular genetics techniques, and
tested in microcosms that contain a chosen plant–pathogen system, with appro-
priate controls (i.e., the wild-type biocontrol strain or no added biocontrol agent).
4. Intrinsically poor biocontrol strains can acquire biocontrol activity by the intro-
duction of antibiotic biosynthetic genes that are not present in the original strains.
5. The expression of antibiotic biosynthetic genes can be observed in the rhizo-
sphere through the use of easily detectable reporter genes that are fused to struc-
tural genes for antibiotic biosynthesis.
3.10 Induced Systemic Resistance
Inducing the plants own defense mechanisms by prior application of biological

inducer is a novel technique for plant protection. Induced disease resistance is the
phenomenon by which a plant exhibits an increased level of resistance to infection
by a pathogen after appropriate stimulation. This resistance response, first charac-
terized by Ross (1961a,b), is expressed systemically throughout the plant and is
effective against a broad spectrum of phytopathogens (Hammerschmidt and Kuc
1995). A well-characterized system of rhizobacteria-induced resistance between
Fig. 3.7 Signalling in

Arabidopsis thaliana leading Plant - Rhizobacterium Plant - Pathogen
to rhizobacteria-mediated interaction interaction
induced systemic resistance
(ISR) or to pathogen-induced
systemic acquired resistance
(SAR). JA jasmonate, PRs JA-response
pathogenesis-related proteins, jar1
SA salicylate (courtesy, Van SA
Loon et al. 1998) NahG
ethylene-response
etr1
npr1
PRs;
enhanced defensive capacity enhanced defensive capacity
ISR SAR
Arabidopsis thaliana and Pseudomonas fluorescens strain WCS417 has been

elaborated by Van Loon’s group (Fig. 3.7) (Pieterse et al. 1996; Van Loon et al.
1998). The resulting elevated resistance due to an inducing agent against infection
by a pathogen is called induced systemic resistance (ISR) or systemic acquired
resistance (SAR) (Hammerschmidt and Kuc 1995). However, induction of systemic
resistance by rhizobacteria is referred as ISR (Van Loon et al. 1998).
The ultimate goal of ISR and SAR is the same but the way they follow to achieve
it is different. SAR requires accumulation of salicylic acid (SA) in the plant (Stitcher
et al. 1997); ISR does not and, instead, is dependent on intact responses to ethylene
and jasmonic acid (JA) (Pieterse et al. 1998). Advantage of ISR is its non-specificity
in suppressing plant diseases, whereas classical biological control, in which antago-
nist selected is active against only one or few pathogens (Wei et al. 1991; Lyon and
Newton 1997). Recently, Hariprasad et al. (2013) confirmed the non-specificity of
ISR by inducing the resistance in tomato plants against root and foliar, fungal and
bacterial pathogens. Once these natural plant resistance mechanisms are activated,
increased defensive capacity is maintained for prolonged period against multiple
pathogens (Tuzun 2001). Further, to conclude that the mechanism responsible for
the protection through ISR requires the disease suppression shown to be plant medi-
ated and that it is extended to plant parts that are not in contact with the inducing
agent. A split root assay was followed by Liu et al. (1995) and Hariprasad et al.
(2009) to demonstrate ISR to root pathogen where the inducing rhizobacteria
applied to one part of a split root system did not move to the part inoculated with the
pathogen. Further, suppression of foliar disease by PGPR clearly indicates the ISR
is mediated through eliciting host defense response and not by direct antagonism.
Bacterial determinants of ISR includes LPS (Leeman et al. 1995; van Wees et al.
1997), 2,4-DAPG (Siddiqui and Shaukat 2003; Weller et al. 2007), siderophores
(Maurhofer et al. 1994; Meziane et al. 2005), iron-regulated compounds (Press et al.
1997), SA ( De Meyer et al. 1999), volatiles (Pieterse et al. 2002; Ryu et al. 2004),
HCN (Defago et al. 1990), and other PGPR-derived macromolecules (Ongena et al.
2002). PGPR-mediated ISR has been demonstrated in many plant species against
various phytopathogens. Various biochemical pathways of plants that are activated
by PGPR were reviewed by Van Loon et al. (1998). Plant growth-promoting and bio-
protecting bacteria triggered ISR fortifies structural barrier, such as thickened cell
wall, suberization, and papillae formation due to the deposition of lignin and callose
(Benhamou et al. 1996, 1998; M’Piga et al. 1997; Raj et al. 2012) and alters host
physiology and metabolic responses, leading to an enhanced synthesis of plant
defense chemicals upon challenge by pathogens and/or abiotic stress factors.
Biochemical or physiological changes in plants include induced increased expres-
sion of defense-related enzymes such as peroxidase, phenylalanine ammonia lyase,
polyphenol oxidase, lioxygenase (Van Peer et al. 1991; Zdor and Anderson 1992).
These enzymes also bring about liberation of molecules that elicit the first steps of
induction of resistance, also synthesize phytoalexins and phenolic compounds
(Mauch et al. 1988; van Loon et al. 1998). Pathogenesis-related proteins such as
PR-1, PR-2, chitinase, β-1, 3-glucanase, thaumatin-like protein (TLP), and some
cell wall peroxidases are also known to play a major role in imparting ISR-mediated
host resistance (van Peer et al. 1991; Zdor and Anderson 1992). Increase in host
defense mechanism depends mainly on the inducing agent, plant genotype, physi-
ological condition, and the pathogen (Tuzun 2001).
The molecular basis and the signalling pathways mediating the protective effect
of ISR have been extensively studied and well described for the interaction by rhi-
zobacteria. Plants are capable of differentially activating distinct defense-related
pathways, depending on the inducing agent. SA, JA, and ET play an important role
in this signalling network. Cross talk between SA-, JA-, and ET-dependent signal-
ling pathways is thought to play an important role in fine tuning complex defense
response (Bostock 1999; Galzebrook 1999; Pieterse and van Loon 1999). Previously
it was reported that JA-dependent defence response is effectively inhibited by SA
(Penninckx et al. 1996; Bowling et al. 1997) and vice versa (Niki et al. 1998). Later,
studies of van Wees et al. (2000) evidenced that simultaneous activation of SAR
and ISR resulted in an additive effect on the level of induced protection against
phytopathogens.
The involvement of jasmonic acid (JA)/ethylene (ET) in inducing plant resis-
tance by PGPR against a number of bacterial and fungal pathogens has been shown
using the arsenal of Arabidopsis signal transduction mutants which demonstrated
that ISR requires functional jasmonate and ethylene signalling (Van Loon et al.
1998; Pieterse et al. 2001) and is independent of SA and PR gene activation (Pieterse
et al. 1996; Van Wees et al. 1997). The above findings were further supported by the
studies where JA response mutant jar1 and the ethylene response mutant etr1, that
express normal levels of pathogen-induced SAR (Lawton et al. 1996; Pieterse et al.
1998), did not express ISR upon treatment with Pseudomonas fluorescens WCS417r,
indicating that the ISR-signalling pathway requires components of the JA and
ethylene response (Knoester et al. 1998). Blocking the response to either of these
signal molecules renders plants more susceptible to pathogens (Knoester et al.
1998; Thomma et al. 1998; Vijayan et al. 1998; Hoffman et al. 1999). In Arabidopsis,
both JA and ethylene have been shown to activate specific sets of defence-related
genes and resistance against P. syringae pv. tomato DC3000 (Pieterse et al. 1998;
Van Wees et al. 1999) which is similar to that of exogenously applied JA and ET
(Boller 1991; Cohen et al. 1993).
NPR1 (Non-expressor of pathogenesis-related gene) is a key regulator of both
SAR and ISR. In the SAR pathway, NPR1 regulates the SA-dependent expression
of PR genes (Cao et al. 1994; Shah et al. 1997), whereas in the ISR pathway it is
required for the expression of the JA- and ethylene-dependent enhanced defensive
capacity (Pieterse et al. 1998). When Arabidopsis plants expressing Pseudomonas
fluorescens WCS417r-mediated ISR were analyzed for the expression of well-
characterized JA- and/or ethylene-responsive genes, none of them was unregulated
locally or systemically in induced plants (van Wees et al. 1999). Similarly, the
concentration of JA or ethylene was not found to be increased during PGPR-
mediated ISR in tomato (Hariprasad et al. 2013). This suggested that ISR is not
accompanied by major changes in the production of either JA or ethylene, but rather
seems to be the result of sensitization of the tissue to these regulators. But, volatiles
from Bacillus amyloliquefaciens strain IN937 is even independent of JA, SA, NPR1,
and ethylene signalling pathways (Pieterse et al. 2002) which revealed that involve-
ment of other mechanisms has to be studied in detail.
3.11 Induced Systemic Tolerance
Stress is an altered physiological condition caused by factors that tend to disrupt the
equilibrium which involves physical and chemical change (Gaspar et al. 2002).
Abiotic stress is the primary cause of crop loss worldwide, reducing average yields
for most major crop plants by more than 50 %. They are caused by complex envi-
ronmental conditions, e.g., salinity, drought, bright light, UV, too high and low tem-
peratures, freezing, heavy metals, hypoxia, flooding, pesticides, and soil pH (Boyer
1982; Mahajan and Tuteja 2005; Mittler 2006).
One of the successful eco-friendly approaches to overcome the adverse effects of
abiotic stresses is by using the biological agents, especially PGPR (Yang et al. 2009;
Glick 2005; Arshad et al. 2008; Zahir et al. 2009). The term “induced systemic
tolerance” (IST) has been proposed by Yang et al. (2009) for PGPR induced physi-
cal and chemical changes in plants that result in enhanced tolerance to abiotic stress.
PGPR-mediated induction of IST depends on two crucial processes which are as
follows, survival and root colonization of rhizobacteria by adapting to stressful
environment and imparting tolerance to host plant against various stress.
3.11.1 Adaptations of Rhizobacteria to Abiotic Stress
Root colonization is one of the key characters exhibited by PGPR at rhizosphere.

But, in order to exhibit its beneficial effect on host plant an efficient PGPR has to
survive for a particular period in rhizosphere by adapting to various biotic and abi-
otic stress. Rhizobacterial adaptation to stress is a complex multilevel regulatory
process in which many enzymes, proteins, and metabolites are involved.
Certain bacterial species living under extreme conditions (thermophiles and
halophiles) adapt by elevating their optimum metabolic activity and membrane sta-
bility to higher temperature or salinity, respectively (Madigan and Oren 1999).
Certain bacteria like Pseudomonas and Azospirillum survive under stress conditions
by producing exopolysaccharides (EPS), which protect microorganisms from hydric
stress and fluctuations in water potential by enhancing water retention and regulat-
ing the diffusion of carbon sources in microbial environment (Skvortsov and Ignatov
1998; Bleakley et al. 1988; Burdman et al. 2000; Sandhya et al. 2009). Also, EPS
produced from rhizobacteria is known to modify soil structure by increasing soil
macropores volume (Alami et al. 2000). Further, bacterial EPS mitigate saline stress
by reducing the content of Na+ available for plant uptake (Upadhyay et al. 2012).
Salinity stress also has been reported to alter the cell envelope composition of the
rhizobacteria resulting in changes in proteins, periplasmic glucans, and capsular,
EPS and LPS, fatty acid composition, and cross-linkage of peptidoglycan (Jofré
et al. 1998; Piuri et al. 2005) and is suggested that composition of the cell envelops
play important role in osmoadaptation (López et al. 2000).
When subjected to osmotic stress conditions, bacteria synthesize one or various
endogenous osmolytes (osmoprotectants) (K+, glutamate, trehalose, proline, gly-
cine betaine, proline betaine, and ectoine) (Blanco and Bernard 1994; Roessler and
Müller 2001) or these osmolites are accumulated by active transport from surround-
ing medium (Sleator and Hill 2002). Osmoprotectants are highly soluble com-
pounds that carry no net charge at physiological pH and are nontoxic at high
concentrations. They raise osmotic pressure in the cytoplasm and also stabilize pro-
teins and membranes under unfavorable environmental conditions. Most of the
osmolites are involved in turgor maintenance only, while others protect cells and
biological macromolecules against denatured effect of not only hyperosmotic stress,
but also other stresses such as heating, freezing, and desiccation (Yancey 2005;
Crowe 2007; Paul and Nair 2008).
The heat-shock response involves the induction of many proteins—called heat-
shock proteins, or Hsps—in response to elevation of temperature (Neidhardt and
Van Bogelen 1987). The bacterial heat-shock response is not limited to changes in
temperature and is a general stress response. The heat-shock proteins include chap-
erones, involved in the proper folding of denatured proteins required for the degra-
dation of irreversibly damaged proteins (Munchbach et al. 1999). Induction of this
response improves thermotolerance, salt tolerance, and tolerance to heavy metals
(Kusukawa and Yura 1988; Inbar and Ron 1993; Qi et al. 2004). Similarly cold-
tolerant bacteria respond to a decrease in temperature by induction of cryoprotective
protein (Koda et al. 2001).
Drought Salt Fertility
Na+ translocation
Ethylene Increased accumulation of
nitrate and phosphate
ROS
HKT1
ABA
Aboveground
Underground Alteration of root
ACC morphology and
Cytokinin deaminase
transporter activity
Antioxidants HKT1 Na+ uptake
IAA, cytokinin and

unknown metabolites
Volatiles
PGPR
TRENDS in Plant Science
Fig. 3.8 Induced systemic tolerance (IST) elicited by PGPR against drought, salt, and fertility
stresses underground (root) and aboveground (shoot). Broken arrows indicate bioactive com-
pounds secreted by PGPR; solid arrows indicate plant compounds affected by bacterial compo-
nents. Some PGPR strains, indicated in red on the plant roots, produce cytokinin and antioxidants
such as catalase, which result in ABA accumulation and ROS degradation, respectively (Figueiredo
et al. 2008; Kohler et al. 2008). Degradation of the ethylene precursor ACC by bacterial ACC
deaminase releases plant stress and rescues normal plant growth under drought and salt stresses
(Kohler et al. 2008; Mayak et al. 2004). The volatiles emitted by PGPR downregulate hkt1 expres-
sion in roots but upregulate it in shoot tissues, orchestrating lower Na+ levels and recirculation of
Na+ in the whole plant under high salt conditions (Zhang et al. 2008). Production by PGPR of IAA
or unknown determinants can increase root length, root surface area, and the number of root tips,
leading to enhanced uptake of nitrate and phosphorous (Gyaneshwar et al. 2002; Mantelin and
Touraine 2004; Adesemoye et al. 2008). ABA abscisic acid, ACC 1-aminocyclopropane-1-
carboxylate, HKT1 high-affinity K+ transporter 1, IAA indole acetic acid, IST induced systemic
tolerance, PGPR plant growth-promoting rhizobacteria, ROS reactive oxygen species. (Courtesy,
Yang et al. 2009)
3.11.2 Alleviation of Abiotic Stress in Plants by Rhizobacteria
Recently Yang et al. (2009) reviewed the rhizobacteria-mediated IST in detail.

Further, Grover et al. (2011) discussed different adaptive strategies followed by
rhizobacteria during different stress conditions and alleviation tolerance to abiotic
stress in plants. An overall mechanism involved in PGPR-mediated mitigation of
abiotic stress in plant is shown in Fig. 3.8.
3.11.3 Modulating Ethylene Level Through ACC

Deaminase Activity
Ethylene, a gaseous phytohormone, commonly appears to enhance root initiation

and growth at lower level. If the ethylene concentration increases above a threshold
level, it becomes detrimental for plant growth. Ethylene biosynthesis is also
increased by stress conditions such as drought, flooding, chilling, exposure to
ozone, or mechanical wounding (Ma et al. 1998; Abeles et al. 1992). Ethylene bio-
synthesis starts with the S-odenosylation of methionine to S-adenosylmethionine
(SAM) followed by the closing of the cyclopropane ring to form 1-aminocyclopropane-
1-carboxylate (ACC) which oxidatively cleaved to form ethylene. 1-aminocyclo-
propane-1-carboxylate deaminase (ACCd), an enzyme which cleaves ACC, the
immediate precursor molecule of ethylene. Hence, many studies have been pub-
lished on beneficial effects of PGPR containing ACCd activity on different plants.
ACC deaminase is a cytoplasmically localized, multimeric enzyme containing 2–3
subunits with a monomeric subunit molecular mass of approximately 35–42 kDa
(Jacobson et al. 1994; Glick 2005). It is a sulfhydryl enzyme which requires a cofac-
tor pyridoxal 5-phosphate for enzymatic activity (Walsh et al. 1981; Glick et al.
1998). By analyzing the Km value of ACC, it was concluded that the enzyme does
not have a particularly high affinity to ACC (Jacobson et al. 1994; Hontzeas et al.
2004). Usually, ACC levels in plants are typically in μM range, hence a small
increase in the ACC concentration will result in the parallel increase in the rate of
ACC cleavage. Plant root colonized with PGPR containing ACCd are dramatically
more resistant to the injurious effect of stress ethylene that is synthesized. It has
been reported that ACC deaminase containing bacteria promote plant growth under
a variety of stressful conditions such as high salt (Saravanakumar and Samiyappan
2007; Nadeem et al. 2012), drought (Mayak et al. 2004; Ali et al. 2013), flooding
(Grichko and Glick 2001), metals (Burd et al. 2000; Gerhardt et al. 2006; Rodriguez
et al. 2008), organic contaminants (Gurska et al. 2009; Reed and Glick 2005;
Gerhardt et al. 2006), and phytopathogens (Hao et al. 2007; Wang et al. 2000).
Downregulation of genes involved in ethylene induced plant stress response and
upregulation genes involved in plant growth were reported in ACC-deaminase pro-
ducing rhizobacteria treated canola roots (Hontzeas et al. 2004). Similarly, ACCd
negative mutants of Enterobacter cloacae UW4 showed reduced activity of ACCd
and subsequently its ability to promote the elongation of canola roots under gnoto-
biotic conditions was greatly diminished when compared to wild types (Li et al.
2000). In each of these cases ACC-deaminase containing bacteria markedly low-
ered the level of ACC in the stressed plants thereby limiting the amount of stress
ethylene synthesis and hence the damage to the plant. These studies revealed the
importance of ACCd activity of PGPR in mitigating abiotic stress by reducing eth-
ylene level in root.
A model describing the role of ACCd in PGPR-mediated abiotic stress suppres-
sion was suggested by Glick et al. (1998) (Fig. 3.9). Briefly, under stress conditions
in order to synthesize ethylene, ACC is produced in plant roots and a part is exuded
Fig. 3.9 Degradation of

ACC which is an immediate
precursor of ethylene by ACC
deaminase producing PGPR
reduced available ACC to
synthesize ethylene in root.
Degradation product
ammonia is further utilized as
N source by plant and PGPR
into rhizosphere. Rhizobacteria in close vicinity of the roots can take up some of
this ACC and hydrolyze it by the activity of ACCd to ammonia and α-ketobutyrate.
The uptake and subsequent hydrolysis of ACC by rhizobacteria decreases the
amount of ACC outside of the plant. Further, to maintain the equilibrium between
internal and external ACC levels, plant must exude large amount of ACC into the
rhizosphere which is utilized by rhizobacteria after cleaving with ACC. This pro-
cess leads to reduction of amount of ACC available to the decreased synthesis of
ethylene and its inhibitory effect on root elongation is reduced.
3.12 Future Prospects and Challenges
Use of these PGPR in sustainable agriculture is directly related to understanding

their mode of action of growth promotion and suppression of abiotic and biotic
stress in plants. In spite of significant advancement made in understanding these
mechanisms, their performance under field conditions are inconsistent and PGPR
are yet to fulfill their promise as potential alternative agrochemicals. Hence more
research should be carried out in order to develop strategies to maintain consistency
of PGPR performance under field conditions. To achieve this, it is important to
select PGPR based on their mode of action which is suitable to enhance the host
plant health under particular conditions. Our review is helpful for beginners and
also for those who are working in this area to conduct some advanced studies. As
per our previous studies, in order to achieve the production in agriculturally impor-
tant crops, it is important to use PGPRs which are endowed with multiple traits
through which they can promote plant growth, mitigate abiotic stress, and also sup-
press the diseases nonspecifically. Even though several modes of actions are fre-
quently reported survival of bacteria under stress conditions, rare mechanisms such
as ABA production should be studied thoroughly.
References
Abbas A, Morrissey JP, Carnicero-Marquez P, Sheehan MM, Delany IR, O’Gara F (2002)
Characterization of interactions between the transcriptional repressor PhlF and its binding site
at the phlA promoter in Pseudomonas fluorescens F113. J Bacteriol 184:3008–3016
Abeles FB, Morgan PW, Saltveit ME (1992) Ethylene in plant biology, 2nd edn. Academic, San
Diego, CA
Adesemoye AO, Torbert HA, Kloepper JW (2008) Enhanced plant nutrient use efficiency with
PGPR and AMF in an integrated nutrient management system. Can J Microbiol 54:876–886
Ae N, Arihara J, Okada K (1991) Phosphorus response of chickpea and evaluation of phosphorus
availability in Indian alfisols and vertisols. In: Johansen C, Lee KK, Sahrawat KL (eds)
International Crops Research Institute for the semi arid tropics. Patancheru, Andhra Pradesh,
India, pp 33–41
Agrios GN (2005) Plant pathology, 5th edn. Elsevier Academic, San Diego. ISBN 80120445653
Akiyoshi DE, Regier DA, Gordon MP (1987) Cytokinin production by Agrobacterium and
Pseudomonas spp. J Bacteriol 169:4242–4248
Alami Y, Achouak W, Marol C, Heulin T (2000) Rhizosphere soil aggregation and plant growth
promotion of sunflowers by an exopolysaccharide-producing Rhizobium sp. strain isolated
from sunflower roots. Appl Environ Microbiol 66:3393–3398
Albareda M, Dardanelli MS, Sousa C, Megías M, Temprano F, Rodríguez Navarro DN (2006)
Factors affecting the attachment of rhizospheric bacteria to bean and soybean roots. FEMS
Microbiol Lett 259:67–73
Ali B, Sabri AN, Ljung K, Hasnain S (2009) Auxin production by plant associated bacteria: impact
on endogenous IAA content and growth of Triticum aestivum L. Lett Appl Microbiol
48:542–547
Ali SZ, Sandhya V, Rao LV (2013) Isolation and characterization of drought-tolerant ACC deami-
nase and exopolysaccharide-producing fluorescent Pseudomonas sp. Arch Microbiol doi:
10.1007/s13213-013-0680-3
Alikhani HA, Saleh-Rastin N, Antoun H (2006) Phosphate solubilization activity of rhizobia
native to Iranian soil. Plant Soil 287:35–41
Angelini TE, Roper M, Kolter R, Weitz DA, Brenner MP (2009) Bacillus subtilis spreads by surf-
ing on waves of surfactant. Proc Natl Acad Sci U S A 106:18109–18113
Antoun H, Beauchamp CJ, Goussard N, Chabot R, Lalande R (1998) Potential of Rhizobium and
Bradyrhizobium species as plant growth promoting rhizobacteria on non-legumes: effect on
radishes (Raphanus sativus L.). Plant Soil 204:57–67
Araujo FF, Henning AA, Hungria M (2005) Phytohormones and antibiotics produced by Bacillus
subtilis and their effects on seed pathogenic fungi and on soybean root development. World J
Microbiol Biotechnol 21:1639–1645
Arima K, Imanaki H, Kousaka M, Fukuta A, Tamura G (1964) Pyrrolnitrin, a new antibiotic sub-
stance, produced by Pseudomonas. Agric Biol Chem 28:575–576
Arshad M, Frankenberger WT (1991) Microbial production of plant hormones. Plant Soil
133:1–8
Arshad M, Frankenberger WT (1993) Microbial production of plant growth regulators. In: Metting
FB Jr (ed) Soil microbial ecology. Applications in agricultural and environmental management.
Marcel Dekker, New York, pp 307–343
Arshad M, Shaharoona B, Mahmood T (2008) Inoculation with Pseudomonas spp. containing
ACC-deaminase partially eliminates the effects of drought stress on growth, yield, and ripening
of pea (Pisum sativum L.). Pedosphere 18:611–620
Asghar HN, Zahir ZA, Arshad M, Khaliq A (2002) Relationship between in vitro production of
auxins by rhizobacteria and their growth-promoting activities in Brassica juncea L. Biol Fert
Soils 35:231–237
Aslantas R, Cakmakci R, Sahin F (2007) Effect of plant growth promoting rhizobacteria on young
apple tree growth and fruit yield under orchard conditions. Sci Hortic 111:371–377
Assmus B, Hutzler P, Kirchhof G, Amann R, Lawrence JR, Hartmann A (1995) In situ localization
of Azospirillum brasilense in the rhizosphere of wheat with fluorescent labeled, rRNA-targeted
oligonucleotide probes and scanning confocal laser microscopy. Appl Environ Microbiol
61:1013–1019
Atzorn R, Crozier A, Wheeler C, Sandberg G (1988) Production of gibberellins and Indole 3-acetic
acid by Rhizobium phaseoli in relation to nodulation of Phaseolus vulgaris roots. Planta
175:532–538
Audenaert K, Pattery T, Cornelis P, Höfte M (2002) Induction of systemic resistance to Botrytis
cinerea in tomato by Pseudomonas aeruginosa 7NSK2: role of salicylic acid, pyochelin, and
pyocyanin. Mol Plant Microb Interact 15:1147–1156
Bacilio-Jimenez M, Aguilar-Flores S, Ventura-Zapata E, Perez-Campos E, Bouquelet S, Zenteno
E (2003) Chemical characterization of root exudates from rice (Oryza sativa) and their effects
on the chemotactic response of endophytic bacteria. Plant Soil 249:271–277
Bais HP, Park SW, Weir TL, Callaway RM, Vivanco JM (2004) How plants communicate using the
underground information superhighway. Trends Plant Sci 9:26–32
Bais HP, Weir TL, Perry LG, Gilroy S, Vivanco JM (2006) The role of root exudates in rhizosphere
interactions with plants and other organisms. Annu Rev Plant Biol 57:233–266
Baker KF (1987) Evolving concepts of biological control of plant pathogens. Annu Rev Phytopathol
25:67–85
Baker R, Elad Y, Sneh B (1986) Physical, biological and host factors in iron competition in soils.
In: Swinburne TR (ed) Iron, siderophores, and plant diseases. Plenum Press, New York,
pp 77–84
Bakker AW, Schipper B (1987) Microbial cyanide production in the rhizosphere in relation to
potato yield reduction and Pseudomonas spp. mediated plant growth reduction. Soil Biol
Biochem 19:452–458
Banat IM, Makkar RS, Cameotra SS (2000) Potential commercial applications of microbial surfac-
tants. Appl Microbiol Biotechnol 53:495–508
Bangera MG, Thomashow LS (1996) Characterization of a genomic locus required for synthesis
of the antibiotic 2,4-diacetylphloroglucinol by the biological control agent Pseudomonas fluo-
rescens Q2-87. Mol Plant Microbe Interact 9:83–90
Barbara RH, Thomas H (1998) Life in grasses: diazotrophic endophytes. Trends Microbiol
6:139–144
Barea JM, Azcon R, Azcon-Aguilar C (2004) Mycorrhizal fungi and plant growth promoting rhi-
zobacteria. In: Verma A, Abbott L, Werner D, Hampp R (eds) Plant surface microbiology.
Springer, Heidelberg, pp 351–371
Barea JM, Pozo MJ, Azcon R, Azcon-Aguilar C (2005) Microbial co-operation in the rhizosphere.
J Exp Bot 56:1761–1778
Bar-Ness E, Chen Y, Hadar Y, Marschner H, Römheld V (1991) Siderophores of Pseudomonas
putida as an iron source for dicot and monocot plants. Plant Soil 130:231–241
Bar-Ness E, Hadar Y, Chen Y, Römheld V, Marschner H (1992) Short-term effects of rhizosphere
microorganisms on Fe uptake from microbial siderophores by maize and oat. Plant Physiol
100:451–456
Barriuso J, Solano BR, Fray RG, Camara M, Hartmann A, Manero FJG (2008) Transgenic tomato
plants alter quorum sensing in plant growth-promoting rhizobacteria. Plant Biotechnol J
6:442–452
Bashan Y, de-Bashan LE (2005) Bacteria. In: Hillel D (ed) Encyclopaedia of soils in the environ-
ment. Elsevier, Oxford, UK, pp 103–115
Bashan Y, de-Bashan LE (2010) How the plant growth promoting bacterium Azospirillum pro-
motes plant growth—a critical assessment. Adv Agron 108:77–136
Bastian F, Cohen A, Piccoli P, Luna V, Baraldi R, Bottini R (1998) Production of indole-3-acetic
acid and gibberellins A1 and A3 by Acetobacter diazotrophicus and Herbaspirillum seropedi-
cae in chemically-defined culture media. Plant Growth Regul 24:7–11
Beever RE, Burns DJW (1980) Phosphorus uptake storage and utilization by fungi. Adv Bot Res
8:127–219
Bell CR, Dickie GA, Harvey WLG, Chan JWYF (1995) Endophytic bacteria in grapevine. Can J
Bell AA, Liu L, Reidy B, Davis RM, Subbarao KV (1998) Mechanisms of subsurface drip
irrigation-mediated suppression of lettuce drop caused by Sclerotinia minor. Phytopathology
88:252–259
Benhamou N, Kloepper JW, Quadt-Hallman A, Tuzun S (1996) Induction of defense related
ultrastructural modifications in pea root tissues inoculated with endophytic bacteria. Plant
Physiol 112:919–929
Benhamou N, Kloepper JW, Tuzun S (1998) Induction of resistance against Fusarium wilt of
tomato by combination of chitosan with an endophytic bacterial strain: ultrastructure and cyto-
chemistry of the host response. Planta 204:153–168
Blanco C, Bernard T (1994) Osmoadaptation in rhizobia: ectoine-induced salt tolerance. J Bacteriol
176:5210–5217
Bleakley BH, Gaskins MH, Hubbel DH, Zam SG (1988) Floc formation by Azospirillum lipoferum
grown on polyb-hydroxybutyrate. Appl Environ Microbiol 54:2986–2995
Boddey RM, Dobereiner J (1995) Nitrogen fixation associated with grasses and cereals: recent
progress and perspectives for the future. Fert Res 42:241–250
Boiero L, Perrig D, Masciarelli O, Pena C, Cassán F, Luna V (2007) Phytohormone production by
strains of Bradyrhizobium japonicum and possible physiological and technological implica-
tions. Appl Microbiol Biotechnol 74:874–880
Boller T (1991) Ethylene in pathogenesis and disease resistance. In: Mattoo AK, Suttle JC (eds)
The plant hormone ethylene. CRC Press, Boca Raton, FL, pp 293–314
Bostock RM (1999) Signal conflicts and synergies in induced resistance to multiple attackers.
Physiol Mol Plant Pathol 55:99–109
Bottiglieri M, Keel C (2006) Characterization of PhlG, a hydrolase that specifically degrades the
antifungal compound 2,4-diacetylphloroglucinol in the biocontrol agent Pseudomonas fluores-
cens CHA0. Appl Environ Microbiol 72:418–427
Bowers JH, Parke JL (1993) Colonization of pea (Pisum sativum L.) taproots by Pseudomonas
fluorescens: effect of soil temperature and bacterial motility. Soil Biol Biochem 25:1693–1701
Bowling SA, Clarke JD, Liu Y, Klessig DF, Dong X (1997) The cpr5 mutant of Arabidopsis
expresses both NPR1-dependent and NPR1-independent resistance. Plant Cell 9:1573–1584
Boyer JS (1982) Plant productivity and environment. Science 218:443–448
Brandl MT, Lindow SE (1997) Environmental signals modulate the expression of an indole-3-
acetic acid biosynthetic gene in Erwinia herbicola. Mol Plant Microb Interact 10:499–505
Budzikiewicz H (1993) Secondary metabolites from fluorescent pseudomonads. FEMS Microbiol
Rev 104:209–228
Bultreys A, Gheysen I, Wathelet B, Maraite H, de Hoffmann E (2003) High-performance liquid
chromatography analyses of pyoverdin siderophores differentiate among phytopathogenic flu-
orescent Pseudomonas species. Appl Environ Microbiol 69:1143–1153
Burd GI, Dixon DG, Glick BR (2000) Plant growth-promoting bacteria that decrease heavy metal
toxicity in plants. Can J Microbiol 46:237–245
Burdman S, Jurkevitch E, Okon Y (2000) Recent advances in the use of plant growth promoting
rhizobacteria (PGPR) in agriculture. In: Subba Rao NS, Dommergues YR (eds) Microbial
interactions in agriculture and forestry, vol II. Science Publishers, Enfield, pp 229–250
Buysens S, Heungens K, Poppe J, Hofte M (1996) Involvement of pyochelin and pyoverdin in
suppression of Pythium-Induced damping-off of tomato by Pseudomonas aeruginosa 7NSK2.
Appl Environ Microbiol 62:865–871
Caltrider PG (1967) Protoanemonin. In: Corcoran JW, Hann F (eds) Antibiotics 1. Mechanism of
action. Springer, Berlin, pp 671–673
Cao H, Bowling SA, Gordon AS, Dong X (1994) Characterization of an Arabidopsis mutant that
is nonresponsive to inducers of systemic acquired resistance. Plant Cell 6:1583–1592
Carvalhais LC, Dennis PG, Fedoseyenko D, Hajirezaei MR, Boriss R, von Wirén N (2011) Root
exudation of sugars, amino acids, and organic acids by maize as affected by nitrogen, phospho-
rus, potassium, and iron deficiency. J Plant Nutr Soil Sci 174:3–11
Cassan F, Bottini R, Schneider G, Piccoli P (2001) Azospirillum brasilense and Azospirillum

lipoferum hydrolyze conjugates of GA20 and metabolize the resultant aglycones to GA1 in
seedlings of rice dwarf mutants. Plant Physiol 125:2053–2058
Cezon R, Manero FJ, Gutierrez PA, Ramos B, Garica JAL (2003) Effect of two plant
growth-promoting rhizobacteria on the germination and growth of pepper seedlings (Capsicum
annum) cv. Roxy. Arch Agron Soil Sci 49:593–603
Chaiharn M, Chunhaleuchanon S, Lumyong S (2009) Screening siderophore producing bacteria as
potential biological control agent for fungal rice pathogens in Thailand. World J Microbiol
Biotechnol 25:1919–1928
Chang WT, Chen ML, Wang SL (2010) An antifungal chitinase produced by Bacillus subtilis using
chitin waste as a carbon source. World J Microbiol Biotechnol 26:945–950
Chatterjee R, Allen RM, Ludden PW, Shah VK (1997) In vitro synthesis of the iron-molybdenum
cofactor and maturation of the nif-encoded apodinitrogenase. J Biol Chem 272:21604–21608
Chen Y, Yan F, Chai Y, Liu H, Kolter R, Losick R, Guo J (2012) Biocontrol of tomato wilt disease
by Bacillus subtilis isolates from natural environments depends on conserved genes mediating
biofilm formation. Environ Microbiol 15:848–864
Chet I, Ordentlich A, Shapira R, Oppenheim A (1990) Mechanisms of biocontrol of soil-borne
plant-pathogens by rhizobacteria. Plant Soil 129:85–92
Chin-A-Woeng TFC, Bloemberg GV, Lugtenberg BJJ (2003) Mechanisms of biological control of
phytopathogenic fungi by Pseudomonas spp. In: Stacey G, Keen NT (eds) Plant–microbe inter-
actions, vol 6. The American Phytopathology Society, St. Paul, USA, pp 173–225
Cohen Y, Gisi U, Niderman T (1993) Local and systemic protection against Phytophthora infes-
tans induced in potato and tomato plants by jasmonic acid and jasmonic methyl ester.
Cohen AC, Bottini R, Piccoli PN (2008) Azospirillum brasilense Sp 245 produces ABA in
chemically-defined culture medium and increases ABA content in Arabidopsis plants. Plant
Growth Regul 54:97–103
Cohen AC, Travaglia CN, Bottini R, Piccoli PN (2009) Participation of abscisic acid and gibberel-
lins produced by endophytic Azospirillum in the alleviation of drought effects in maize. Botany
87:455–462
Compant S, Duffy B, Nowak J, Clement C, Barka EA (2005) Use of plant growth-promoting bac-
teria for biocontrol of plant diseases: principles, mechanisms of action, and future prospects.
Costerton JW, Lewandowski Z, Caldwell DE, Korber DR, Lappin-Scott HM (1995) Microbial
biofilms. Annu Rev Microbiol 49:711–745
Cox CD, Rinehart KL Jr, Moore ML, Cook JC Jr (1981) Pyochelin: novel structure of an iron-
chelating growth promoter for Pseudomonas aeruginosa. Proc Natl Acad Sci U S A
78:4256–4260
Crichton RR, Charloteaux-Wauters M (1987) Iron transport and storage. Eur J Biochem
164:485–506
Crosa JH, Walsh CT (2002) Genetics and assembly line enzymology of siderophore biosynthesis
in bacteria. Microbiol Mol Biol Rev 66:223–249
Crowe JH (2007) Trehalose as a ‘chemical chaperone’: fact and fantasy. Adv Exp Med Biol
594:143–158
Crowley DA (2006) Microbial siderophores in the plant rhizosphere. In: Barton LL, Abadía J (eds)
Iron nutrition in plants and rhizospheric microorganisms. Springer, Berlin
Crozier A, Kamiya Y, Bishop G, Yokota T (2000) Biosynthesis of hormones and elicitor molecules.
In: Buchanan BB, Gruissem W, Jones RL (eds) Biochemistry and molecular biology of plants.
American Society of Plant Physiology, Rockville, pp 850–929
Czaban J, Gajda A, Wroblewska B (2007) The motility of bacteria from rhizosphere and different
zones of winter wheat roots. Pol J Environ Stud 16:301–308
Davies PJ (1995) Plant hormones: physiology, biochemistry, and molecular biology. Kluwer
Academic, London, pp 6–7
de Freitas JR, Banerjee MR, Germida JJ (1997) Phosphate solubilizing rhizobacteria enhance the
growth and yield but not phosphorus uptake of canola (Brassica napus). Biol Fertil Soils
24:358–364
De Meyer G, Capieau K, Audenaert K, Buchala A, Métraux JP, Höfte M (1999) Nanogram amounts
of salicylic acid produced by the rhizobacterium Pseudomonas aeruginosa 7NSK2 activate the
systemic acquired resistance pathway in bean. Mol Plant Microbe Interact 12:450–458
de Salamone G, Hynes RK, Nelson LM (2001) Cytokinin production by plant growth promoting
rhizobacteria and selected mutants. Can J Microbiol 47:404–411
de Souza J, Arnould C, Deulvot C, Lamanceau P, Pearson VG, Raaijmakers JM (2003) Effect of
2,4 diacetyl phloro glucinol on Pythium: cellular responses and variation in sensitivity among
propagules and species. Phytopathology 93:966–975
de Weert S, Bloemberg GV (2006) Rhizosphere competence and the role of root colonization in
biocontrol. In: Gnanamanickam SS (ed) Plant-associated bacteria. Springer, Dordrecht,
pp 317–333
de Weert S, Vermeiren H, Mulders IHM, Kuiper I, Hendrickx N (2002) Flagella-driven chemotaxis
towards exudate components is an important trait for tomato root colonization by Pseudomonas
fluorescens. Mol Plant Microbe Interact 15:1173–1180
Defago G, Berling CH, Burger U, Hass D, Kahr G, Keel C, Voisard C, Wirthner P, Wuthrich B
(1990) Suppression of black root rot of tobacco and other root disease by strains of Pseudomonas
fluorescens: potential applications and mechanisms. In: Schippers D, Cook RJ, Henis Y, Ko
WH, Rovira AD, Schippers B, Scott PR (eds) Biological control of soil borne plant pathogens.
CABI, Oxfordshire, UK, pp 93–108
Dekkers LC, van der Bij AJ, Mulders IHM, Phoelich CC, Wentwoord RAR, Glandorf DCM,
Wijffelman CA, Lugtenberg BJJ (1998) Role of the O-antigen of lipopolysaccharide and pos-
sible roles of growth rate and of NADH: ubiquinone oxidoreductase (nuo) in competitive
tomato root-tip colonization by Pseudomonas fluorescens WCS365. Mol Plant Microbe
Interact 11:763–771
Dey R, Pal KK, Bhatt DM, Chauhan SM (2004) Growth promotion and yield enhancement of
peanut (Arachis hypogaea L.) by application of plant growth-promoting rhizobacteria.
Microbiol Res 159:371–394
Djavaheri M (2007) Iron-regulated metabolites of plant growth-promoting Pseudomonas fluores-
cens WCS374: their role in induced systemic resistance. PhD thesis, University Utrecht, The
Netherlands
Dobbelaere S, Croonenborghs A, Thys A, Vande Broek A, Vanderleyden J (1999) Phyto stimula-
tory effect of Azospirillum brasilense wild type and mutant strains altered in IAA production
on wheat. Plant Soil 212:155–164
Dobbelaere S, Vanderleyden J, Okon Y (2003) Plant growth-promoting effects of diazotrophs in
the rhizosphere. Crit Rev Plant Sci 22:107–149
Dobereiner J (1997) Biological nitrogen fixation in tropics: social and economic contribution. Soil
Biol Biochem 29:771–774
Dobert RC, Rood SB, Blevins DG (1992) Gibberellins and the legume-Rhizobium symbiosis.
I. Endogenous gibberellins of Lima Bean (Phaseolus lunatus L.) stems and nodules. Plant
Physiol 98:221–224
Dowling DN, Boesten B, Gill PR Jr, OíGara F (1994) Developing concepts in biological control:
a molecular ecology approach. In: OíGara F et al (eds) Molecular ecology of rhizosphere
microorganisms. Verlagsgesellschaft, Weinheim, Germany, pp 57–64
Duffy B, Schouten A, Raaijmakers JM (2003) Pathogen self defense: mechanisms to counteract
microbial antagonism. Annu Rev Phytopathol 41:501–538
Esitken A, Pirlak L, Turan M, Sahin F (2006) Effects of floral and foliar application of plant growth
promoting rhizobacteria (PGPR) on yield, growth and nutrition of sweet cherry. Sci Hortic
110:324–327
Essen SA, Johnsson A, Bylund D, Pederson K, Lundstrom US (2007) Siderophore production by
Pesudomonas stutzeri under aerobic and anaerobic conditions. Appl Environ Microbiol
73:5857–5864
Estrada-de los Santos P, Bustillos-Cristales R, Caballero-Mellado J (2001) Burkholderia, a genus

rich in plant-associated nitrogen fixers with wide environmental and geographic distribution.
Ferguson L, Lessenger JE (2006) Plant growth regulators. In: Lessenger JE (ed) Agricultural medi-
cine. Springer, New York, pp 156–166
Figueiredo MVB, Burity HA, Martínez CR, Chanway CP (2008) Alleviation of drought stress in
the common bean (Phaseolus vulgaris L.) by co-inoculation with Paenibacillus polymyxa and
Rhizobium tropici. Appl Soil Ecol 40:182–188
Franche C, Lindstrom K, Elmerich C (2009) Nitrogen-fixing bacteria associated with leguminous
and non-leguminous plants. Plant Soil 321:35–59
Fravel DR (1988) Role of antibiosis in the biocontrol of plant diseases. Annu Rev Phytopathol
26:75–91
Fridlender M, Inbar J, Chet I (1993) Biological control of soilborne plant pathogens by a β-1,3-
glucanase producing Pseudomonas cepacia. Soil Biol Biochem 25:1211–1221
Fuentes-Ramírez LE, Bustillos-Cristales R, Tapia-Herńandez A, Jiménez-Salgado T, Wang ET,
Martínez-Romero E, Caballero-Mellado J (2001) Novel nitrogen-fixing acetic acid bacteria,
Gluconacetobacter johannae sp. nov. And Gluconacetobacter azotocaptans sp. nov., associ-
ated with coffee plants. Int J Syst Evol Microbiol 51:1305–1314
Galzebrook J (1999) Genes controlling expression of defence responses in Arabidopsis. Curr Opin
Plant Biol 2:280–286
Gaspar T, Franck T, Bisbis B, Kevers C, Jouve L, Hausman JF, Dommes J (2002) Concepts in plant
stress physiology. Application to plant tissue cultures. Plant Growth Regul 37:263–285
Gaudin V, Vrain D, Jouanin L (1994) Bacterial genes modifying hormonal balance in plant. Plant
Physiol Biol 32:11–29
Gerhardt KE, Green berg BM, Glick BR (2006) The role of ACC deaminase in facilitating the
phytoremediation of organic metals and salt. Curr Trends Microbiol 2:61–73
Glass ADM (1989) Plant nutrition: an introduction to current concepts. Jones and Bartlett, Boston
Glick BR (2005) Modulation of plant ethylene levels by the enzyme ACC deaminase. FEMS
Glick BR, Karaturovic DM, Newell PC (1995) A novel procedure for rapid isolation of plant
growth promoting pseudomonads. Can J Microbiol 41:533–536
Glick BR, Penrose DM, Li J (1998) A model for lowering of plant ethylene concentrations by plant
growth-promoting rhizobacteria. J Theor Biol 190:63–68
Glick BR, Patten CL, Holquin G, Penrose DM (1999) Biochemical and genetic mechanisms used
by plant growth promoting bacteria. Imperial College Press, London
Glick BR, Todorovic B, Czarny J, Cheng Z, Duan J, McConkey B (2007) Promotion of plant
growth by bacterial ACC deaminase. Crit Rev Plant Sci 26:227–242
Goddard VJ, Bailey MJ, Darrah P, Lilley AK, Thompson IP (2001) Monitoring temporal and spa-
tial variation in rhizosphere bacterial population diversity: a community approach for the
improved selection of rhizosphere competent bacteria. Plant Soil 232:181–193
Goldstein AH (1986) Bacterial phosphate solubilization: historical perspective and future pros-
pects. Am J Altern Agric 1:51–57
Goldstein AH (1994) Involvement of the quinoprotein glucose dehydrogenises in the solubilization
of exogenous phosphates by Gram-negative bacteria. In: Gorini AT, Yagil E, Silver S (eds)
Phosphate in microorganisms: cellular and molecular biology. American Society for
Microbiology, Washington, DC, pp 197–203. ISBN 1-55581-265-1
Gracia De Salome IE, Hynes RK, Nelson LM (2001) Cytokinin production by plant growth pro-
moting rhizobacteria and selected mutants. Can J Microbiol 47:404–411
Gray EJ, Smith DL (2005) Intracellular and extracellular PGPR: commonalities and distinctions in
the plant-bacterium signaling processes. Soil Biol Biochem 37:395–412
Grichko VP, Glick BR (2001) Amelioration of flooding stress by ACC deaminase-containing plant
growth-promoting bacteria. Plant Physiol Biochem 39:11–17
Grover M, Ali SZ, Sandhya V, Rasul A, Venkateswarlu B (2011) Role of microorganisms in adap-
tation of agriculture crops to abiotic stresses. World J Microbiol Biotechnol 27:1231–1240
Gualtieri G, Bisseling T (2000) The evolution of nodulation. Plant Mol Biol 42:181–194
Gurska J, Wang W, Gerhardt KE, Khalid AM, Isherwood DM, Huang XD, Glick BR, Greenberg
BM (2009) Three year field test of a plant growth promoting rhizobacteria enhanced
phytoremediation system at a land farm for treatment of hydrocarbon waste. Environ Sci
Technol 43:4472–4479
Gutierrez-Mannero FJ, Ramos-Solano B, Probanza A, Mehouachi J, Tadeo FR, Talon M (2001)
The plant growth promoting rhizobacteria Bacillus pumilus and Bacillus licheniformis produce
high amounts of physiologically active gibberellins. Physiol Plant 111:206–211
Gyaneshwar P, Kumar GN, Parekh LJ, Poole PS (2002) Role of soil microorganisms in improving
P nutrition of plants. Plant Soil 245:83–93
Haas D, Défago G (2005) Biological control of soilborne pathogens by fluorescent pseudomonads.
Nat Rev Microbiol 3:307–319
Haba E, Pinazo A, Jauregui O, Espuny MJ, Infante MR, Manresa A (2003) Physicochemical char-
acterization and antimicrobial properties of rhamnolipids produced by Pseudomonas aerugi-
nosa 47T2 NCBIM 40044. Biotechnol Bioeng 81:316–322
Haiyin H, Silo-Suh LA, Handelsman J, Clardy J (1994) Zwittermicin A, an antifungal and plant
protection agent from Bacillus cereus. Tetrahedron Lett 35:2499–2502
Hallmann J, Rodriguez-Kabana R, Kloepper JW (1999) Chitin-mediated changes in bacterial com-
munities of the soil, rhizosphere and within roots of cotton in relation to nematode control. Soil
Biol Biochem 31:551–560
Hammerschmidt R, Kuc JA (1995) Lignification as a mechanism for induced systemic resistance
in cucumber. Physiol Plant Pathol 20:61–71
Handelsman J, Stabb EV (1996) Biocontrol of soil-borne plant pathogens. Plant Cell 8:
1855–1869
Hao Y, Charles TC, Glick BR (2007) ACC deaminase from plant growth promoting bacteria affects
crown gall development. Can J Microbiol 53:1291–1299
Hariprasad P, Niranjana SR (2009) Isolation and characterization of phosphate solubilizing rhizo-
bacteria to improve plant health of tomato. Plant Soil 316:13–24
Hariprasad P, Navya HM, Chandranayak S, Niranjana SR (2009) Advantage of using PSIRB over
PSRB and IRB to improve plant health in tomato. Biol Control 50:307–316
Hariprasad P, Divakara ST, Niranjana SR (2011) Isolation and characterization of chitinolytic rhi-
zobacteria for the management of Fusarium wilt in tomato. Crop Prot 30:1606–1612
Hariprasad P, Chandrashekar S, Brijesh Singh S, Niranjana SR (2013) Mechanism of plant growth
promotion and disease suppression by Pseudomonas aeruginosa strain 2apa. J Basic Microbiol
(DOI: 10.1002/jobm.201200491).
Hartmann A, Singh M, Klingmuller W (1983) Isolation and characterization of Azospirillum
mutants excreting high amounts of indoleacetic acid. Can J Microbiol 29:916–923
Hasegawa S, Poling SM, Maier VP, Bennett RD (1984) Metabolism of abscisic-acid bacterial
conversion to dehydrovomifoliol and vomifoliol dehydrogenase-activity. Phytochemistry
23:2769–2771
Hashizume H, Igarashi M, Sawa R, Adachi H, Nishimura Y, Akamatsu Y (2008) A new type
of tripropeptin with anteiso-branched chain fatty acid from Lysobacter sp. BMK333-48F3.
J Antibiot 61:577–582
Hassan HM, Fridovich I (1980) Mechanism of the antibiotic action pyocyanine. J Bacteriol
141:156–163
Hassett DJ, Woodruff WA, Wozniak DJ, Vasil ML, Cohen MS, Ohman DE (1993) Cloning of sodA
and sodB genes encoding manganese and iron superoxide dismutase in Pseudomonas aerugi-
nosa: demonstration of increased manganese superoxide dismutase activity in alginate-
producing bacteria. J Bacteriol 175:7658–7665
Henri F, Laurette NN, Annertte D, John Q, Wolfgang M, Francois-Xavier E, Dieudonné N (2008)
Solubilization of inorganic phosphates and plant growth promotion by strains of Pseudomonas
fluorescens isolated from acidic soils of cameron. Afr J Microbiol Res 2:171–178
Hilda R, Fraga R (1999) Phosphate solubilizing bacteria and their role in plant growth promotion.
Biotechnol Adv 17:319–339
Hiltner L (1904) Uber neuere erfahrungen und problem auf dem gebeit der bodenbakteriologie und
unter besonderer berucksichtigung der grund ungung und brache. Arb Dtsc Landwirt Ges
98:59–78
Hinsa SM, Espinosa-Urgel M, Ramos JL, O’Toole GA (2003) Transition from reversible to irre-
versible attachment during biofilm formation by Pseudomonas fluorescens WCS365 requires
an ABC transporter and a large secreted protein. Mol Microbiol 49:905–918
Hoffman T, Schmidt JS, Zheng X, Bent AF (1999) Isolation of ethylene-insensitive soybean
mutants that are altered in pathogen susceptibility and gene-for-gene disease resistance. Plant
Physiol 119:935–949
Hofte M, Woesyne MV, Verstraete W (1994) Role of siderophores in plant growth promotion and
plant protection by fluorescent pseudomonads. In: Manthey JA et al (eds) Biochemistry of
metal micronutrients in the rhizosphere. Lewis Publishers, Boca Raton, FL, pp 81–92
Hontzeas N, Zoidakis J, Glick BR, Abu-Omar MM (2004) Expression and characterization of
1-aminocyclopropane-1-carboxylate deaminase from the rhizobacterium Pseudomonas putida
UW4: a key enzyme in bacterial plant growth promotion. Biochim Biophys Acta 1703:11–19
Horemans S, Koninck KD, Neuray J, Hermans R, Vlassak K (1986) Production of plant growth
substances by Azospirillum sp. and other rhizosphere bacteria. Symbiosis 2:341–346
Horinouchi S (2002) A microbial hormone, A-factor, as a master switch for morphological differ-
entiation and secondary metabolism in Streptomyces griseus. Front Biosci 7:2045–2057
Howell CR, Stipanovic RD (1980) Suppression of Pythium ultimum-induced damping-off of cot-
ton seedlings by Pseudomonas fluorescens and its antibiotic, pyoluteorin. Phytopathology
70:712–715
Huang C, Chen CY (2004) Gene cloning and biochemical characterization of chitinase CH from
Bacillus cereus-28-9. Ann Microbiol 54:289–297
Huang C, Wang T, Chung S, Chen C (2005) Identification of an antifungal chitinase from a poten-
tial biocontrol agent, Bacillus cereus 28-9. J Biochem Mol Biol 38:82–88
Hughes J, Mellows G (1980) Interaction of pseudomonic acid A with Escherichia coli B isoleucyl-
tRNA synthetase. Biochemistry 191:209–219
Hussain A, Hasnain S (2009) Cytokinin production by some bacteria: Its impact on cell division in
cucumber cotyledons. Afr J Microbiol Res 3:704–712
Iavicoli A, Boutet E, Buchala A, Métraux JP (2003) Induced systemic resistance in Arabidopsis
thaliana in response to root inoculation with Pseudomonas fluorescens CHA0. Mol Plant
Idris EES, Iglesias DJ, Talon M, Borriss R (2007) Tryptophan-dependent production of Indole-3-
Acetic Acid (IAA) affects level of plant growth promotion by Bacillus amyloliquefaciens
FZB42. Mol Plant Microbe Interact 20:619–626
Illmer P, Schinner F (1995) Solubilization of inorganic calcium phosphates-solubilization mecha-
nisms. Soil Biol Biochem 27:257–263
Ilyas N, Bano A (2010) Azospirillum strains isolated from roots and rhizosphere soil of wheat
(Triticum aestivum L.) grown under different soil moisture conditions. Biol Fert Soil
46:393–406
Inbar O, Ron EZ (1993) Induction of cadmium tolerance in Escherichia coli K-12. FEMS
Islam Md T, Deora A, Hashidoko Y, Rahman A, Ito T, Tahara S (2007) Isolation and identification
of potential phosphate solubilizing bacteria from the rhizosphere of Oryza sativa L. cv. BR29
of Bangladesh. Z Natureforsch 62:103–110
Itoh S, Honda H, Tomita F, Suzuki T (1971) Rhamnolipids produced by Pseudomonas aeruginosa
grown on n-paraffin (mixture of C12, C13 and C14 fractions). J Antibiot 24:855–859
Jacobson CB, Pasternak JJ, Glick BR (1994) Partial purification and characterization of
1-aminocyclopropane-1-carboxylate deaminase from the plant growth promoting rhizobacte-
rium Pseudomonas putida GR12-2. Can J Microbiol 40:1019–1025
Jagadeesh KS, Kulkarni JH, Krishnaraj PU (2001) Evaluation of the role of fluorescent siderophore
in the biological control of bacterial wilt in tomato using Tn5 mutants of fluorescent
Pseudomonas sp. Curr Sci 81:882–883
Jaizme-Vega MDC, Rodriguez-Romero AS, Guerra MSP (2004) Potential use of rhizobacteria
from the Bacillus genus to stimulate the plant growth of micropropagated bananas. Fruit
59:83–90
Janiak AM, Milewski S (2001) Mechanism of antifungal action of kanosamine. Med Mycol 39:
401–408
Janzen R, Rood S, Dormar J, McGill W (1992) Azospirillum brasilense produces gibberellins in
pure culture and chemically-medium and in co-culture on straw. Soil Biol Biochem
24:1061–1064
Jiao Y, Yoshihara T, Ishikuri S, Uchino H, Ichihara A (1996) Structural identification of Cepaciamide
A, a novel fungitoxic compound from Pseudomonas cepacia D-202. Tetrahedron Lett
37:1039–1042
Jofré E, Fischer S, Rivarola V, Balegno H, Mori G (1998) Saline stress affects the attachment of
Azospirillum brasilense Cd to maize and wheat roots. Can J Microbiol 44:416–422
Joo GJ, Kim YM, Lee IJ, Song KS, Rhee IK (2004) Growth promotion of red pepper plug seed-
lings and the production of gibberellins by Bacillus cereus, Bacillus macroides and Bacillus
pumilus. Biotechnol Lett 26:487–491
Kamil Z, Rizk M, Saleh M, Moustafa S (2007) Isolation and identification of rhizosphere bacteria
and their potential in antifungal biocontrol. Global J Mol Sci 2:57–66
Kampert M, Strzelczyk E, Pokojska A (1975) Production of auxins by bacteria isolated from the
roots of pine seedlings (Pinus silvestris L.) and from soil. Acta Microbiol Pol 7:135–143
Kaper JM, Veldstra H (1958) On the metabolism of tryptophan by Agrobacterium tumefaciens.
Biochim Biophys Acta 30:401–420
Kate M, Bryant L (2007) Topical antibiotics—more harm than good. Focus. p.1. Archived from the
original on 2007-07-16
Kaymak HC, Yarali F, Guvenc I, Donmez FM (2008) The effect of inoculation with plant growth
rhizobacteria (PGPR) on root formation of mint (Mentha piperita L.) cuttings. Afr J Biotechnol
24:4479–4483
Kearns DB, Chu F, Rudner R, Losick R (2004) Genes governing swarming in Bacillus subtilis and
evidence for a phase variation mechanism controlling surface motility. Mol Microbiol 52:
357–369
Keel C, Schiner U, Maurhofer M, Voisard C, Laville J, Burger U, Wirthner P, Haas D, Defago G
(1992) Suppression of root diseases by Pseudomonas fluorescens CHA0: importance of the
bacterial secondary metabolite 2,4-diacetylphloroglucinol. Mol Plant Microbe Interact 5:4–13
Kennedy AC (1999) Bacterial diversity in agroecosystems. Agric Ecosyst Environ 74:65–76
Kennedy IR, Pereg-Gerk LL, Wood C, Deaker R, Glichrist K, Katupitiya S (1997) Biological
nitrogen fixation in non-leguminous field corps: facilitating the evolution of an effective asso-
ciation between Azospirillum and Wheat. Plant Soil 194:65–79
Khan MS, Zaidi A, Wani PA (2006) Role of phosphate-solubilizing microorganisms in sustainable
agriculture—a review. Agron Sustain Dev 26:1–15
Khan MS, Zaidi A, Wani PA (2007) Role of phosphate-solubilizing microorganisms in sustainable
agriculture-a review. Agron Sustain Dev 27:29–43
Khiyami M, Masmali I (2008) Characterization of thermostable chitinase enzyme of Bacillus
licheniformis isolated from red palm weevil gut. Aust J Basic Appl Sci 2:943–948
Kim KY, Mc Donald GA, Jordan D (1997) Solubilization of hydroxypatite by Enterobacter agglo-
merans and cloned Escherichia coli in culture medium. Biol Fertil Soils 24:347–352
Kim BS, Lee JY, Hwang BK (2000) In vivo control and in vitro antifungal activity of rhamnolipid
B, a glycolipid antibiotic, against Phytophthora capsici and Colletotrichum orbiculare. Pest
Manag Sci 56:1029–1035
Kishore GK, Pande S (2007) Chitin-supplemented foliar application of chitinolytic Bacillus cereus
reduces severity of Botrytis gray mold disease in chickpea under controlled conditions. Lett
Appl Microbiol 44:98–105
Kishore GK, Pande S, Podile AR (2005) Chitin-supplemented foliar application of Serratia

marcescens GPS 5 improves control of late leaf spot disease of groundnut by activating
defense-related enzymes. J Phytopathol 153:169–173
Kloepper JW, Scroth MN (1978) Plant growth-promoting rhizobacteria on radishes. In: Proceedings
of the fourth international Conference on Pl pathogenic bacteria, vol 2. Station de Pathologie
Vegetale et Phytobacteriologie, INRA, Angers, France, pp 879–882
Kloepper JW, Hume DJ, Scher FM, Singleton C, Tipping B, Laliberte M, Frauley K, Kutchaw T,
Simonson C, Lifshitz R, Zaleska I, Lee L (1988) Plant growth-promoting rhizobacteria on
canola (rape seed). Plant Dis 72:42–45
Kloepper JW, Lifshitz R, Zablotowicz RM (1989) Free-living bacterial inocula for enhancing crop
productivity. Trends Biotechnol 7:39–43
Kloepper JW, Zablokovisz RM, Tipping EM, Lifshitz R (1991) Plant growth promotion mediated
by bacterial rhizosphere colonizers. In: Keister DL, Cregan PB (eds) The rhizosphere and plant
growth. Kluwer Academic, The Netherlands, pp 315–326
Knoester M, van Loon LC, van den Heuvel J, Hennig J, Bol JF, Linthorst HJM (1998) Ethylene-
insensitive tobacco lacks non host resistance against soil-borne fungi. Proc Natl Acad Sci USA
95:1933–1937
Kobayashi M, Izui H, Nagasawa T, Yamada H (1993) Nitrilase in biosynthesis of the plant hor-
mone indole-3-acetic acid from indole-3-acetonitrile—cloning of the Alcaligenes gene and
site-directed mutagenesis of cysteine residues. Proc Natl Acad Sci 90:247–251
Koch B, Nielsen TH, Sorensen D, Andersen JB, Christophersen C, Molin S, Givskov M, Sorensen
J, Nybroe O (2002) Lipopeptide production in Pseudomonas sp. strain DSS73 is regulated by
components of sugar beet exudates via the Gac two component regulatory system. Appl
Environ Microbiol 68:4509–4516
Koda N, Asaeda T, Yamade K, Kawahara H, Obata H (2001) A novel cryoprotective protein (CRP)
with high activity from the ice nucleating bacterium, Pantoea agglomerans IFO12686. Biosci
Biotechnol Biochem 65:888–894
Kohler J, Hernandez JA, Caravaca F, Roldan A (2008) Plant growth promoting rhizobacteria and
arbuscular mycorrhizal fungi modify alleviation biochemical mechanisms in water-stressed
plants. Funct Plant Biol 35:141–151
Kokalis-Burelle N, Backman PA, Rodriguez-kabana R, Ploper LD (1992) Potential for biological
control of early leaf spot of peanut using Bacillus cereus and chitin as foliar amendments. Biol
Control 2:321–328
Kpomblekou K, Tabatabai MA (1994) Effect of organic acids on release of phosphorous from
phosphate rocks. Soil Sci 158:442–453
Kravchenko LV, Azarova TS, Makarova NM, Tikhonovich IA (2004) The effect of tryptophan of
plant root metabolites on the phytostimulating activity of rhizobacteria. Mikrobiologia
73:195–198
Kumar RS, Ayyadurai N, Pandiaraja P, Reddy AV, Venkateswarlu Y, Prakash O, Shakthivel N
(2005) Characterization of antifungal metabolite produced by a new strain of Pseudomonas
aeruginosa PUPa3 that exhibits broad-spectrum antifungal activity and biofertilizing traits.
J Appl Microbiol 98:145–154
Kumar SPP, Hariprasad P, Brijesh Singh S, Gowtham HG, Niranjana SR (2014) Structural and
functional diversity of rhizobacteria associated with Rauwolfia spp. across the Western Ghat
regions of Karnataka, India. World J Microbiol Biotechnol 30:163–173
Kunc F, Macura J (1988) Mechanism of adaptation and selection of microorganisms in the soil. In:
Vancura V, Kunc F (eds) Soil microbial associations. Elsevier, Amsterdam, pp 281–299
Kusukawa N, Yura T (1988) Heat-shock protein GroE of Escherichia coli: key protective roles
against thermal stress. Genes Dev 2:874–882
Lambert B, Leyns F, Van Rooyen L, Gossele F, Papon Y, Swings J (1987) Rhizobacteria of maize
and their antifungal activities. Appl Environ Microbiol 53:1866–1871
Lankford CE (1973) Bacterial assimilation of iron. Crit Rev Microbiol 2:273–331
Lawton KA, Friedrich L, Hunt M, Weymann K, Delaney T, Kessmann H, Staub T, Ryals J (1996)
Benzothiadiazole induces disease resistance in Arabidopsis by activation of the systemic
acquired resistance signal transduction pathway. Plant J 10:71–82
Lee B, Farag MA, Park HB, Kloepper JW, Lee SH, Ryu CM (2012) Induced resistance by a long-
chain bacterial volatile: elicitation of plant systemic defense by a C13 volatile produced by
Paenibacillus polymyxa. PLoS One 7:e48744
Leelasuphakul W, Sivanunsakul P, Phongpaichit S (2006) Purification, characterization and syner-
gistic activity of -1,3-glucanase and antibiotic extract from an antagonistic Bacillus subtilis.
Enzyme Microb Technol 38:990–997
Leeman M, Van Pelt JA, Den Ouden FM, Heinsbroek M, Bakker PAHM, Schippers BS (1995)
Induction of systemic resistance by Pseudomonas fuorescens in radish cultivars differing in
susceptibility to Fusarium wilt, using a novel bioassay. Eur J Plant Pathol 101:655–664
Leong J, Bitter W, Koster M, Marugg JD, Weisbeek PJ (1991) Genetics of iron transport in plant
growth-promoting Pseudomonas putida WCS358. In: Keister DL, Cregan PB (eds) The rhizo-
sphere and plant growth. Kluwer Academic, Dordrecht, The Netherlands, pp 271–278
Li J, Ovakim D, Charles TC, Glick BR (2000) An ACC deaminase minus mutant of Enterobacter
cloacae UW4 no longer promotes root elongation. Curr Microbiol 41:101–105
Liu L, Kloepper JW, Tuzun S (1995) Induction of systemic resistance in cucumber against fusar-
ium wilt by plant growth promoting rhizobacteria. Phytopathology 85:695–698
López CS, Heras H, Garda H, Ruzal S, Sánchez-Rivas C, Rivas E (2000) Biochemical and bio-
physical studies of Bacillus subtilis envelopes under hyperosmotic stress. Int J Food Microbiol
55:137–142
Lou H, Chen M, Black SS, Bushell SR, Ceccarelli M (2011) Altered antibiotic transport in ompc
mutants isolated from a series of clinical strains of multi-drug resistant E. coli. PLoS One
6(10):e25825
Lucy M, Reed E, Glick BR (2004) Applications of free living plant growth-promoting rhizobacte-
ria. Antonie Van Leeuwenhoek 86:1–25
Lugtenberg BJJ, Dekkers LC (1999) What makes Pseudomonas bacteria rhizosphere competent?
Lugtenberg BJJ, van Der Bij A, Blemberg G, Woeng TCA, Dekkers K, Kravchenko L, Mulders I,
Phoelich C, Simons M, Spink H, Tikhonovich I, De Weger L, Wijffelman C (1996) Molecular
basis of rhizosphere colonization by Pseudomonas bacteria. In: Stacey G, Mullin B, Gresshoff
PM (eds) Biology of plant-microbe interactions. Proceedings of eighth international sympo-
sium on mol plant-microbe interaction, Knoxville, TN, pp 433–440
Lugtenberg BJJ, Dekkers L, Bloemberg GV (2001) Molecular determinants of rhizosphere coloni-
zation by bacteria. Annu Rev Phytopathol 39:461–490
Lyon GD, Newton AC (1997) Do resistance elicitors offer new opportunities in integrated disease
control strategies? Plant Pathol 46:636–641
porum f. sp. radicis lycopersici in tomato plants treated with endophytic bacterium
Pseudomonas fluorescens strain 63–28. Physiol Mol Plant Pathol 50:301–320
Ma JH, Yao JL, Cohen D, Mom’s B (1998) Ethylene inhibitors enhance in vitro formation from
apple shoot cultures. Plant Cell Rep 17:211–214
Ma W, Zalec K, Glick BR (2001) Biological activity and colonization pattern of the bioluminescence-
labeled plant growth-promoting bacterium Kluyvera ascorbata SUD165/26. FEMS Microbiol
Ecol 35:137–144
Madigan MT, Oren A (1999) Thermophilic and halophilic extremophiles. Curr Opin Microbiol
2:265–269
Mahajan S, Tuteja N (2005) Cold, salinity and drought stresses: an overview. Arch Biochem
Biophys 444:139–158
Maksimov IV, Abizgil’dina RR, Pusenkova LI (2011) Plant growth promoting rhizobacteria as
alternative to chemical crop protectors from pathogens (Review). Appl Biochem Microbiol
47:333–345
Maloney PE, van Bruggen AHC, Hu S (1997) Bacterial community structure in relation to the
carbon environments in lettuce and tomato rhizospheres and in bulk soil. Microbial Ecol
34:109–117
Mandimba G, Heulin T, Bally R, Guckert A, Balandreau J (1986) Chemotaxis of free-living
nitrogen-fixing bacteria towards maize mucilage. Plant Soil 90:129–139
Manjula K, Podile AR (2001) Chitin-supplemented formulations improve biocontrol and plant
growth promoting efficiency of Bacillus subtilis AF 1. Can J Microbiol 47:618–625
Mantelin S, Touraine B (2004) Plant growth-promoting bacteria and nitrate availability impacts on
root development and nitrate uptake. J Exp Bot 55:27–34
Marasco EK, Schmidt-Dannert C (2008) Identification of bacterial carotenoid cleavage dioxygen-
ase homologues that cleave the interphenyl α, β double bond of stilbene derivatives via a mono-
oxygenase reaction. Chem Biol Chem 9:1450–1461
Marschner P, Timonen S (2006) Bacterial community composition and activity in rhizosphere of
roots colonized by arbuscular mycorrhizal fungi. In: Mukerji KG, Manoharachari C, Singh J
(eds) Microbial activity in the rhizosphere. Soil Biology 7:139-154. Springer, Berlin
Martens DA, Frankenberger WT (1994) Assimilation of exogenous 2’-14C-indole-3-acetic acid and
3’-14C-tryptophan exposed to the roots of three wheat varieties. Plant Soil 166:281–290
Masalha J, Kosegarten H, Elmaci O, Mengel K (2000) The central role of microbial activity for
iron acquisition in maize and sunflower. Biol Fert Soils 30:433–439
Mauch F, Mauch-Mani B, Boller T (1988) Antifungal hydrolasses in pea tissue: II. Inhibition of
fungal growth by combinations of chitinases and two β-1,3-glucanases. Plant Physiol 87:
936–942
Maurhofer M, Keel C, Schnider U, Voisard C, Haas D, Defago G (1992) Influence of enhanced
antibiotic production in Pseudomonas fluorescens strain CHA0 on its disease suppressive
capacity. Phytopathology 82:190–195
Maurhofer M, Hase C, Meuwly P, Metraux JP, Defago G (1994) Induction of systemic resistance
of tobacco to tobacco necrosis virus by the root-colonizing Pseudomonas fluorescens
strain CHAO: influence of the gacA gene and of pyoverdine production. Phytopathology
84:139–146
Mavingui P, Laguerre G, Berge O, Heulin T (1992) Genetic and phenotypic diversity of Bacillus
polymyxa in soil and wheat rhizosphere. Appl Environ Microbiol 58:1894–1903
Mavrodi DV, Blankenfeldt W, Thomashow LS (2006) Phenazine compounds in fluorescent
Pseudomonas spp. biosynthesis and regulation. Annu Rev Phytopathol 44:417–445
Mawdsley JL, Burns RG (1994) Root colonization by a Flavobacterium species and the influence
of percolating water. Soil Biol Biochem 26:861–870
Mayak S, Tirosh T, Glick BR (2004) Plant growth-promoting bacteria confer resistance in tomato
plants to salt stress. Plant Physiol Biochem 42:565–572
Meharg AA, Killham K (1995) Loss of exudates from the roots of perennial ryegrass inoculated
with a range of microorganisms. Plant Soil 170:345–349
Mercado-Blanco J, van der Drift KMGM, Olsson PE, ThomasOates JE, van Loon LC, Bakker
PAHM (2001) Analysis of the pmsCEAB gene cluster involved in biosynthesis of salicylic acid
and the siderophore pseudomonine in the biocontrol strain Pseudomonas fluorescens WCS374.
Meyer JM, Geoffroy VA, Baida N, Gardan L, Izard D, Lemanceau P, Achouak W, Palleroni NJ
(2002) Siderophore typing, a powerful tool for the identification of fluorescent and nonfluores-
cent pseudomonads. Appl Environ Microbiol 68:2745–2753
Meziane H, Van der Sluis I, Van Loon LC, Hofte M, Bakker PAHM (2005) Determinants of
Pseudomonas putida WCS358 involved in inducing systemic resistance in plants. Mol Plant
Pathol 6:177–185
Miller CM, Miller RV, Kenny DG, Redgrave B, Sears J, Condron MM, Teplow DB, Strobel GA
(1998) Ecomycins, unique antimycotics from Pseudomonas viridiflava. J Appl Microbiol 84:
937–944
Mirza MS, Mehnaz S, Normand P, Prigent-Combaret C, Moe¨nne-Loccoz Y, Bally R, Malik KA
(2006) Molecular characterization and PCR detection of a nitrogen-fixing Pseudomonas strain
promoting rice growth. Biol Fertil Soils 43:163–170
Mittler R (2006) Abiotic stress, the field environment and stress combination. Trends Plant Sci
11:15–19
Molina-Favero C, Creus CM, Lanteri ML, Correa-Aragunde N, Lombardo MC, Barassi CA,
Lamattina L (2007) Nitric oxide and plant growth promoting rhizobacteria: common features
influencing root growth and development. Adv Bot Res 46:1–33
Mordukhova EA, Skvortsova NP, Kochetkov VV, Dubei-kovskii AN, Boronin AM (1991) Synthesis
of the phytohormone indole-3-acetic acid by rhizosphere bacteria of the genus Pseudomonas.
Mikrobiologiya 60:494–500
Morris RO (1995) Genes specifying auxin and cytokinin biosynthesis in prokaryotes. In: Davies PJ
(ed) Plant hormones. Kluwer, Dordrecht, The Netherlands, pp 318–339
Mossialos D, Meyer JM, Budzikiewicz H, Wolff U, Koedam N, Baysse C, Anjaiah V, Cornelis P
(2000) Quinolobactin, a new siderophore of Pseudomonas fluorescens ATCC 17400, the pro-
duction of which is repressed by the cognate pyoverdine. Appl Environ Microbiol 66:
487–492
Mulkey TJ, Kuzmanoff KM, Evans ML (1982) Promotion of growth and shift in the auxin dose/
response relationship in maize roots treated with the ethylene biosynthesis inhibitors aminoe-
thoxyvinylglycine and cobalt. Plant Sci Lett 25:43948
Munchbach M, Dainese P, Staudenmann W, Narberhaus F, James P (1999) Proteome analysis of
heat-shock protein expression in Bradyrhizobium japonicum. Eur J Biochem 264:39–48
Murphy JF, Reddy MS, Ryu CM, Kloepper JW, Li R (2003) Rhizobacteria-mediated growth pro-
motion of tomato leads to protection against Cucumber mosaic virus. Phytopathology 93:
1301–1307
Nadeem M, Younis A, Riaz A, Hameed M (2012) Growth response of some cultivars of bermuda
grass (Cyanodon dactylon L.) to salt stress. Pak J Bot 44:1347–1350
Nagasawa T, Mauger J, Yamada H (1990) A novel nitrilase, arylacetonitrilase, of Alcaligenes fae-
calis JM3—purification and characterization. Eur J Biochem 194:765–772
Nahas E (1996) Factors determining rock phosphate solubilization by micro-organisms. World J
Nakayama T, Homma Y, Hashidoko Y, Mizutani J, Tahara S (1999) Possible role of xanthobaccins
produced by Stenotrophomonas sp. strain SB-K88 in suppression of sugar beet damping-off
disease. Appl Environ Microbiol 55:4334–4339
Neidhardt F, Van Bogelen RA (1987) Heat shock response. In: Neidhardt FC, Ingraham JL, Low
KB, Magasanik B, Schaechter M, Umbarger E (eds) Escherichia coli and Salmonella
typhimurium, vol 2. American Society of Microbiology, Washington, DC, pp 1334–1345
Neiland JB (1981) Microbial iron compounds. Annu Rev Biochem 50:715–731
Nielsen TH, Thrane C, Christophersen C, Anthoni U, Sorensen J (2000) Structure, production
characteristics and fungal antagonism of tensin—a new antifungal cyclic lipopeptide from
Pseudomonas fluorescens strain 96.578. J Appl Microbiol 89:992–1001
Nieto KF, Frankenberger WT Jr (1989) Biosynthesis of cytokinin by Azotobacter chroococcum.
Soil Biol Biochem 21:967–972
Nihorimbere V, Cawoy H, Seyer A, Brunelle A, Thonart P, Ongena M (2012) Impact of rhizosphere
factors on cyclic lipopeptide signature from the plant beneficial strain Bacillus amyloliquefa-
ciens S499. FEMS Microbiol Ecol 79:176–191
Niki T, Mitsuhara I, Seo S, Ohtsubo N, Ohashi Y (1998) Antagonistic effects of salicylic acid and
jasmonic acid on the expression of pathogenesis-related (PR) protein genes in wounded mature
tobacco leaves. Plant Cell Physiol 39:500–507
Niranjana SR, Hariprasad P (2012) Serratia—an under estimated potential plant growth promoting
and bioprotecting rhizobacteria. Biopestic Int 8:49–62
Nowak-Thompson B, Chaney N, Wing JS, Gould SJ, Loper JE (1999) Characterization of the
pyoluteorin biosynthetic gene cluster of Pseudomonas fluorescens Pf-5. J Bacteriol 181:
2166–2174
Oberhansli T, Défago G, Haas D (1991) Indole-3-acetic-acid (IAA) synthesis in the biocontrol
strain CHA0 of Pseudomonas fluorescens—role of tryptophan side-chain oxidase. J Gen
Microbiol 137:2273–2279
Okon Y, Labandera-Gonzalez CA (1994) Agronomic applications of Azospirillum. An evaluation

of 20 years worldwide field inoculation. Soil Biol Biochem 26:1591–1601
Oldroyd GED (2007) Nodules and hormones. Science 315(5808):52–53
Omar SA (1998) The role of rock phosphate solubilizing fungi and vesicular arbuscular mycor-
rhizae (VAM) in growth of wheat plants facilitated with rockphosphate. World J Microbiol
Biotechnol 14:211–218
Ongena M, Daayf F, Jacques P, Thonart P, Benhamou N, Paulitz TC, Cornelis P, Koedam N,
Belanger RR (1999) Protection of cucumber against Pythium root rot by fluorescent pseudo-
monads: predominant role of induced resistance over siderophore and antibiosis. Plant Pathol
48:66–76
Ongena M, Giger A, Jacques P, Dommes J, Thonart P (2002) Study of bacterial determinants
involved in the induction of systemic resistance in bean by Pseudomonas putida BTP1. Eur J
Plant Pathol 108:187–196
Patten CL, Glick BR (1996) Bacterial biosynthesis of indole-3-acetic acid. Can J Microbiol
42:207–220
Patten CL, Glick BR (2002) Role of Pseudomonas putida indole acetic acid in development of the
host plant root system. Appl Environ Microbiol 68:3795–3801
Paul D, Nair S (2008) Stress adaptations in a plant growth promoting rhizobacterium (PGPR) with
increasing salinity in the coastal agricultural soils. J Basic Microbiol 48:378–384
Penninckx IAMA, Eggermont K, Terras FRG, Thomma BPHJ, De Samblanx GW, Buchala A,
Métraux J-P, Manners JM, Broekaert WF (1996) Pathogen-induced systemic activation of a
plant defensin gene in Arabidopsis follows a salicylic acid–independent pathway. Plant Cell
8:2309–2323
Perley JW, Stowe BB (1966) On the ability of Taphrina deformans to produce indoleacetic acid
from tryptophan by way of tryptamine. Plant Physiol 41:234–237
Pierson EA, Wood DW, Cannon JA, Blachere FM, Pierson LS III (1998) Interpopulation signaling
via N-acyl homoserine lactones among bacteria in the wheat rhizosphere. Mol Plant Microbe
Interact 11:1078–1084
Pieterse CMJ, van Loon LC (1999) Salicylic acid-independent plant defence pathways. Trends
Plant Sci 4:52–58
Pieterse CMJ, Van Wees SCM, Hoffland E, Van Pelt JA, Van Loon LC (1996) Systemic resistance
in Arabidopsis induced by biocontrol bacteria is independent of salicylic acid accumulation
and pathogenesis-related gene expression. Plant Cell 8:1225–1237
Pieterse CMJ, Van Wees SCM, Van Pelt JA, Knoester M, Laan R, Gerrits H, Weisbeek PJ, Van
Loon LC (1998) A novel signalling pathway controlling induced systemic resistance in
Arabidobsis. Plant Cell 10:1571–1580
Pieterse CMJ, Ton J, Van Loon LC (2001) Cross-talk between plant defence signalling pathways:
boost or burden? AgBiotechNet 3:ABN 068
Pieterse CMJ, Van Wees SCM, Ton J, Van Pelt JA, Van Loon LC (2002) Signaling in rhizobacteria-
induced systemic resistance in Arabidopsis thaliana. Plant Biol 4:535–544
Piuri M, Sanchez-Rivas C, Ruzal SM (2005) Cell wall modifications during osmotic stress in
Lactobacillus casei. J Appl Microbiol 98:84–95
Press CM, Wilson M, Tuzun S, Kloepper JW (1997) Salicylic acid produced by Serratia marces-
cens 90-166 is not the primary determinant of induced systemic resistance in cucumber or
tobacco. Mol Plant Microbe Interact 6:761–768
Press CM, Loper JE, Kloepper JW (2001) Role of iron in rhizobacteria mediated induced systemic
resistance of cucumber. Phytopathology 91:593–598
Prinsen E, Costacurta A, Michiels K, Vanderleyden J, Van Onckelen H (1993) Azospirillum
brasilense indole-3-acetic acid biosynthesis: evidence for a non-tryptophan dependent path-
way. Mol Plant Microb Interact 6:609–615
Qi F, Merritt J, Lux R, Shi W (2004) Inactivation of the ciaHgene in Streptococcus mutans
diminishes mutacin production and competence development, alters sucrose-dependent biofilm
formation, and reduces stress tolerance. Infect Immun 72:4895–4899
Raaijmakers JM, van der Sluis I, Koster M, Bakker PAHM, Welsbeek PJ, Schippers B (1995)
Utilization of heterologous siderophores and rhizosphere competence of fluorescent
Pseudomonas spp. Can J Microbiol 41:126–135
Raaijmakers JM, Weller DM, Thomashow L (1997) Frequency of antibiotics producing spp. in
natural environments. Appl Environ Microbiol 63:881–887
Raaijmakers JM, Vlami M, de Souza JT (2002) Antibiotic production by bacterial biocontrol
agents. Antonie Van Leeuwenhoek 81:537–547
Radjacommare R, Kandan A, Nandakumar R, Samiyappan R (2004) Association of the hydrolytic
enzyme chitinase against Rhizoctonia solani in rhizobacteria-treated rice plants. J Phytopathol
152:365–370
Raj NS, Shett NP, Shetty HS (2004) Seed bio-priming with Pseudomonas fluorescens isolates
enhances growth of pearl millet plants and induces resistance against downy mildew. Int J Pest
Manage 50:41–48
Raj NS, Lavanya SN, Amruthesh KN, Niranjana SR, Reddy MS, Shetty HS (2012) Histo-chemical
changes induced by PGPR during induction of resistance in pearl millet against downy mildew
disease. Biol Control 60:90–102
Ramos-Solano B, García JAL, Garcia-Villaraco A, Algar E, Garcia-Cristobal J, Mañero FJG
(2010) Siderophore and chitinase producing isolates from the rhizosphere of Nicotiana glauca
Graham enhance growth and induce systemic resistance in Solanum lycopersicum L. Plant Soil
334:189–197
Ran LX, Li ZN, Wu GJ, Van Loon LC, Bakker PAHM (2005) Induction of systemic resistance
against bacterial wilt in Eucalyptus urophylla by fluorescent Pseudomonas spp. Eur J Plant
Pathol 113:59–70
Rana A, Saharan B, Joshi M, Prasanna R, Kumar K, Nain L (2011) Identification of multi-trait
PGPR isolates and evaluating their potential as inoculants for wheat. Ann Microbiol 61:
893–900
Rane MR, Sarode PD, Chaudhar BL, Chincholkar SB (2007) Detection isolation and identification
of phenzine-1-carboxylic acid produced by biocontrol strains of Pseudomonas aeruginosa.
J Sci Ind Res 66:627–631
Reed MLE, Glick BR (2005) Growth of canola (Brassica napus) in the presence of plant growth-
promoting bacteria and either copper or polycyclic aromatic hydrocarbons. Can J Microbiol
51:1061–1069
Reinhold-Hurek B, Hurek T, Gillis M, Hoste B, Vancanneyt M, Kersters K, De Ley J (1993)
Azoarcus gen. nov., nitrogen-fixing proteobacteria associated with roots of Kallar grass
(Leptochloa fusca (L.) Kunth) and description of two species Azoarcus indigens sp. nov. and
Azoarcus communis sp. nov. Int J Syst Bacteriol 43:574–584
Reyes I, Valery A, Valduz Z (2006) Phosphate-solubilizing microorganisms isolated from rhizo-
spheric and bulk soils of colonizer plants at an abandoned rock phosphate mine. Plant Soil
287:69–75
Richardson AE (2001) Prospects for using soil microorganism to improve the acquisition of phos-
phate by plant. Aus J Plant Physiol 28:897–906
Riggs PJ, Chelius MK, Iniguez AL, Kaeppler SM, Triplett EW (2001) Enhanced maize productiv-
ity by inoculation with diazotrophic bacteria. Aus J Plant Physiol 28:829–836
Riley MA, Wertz JE (2002) Bacteriocins: evolution, ecology and application. Annu Rev Microbiol
56:117–137
Rodriguez JA, Nanos N, Grau JM, Gil L, Lopez-Arias M (2008) Multiscale analysis of heavy
metal contents in Spanish agricultural topsoils. Chemosphere 70:1085–1096
Roessler M, Müller V (2001) Osmoadaptation in Bacteria and Archaea: common principles and
differences. Environ Microbiol 3:743–754
Ross AF (1961a) Localized acquired resistance to plant vinis infection in hypersensitive hosts.
Ross AF (1961b) Systemic acquired resistance induced by localized virus infections in plants.
Rovira AD (1969) Plant root exudates. Bot Rev 35:35–57

Ryan PR, Delhaize E, Jones DL (2001) Function and mechanism of organic anion exudation from
plant roots. Annu Rev Plant Physiol Plant Mol Biol 52:527–560
Ryu C-M, Farag MA, Hu C-H, Reddy MS, Wei HX, Paré PW, Kloepper JW (2003) Bacterial vola-
tiles promote growth in Arabidopsis. Proc Natl Acad Sci U S A 100:4927–4932
Ryu CM, Farag MA, Hu CH, Reddy MS, Kloepper JW, Pare PW (2004) Bacterial volatiles induce
systemic resistance in Arabidopsis. Plant Physiol 134:1017–1026
Salisbury FB (1994) The role of plant hormones. In: Wilkinson RE (ed) Plant-environment interac-
tions. Marcel Dekker, New York, pp 39–81
Salisbury FB, Ross CW (1992) Plant physiology. Wadsworth, Belmont, CA, pp 127–138
Sandhya V, Ali SZ, Grover M, Reddy G, Venkateswarlu B (2009) Alleviation of drought stressef-
fects in sunflower seedlings by the exopolysaccharides producing Pseudomonas putida strain
GAP-P45. Biol Fertil Soils 46:17–26
Saravanakumar D, Samiyappan R (2007) ACC deaminase from Pseudomonas fluorescens
mediated saline resistance in groundnut (Arachis hypogaea) plants. J Appl Microbiol 102:
1283–1292
Sattely ES, Walsh CT (2008) A latent oxazoline electrophile for N-O-C bond formation in pseudo-
monine biosynthesis. J Am Chem Soc 130:12282–12284
Sayyed RZ, Chincholkar SB (2009) Siderophore-producing Alcaligenes feacalis exhibited more
biocontrol potential Vis-à-Vis chemical fungicide. Curr Microbiol 58:47–51
Scher FM, Baker R (1982) Effect of Pseudomonas putida and a synthetic iron chelator on induc-
tion of soil suppressiveness to Fusarium wilt pathogens. Phytopathology 72:1567–1573
Scher FM, Kloepper JW, Singleton CA (1985) Chemotaxis of fluorescent Pseudomonas spp. to
soybean seed exudates in vitro and in soil. Can J Microbiol 31:570–574
Schultze M, Kondorosi A (1998) Regulation of symbiotic root nodule development. Annu Rev
Genet 32:33–57
Senthil Kumar R, Parthibhan KT, Govinda Rao M (2009) Molecular characterization of Jatropha
genetic resources through inter-simple sequence repeat (ISSR) markers. Mol Biol Rep
36:1951–1956
Sessitsch A, Howieson JG, Perret X, Antoun H, Martinez-Romero E (2002) Adavances in
Rhizobium research. Crit Rev Plant Sci 21:323–378
Shah J, Tsui F, Klessig DF (1997) Characterization of a salicylic acid–insensitive mutant (sai1) of
Arabidopsis thaliana, identified in a selective screen utilizing the SA-inducible expression of
the tms2 gene. Mol Plant Microbe Interact 10:69–78
Siddiqui IA, Shaukat SS (2003) Suppression of root-knot disease by Pseudomonas fluorescens
CHA0 in tomato: importance of bacterial secondary metabolite, 2,4-diacetylphloroglucinol.
Silo-Suh LA, Lethbridge BJ, Raffel SJ, He H, Clardy J, Handelsman J (1994) Biological activities
of two fungistatic antibiotics produced by Bacillus cereus UW85. Appl Environ Microbiol
60:2023–2030
Silo-suh LA, Stab VE, Raffel SR, Handelsman J (1998) Target range of Zwittermicin A, an
Aminopolyol antibiotic from Bacillus cereus. Curr Microbiol 37:6–11
Singh P, Cameotra SS (2004) Potential applications of microbial surfactants in biomedical sci-
ences. Trends Biotechnol 22:142–146
Siwayaprahm P, Audtho M, Ohmiya K, Wiwat C (2006) Purification and characterization of a
Bacillus circulans No. 41 chitinase expressed in Escherichia coil. World J Microbial Biotechnol
22:331–335
Skvortsov IM, Ignatov VV (1998) Extracellular polysaccharides and polysaccharide-containing
biopolymers from Azospirillum species: properties and the possible role in interaction with
plant roots. FEMS Microbiol Lett 165:223–229
Sleator RD, Hill C (2002) Bacterial osmoadaptation: the role of osmolytes in bacterial stress and
virulence. FEMS Microbiol Rev 26:49–71
Sorensen J (1997) The rhizosphere as a habitat for soil microorganisms. In: van Elsa JD, Trevors
JT, Welington EMH (eds) Modern soil ecology. Marcel Dekker, New York, pp 21–46
Sotirova AV, Spasova DI, Galabova DN, Karpenko E, Shulga A (2008) Rhamnolipid–biosurfactant
permeabilizing effects on gram-positive and gram-negative bacterial strains. Curr Microbiol
56:639–644
Spaepen S, Dobbelaere S, Croonenborghs A, Vanderleyden J (2008) Effects of Azospirillum
brasilense indole-3-acetic acid production on inoculated wheat plants. Plant Soil 312:15–23
Srivastava LM (2002) Plant growth and development: hormones and environment. Academic,
San Diego
Stabb EV, Handelsman J (1998) Genetic analysis of zwittermicin A resistance in Escherichia coli:
effects on membrane potential and RNA polymerase. Mol Microbiol 27:311–322
Staunton S, Leprince F (1996) Effect of ph and some organic anions on the solubility of soil phos-
phate: implications for P bioavailability. Eur J Soil Sci 47:231–239
Stevens PJG, Walker JTS, Shaw PW, Suckling DM (1994) Organosilicone surfactants: tools for
horticultural crop protection. BCPC Pests Dis 2:755–760
Stitcher L, Mauch-Mani B, Metraux JP (1997) Systemic acquired resistance. Annu Rev Phytopathol
35:235–270
Strzelczyk E, Pokojska-Burdziej A (1984) Production of auxins and gibberellin like substances by
mycorrhizal fungi, bacteria and actinomycetes isolated from soil and mycorhizosphere of pine
(Pinus silvestris L.). Plant Soil 81:185–194
Subba Rao NS (1982) Advances in agricultural microbiology. Oxford and IBH Publishing, Delhi
Tahmatsidou V, O’Sullivan J, Cassells AC, Voyiatzis D, Paroussi G (2006) Comparison of AMF
and PGPR inoculants for the suppression of Verticillium wilt of strawberry (Fragaria ananassa
cv. Selva). Appl Soil Ecol 32:316–324
Taize L, Zeiger E (2006) Plant physiology, 4th edn. Sinauer Association, Sunderland, MA,
http://4e.plantphys.net
Takeuchi Y, Yoshikawa M, Takeba G, Tanaka K, Shibata D, Horino O (1990) Molecular cloning
and ethylene induction of mRNA encoding a phytoalexin elicitor-releasing factor, β‐1,3‐gluca-
nase, in soybean. Plant Physiol 93:673–682
Taller BJ, Wong TY (1989) Cytokinins in Azobacter vinelandii culture medium. Appl Environ
Tanaka H, Watanabe T (1995) Glucanases and chitinases of Bacillus circulans WL-12. J Ind
Tans-Kersten J, Huang H, Allen C (2001) Ralstonia solanacearum needs motility for invasive viru-
lence on tomato. J Bacteriol 183:3597–3605
Teplitski M, Robinson JB, Bauer WD (2000) Plants secrete substances that mimic bacterial N-acyl
homoserine lactone signal activities and affect population density dependent behaviors in asso-
ciated bacteria. Mol Plant Microbe Int 13:637–648
Theunis M, Kobayashi H, Broughton WJ, Prinsen E (2004) Flavonoids, NodD1, NodD2, and nod-
box NB15 modulate expression of the y4wEFG locus that is required for indole-3-acetic acid
synthesis in Rhizobium sp. strain NGR234. Mol Plant Microbe Interact 17:1153–1161
Thomashow LS, Weller DM (1988) Role of a phenazine antibiotic from Pseudomonas fluorescens
in biological control of Gaeumannomyces graminis var. tritici. J Bacteriol 170:3499–3508
Thomashow LS, Bonsall RF, Weller DM (1997) Antibiotic production by soil and rhizosphere
microbes in situ. In: Hurst CJ, Knudsen GR, McInerney MJ, Stetzenbach LD, Walter MV (eds)
Manual of environmental microbiology, 1st edn. American Society of Microbiology,
Washington, DC, pp 493–499
Thomma BPHJ, Eggermont K, Penninckx IAMA, Mauch-Mani B, Vogelsang R, Cammue BPA,
Broekaert WF (1998) Separate jasmonate-dependent and salicylate-dependent defense-
response pathways in Arabidopsis are essential for resistance to distinct microbial pathogens.
Proc Natl Acad Sci U S A 95:15107–15111
Thrane C, Nielsen TH, Nielsen MN, Olsson S, Sorensen J (2000) Viscosinamide producing
Pseudomonas fluorescens DR54 exerts biocontrol effect on Pythium ultimum in sugar beet
rhizosphere. FEMS Microbiol Ecol 33:139–146
Tien TM, Gaskins MH, Hubbell DH (1979) Plant growth substances produced by Azospririllum
brasilense and their effect on the growth of pearl millet (Pennisetum americanum L.). Appl
Tilak KVBR, Ranganayaki N, Pal KK, De R, Saxena AK, Nautiyal CS, Mittal S, Tripathi AK,
Johri BN (2005) Diversity of plant growth and soil health supporting bacteria. Curr Sci
89:136–150
Timmusk S, Grantcharova N, Wagner EGH (2005) Paenibacillus polymyxa invades plant roots and
forms bio-films. Appl Environ Microbiol 11:7292–7300
Tisdale SL, Nelson WL, Beaton JD, Havlin JL (1993) Soil fertility and fertilizers, 5th edn.
Macmillan, New York, p 634
Toshima BH, Maru K, Saito M, Ichihara A (1999) Study on fungitoxic 3-amino-2-piperidinone-
containing lipids: total syntheses of cepaciamides A and B. Teterahedron Lett 40:939–942
Toth IK, Newton JA, Hyman LJ, Lees AK, Daykin M, Ortori C, Williams P, Fray RG (2004) Potato
plants genetically modified to produce N-acylhomoserine lactones increase susceptibility to
soft rot erwiniae. Mol Plant Microbe Interact 17:880–87161
Tripathi RK, Gottlieb D (1969) Mechanism of action of the antifungal antibiotic pyrrolnitrin.
Tripathi M, Munot HP, Schouche Y, Meyer JM, Goel R (2005) Isolation and functional character-
ization of siderophore-producing lead and cadmium-resistant Pseudomonas putida KNP9.
Curr Microbiol 50:233–237
Tuzun S (2001) The relationship between pathogen-induced systemic resistance (ISR) and multi-
genic (horizontal) resistance in plants. Eur J Plant Pathol 107:85–93
Ugoji EO, Laing MD, Hunter CH (2005) Colonization of Bacillus spp. on seeds and in plant rhi-
zoplane. J Environ Biol 26:459–466
Upadhyay SK, Maurya SK, singh DP (2012) Salinity tolerance in free living plant growth promot-
ing rhizobacteria. Indian J Sci Res 3:73–78
Uren NC (2000) Types, amounts and possible functions of compounds released into the rhizo-
sphere by soil grown plants. In: Pinton R, Varani Z, Nanniperi P (eds) The rhizosphere: bio-
chemistry, and organic substances at the soil interface. Marcel Dekker, New York, pp 19–40
Vaidya RJ, Roy S, Macmil S, Gandhi S, Vyas P, Chhatpar HS (2003) Purification and characteriza-
tion of chitinase from Alcaligenes xylosoxydans. Biotehnol Lett 25:715–717
Van Loon LC, Bakker PAHM, Pieterse CMJ (1998) Systemic resistance induced by rhizosphere
bacteria. Annu Rev Phytopathol 36:453–483
Van Overbeek LS (2013) Exploration of hitherto-uncultured bacteria from the rhizosphere. In: de
Bruijn FJ (ed) Molecular microbial ecology of the rhizosphere, vol 1 & 2. Wiley, Hoboken, NJ.
doi:10.1002/9781118297674.ch16
Van Peer R, Niemann GJ, Schippers B (1991) Induced resistance and phytoalexin accumulation in
biological control of Fusarium wilt of carnation by Pseudomonas sp. strain WCS417r.
Van Wees S, Pieterse CMJ, Trijssenaar A, Van´t Westende YAM, Hartog F, Van Loon LC (1997)
Differential induction of systemic resistance in Arabidobsis by biocontrol bacteria. Mol Plant
Van Wees SCM, Luijendijk M, Smoorenburg I, Van Loon LC, Pieterse CMJ (1999) Rhizobacteria-
mediated induced systemic resistance (ISR) in Arabidopsis is not associated with a direct effect
on expression of known defense-related genes but stimulates the expression of the
jasmonate-inducible gene Atvsp upon challenge. Plant Mol Biol 41:537–549
Van Wees SCM, de Swart EAM, Van Pelt JA, Van Loon LC, Pieterse CMJ (2000) Enhancement of
induced disease resistance by simultaneous activation of salicylate and jasmonate dependent
defence pathways in Arabidopsis thaliana. Proc Natl Acad Sci 97:8711–8716
Vande Broek A, Vanderleyden J (1995) The role of bacterial motility, chemotaxis, and attachment
in bacteria-plant interactions. Mol Plant Microbe Interact 8:800–810
Vande Broek A, Lambrecht M, Eggermont K, Vanderleyden J (1999) Auxins upregulate expression
of the indole-3-pyruvate decarboxylase gene in Azospirillum brasilense. J Bacteriol 181:
1338–1342
Vande Broek A, Gysegom P, Ona O, Hendrickx N, Prinsen E, Van Impe J, Vanderleyden J (2005)
Transcriptional analysis of the Azospirillum brasilense indole-3-pyruvate decarboxylase gene
and identification of a cis-acting sequence involved in auxin responsive expression. Mol Plant
Vesper SJ (1987) Production of pili (fimbriae) by Pseudomonas xuorescens and correlation with
attachment to corn roots. Appl Environ Microbiol 53:1397–1403
Vessey JK (2003) Plant growth promoting rhizobacteria as biofertilizers. Plant Soil 255:571–586
Vijayan P, Shockey J, Levesque CA, Cook RJ, Browse J (1998) A role for jasmonate in pathogen
defense of Arabidopsis. Proc Natl Acad Sci U S A 95:7209–7214
Villegas J, Fortin JA (2002) Phosphorous solubilization and pH changes as a result of the interac-
tions between soil bacteria and arbuscular mycorrhizae fungi on a medium containing no3 as
nitrogen source. Can J Bot 80:571–576
Visca P, Imperi F, Lamont IL (2007) Pyoverdine siderophores: from biogenesis to biosignificance.
Trends Microbiol 15:22–30
Voisard C, Keel C, Haas D, Defago G (1989) Cyanide production by Pseudomonas fluorescens
helps suppress black root rot of tobacco under gnotobiotic conditions. Eur Mol Biol Org J 8:
351–358
Walker TS, Bais HP, Grotwewold E, Vivanco JM (2003) Root exudation and rhizosphere biology.
Plant Physiol 132:44–51
Walsh C, Pascal RA Jr, Johnston M, Raines R, Dikshit D, Krantz A, Honma M (1981) Mechanistic
studies on the pyridoxal phosphate enzyme 1-aminocyclopropane-1-carboxylate deaminase
from Pseudomonas sp. Biochemistry 20:7509–7519
Walsh UF, Morrissey JP, O’Gara F (2001) Pseudomonas for biocontrol of phytopathogens: from
functional genomics to commercial exploitation. Curr Opin Biotechnol 12:289–295
Wang S, Chang W (1997) Purification and characterization of two bifunctional chitinase/lyso-
zymes extracellularly produced by Pseudomonas aeruginosa K-187 in a shrimp and crab shell
powder medium. Appl Environ Microbiol 63:380–386
Wang Y, Brown HN, Crowley DE, Szaniszlo PJ (1993) Evidence for direct utilization of a sidero-
phore, ferrioxamine B, in axenically grown cucumber. Plant Cell Environ 16:579–585
Wang CKE, Glick BR, Defago G (2000) Effect of transferring 1-aminocyclopropane-1-carboxylic
acid (ACC) deaminase genes into Pseudomonas fluorescens strain CHA0 and its gacA deriva-
tive CHA96 on their growth-promoting and disease-suppressive capacities. Can J Microbiol
46:898–907
Watt M, Hugenholtz P, White R, Vinall K (2006) Numbers and locations of native bacteria on field
grown wheat roots quantified by fluorescence in situ hybridization. Environ Microbiol 71:
1291–1299
Wei G, Kloepper JW, Tuzun S (1991) Induction of systemic resistance of cucumber to
Colletotrichum orbiculare by select strains of plant growth-promoting rhizobacteria.
Weller DM, Landa BB, Mavrodi OV, Schroeder KL, De La Fuente L, Bankhead SB, Molar RA,
Bonsall RF, Mavrodi DM, Thomashow LS (2007) Role of 2,4-diacetylphloroglucinol produc-
ing fluorescent Pseudomonas spp. in plant defence. Plant Biol 9:4–20
Werner T, Motyka V, Strnad M, Schmulling T (2001) Regulation of plant growth by cytokinin.
Whipps JM (2001) Microbial interaction and biocontrol in the rhizosphere. J Exp Bot 52:
487–511
Whitehead NA, Barnard AML, Slater H, Simpson NJL, Salmond GPC (2001) Quorum-sensing in
Gram-negative bacteria. FEMS Microbiol Rev 25:365–404
Whitelaw MA (2000) Growth promotion of plants inoculated with phosphate solubilizing fungi.
Adv Agron 69:99–151
Winkelmann G (ed) (1991) Handbook of microbial iron chelates. CRC Press, Boca Raton, FL
Winkelmann G, van der Helm D, Neilands JB (1987) Iron transport in microbes, plants and ani-
mals. VCH Press, Weinheim
Wu S, Fallon RD, Payne MS (1997) Over-production of stereoselective nitrile hydratase from
Pseudomonas putida 5B in Escherichia coli: requirement for a novel downstream protein. Appl
Xie H, Pasternak JJ, Glick BR (1996) Isolation and characterization of mutants of the plant growth-
promoting rhizobacterium Pseudomonas putida GR12–2 that overproduce indoleacetic acid.
Yadav BK and Verma A (2012) Phosphate solubilization and mobilization in soil through microor-
ganisms under arid ecosystems. In Ali M (ed) The functioning of ecosystems. ISBN:978-953-
51-0573-2, In Tech, Available from:http://www.intechopen.com/books/the-functioning-of-eco-
systems/phosphate-solubilization-and-mobilization-in-soil-through-microorganisms-under-arid-
ecosystems
Yamada Y (1999) Autoregulatory factors and regulation of antibiotic production in Streptomyces.
In: England R, Hobbs G, Bainton N, Roberts ML (eds) Microbial signalling and communica-
tion. Society for General Microbiology, Cambridge, pp 177–196
Yamada Y, Nihira T (1998) Microbial hormones and microbial chemical ecology. In: Barton DHR,
Nakanishi K, Meto-Cohn O (eds) Comprehensive natural products chemistry, vol 8. Elsevier,
Oxford, pp 377–413
Yancey PH (2005) Organic osmolytes as compatible, metabolic and counteracting cytoprotectants
in high osmolarity and other stresses. J Exp Biol 208:2819–2830
Yang CH, Crowley DE (2000) Rhizosphere microbial community structure in relation to root loca-
tion and plant iron nutritional status. Appl Environ Microbiol 66:345–351
Yang J, Kloepper JW, Ryu CM (2009) Rhizosphere bacteria help plants tolerate abiotic stress.
Trends Plant Sci 14:1–4
Yasmin F, Othman R, Sijam K, Saad MS (2009) Characterization of beneficial properties of
plant growth-promoting rhizobacteria isolated from sweet potato rhizosphere. Afr J Microbiol
Res 3:815–821
Zahir ZA, Ghani U, Naveed M, Nadeem SM, Arshad M (2009) Comparative effectiveness of
Pseudomonas and Serratia sp. containing ACC-deaminase for improving growth and yield of
wheat under salt-stressed conditions. Arch Microbiol 191:415–424
Zdor RE, Anderson AJ (1992) Influence of root colonizing bacteria on the defense responses of
bean. Plant Soil 140:99–107
Zhang H, Kim MS, Krishnamachari V, Payton P, Sun Y, Grimson M, Farag MA, Ryu CM, Allen R,
Melo IS, Pare PW (2007) Rhizobacterial volatile emissions regulate auxin homeostasis and cell
expansion in Arabidopsis. Planta 226:839–851
Zhang H, Kim MS, Sun Y, Dowd SE, Shi H, Pare PW (2008) Soil bacteria confer plant salt toler-
ance by tissue specific regulation of the sodium transporter HKT1. Mol Plant Microbe Interact
21:737–744
Chapter 4
Downy Mildew Disease of Pearl Millet
and Its Control
H.S. Prakash, Chandra S. Nayaka, and K. Ramachandra Kini
4.1 Pearl Millet Introduction
Pearl millet (Pennisetum glaucum) is an important food and fodder crop of arid and
semi-arid tropics of India and Africa. This crop is grown in an area of 27 m ha in the
world with yield of 36 m tons. India is the largest producer of this crop in terms of
area (9 m ha) and production (9 mt), with a productivity of 780 kg/ha, Rajasthan
being the major contributor (51 %) followed by Maharashtra and Gujarat. Single-
cross F1 hybrids based on cyto-nuclear male sterility (CMS) contributed signifi-
cantly to pearl millet production in India. Though pearl millet is considered to be an
orphan crop, it promises to be a staple food crop in the years to come due to shortage
of water. The crop is nutritionally rich with a good balance of starch, protein and fat.
Pearl millet provides 11–12 % of worlds’ supply of protein (Yadav et al. 2011). It is
also rich in iron, phosphorus, B-complex vitamins and fibre content.
Currently 65 % pearl millet area is under high yielding varieties (Yadav 2012).
During last 25 years 115 improved pearl millet cultivars have been released. The
productivity of pearl millet has improved 45 %, from 5.83 m tons during 1986–1990
to 8.48 m tons during 2006–2010 in spite of 18 % decline in crop area from 10.7 m ha
to 9.1 m ha (http://www.agricoop.nic.in).
Pearl millet is infected by five major pathogens, Sclerospora graminicola causing
downy mildew, Claviceps fusiformis causing ergot, Moesziomyces penicillariae
causing smut, Puccinia substriata causing rust and Pyricularia grisea causing blast.
H.S. Prakash, Ph.D. (*) • C.S. Nayaka, Ph.D. • K.R. Kini, M.Sc., Ph.D.
Department of Studies in Biotechnology, University of Mysore,
Manasagangotri, Mysore 570 006, Karnataka, India
e-mail: hasriprakash@gmail.com

110 H.S. Prakash et al.
4.2 Downy Mildew
The downy mildew is a major production constraint in pearl millet cultivation. The
disease appeared in epiphytotic proportion with the introduction of hybrids in late
1960s. In early 1970s the disease alone was responsible for almost 70 % yield loss
in the hybrid HB3.
4.2.1 Taxonomic Status of Sclerospora graminicola
The pathogen was first described as Protomyces graminicola from Setaria verticillata
by Saccardo in 1876. Schroeter (1879) renamed the pathogen as Sclerospora
graminicola. S. graminicola is placed in Eusclerospora as it produces spores that
germinate indirectly by zoospores in contrast to Peronosclerospora graminicola
that produces directly germinating spores. The oomycetous fungi including
S. graminicola are now placed in a separate phylum oomycota under the kingdom
Stramenopila, as they are closely related to the golden-brown algae and diatoms
(Dick 2001). Though oomycota behave like the true fungi in exhibiting apical
growth and similar infection strategies, they are unrelated to the true fungi having
plant-like features including cell walls composed of primarily of glucans and
cellulose-like polymers, cell membrane composed of plant sterols, coenocytic
hyphae, and motile asexual spores.
4.2.2 Symptoms
The pathogen causes systemic infection. The symptoms are seen throughout the
growth stages, starting from coleoptile stage. The leaves initially show chlorosis
which later on shows whitish downy growth on the lower surface due to the produc-
tion of sporangia (Figs. 4.1 and 4.2). Early infection leads to seedling death. Delayed
infection cause dwarfing of plants and some tillers may escape disease. Severely
infected plants do not produce panicles. The floral parts of infected plants may get
transformed totally or partially to leafy structures, hence the name ‘green ear’. The
host genotype, time of expression and ambient conditions may influence type of
symptoms (Singh and King 1988).
4.2.3 Biology of the Pathogen
Sclerospora graminicola is an obligate parasite (Kenneth 1970). The sporangio-

phores are short, stout, determinate, dichotomously branched, hypophyllous or
amphigenous, clavate, non-septate and measure 15–22 × 12–21 μm with one to six
4 Downy Mildew Disease of Pearl Millet and Its Control 111
Fig. 4.1 (a, b) Typical downy mildew symptoms of pearl millet showing chlorosis and stunted
growth in field condition
Fig. 4.2 Abaxial side of pearl millet leaf infected with Sclerospora graminicola
short pedicels. Sporangiophores emerge through stomata. Sporangia are produced

on pedicels located at the tip of sporangiophore branches. Sporangia are hyaline,
thin-walled, ellipsoid or broadly elliptic, papillate and 15–22 × 12–21 μm (Jouan
and Delassus 1971). The zoospores are produced in sporangium, each sporangium
produces four to eight reniform zoospores that measure 9–12 μm on long axis. Each
zoospore is biflagellate, the anterior flagellum is of tinsel-type, while the posterior
flagellum is of whiplash-type. Zoospores are wall-less, but retain a consistent but
flexible shape.
The pathogen produces oospores through sexual reproduction. The mature
oospores are light brown to reddish-brown with thick walls and measure 22–35 μm
in diam. Presence of retentive oogonial wall fused with the oospore wall is charac-
teristic of Sclerospora genus. The oospore wall has three distinct layers: the
exosporium, the mesosporium and the endosporium. The oospores germinate
directly by hyphal germ tubes. Michelmore et al. (1982) have shown that S. gramini-
cola is heterothallic. So far the germination of oospores in vitro has not been dem-
onstrated conclusively. Hence the viability of oospores can be tested only by using
a vital staining technique (Shetty et al. 1978).
The mycelium of S. graminicola is systemic, coenocytic and highly branched

(Ramakrishnan 1963). The intracellular haustoria may be simple or branched,
globose or digitate (Weston 1929). The asexual zoospores help in secondary spread
of downy mildew (Singh and Williams 1980). The sporulation is supported by the
photosynthate accumulated during exposure to sunshine between successive crops
of sporulation and relatively low temperatures and high relative humidities occur-
ring in the early hours of the morning (02.00–04.00 h). Optimum sporangial pro-
duction occurs at 20–25 °C and 95–100 % RH. Zoospores germinate by germ tubes
and retain their infectivity for about 4 h at 30 °C (Singh and Gopinath 1985).
4.2.4 Infection, Colonization and Disease Spread
The oospores present in soil are the main source of primary infection. The oospores
remain viable for up to 10 years (Borchhardt 1927; Nene and Singh 1976). The
oospores infect through coleorrhizas, radicles and lower portions of the coleoptiles
of seedling, roots and underground portions of stem bases. The germ tube produces
an appressorium at the junction of epidermal cells, directly over the epidermal cells
or over stomata.
The secondary spread is through the sporangia/zoospores. The apical meristem
is the most vulnerable site of infection for zoospores. The zoospores released per
sporangium vary from 1 to 12 (ICRISAT 1987). Zoospores emerge through a pore
produced by the release of an operculum. Zoospores swim for 30–60 min, encyst,
and then germinate by forming a germ tube. Sometimes zoospores may germinate
within the sporangium (Shaw 1981). Zoospore release from the sporangia occurs at
a wide temperature range (10–45 °C); liberation is optimum at 30 °C in about 2 h
40 min. Zoospores retain their infectivity for about 4 h at 30 °C and for a longer
period at lower temperatures (Singh and Gopinath 1985). Low temperature, high
relative humidity and well distributed rainfall are critical factors for infection by
S. graminicola and for the development and spread of disease in the crop (Jeger
et al. 1998; Gupta and Singh 1999). Sclerospora graminicola is also seed-borne,
externally in the form of oospore contamination and internally as mycelial infection
in embryo (Shetty et al. 1980). The seed-borne inoculum could be detected by
washing test for oospores and embryo extraction procedure for internal mycelia.
The seed transmission has been established under in vitro conditions. This aspect is
of relevance in seed health certification, especially in germplasm exchange.
4.2.5 Pathogen Variability
Sclerospora graminicola shows a high degree of variability in its pathogenicity.

The pathotypes could be distinguished based on reaction on differential hosts. The
first epidemic of downy mildew appeared in pearl millet hybrid HB3 in 1971.
The variability in S. graminicola was first reported in 1973 when NHB3 was found
susceptible at Gulbarga but resistant at Mysore (Shetty and Ahmad 1981). Later on
several pathotypes of S. graminicola have been reported from India and Africa
(Singh et al. 1993) and even locational differences in virulence have also been
established in the International Pearl Millet Downy Mildew Nursery, the West
African Downy Mildew Variability Nursery and the West African Downy Mildew
Observation Nursery (Singh et al. 1992). It has been shown that some genotypes
such as MBH110, NHB3 and 81B (ICMB-1) showed differential downy mildew
reactions between locations and pathogen populations (Werder and Ball 1992).
The variability in pearl millet cultivar response to downy mildew is determined
by host and pathogen genotypes (Ball 1983). West African isolates of the pathogen
were generally more pathogenic than Indian isolates and cultivar ICH 105 could
differentiate these two isolates. Substantial differences were also established
between two isolates collected from different host cultivars at the same location in
Upper Volta. Cultivars 700516 and MBH110 also showed differential responses to
isolates. Distinct types of symptom expression were also observed which was found
to be characteristic of cultivar genotype, independent of pathogen isolate. Both race
specific and race non-specific resistance may coexist in this pathosystem.
Thakur et al. (2004a) identified five major groups of S. graminicola based on
host differentials. Oospore collections from Africa and India showed differences in
virulence under greenhouse tests in the UK (Ball 1983; Ball et al. 1986) and in India
(Thakur et al. 1992); Singh and Singh (1987) provided evidence that S. graminicola
is highly cultivar-specific. Disease monitoring field surveys of pearl millet crops in
Maharashtra, India, during 1993–1996 (Thakur et al. 1999) indicated high vulner-
ability of several popular hybrids whereas open-pollinated cultivars recorded trace
or no downy mildew incidence. Virulence and DNA fingerprinting analyses showed
that isolate Sg 021 from hybrid MLBH 104 was quite distinct from those collected
from other hybrids (Sastry et al. 1995).
Five pathotypes of S. graminicola were identified in India (Thakur and Rao
1997; Thakur 1999). The pathotypes were less virulent on some pearl millet geno-
types indicating non-pathotype-specific resistance. These genotypes can serve as
sources of stable resistance. A new pathotype ‘Path-7’ was described from Jodhpur,
India (Thakur et al. 1998). Variation in single-oospore and single-zoospore isolates
for virulence on a set of differential lines has been recorded (Thakur and Shetty
1993; Gwary et al. 2007) reported the occurrence of five pathogen populations in
Nigeria and no cultivar was resistant to all the pathotypes. JuZheng et al. (1996)
reported the existence of physiological specialization among oospore isolates of S.
graminicola infecting Setaria italica from China.
Currently, 14 host differentials are identified to differentiate the pathotypes of
S. graminicola. There are currently many pathotypes of S. graminicola prevalent in
different parts of pearl millet growing regions of India, and new ones with higher
virulence levels continue to appear with deployment of new cultivars (Thakur et al.
2004b; Pushpavathi et al. 2006) More than 300 isolates of S. graminicola were col-
lected from farmers fields of India, out of which 27 isolates with distinct features of
variation were further characterized based on host differentials and molecular
Table 4.1 Host differentials for the identification of Sclerospora graminicola pathotype
Pathotypes
assigned HB 3 KaluKombu MBH 110 7042S MLBH104 HHB-67
Path-I √ x √ √ √ √
Path-II x √ x √ √ x
Path-III √ X √ √ x √
Path-IV √ X √ √ √ √
Path-V x X √ √ √ √
Path-VI √ X x √ √ √
ND √ x √ √ x √
ND not determined
markers (Sudisha et al. 2008). The seven pathotypes of S. graminicola are differen-
tiated based on the reaction of six host genotypes (Table 4.1).
Sharma et al. (2010) have determined the genotypic diversity among 46 isolates
of S. graminicocla collected from seven states in India during 1992–2005 through
pathotyping and AFLP analysis. These isolates were classified in 21 pathotypes
based on reaction on a set of nine pearl millet lines. The average linkage cluster
analysis of virulence index clustered the 46 isolates into eight groups. Region-
specific and temporal variation was observed. Cluster analysis of AFLP data clus-
tered the test isolates into seven groups. Sharma et al. (2011) have identified Sg 492
from Aligarh and Sg510 isolate from Badaun in Uttar Pradesh as the highly virulent
isolates based on the reaction on pearl millet cultivar 7042S in greenhouse
conditions.
A genomic library of ‘path-6’ (ex 7042S) of S. graminicola had shown 8 %
repetitive DNA content on colony hybridization of total fungal DNA with a genomic
library (Sastry et al. 1997). The library also revealed partial methylation of GATC
and CCGG sequences in the genome and presence of retrotransposable elements.
Sudisha et al. (2008) have screened 27 isolates on host differentials and identified 6
pathotypes and also developed RAPD (Table 4.2) and ISSR (Table 4.3) markers to
distinguish the six pathotypes (Figs. 4.3 and 4.4).
The genetic basis of host specificity in S. graminicola was studied in a host-
pathogen cross-inoculation experiment (Sastry et al. 2001). Two pathotypes, Path-I
and Path-5 selected from genetically uniform hybrid NHB 3 and genetically hetero-
geneous landrace population 700651, respectively, were maintained for 10 asexual
generations by serial passage on the seedlings of their respective hosts. Pathogenicity
test with Path-I indicated an increase in virulence over its new host 700651, com-
pared with the adapted host, NHB 3. However, it was not true for Path-5 with NHB3.
RAPD primers were identified to detect variations in Path-I and Path-5. The DNA
fingerprinting profile of the isolates obtained after 10 generations revealed differ-
ences within the microsatellite probe (GATA), compared with the initial generation.
The change in virulence in Path-I and its adaptation to the new host, 700651, was
demonstrated by the change in RAPDs and DNA fingerprinting profile in the two
extreme generations.
Table 4.2 Fingerprint patterns generated using RAPD in six pathotypes
of S. graminicola
Total no. of No. of polymorphic
Sl. No. Primers bands amplified bands
1 OPA-05 06 05
2 OPA-07 07 05
3 OPA-11 05 05
4 OPA-14 08 06
5 OPA-15 08 06
6 OPB-02 06 04
7 OPB-03 09 06
8 OPB-06 07 05
9 OPB-09 12 12
10 OPB-12 07 07
11 OPC-07 09 06
12 OPC-10 07 06
13 OPC-12 07 05
14 OPD-09 09 06
15 OPS-02 06 06
16 OPS-09 08 06
17 OPL-18 08 06
18 OPM-04 07 06
19 OPN-20 10 09
20 OPX-09 06 05
Total 152 112
Table 4.3 Fingerprint patterns generated using ISSR primers in six pathotypes
of Sclerospora graminicola
ISSR Annealing No. of bands No. of polymorphic
Sequence primer temp (°C) generated bands
(CT)8TC 814 40 15 12
(CT)8 AC 844 A 40 14 11
(CT)8GC 844 B 40 15 15
(CA)6 AC 17898 A 45 15 13
(CA)6GT 17898 B 45 14 12
(CA)6AG 17899 A 45 18 15
(CA)6GC 17899 B 45 19 19
(GA)6GG HB 08 48 16 12
(GT)6GG HB 09 48 14 11
(GA)6CC HB 10 48 17 14
(GT)6CC HB 11 48 16 13
(CAC)3GC HB 12 45 18 14
(GAG)3GC HB 13 45 14 11
(CTC)3GC HB 14 45 13 13
(GTG)3GC HB 15 48 18 13
(GA)9 T ISSR 16 48 14 11
(GA)9C ISSR 17 48 16 12
(TAG)4 ISSR 18 40–55 00 00
(GACA)4 ISSR 19 48 14 10
(GGAT)4 ISSR 20 50 17 13
297 244
Fig. 4.3 Agarose gel

electrophoresis shown DNA
fingerprint of six pathotypes
of Sclerospora graminicola
Fig. 4.4 Dendrogram based Sg 139a

42
on ISSR polymorphisms of Sg 334-local
61
Sclerospora graminicola Sg 332
occurring on pearl millet by
Pat-K1977
unweighted pair group
30 42
method of averages 100
Path-6
(UPGMA) cluster analysis 23 Sg 335-HHB67
(numbers inside the branches Pat-K1987
are bootstrap values) (Data 32
34
Path-5
from Sudisha et al. 2008)
Sg 200
90 52
Sg 212
Sg 048
35
Path4
21
Sg 021
36
75 15 Sg 348
Sg 298
30
Sg 151
62
Sg 139
Path-3
100
Path-1
66
Sg 153
Sg 150
70
Path-2 (local)
Different pathotypes of S. graminicola were also characterized based on cellular

fatty acid composition (Geetha et al. 2002; Amruthesh et al. 2005), isoelectric
focusing (IEF) and matrix-assisted laser desorption ionization (MALDI) techniques
(Sharathchandra 2006) which also corroborates AFLP data. These isolates were
grouped into four major clusters belonging to six pathotypes. Sequence Characterized
Amplified Region (SCAR) primers were developed for pathotype-1 (Sudisha et al.
2009). PCR has amplified a single amplicon of 290 bp only in Pathotype-1. The
novel sequences have been deposited in the GenBank of the NCBI (Accession num-
ber EF599095).
4.2.6 Control Strategies
Sclerospora graminicola is an obligate biotroph, multiplying only in living host tis-

sue. The pathogen is seed, soil and air-borne. The crop is susceptible to infection
throughout the vegetative phase of growth. Hence the control strategies should start
from the seedling stage itself. An effective control strategy depends on a clear
understanding of genetic basis of resistance to identify sources of resistance in
breeding and an understanding of disease cycle to identify the vulnerable stage to
break the disease cycle. Though several control strategies have been experimented,
only two approaches i.e. deployment of resistance cultivars and chemical control
strategies have been widely employed.
4.2.7 Chemical Control
The epidemics of downy mildew lead to the search of newer fungicides specifically
targeting oomycetous fungi including downy mildew of pearl millet. Ciba-Geigy
has developed Ridomil as a fungicide of choice to control downy mildew. This sys-
temic fungicide was registered and released to market in 1980s. Metalaxyl 35
(Apron) seed treatment @ 6 g a.i. per kilogram of seeds protected the seedlings
from downy mildew up to 30 days. Foliar spray with Metalaxyl 25 (Ridomil) at 30
days offered an effective control of downy mildew. Metalaxyl is recommended for
the control downy mildew in farmers' fields and also in commercial seed production
plots (Singh and Shetty 1990). Seed treatment with metalaxyl gave protection up to
30 days. After foliar treatment, metalaxyl residues persisted in all plant parts for 90
days depending on the concentration applied. More fungicide was taken up in soak-
ing treatment than in slurry or dust treatments (Reddy et al. 1990). Field experi-
ments by Gupta et al. (2012) with Apron (4.2 g a.i. per kg seed) and two sprays of
Ridomil MZ 72 WP (2.88 kg a.i. per ha) at 20 and 40 days after sowing demon-
strated effective control of downy mildew. Spray alone was more effective than seed
treatment. The residue of metalaxyl or mancozeb was either nil or in traces in soil,
grain and straw.
Three formulations of Strobilurin fungicides, azoxystrobin, kresoxim-methyl

and trifloxystrobin inhibited sporulation, zoospores release and mobility at 0.1 to
2 ug mL-1 concentration. Azoxystrobin gave the best disease protection. Seed plus
foliar spray gave 93 % protection, whereas foliar spray alone gave 91 % protection
(Sudisha et al. 2005).
Sharathchandra et al. (2004) have tried a commercial aqueous chitosan formula-
tion ‘Elexa’ at a concentration of 1:19 as seed soaking treatment for 6 h which gave
48 % protection against downy mildew. Foliar spay alone on 2-day-old seedlings
gave 67 % protection. A combined seed and spray treatment gave 71 % protection
in greenhouse and field conditions. Maximum resistance was observed after 24 h of
Elexa application. Chaluvaraju et al. (2004) also obtained good control of downy
mildew by seed and foliar application of phosphorous-based compounds like
di-potassium hydrogen phosphate, 2,3,5 tri-iodo benzoic acid, phosphorous acid
and its commercially available formulations alcomon-40 and potassium phosphate.
Deepak et al. (2005) have worked out the cost-return budget in the control of
downy mildew of pearl millet and reported that less than 30 % disease control is
uneconomical. Among the 15 commercially available and five experimental fungi-
cides, anti-mildew activity of acylanilide series exhibited higher (over 95 %) protec-
tion effect.
4.2.8 Abiotic Elicitors
Several abiotic elicitors applied as seed treatment were effective in reducing the
disease incidence in greenhouse and field conditions. Seed treatment with β-amino-
butyric acid (BABA), a rare non-protein amino acid, at 50 mM concentration pro-
vided upto 75 % disease protection (Shailasree et al. 2001). The resistance induced
in seedlings was long lasting through the vegetative and reproductive growth of
pearl millet plants. This increased resistance was supposed to be due to the increased
accumulation of defense-related proteins such as β-1,3-glucanase, phenylalanine
ammonia lyase, peroxidase and hydroxyproline rich glycoproteins (Shailasree
et al. 2007).
A total of 319 inducers were tested and these agents demonstrated considerable
differences in their ability to induce downy mildew disease resistance at University
of Mysore, India (Unpublished data; Table 4.4). The inducers tested were rated
based on their performances after screening both under artificial green house and
epiphytotic field conditions. The inducers included Amino acids (13), Antibiotics
(1), Aromatic compounds (4), Biopolymer (2), Carbohydrates (21), Carbohydrate
Specific proteins (2), Cell wall components (2), Commercial formulation (18),
Endophytic actinomycetes (20), Fatty acids (24), Endophytic streptomycetes (37),
Growth regulators (9), Metal salts (17), Micronutrients (3), Mineral salts (14), Nitric
oxide donors (5), Organic acids (5), Phenolic acids (6), Plant extracts (58),
Table 4.4 Some important inducers tested for controlling downy mildew disease in pearl millet at
University of Mysore
% DM
Chemicals Name of the inducer protection
1. Amino acids L-Phenyl alanine 68
L-Leucine 68
L-isoleucine 64
2. Antibiotics Validamycin-A 63
3. Aromatic Compounds Methyl jasmonate 44
4-Hydroxybenaldehyde 27
4. Biopolymers Chitin oligomers 61
Curdlan 74
5. Carbohydrates Laminarin 62
Trehalose 63
Mannitol 52
Galactose 49
6. Carbohydrate specific N-Acetyl glucosoamine 56
proteins N-Acetyl neuramic acid 41
7. Cell wall components Colletotrichum dematium Nml 237-04 52
Pestalotiopsis sp. Gcr2-04 49
Colletotrichum gloeosporioides 45
Nml 230-04
8. Commercial formulation Trichoshield 65
Cerebroside B 58
Bacillus sp. Mr 33 60
Bacillus spp. Mr 35 61
Nutri kelp 65
Nutri care 62
9. Endophytic actinomycetes Actinomycete Pgr 06-05 61
Actinomycete Pgr 05-05 53
10. Endophytic fungi Penicillium sp. Hcr 115-04 55
Fusarium oxysporum Ais 231-04 58
Fusarium oxysporum Pgr 32-04 50
11. Endophytic streptomycetes Streptomycetes Pgr 05-05 71
Streptomycetes Pgr 06-05 63
Streptomycetes Pgr 30-05 56
12. Fatty acid Eicosapentanoic acid 78
Arachidonic acid 76
Lineolic acid 66
13. Growth regulators Indole 3 butryic acid 71
Benzyl amino purine 63
Abscisic acid 62
14. Metal salts Calcium silicate 33
Ammonium sulfamate 32
Sodium silicate 30
15. Micronutrients Meso inositol 61
Myo-inositol 60
Zinc sulphate 27
(continued)

% DM
Chemicals Name of the inducer protection
16. Mineral salts Copper sulphate 75
Sodium carbonate 74
Calcium nitrate 41
17. Nitric oxide donors Sodium nitroprusside 60
Iso sorbite dinitrite 59
Glycerol trinitrate 48
18. Organic acids Phosphorous acids 51
Citric acid 37
Gallic acid 37
19. Phenolic acids Caffeic acid 63
Coumaric acid 62
T-Cinnamic acid 61
20. Plant extract Jatropha glandufolia 73
Lactuca sativa 73
Tridax procumbens 64
21. Plant growth promoting Azospirillum brasilense Pgr 07 71
rhizobacteria (PGPR) Bacillus pumulis NI 1 67
Bacillus pumulis INR 7 67
22. Plant growth promoting Trichoderma viride Tstv 1 52
fungi (PGPF) Trichoderma harzianum Pgr Th2 44
Trichoderma lignorum Ts T11 42
23. Salicylic acid analogue para-Hydroxy benzoic acid 41
Methyl salicylate 73
Benzoic acid 40
24. Secondary metabolite Flavone 56
Isoflavone 41
Indoquinone 35
25. Vitamins MSB 73
Thiamine 72
Roseoflavin 61
PGPR (13), PGPF (5), Salicylic acid analogues (11), Secondary metabolites (5) and
Vitamins (7). Among all the inducers tested, 14 inducers offered more than 70 %
protection against downy mildew, whereas other inducers offered less than 30–70 %
disease protection in different methods of application.
Geetha and Shetty (2002) have demonstrated the induction of resistance by
Benzothiadiazole (BTH), calcium chloride and hydrogen peroxide. BTH (0.75 %)
gave the best protection of 78 %. Sarosh et al. (2005) have also reported the elicita-
tion of defense-related enzymes like Pr-1a, B-1,3-glucanase, chitinase, POX,
Lipoxygenase, chalcone synthase in terms of transcript accumulation in the suscep-
tible genotype of pearl millet. Cow milk (10 %) and amino acid L-phenylalanine
Table 4.5 Downy mildew protection offered by different bioagents

Downy mildew
Bioagent protection (%)
Trichoderma harzianum UOM SAR1 67
Trichoderma viride UOM SAR 27 63
Chaetomium globosum UOM SAR 39 52
Pseudomonas fluorescens 80
Pseudomonas fluorescens UOM14 77
Pseudomonas fluorescens UOM80 71
Bacillus subtilis UOM SAR 4 70
Bacillus pumilus UOM SAR 16 68
Apron 87
Data from Raj (2005)
have elicitated the defense-related enzymes like phenyl alanine ammonia lyase
(PAL), peroxidase (POX), in pearl millet against downy mildew disease (Sudisha
et al. 2011) and offered 35 % and 68.6 % protection, respectively. Vitamins like
pyridoxine, folic acid, riboflavin, niacin, D-biotin, menadione sodium bisulphate
(MSB) also offered different levels of downy mildew protection (Pushpalatha et al.
2007). Soaking of seeds in 20 mM MSB for 6 h gave the best protection of 73 %.
Maximum resistance was evident fourth day after sowing and persisted till the end
of crop growth period.
Nitric oxide donors Nitroso-R-salt, 2-nitroso-1-naphthol and sodium nitro prus-
side (SNP) were tried as inducers of downy mildew resistance. Aqueous SNP seed
treatment was very effective in induction of resistance both in greenhouse and field
conditions, maximum resistance being evident in 3-day time gap. Primary defense
responses like hypersensitive response, lignin deposition and enhanced defense-
related enzyme activity were evident (Manjunatha et al. 2008; Deepak et al. 2007a)
have demonstrated the induction of resistance against S. graminicola by a synthetic
jasmonate analogue 1-oxo-indamoyl-L-isoleucine methyl ester based on greenhouse
experiments and enhanced activity of PAL, POX and HRGP.
4.2.9 Biological Control
Umesha et al. (1998) tried biocontrol agents like pure culture and talc-based formu-
lation of Pseudomonas fluorescens under greenhouse and field conditions. The seed
treatment followed by foliar spray gave an effective control of the disease. Theradi
Mani and Juliet Hepziba (2009) tried seed treatment with talc-based formulation of
Trichoderma spp. (4 g/kg) and P. fluorescens (10 g/kg) and peat-based formulation
of Bacillus subtilis (30 g/kg) and found that P. fluorescens treatment reduced the
disease incidence to 9.50 % (Table 4.5).
4.3 Host-Plant Resistance
Several defense-responsive enzymes are associated with resistance mechanism of

pearl millet against downy mildew. These include β-1,3-glucanase, chitinase, lipox-
ygenase, phenylalanine ammonia lyase, peroxidase, H+-ATPase, superoxide dis-
mutase, polyphenol oxidase etc. The involvement of plasma membrane H+-ATPase
in downy mildew disease resistance has been demonstrated by Madhu et al. (2001).
Differential induction of superoxide dismutase in downy mildew resistant and sus-
ceptible genotypes of pearl millet upon inoculation with S. graminicola has been
reported by Babitha et al. (2002a). Native PAGE analysis showed four isozymes of
SOD, three of which (SOD-1, -2, and -4) were Cu/Zn SOD, and isozyme SOD-3 was
Mn-SOD. Mn-SOD was further purified and partially characterized (Babitha et al.
2002b). Induction of Lipoxygenase (LOX) was also reported in resistant pearl millet
seedlings due to infection with S. graminicola. Three of the six isozymes were puri-
fied, of which LOX-6 was attributed to the downy mildew resistance (Babitha et al.
2004). Higher levels of ribonuclease (RNase) enzyme activity and differential RNase
isoenzymes profiles were evident in resistant cultivars (Shivakumar et al. 2000).
Both constitutive and inducible lytic factors were observed in different resistant cul-
tivars (Umesha et al. 2000). Pearl millet cells expressing hypersensitive reaction
after inoculation with S. graminicola and arachidonic acid showed the differential
accumulation of autofluorescent compounds in resistant and susceptible genotypes,
with most accumulation occurring in resistant cells (Geetha et al. 1998).
In addition to the defense-related enzymes other cell wall associated defense
proteins such as hydroxyproline rich glycoproteins (HRGPs) and polygalacturonase
inhibitor proteins (PGIPs) have also been known to play a role in host resistance in
pearl millet (Shailasree et al. 2004; Deepak et al. 2007b; Prabhu et al. 2012a). These
proteins have been purified and characterized from pearl millet tissues (Deepak
et al. 2007c; Prabhu et al. 2012b).
4.4 Resistance Breeding
Use of resistant cultivars is the most cost-effective method for the control of downy
mildew. It is mandatory that the cultivars should have at least 8 % tolerance to
downy mildew before notification.
The lack of diversity and inadequate downy mildew resistance in parental lines
is a major bottleneck in breeding single-cross hybrids of pearl millet. Several downy
mildew resistant male-sterile lines of pearl millet (Rai et al. 1998; Thakur et al.
2001) and male parents have been identified (Singh et al. 1997) and used in develop-
ing commercial hybrids. It is suggested that the male-sterile cytoplasm is not linked
to downy mildew susceptibility and thus could be exploited commercially to
broaden the cytoplasmic base of the male-sterile lines (Yadav 1996). Some of the
resistant sources have been used in breeding of hybrids and open-pollinated variet-
ies (Hash et al. 1999).
Wilson et al. (2008) identified several downy mildew resistant entries from
sub-saharan African Countries based on multi-locational trials. Angarawai et al. (2008)
reported that the inheritance of downy mildew in pearl millet is quantitative, highly
heritable and would respond to selection. This could be further facilitated by mod-
ern biotechnological tools such as marker-assisted breeding techniques. Marker-
assisted backcross breeding technique was employed to circumvent the breakdown
of host resistance (Hash et al. 2003).
Reliable screening techniques using infector susceptible rows, test entries, check
entries and scoring systems have been developed to identify sources of downy mil-
dew resistance (Williams et al. 1981; Singh and Gopinath 1985; Singh et al. 1993).
Singh (1995) identified accessions with 100 % resistance against major pathotypes
occurring in India and West Africa and resistance sources were used to breed pol-
linators, male-sterile lines and cultivars. Several open-pollinated varieties and
hybrids have been developed for cultivation in India (Singh 1995) and West Africa
(Singh et al. 1993) by ICRISAT. A large number of resistant sources were identified
from India/Western Africa based on laboratory, greenhouse and field screening
(Singh 1990; Singh et al. 1997). Thakur et al. (2001) identified IP 18292 as the
highly stable and resistant genotype for all the six pathotypes in India.
Several germplasm accessions of pearl millet having stable resistance to
S. graminicola were selected from bulk germplasm from Nigeria. The severity of
infection on the selected accessions ranged from <1 to 7 % compared with 42 to
69 % on the susceptible standard NHB3 (Singh and Shetty 1990). A number of
pearl millet germplasm and breeding lines have been identified by field and green-
house screening (Singh et al. 1997) and evaluated by multi-locational trials at 20
locations in Burkina Faso, India, Nigeria, Niger and Senegal under International
Pearl Millet Downy Mildew Nursery (IPMDMN) to identify stable sources of
downy mildew resistance.
The inheritance of downy mildew resistance in pearl millet is highly variable and
inconsistent. This could be attributed to lack of homozygous resistant/susceptible
genotypes, a lack of genetically pure pathogen isolate, and variable environmental
conditions. The resistance mechanism is governed either by additive or dominant
gene effects, or both (Rai et al. 2006; Shetty et al. 1998), while in others, both
additive and non-additive gene effects with epistatic interactions were important
(Deswal and Govila 1994). However, Singh and Talukdar (1998) have shown single
dominant gene (Rsg1) controlled resistance.
4.4.1 Resistance Mechanism
4.4.1.1 Induced Resistance
Inoculation of pearl millet seedlings with a suboptimal concentration of S. gramini-

cola induced resistance against subsequent infection by the pathogen (Kumar et al.
1998). Increased levels of β-1,3-glucanase and peroxidase activity was associated
with the induction of resistance in pearl millet. Arachidonic acid also induced a
hypersensitive response (HR) on coleoptile/root regions of 2-day-old pearl millet

seedlings (Geetha et al. 1998). A time delay in the appearance of HR among
genotypes was related to the degree of resistance to downy mildew. Pearl millet
genotypes were categorized as highly resistant/resistant (HR in 13 h and above).
4.4.1.2 Recovery Resistance
Recovery resistance is a phenomenon in which the pathogen completes its life cycle
without affecting the normal development of the plant (Singh and King 1988).
A high level of recovery resistance (up to 95 %) was developed in ICMA1 (81A, a
male-sterile line) and its maintainer line ICMB1 (81B), through pedigree selection
for five generations (Singh and Talukdar 1996).
4.4.1.3 Resistance Gene Characterization
Plant disease resistance genes show significant similarity among their sequences with
the presence of conserved motifs common to the nucleotide-binding site (NBS).
Oligonucleotide degenerate primers designed from conserved NBS motifs encoded
by different plant disease resistance genes can be used to amplify resistance gene
analogues (RGAs) corresponding to the NBS sequences from the genomic DNA of
various plant species. Using this approach 22 RGAs were cloned and sequenced from
pearl millet (Sarosh 2002; Sarosh et al. 2011). Phylogenetic analysis of the predicted
amino acid sequences grouped the RGAs into nine distinct classes. GenBank database
searches with the consensus protein sequences of each of the nine classes revealed
their conserved NBS domains and similarity to other known R genes of various crop
species. One RGA 213 was mapped onto LG1 and LG7 in the pearl millet linkage
map. Accumulation of the transcripts of this RGA during infection with S. graminic-
ola in resistant pearl millet seedlings indicated its involvement in resistance mecha-
nism against downy mildew (Ranjini et al. 2006). Further studies indicated that this
RGA encodes a putative ser-thr protein kinase (Ranjini et al. 2011).
4.5 Future Challenges
Pearl millet is envisaged to gain the status of an important food and fodder crop in
future because of its drought-tolerance ability and its nutritional quality. An effec-
tive strategy should be developed to manage the diseases in pearl millet crops in
order to improve the productivity. The downy mildew disease is still the major biotic
constraint in all pearl millet growing areas. Though extensive work has been done
on this disease, still it is difficult to manage. Of late, blast disease is also becoming
important in certain pearl millet growing regions. Hence this disease also needs
immediate attention.
The future challenges are:

• Monitor the shift in virulence of S. graminicola with the introduction of new
cultivars of pearl millet.
• Understand the basic mechanism of resistance using proteomic approaches.
• Identify suitable and reliable genetic markers for selection of promising resistant
pearl millet cultivars and adapt them in the breeding programmes.
• Identify suitable biotic/abiotic elicitors; develop suitable formulation and delivery
strategies for large-scale application.
• Exploit the newer biotechnological tools such as transgenic technology to incor-
porate genes offering resistance to downy mildew.
References
Amruthesh KN, Geetha NP, Hans LJ, de Neergaard E, Shetty HS (2005) Unsaturated fatty acids
from zoospors of Sclerospora graminicola induce downy mildew resistance in pearl millet. Eur
J Plant Pathol 111:125–127
Angarawai II, Kadams AM, Bello D, Mohammed SG (2008) Quantitative nature of downy mildew
resistance in Nigerian elite pearl millet lines. J SAT Agric Res 6:1–3
Babitha MP, Bhat SG, Prakash HS, Shetty HS (2002a) Differential induction of superoxide dis-
mutase in downy mildew-resistant and -susceptible genotypes of pearl millet. Plant Pathol
52:480–486
Babitha MP, Prakash HS, Shetty HS (2002b) Purification and partial characterization of manganese
superoxide dismutase from downy mildew resistant pearl millet seedlings inoculated with
Sclerospora graminicola. Plant Sci 163:917–924
Babitha MP, Prakash HS, Shetty HS (2004) Purification and properties of lipoxygenase induced in
downy mildew resistant pearl millet seedlings due to infection with Sclerospora graminicola.
Plant Sci 166:31–49
Ball SL (1983) Pathogenic variability of downy mildew (Sclerospora graminicola) on pearl millet
I. Host cultivar reactions to infection by different pathogen isolates. Ann Appl Biol
104:41–51
Ball SL, Pike DJ, Burridge CY (1986) Characterization of Sclerospora graminicola. Annal Appl
Biol 108:519–526
Borchhardt A (1927) Operations of the phytopathological section of the Agricultural Experiment
Station in the eastern Steppe region in the year 1925. Dniepropetrovok (Ekaterinoslaff): 3–37,
(Russian, Abs. in Botanic Centralbl, N.S. 11:440–441, 1928)
Chaluvaraju G, Puttalingaiah B, Shetty NP, Deepak SA, Amruthesh KN, Shetty HS (2004) Effect
of some phosphorous-based compounds on control of pearl millet downy mildew disease. Crop
Prot 23:595–600
Deepak SA, Chaluvaraju G, Basavaraju P, Amruthesh KN, Shetty HS, Oros G (2005) Response of
pearl millet downy mildew (Sclerospora graminicola) to diverse fungicides. Int J Pest Manage
51:7–16
Deepak S, Raj SN, Shailasree S, Kini RK, Boland W, Shetty HS, Mithofer A (2007a) Induction
ofresistance against downy mildew pathogen in pearl millet by a synthetic jasmonate analogon.
Deepak S, Shailasree S, Kini KR, Shetty HS, Hause B, Mithöfer A (2007b) Role of hydroxyproline
rich glycoproteins in resistance of pearl millet against downy mildew pathogen Sclerospora
graminicola. Planta 226:323–333
Deepak S, Shailasree S, Sujeeth N, Kini KR, Shetty HS, Mithofer A (2007c) Purification and
characterization of proline/hydroxyproline rich glycoprotein from pearl millet coleoptiles
infected with downy mildew pathogen Sclerospora graminicola. Phytochemistry 68:298–305
Deswal DP, Govila OP (1994) Genetics of resistance to downy mildew (Sclerospora graminicola)
in pearl millet (Pennisetum glaucum). Indian J Agric Sci 64:661–663
Dick MW (2001) Straminipolous fungi. Kluwer Academic Publishers, New York
Geetha HM, Shetty HS (2002) Induction of resistance in pearl millet against downy mildew dis-
ease caused Sclerospora graminicola using benzothiadiazole, calcium chloride and hydrogen
peroxide—a comparative evaluation. Crop Prot 21:601–608
Geetha S, Shetty SA, Shetty HS, Prakash HS (1998) Sclerospora graminicola and arachidonic
acid-induced autofluorescence in downy mildew resistant and susceptible genotypes of pearl
millet. Ann Appl Biol 33:136–139
Geetha NP, Amruthesh KN, Shetty HS (2002) Determination of cellular fatty acid components
in five pathotypes of Sclerospora graminicola, the downy mildew pathogen of pearl millet.
J Mycol Plant Pathol 32:345–353
Gupta GK, Singh D (1999) Role of edaphic factors in the development of downy mildew
(Sclerospora graminicola) in pearl millet. J Agric Sci 133:61–68
Gupta SK, Ran Sharma Rai KN, Thakur RP (2012) Inheritance of foliar blast resistance in pearl
millet (Pennisetum glaucum). Plant Breed 131(1):217–219
Gwary DM, Garba I, Gwary SD (2007) Evidence of pathogenic variation in Sclerospora gramini-
cola populations from pearl millet regions of Nigeria. Int J Agric Biol 9(1):94–97
Hash CT, Singh SD, Thakur RP, Talukdar BS (1999) Breeding for disease resistance. In: Khairwal
IS, Rai KN, Andrews DJ, Harinarayana G (eds) Pearl millet breeding. Oxford and IBH
Publishing Co Pvt Ltd, New Delhi, pp 337–380
Hash CT, Sharma A, Kolesnikova-Allen MA, Serraj R,Thakur RP, Bidinger FR, Bhasker Raj AG,
Rizvi SMH, Beniwal CR, Yadav HP, Yadav YP, Srikant, Bhatnagar SK, Yadav RS, Howarth
CJ, Breese WA, Witcombe JR (2003) Marker-assisted breeding to improve pearl millet hybrid
HHB 67: lab to field. In: the Wake of the Double Helix: From the Green Revolution to the Gene
Revolution, abstracts and final program, 27–31 May 2003, Bologna (Abst.), p 82
ICRISAT (International Crops Research Institute for the Semi-Arid Tropics) (1987) Proc Internat
Pearl Millet Workshop, 7–11 April 1986, ICRISAT Center, India, Patancheru, p 36
Jeger MJ, Gilijamse E, Bock CH, Frinking HD (1998) The epidemiology, variability and control
of the downy mildews of pearl millet and sorghum, with particular reference to Africa. Plant
Pathol 47:544–569
Jouan B, Delassus M (1971) Principales maladies des mis et sorghos observes au Niger (In Fr.
Summaries In En. Es.). Agron Trop 26(8):830–860
JuZheng C, YaRu W, XiuJu C, ChunLan D, HuaiXiang L, YanChun S (1996) On the resistance of
foxtail millet to downy mildew. II. Variability and physiological races of Sclerospora gramini-
cola (Sacc.) Schröt. and its distribution in China. Acta Phytopathol Sin 26(2):145–151
Kenneth R (1970) Downy mildews of graminae in Israel. Indian Phytopathol 23:371–377
Kumar VU, Hindumathi CK, Ramachandra Kini K, Shetty HS (1998) Prior inoculation inducing
resistance to downy mildew (Sclerospora graminicola) enhances growth, peroxidase and β-1,3-
glucanase activity in pearl millet (Pennisetum glaucum). J Plant Pathol 80:203–209
Madhu D, Dharmesh MS, Chandrashekar A, Shetty HS, Prakash HS (2001) Role of H+-ATPase in
pearl millet downy mildew disease resistance. Plant Sci 161(4):799–806
Manjunatha G, Raj SN, Shetty NP, Shetty HS (2008) Nitric oxide donor seed priming enhances
defense responses and induces resistance against pearl millet downy mildew disease. Pestic
Biochem Physiol 91(1):1–11
Michelmore RW, Pawar MN, Williams RJ (1982) Heterothallism in Sclerospora graminicola.
Nene YL, Singh SD (1976) A comprehensive review of downy mildew and ergot of pearl millet. In
Proc Consultants’ Group Meetings on Downy Mildew and Ergot of Pearl Millet, 1–3 Oct 1975,
ICRISAT Center, India, Patancheru, pp 15–53
Prabhu SA, Kini KR, Niranjan Raj S, Moerschbacher BM, Shetty HS (2012a) Polygalacturonase-
inhibitor proteins in pearl millet: possible involvement in resistance against downy mildew.
Acta Biochim Biophys Sin 45:415–423
Prabhu SA, Kini KR, Shetty HS (2012b) Partial purification and characterization of
polygalacturonase-inhibitor proteins from pearl millet. Afr J Biotechnol 11:7000–7008
Pushpalatha HG, Mythrashree SR, Radhakrishna-Shetty, Geetha NP, Sharathchandra RG,
Amruthesh KN, Shekar-Shetty H (2007) Ability of vitamins to induce downy mildew disease
resistance and growth promotion in pearl millet. Crop Prot 26:1674–1681
Pushpavathi B, Thakur RP, Chandrashekara Rao K, Rao VP (2006) Characterization of Sclerospora
graminicola isolates from pearl millet for virulence and genetic diversity. Plant Pathol J
22:28–35
Rai KN, Thakur RP, Rao AS (1998) Registration of pearl millet parental lines ICMA 92666 and
ICMB 92666 with multiple disease resistance. Crop Sci 38(2):575
Rai KN, Kulkarni VN, Thakur RP, Haussmann BIG, Mgonja MA (2006) Pearl millet hybrid par-
ents research: approaches and achievements. In: Gowda CLL, Rai KN, Reddy Belum VS,
Saxena KB (eds), Hybrid parent research at ICRISAT, Internat Crops Research Institute for the
Semi-Arid Tropics, Patancheru, pp 11–73
Raj SN (2005) Plant growth promoting rhizobacteria mediated induction of resistance in pearl
millet against downy mildew-Histological, biochemical and molecular analysis. Ph.D. thesis,
University of Mysore, Mysore
Ramakrishnan TS (1963) Diseases of millets. Indian Council of Agricultural Research, New Delhi
Ranjini P, Shailasree S, Kini KR, Shetty HS (2006) Transcripts of resistance gene candidates accu-
mulate in pearl millet as a response to infection by Sclerospora graminicola. J Mycol Plant
Pathol 36:411–414
Ranjini P, Shailasree S, Kini KR, Shetty HS (2011) Isolation and characterization of a NBS-LRR
resistance gene analogue from pearl millet. Arch Phytopathol Plant Prot 44:1013–1023
Reddy MVB, Shetty HS, Reddy MS (1990) Mobility, distribution and persistence of metalaxyl
residues in pearl millet (Pennisetum americanum (L) Leeke). Bull Environ Contam Toxicol
45:250–257
Sarosh BR (2002) Induced systemic resistance in pearl millet against downy mildew disease and
molecular genetics of disease resistance. Ph.D. thesis submitted to University of Mysore,
Mysore
Sarosh BR, Sivaramakrishnan S, Shetty HS (2005) Elicitation of defense related enzymes and
resistance by L-methionine in pearl millet against downy mildew disease caused by Sclerospora
graminicola. Plant Physiol Biochem 43:808–815
Sarosh BR, Niranjan Raj S, Shivaramakrishnan S, Shetty HS (2011) Isolation, cloning and charac-
terization of resistance gene analogues in pearl millet based on conserved nucleotide-binding
sites. J Phytopathol 159:382–389
Sastry JG, Ramakrishna W, Sivaramkrishna S, Thakur RP, Gupta VS, Ranjekar PK (1995) DNA
fingerprinting detects genetic variability in the pearl millet downy mildew pathogen
(Sclerospora graminicola). Theor Appl Genet 91:856–861
Sastry JG, Sivaramkrishnan S, Thakur RP, Gupta VS, Ranjekar PK (1997) Characterization of the
genome Sclerospora graminicola, the causal fungus of downy mildew of pearl millet. World J
Sastry JG, Sivaramakrishnan S, Rao VD, Thakur RP, Singru RS, Gupta VS, Ranjekar PK (2001)
Genetic basis of host-specificity in Sclerospora graminicola, the pearl millet downy mildew
pathogen. Indian Phytopathol 54(3):323–328
Schroeter J (1879) Protomyces graminicola Saccardo. Hedwigia 18:83–87
Shailasree S, Sarosh B, Vasanthi N, Shetty H (2001) Seed treatment with β-aminobutyric acid
protects Pennisetum glaucum systemically from Sclerospora graminicola. Pest Manag Sci
57:721–728
Shailasree S, Ramachandra Kini K, Deepak S, Kumudini BS, Shetty HS (2004) Accumulation of
hydroxyproline-rich glycoproteins in pearl millet seedlings in response to Sclerospora gramini-
cola infection. Plant Sci 167:1227–1234
Shailasree S, Kini KR, Shetty HS (2007) Beta amino butyric acid induced resistance in pearl millet
to downy mildew is associated with accumulation of defense related proteins. Australasian
Sharathchandra RG (2006) Elicitation of systemic defense responses in pearl millet against downy
mildew fungus and the associated molecular events. Ph.D. thesis, Department of Studies in
Applied Botany and Biotechnology, University of Mysore, Mysore
Sharathchandra RG, Niranjan Raj S, Shetty NP, Amruthesh KN, Shekar Shetty H (2004) A chito-
san formulation Elexa induces downy mildew disease resistance and growth promotion in pearl
millet. Crop Prot 23:881–888
Sharma R, Rao VP, Varshney RK, Prasanth VP, Kannan S, Thakur RP (2010) Characterization of
pathogenic and molecular diversity in Sclerospora graminicola, the causal agent of pearl millet
downy mildew. Arch Phytopathol Plant Prot 43(6):538–551
Sharma R, Rao VP, Senthilvel S, Rajput SC, Thakur RP (2011) Virulence diversity in north Indian
isolates of Sclerospora graminicola, the pearl millet downy mildew pathogen. J Plant Pathol
93(1):71–78
Shaw CG (1981) Taxonomy and evolution. In: Spencer DM (ed) The downy mildews. Academic,
London, pp 17–29
Shetty HS, Ahmad R (1981) Physiologic specialization in Sclerospora graminicola. Indian
Shetty HS, Khanzada AK, Mathur SB, Neergard P (1978) Procedures for detecting seed-borne
inoculums of Sclerospora graminicola in pearl millet (Pennisetum typhoides). Seed Sci Technol
6:935–941
Shetty HS, Mathur SB, Neergaard P (1980) Sclerospora graminicola in pearl millet seeds and its
transmission. Trans Br Mycol Soc 74:127–134
Shetty SA, Shishupala S, Nagarathna KC, Kumar VU, Shetty HS (1998) Management of cereal
downy mildews. In: Upadhyay RK, Mukerji KG, Rajak RL (eds) Book series in integrated pest
management system in agriculture, I, Adithya Books Ltd, New Delhi, IARI, Delhi, PI 59
Shivakumar PD, Vasanthi NS, Shetty HS, Smedegaard-Petersen V (2000) Ribonucleases in the
seedlings of pearl millet and their involvement in resistance against downy mildew disease. Eur
Singh SD (1990) Sources of resistance to downy mildew and rust in pearl millet. Plant Dis
74:871–874
Singh SD (1995) Downy mildew of pearl millet. Plant Dis 79:545–550
Singh SD, Gopinath R (1985) A seedling inoculation technique for detecting downy mildew
resistance in pearl millet. Plant Dis 69:582–584
Singh SD, King SB (1988) Recovery resistance to downy mildew in pearl millet. Plant Dis
72:425–428
Singh SD, Shetty HS (1990) Efficacy of systemic fungicide metalaxyl for the control of downy
mildew (Sclerospora graminicola) of pearl millet (Pennisetum glaucum). Indian J Agric Sci
60:575–581
Singh SD, Singh G (1987) Resistance to downy mildew in pearl millet hybrid NHB-3. Indian
Phytopathol 40(2):178–180
Singh SD, Talukdar BS (1996) Recovery resistance to downy mildew in pearl millet parental lines
ICMA 1 and ICMB 1. Crop Sci 36(1):201–203
Singh SD, Talukdar BS (1998) Inheritance of complete resistance to pearl millet downy mildew.
Singh SD, Williams RJ (1980) The role of sporangia in the epidemiology of pearl millet downy
mildew. Phytopathology 70:1187–1190
Singh SD, Singh P, Andrew DJ, Talukdar BS, King SB (1992) Reselection of a pearl millet cultivar
utilizing residual variability for downy mildew reaction. Plant Breed 109:54–59
Singh SD, King SB, Werder J (1993) Downy mildew disease of pearl millet. Information Bulletin
no 37. ICRISAT, Patancheru
Singh SD, Wilson JP, Navi SS, Talukdar BS, Hess DE, Reddy KN (1997) Screening techniques and
sources of resistance to downy mildew and rust in pearl millet. Information Bulletin no. 48.
ICRISAT, Patancheru, p 110
Sudisha J, Amruthesh KH, Deepak SA, Shetty NP, Sarosh BR, Shetty HS (2005) Comparative
efficacy of strobilurin fungicides against downy mildew disease of pearl millet. Pest Biochem
Physiol 81(3):188–197
Sudisha J, Kumar SA, Shetty HS (2008) Characterization of downy mildew isolates of Sclerospora
graminicola by using differential cultivars and molecular markers. J Cell Mol Biol 7:41–55
Sudisha J, Kumar SA, Niranjana SR, Shetty NP, Shetty HS (2009) Cloning and development of
pathotype-specific SCAR marker associated with Sclerospora graminicola isolates from pearl
millet. Aust Plant Pathol 38:216–221
Sudisha J, Kumar A, Amruthesh KN, Niranjana SR, Shetty HS (2011) Elicitation of resistance and
defense related enzymes by raw cow milk and amino acids in pearl millet against downy mil-
dew disease caused by Sclerospora graminicola. Crop Prot 30(7):794–801
Thakur RP (1999) Pathogen diversity and plant disease management. Indian Phytopathol
52(1):1–9
Thakur RP, Rao VP (1997) Variation in virulence and aggressiveness among pathotypes of
Scleropora graminicola on pearl millet. Indian J Mycol Plant Pathol 50:41–47
Thakur RP, Shetty KG (1993) Variation in pathogenicity among single oospore isolates of
Sclerospora graminicola the causal organism of downy mildew in pearl millet. Plant Pathol
42:715–721
Thakur RP, Shetty KG, King SB (1992) Selection for host-specific virulence in asexual popula-
tions of Sclerospora graminicola. Plant Pathol 41:626–632
Thakur RP, Rao, VP, Hash CT (1998) Emergence of a highly virulent pathotype of Sclerospora
graminicola at Jodhpur, Rajasthan, India. International Sorghum Pearl Millet News Letter.
Thakur RP, Rao VP, Sastry JG, Sivaramakrishnan S, Amruthesh KN, Barbind LD (1999) Evidence
for a new virulent pathotype of Sclerospora graminicola on pearl millet. Indian J Mycol Plant
Pathol 29:61–69
Thakur RP, Rai KN, Rao VP, Rao AS (2001) Genetic resistance in pearl millet male-sterile lines to
diverse pathotypes of Sclerospora graminicola. Plant Dis 85:621–626
Thakur RP, Rao VP, Wu BM, Subbarao KV, Shetty HS, Singh G, Lukose C, Panwar MS, Paco S,
Hess DE, Gupta SC, Dattar VV, Panicker S, Pawar NB, Bhangale GT, Panchbhai SD (2004a)
Host resistance stability to downy mildew in pearl millet and pathogenic variability in
Sclerospora graminicola. Crop Prot 23:901–908
Thakur RP, Sivaramakrishnan S, Kannan S, Rao VP, Hess DE, Magil CW (2004b) Genetic and
pathogenic variability among isolates of Sclerospora graminicola the downy mildew pathogen
of pearl millet. In: Spencer-Phillips P, Jeger M (eds) Advances in Downy Mildew Research,
Kluwer Academic Publishers, 2:179–192
Theradi Mani M, Juliet Hepziba S (2009) Biological management of pearl millet downy mildew
caused by Sclerospora graminicola. Arch Phytopathol Plant Prot 42(2):129–135
Umesha S, Dharmesh SM, Shetty SA, Krishnappa M, Shetty HS (1998) Biocontrol of downy
mildew disease of pear millet using Pseudomonas fluorescens. Crop Prot 17:387–392
Umesha S, Shylaja Dharmesh M, Shetty HS (2000) Lytic activity in pearl millet: its role in downy
mildew disease resistance. Plant Sci 157(1):33–41
Werder J, Ball L (1992) Variability of pearl millet downy mildew (Sclerospora graminicola) and
its implications for breeding for stable and durable resistance. Trop Pest Manag 38(1):43–47
Weston WH (1929) The occurrence of Sclerospora graminicola on maize in Wisconsin.
Williams RJ, Singh SD, Pawar MN (1981) An improved field screening technique for downy mil-
dew resistance in pearl millet. Plant Dis 65:239–241
Wilson JP, Samoga MD, Nutsugah SK, Angarawai I, Fofana A, Traore H, Ahmadou I, Muuka FP
(2008) Evaluation of Pearl millet for yield and downy resistance across seven countries in sub-
saharan Africa. Afr J Agric Res 3(5):371–378
Yadav OP (1996) Downy mildew incidence of pearl millet hybrids with different male sterility
inducing cytoplasms. Theor Appl Genet 92:278–280
Yadav OP (2012). Project Coordinator Review. Annual Workshop of All India Coordinated Pearl
Millet Improvement programme, Indian Council of Agricultural Research, p15
Yadav RS, Sehgal D, Vadez V (2011) Using genetic mapping and genomics approaches in under-
standing and improving drought tolerance in pearl millet. J Exp Bot 62:397–408
Chapter 5
Research on Plant Pathogenic Fungi
in the Genomics Era: From Sequence
Analysis to Systems Biology
Anandaraj Muthuswamy and Santhosh J. Eapen
5.1 Introduction
Fungi are of immense importance to mankind, in a multitude of ways that reflect the
diversity of this kingdom, which ranges from mushrooms to plant pathogens and
biocontrol agents. With the recent advances in genome sequencing, we are on the
verge of a flood of new genome data from a plethora of plant pathogens. The avail-
ability of whole-genome sequences has also fundamentally changed the methods
used for the identification and mapping of genes. Current peer-reviewed literature is
littered with many other exciting new tools and techniques that are being used in all
areas of biology and medicine. Transcriptomics, proteomics and, more recently,
metabolomics are three of these techniques that have impacted on fungal plant
pathology. The relatively young discipline of bioinformatics became vital for man-
aging the large amounts of data produced by these new techniques. Bioinformatics
platforms have become essential tools for accessing “omics” data sets for the effi-
cient mining and integration of biologically significant knowledge.
There are several recent reviews available on next-generation sequencing,
genomics and bioinformatics (Mardis 2008; Morozova et al. 2009; Stahl and
Lundeberg 2012; Li et al. 2013) and their application in studying plant pathogens
and their interaction with host plants (Schneider and Collmer 2010; Studholme
et al. 2011). In this review we summarize the current status of fungal genome
projects including that of oomycetes and the usefulness of this vast genomic
A. Muthuswamy, Ph.D. (*)

Indian Institute of Spices Research, P.B. 1701, Marikunnu Post, Kozhikode,
Kerala 673012, India
e-mail: anandaraj@spices.res.in
S.J. Eapen, Ph.D.
Division of Crop Protection, Indian Institute of Spices Research, Kozhikode, Kerala, India

132 A. Muthuswamy and S.J. Eapen
information to determine gene function and to compare genomes from different

species. Since this is such a fast-moving field, useful web sites and bioinformat-
ics tools are listed that will enable the plant pathologists to employ them in their
routine research.
5.2 Sequence Resources for Fungi
Recent high-throughput technological advances have provided opportunities to

develop collections of sequence-based resources and related resource platforms for
specific organisms. Comprehensively collected sequence data provide essential
genomic resources for accelerating molecular understanding of biological proper-
ties and for promoting the application of such knowledge. Species-specific nucleo-
tide sequence collections also provide opportunities to identify the genomic aspects
of phenotypic characters based on genome-wide comparative analyses and knowl-
edge of model organisms. Genomes of biocontrol strains and related species allow
the identification of biocontrol factors in the respective strains. Next-generation
sequencing technology coupled with reference genome sequence data allows us to
discover variations among individuals, strains, and/or populations. Nucleotide poly-
morphisms are effectively identified by mapping sequence fragments onto a particu-
lar reference genome data set, a capability that is of immense importance in all
genetic research. A necrotrophic fungal pathogen (Pyrenophora teres f. teres) of
barley (Hordeum vulgare) has recently become the first eukaryotic phytopathogen
to have a complete genome sequenced exclusively using short (75-nucleotide)
Illumina reads (Ellwood et al. 2010). Short Illumina sequence reads from
Phytophthora infestans and its closely related sister species were aligned against the
high-quality reference sequence of strain T30–4 using the MAQ alignment software
to study the genomic evolution in this group and to infer copy-number variations,
SNPs, and signatures of positive selection (Raffaele et al. 2010).
There are a number of providers for fungal genome sequences and annotations.
A list of web-accessible information resources providing genome sequences and
annotations of various fungal species is provided in Table 5.1. Among the eukary-
otes, the greatest numbers of sequenced genomes have been from the fungal king-
dom (Haridas et al. 2011). The first genome sequence of a fungus was published in
1996 for Saccharomyces cerevisiae, which is now used as a model species. To date,
several genome sequencing projects involving various fungal and oomycete plant
pathogens have already been completed and many are in the pipeline (Table 5.2).
The proliferation of new sequencing technologies and assembly software and the
decline in their cost have made it feasible for many research labs to now attempt
sequencing and assembly of genomes of their interest. At Indian Institute of Spices
Research (Kozhikode, India) two isolates of Phytophthora capsici from black pep-
per (05-06 and 98-93) were sequenced using Illumina/Roche 454 platforms and the
cross-platform sequence data was de novo assembled and annotated structurally
and functionally to curate all possible gene by gene information. Whole-genome
5 Research on Plant Pathogenic Fungi in the Genomics Era… 133
Table 5.1 Internet resources providing information on fungal genome sequencing projects
Organization/Resource URL
Broad Institute http://www.broad.mit.edu/annotation/fgi/
Genomes OnLine http://www.genomesonline.org/
Database
Genoscope, Sequencing http://www.genoscope.cns.fr/spip/Fungi-sequenced-at-Genoscope.html
National Centre
Joint Genome Institute http://genome.jgi-psf.org/euk_home.html
National Center for http://www.ncbi.nlm.nih.gov/genomes/FUNGI/funtab.html
Biotechnology
Information
Sanger Center http://www.sanger.ac.uk/Projects/Fungi/
The Genome Center at http://genome.wustl.edu/genomes/list/plant_fungi
Washington
University
(WU-GSC)
The Institute for http://www.tigr.org/tdb/fungal/index.shtml
Genomic Research
The Sanger Institute http://www.sanger.ac.uk/Projects/Fungi/
fungal sequencing
Fusarium graminearum http://mips.helmholtz-muenchen.de/genre/proj/FGDB/
genome database
(FGDB)
Neurospora crassa http://mips.helmholtz-muenchen.de/genre/proj/ncrassa/
Genome Database
(MNCDB)
Ustilago maydis http://mips.gsf.de/genre/proj/ustilago
Database (MUMDB)
Saccharomyces Genome http://www.yeastgenome.org/
Database (SGD)
Aspergillus Database http://www.cadre-genomes.org.uk/
Repository
(CADRE)
alignment of 05-06 and 98-93 sequence data with the reference genome revealed
that their similarity was 95.35 % and 87.90 %, respectively, with the reference
genome, indicating the wide variability existing in P. capsici isolates of Indian sub-
continent (IISR 2013).
All these new techniques are massively parallel in nature and present new chal-
lenges in terms of bioinformatics support required. A broad outline of bioinformat-
ics approaches for the analysis of NGS data and the tools available are given by
Horner et al. (2009) and Haridas et al. (2011). Most of the current generation of
bioinformatics tools for analysis of NGS data is command line driven and somewhat
inaccessible to many biologists. More intuitive and simple graphic user interfaces
are the current need of the hour to render the power of these new technologies avail-
able to a wider audience within the scientific community.
Table 5.2 Plant pathogenic fungi and oomycetes whose whole genomes have been completely
sequenced
Genome
Pathogen Disease size (Mb) Status Genome centre/lab
A. Fungi
Alternaria Black spot on 30 Draft • Washington
brassicicola crucifers University
Ashbya gossypii Stigmatomycosis 8.74 Complete • University of Basel
• Syngenta AG
Aspergillus flavus Grain mold 36 Draft • J. Craig Venter
Institute
Aspergillus niger Black mold 32 Draft • DOE-JGI
ATCC 1015
Aspergillus niger Black mold 33.98 Complete • DSM Food
CBS 513.88 Specialties
• Gene Alliance
Blumeria graminis f. Barley powdery 45 Complete • Agencourt
sp. hordei mildew Bioscience
• Blumeria Genome
Sequencing
Consortium
Botrytis cinerea Gray mold rot of 38.8 Complete • Broad Institute
grapes
Cochliobolus Southern corn leaf 34.9 Draft • DOE Joint Genome
heterostrophus blight in maize Institute
Fusarium Fusarium head blight 36.33 Complete • Broad Institute
graminearum
Fusarium oxysporum Fusarium wilt of 60 Draft • Broad Institute
f. sp. lycopersici tomato
(race 2)
Fusarium Kernel and ear rot of 46 Mb Draft • Broad Institute
verticillioides maize
Gaeumannomyces Take-all plant disease 41.98 Complete • Broad Institute
graminis tritici of cereal plants
Gibberella Kernel and ear rot of 41.98 Draft • Broad Institute
moniliformis maize
Gibberella zeae Fusarium head blight 36.49 Complete • Broad Institute
on wheat and
barley
Grosmannia Destruction of pine 32.5 Complete • BC Genome
clavigera kw1407 tree Sciences Center
Magnaporthe grisea Rice blast 41.5 Complete • Broad Institute
• North Carolina
State University
Mycosphaerella Black leaf streak 74.1 Complete • DOE Joint Genome
fijiensis disease of banana Institute
Mycosphaerella Septoria tritici blotch 41.2 Complete • DOE Joint Genome
graminicola Institute
Nectria Stem and root rot 51.27 Complete • DOE Joint Genome
haematococca Institute
(continued)

Genome
Pathogen Disease size (Mb) Status Genome centre/lab
Phaeosphaeria Disease of wheat 37.21 Complete • Broad Institute
nodorum
Phanerochaete White rot 35.1 Draft • DOE Joint Genome
chrysosporium Institute
Puccinia graminis f. Wheat stem rust 81.5 Draft • Broad Institute
sp. tritici
Pyrenophora Tan spot of wheat 40 Draft • Broad Institute
tritici-repentis
Sclerotinia Large host range 38.53 Complete • Broad Institute
sclerotiorum
Stagonospora Glume blotch of 37.1 Draft • Broad Institute
nodorum wheat
Ustilago maydis Corn smut 19.64 Complete • Bayer
• Broad Institute
• LION Bioscience
AG
Verticillium dahliae Wilt in several plants 33.83 Draft • Broad Institute
VdLs.17
B. Oomycetes
Hyaloperonospora Downy mildew of 75 Draft • Washington
parasitica Arabidopsis University/VBI
thaliana
Phytophthora capsici Damping-off, stem – Draft • NCGR/DOE Joint
and vine blight, Genome Institute
wilting or fruit rot
Phytophthora Potato late blight 240 Draft • Broad Institute
infestans
Phytophthora Sudden oak death 6.6 Draft • DOE Joint Genome
ramorum Institute
Phytophthora sojae Soybean blight 95 Draft • DOE Joint Genome
Institute
Pythium ultimum Pythium root rot – Draft • JVCI/Michigan
State University
The flood of new data from a large cohort of microbial genomes enables a rapid
and systematic mining for gene identification, classification, and functional analysis.
Whole-genome sequence information allows us to derive sets of important genomic
features, including the identification of protein-coding or non-coding genes and con-
structs such as gene families, regulatory elements, repetitive sequences, simple
sequence repeats (SSRs), and guanine–cytosine (GC) content. These data sets have
become primary sequence material for the design of genome sequence-based plat-
forms such as microarrays, tiling arrays or molecular markers, as well as for refer-
ence data sets for the integration of “omics” elements into a genome sequence.
Chromosome-scale comparisons identifying conserved similarities of gene
coordinates facilitate documentation of segmental and tandem duplications in
related species. Whole-genome comparisons identifying chromosomal duplication

and conserved synteny among related species provide evidence for hypotheses on
comparative evolutionary histories with regard to the diversification of species in a
related lineage. New sequencing technologies have provided us with new opportu-
nities to be addressed at the entire genome level in the fields of comparative genom-
ics, metagenomics, and evolutionary genomics.
5.3 Comparative Genomics
The availability of genomes from several fungal species allows us to examine the
demarcation of fungal species at the whole-genome level. Genomic data can aid
fungal taxonomy by serving as a source of novel and unprecedented amounts of
comparative data, as a resource for the development of additional diagnostic tools,
and finally as a knowledge database about the biological differences between strains
and species. Comparative genomics will greatly influence the way we understand
these organisms, as comparative anatomy did in the eighteenth and nineteenth cen-
turies. Such extensive genome comparisons have been made for Aspergillus (Rokas
et al. 2007). Dedicated comparative genomics platforms like CFGP (http://cfgp.
riceblast.snu.ac.kr/) are available for fungi (Park et al. 2008).
5.3.1 Molecular Markers
Studies on epidemiology, ecology, evolution, and taxonomy of plant pathogens rely

on availability of genetic markers. Recent developments in genomics have opened
up for newer opportunities to study the diversity and classification of fungi. With the
progress of genome sequencing and large-scale EST analysis in various species,
these sequence data sets have become quite efficient resources for designing molec-
ular markers covering entire genomes. Hitherto we were relying on conventional
markers such as RFLP (restriction fragment length polymorphism), RAPD (random
amplified polymorphic DNA), SSRs, and AFLP (amplified fragment length poly-
morphism). More recently, it has become common to perform multilocus sequence
analysis (MLSA), whereby partial or complete nucleotide sequences are determined
for several housekeeping genes. A number of attempts to design polymorphic mark-
ers from accumulated sequence data sets have been made for various species. Novel
high-throughput sequencing methods outperform earlier approaches in terms of
resolution and magnitude. With the rapid development of NGS technologies, tre-
mendous numbers of molecular markers like SSRs and SNPs have been identified.
With the availability of genomic sequence data, SNP markers become more acces-
sible for use in mapping, to help achieve a much better resolution. Genome-wide
marker discovery by NGS has become more feasible using several new methods
that facilitate studying association mapping, patterns of natural population structure
and the decay of linkage disequilibrium.
5.3.2 Evolutionary Genomics
Understanding the evolutionary history of newly emerging or reemerging pathogens

can help in management of emerging epidemics and suggest strategies to address
future threats. Nucleotide sequence data offer the possibility of reconstructing pat-
terns of descent among genotypes within a species, or among populations of one or
more species (Goss et al. 2009; Stukenbrock et al. 2007). There is an increasing
body of evidence to suggest that horizontal gene transfer (HGT), frequently observed
in prokaryotes, is an important mechanism in eukaryotic genome evolution too. Of
late, a number of fungal HGT events are being reported through bioinformatics-
based methodologies. The implications HGT on the fungal tree of life have been
recently reviewed by Fitzpatrick (2012).
Ancestral and derived states can be distinguished from sequence data using a
combination of coalescent analysis to infer gene genealogies and Bayesian or maxi-
mum likelihood (ML) approaches to determine distributions for population param-
eters of interest (Grunwald and Goss 2011). Coalescent-based methods help in
answering questions on the evolutionary origin of emerging pathogens as new spe-
cies or subspecies, or are they evolved from local populations or are they new intro-
ductions to a host or environment, or are they variable populations as a result of
diversification. Coalescent analysis based on genome-wide, high-density SNP
data, or population genomic studies using high-throughput sequencing data will
provide yet another level of analysis not currently available. If a barcoding system
can be developed for use with NGS technology, many fungal species could now be
sequenced simultaneously at a lower cost. Sequencing at lower levels of coverage
or sequencing only targeted regions of DNA are practical strategies for studying
population genetics, conservation genetics and molecular ecology. Some of the
tools for estimation of the age of a population, species, or evolutionary lineages are
listed in Table 5.3.
Table 5.3 Tools for population genetics studies

Tool URL
BEAGLE http://faculty.washington.edu/browning/beagle/beagle.html
Genetree http://www.stats.ox.ac.uk/~griff/software.html
IM & IMa2 http://genfaculty.rutgers.edu/hey/software
InStruct http://cbsuapps.tc.cornell.edu/InStruct.aspx
LAMARC http://evolution.genetics.washington.edu/lamarc/lamarc_download.html
LDhat http://ldhat.sourceforge.net/
MIGRATE http://popgen.sc.fsu.edu/Migrate/Migrate-n.html
SequenceLD http://www.maths.lancs.ac.uk/~fearnhea/software/Rec.html
STRUCTURE http://cbsuapps.tc.cornell.edu/structure.aspx
TESS http://membres-timc.imag.fr/Olivier.Francois/tess.html
5.4 Functional Genomics
5.4.1 Host–Pathogen Interaction
Many fungal genes involved in pathogenicity and genes involved in effector

recognition and defense responses have been identified over the past decade.
Complete genome sequences have generated new lists of virulence candidates
based on homology, pathogen-specific paralog amplification, linkage with regions
that are variable and/or enriched in known virulence genes, and other criteria
(Schneider and Collmer 2010). Many hundreds of candidate cytoplasmic effector
(CE) genes that would have previously escaped detection are now found out.
Furthermore, with next-generation sequencing thousands of CEs can be invented
for the pan-genome of various species. Genome mining and bioinformatics pipe-
lines have streamlined the suite of effectors in important pathogen genomes, so
researchers can make more targeted strikes on potentially important effectors. The
current genomics-driven research though enables the discovery of many effector
repertoires, urgently requires gene ontology (GO) terms to systematically accumu-
late information about them. The universal nature of GO terms will facilitate com-
parisons with other virulence factors in diverse systems. The Plant-Associated
Microbe Gene Ontology (PAMGO) interest group has worked with the GO
Consortium to generate more than 800 new GO terms which can address biological
processes associated with host–microbe interactions (Torto-Alalibo et al. 2009).
This combination of informatics and empirical studies will allow greater insight
into effector function. Bioinformatics data mining tools and techniques are also
being used for identifying and characterizing several genes helpful in the transcrip-
tional and expression based study of pathogenesis like 1-aminocyclopropane-1-car-
boxylate deaminase in P. sojae (Singh and Kashyap 2012), glucanase inhibitor
protein (Reena et al. 2010a) and elicitin (Vijeshkumar et al. 2013) in P. capsici,
hydrophobins in Aspergillus (Littlejohn et al. 2012), transcription factors
(Převorovsky et al. 2011), and pathogenesis related proteins (Prasath et al. 2014).
Bioinformatics approaches are indispensable for predicting secreted proteins
(Reena et al. unpublished; Brown et al. 2012; do Amaral et al. 2012) and miRNAs
(Nan et al. 2012) from the available genomic information.
5.4.2 Expressed Sequence Tags and cDNA Clones
Expressed sequence tags (ESTs) are a sequence-based method for expression pro-
filing. ESTs are created by partial “one-pass” sequencing of randomly picked
gene transcripts that have been converted into cDNA. Since cDNA and EST
collections can be acquired regardless of genomic complexity, this approach has
been applied not only to model species but also to a number of other species.
As more and more EST data have become publicly available, the usage of ESTs
has expanded to other areas, such as in silico genetic marker discovery, in silico
gene discovery, construction of gene models, alternative splicing prediction,
genome annotation, expression profiling, and comparative genomics. In compari-
son with whole-genome sequencing, EST technology is simpler and less costly,
especially in the case of large genomes. Moreover, since ESTs represent “the
expressed parts” of genomes, they are more immediately informative about the
transcriptomes. On the other hand, ESTs are not suitable for the studies related to
“the control parts” of genomes, such as promoters and transcription enhancing/
inhibiting elements. In addition, information for rarely expressed genes is also
difficult to mine from EST data.
The comprehensive and rapid accumulation of cDNA clones together with mass
volume data sets of their sequence tags have become significant resources for func-
tional genomics. ESTs derived from various kinds of tissues, including tissues from
organisms in a range of developmental stages or under stress, could significantly
facilitate gene discovery as well as gene structural annotation, large-scale expres-
sion analysis, genome-scale intraspecific and interspecific comparative analysis of
expressed genes and the design of expressed gene-oriented molecular markers and
probes for microarrays (Zhong et al. 2009). The sequence resources derived from
full-length cDNAs can also help substantially in identifying transcribed regions in
completed or draft genome sequences. Full-length cDNAs are also useful for deter-
mining the three-dimensional (3D) structures of proteins by X-ray crystallography
and nuclear magnetic resonance (NMR) spectroscopy and for functional biochemical
analyses of expressed proteins in the molecular interactions of protein–ligands,
protein–proteins and protein–DNAs.
EST data mining requires bioinformatics resources such as databases, data
retrieving tools and analysis algorithms. Because EST data collected from the
cDNA libraries of a particular organism consist of redundant sequence data
derived from the same gene locus or transcription unit, it is often necessary to
perform EST grouping by transcription units and to assemble these groups in
order to create a consolidated alignment and representative sequence of each tran-
script before further analysis that are performed computationally. Bioinformatics
tools are also indispensible to deal with EST errors and contaminations. Many of
these tools are freely available to the academic community. NCBI’s dbEST, a pub-
lic domain EST database (http://www.ncbi.nlm.nih.gov/dbEST/) includes a num-
ber of fungal species. ESTs from 18 species of plant pathogenic fungi and two
species of phytopathogenic oomycete can be found in the COGEME database
(Soanes and Talbot 2006). ESTs of P. capsici were processed and functionally
annotated using in silico tools and a range of genes likely to be involved in patho-
genesis, drug resistance, stress, host degradation, and genetic marker related pro-
teins were identified (Reena et al. 2010b). In a similar approach, disease resistance
genes were identified through downstream analysis of ginger ESTs (Karthika
et al. 2013).
5.4.3 Transcriptomics
Transcriptomics, or quantitative gene expression profiling is the large-scale study of

the transcriptome, giving a global view of all transcripts simultaneously. It helps in
identification of the complete set of transcripts in a particular biological sample and
estimation of their abundances under specific physiological conditions or at specific
developmental stages. Northern blotting, real-time PCR, serial analysis of gene
expression (SAGE), and microarrays were hitherto used for gene expression profil-
ing. Application of next-generation sequencing technologies to cDNA sequencing
is commonly called RNA-Seq. This method of transcriptome analysis is fast and
simple because it does not require bacterial cloning of the cDNAs. RNA-seq tech-
nology, in conjunction with efficient bioinformatics tools, is now more widely used
to support predicted gene models, extract differentially expressed genes, and find
novel transcripts in de novo assemblies. In addition, being very sensitive, it allows
the detection of low-abundance transcripts. Massively parallel short-read sequenc-
ing technologies have been highly efficacious for the discovery of novel small non-
coding RNAs (ncRNAs) viz. micro-RNAs (miRNAs) and small interfering RNAs
(siRNAs) which serve as posttranscriptional regulators of gene expression in a wide
range of organisms (Morozova et al. 2009). miRNAs have been identified through
high-throughput screening in Sclerotinia sclerotiorum (Zhou et al. 2012) and
Cryptococcus neoformans (Nan et al. 2012).
Illumina and 454 sequencing platforms contributed large numbers of cDNA
sequences from fungal (Spanu et al. 2010) and oomycete (Levesque et al. 2010;
Miller et al. 2008) plant pathogens. Illumina genome analyzer based sequencing
technology (Illumina, USA) yields huge amount of short reads with high coverage.
Assembling such short reads is a challenging task, more so in the absence of refer-
ence sequences. The downstream analysis in transcriptomics involves transcriptome
characterization and gene annotation using a set of differentially expressed genes.
Bioinformatics tools dealing with transcriptome alignment, splicing event predic-
tion, and de novo assembly are also available (Table 5.4).
Fungal transcriptomics has been reviewed by Vijai et al. (2007). For identifying
putative key genes in plant–pathogen interactions, simultaneous transcriptome anal-
ysis of plant and pathogen by using de novo assembly was attempted in sorghum—
Bipolaris sorghicola (Yazawa et al. 2013), rice—Magnaporthe oryzae (Kawahara
et al. 2012), banana—Fusarium oxysporum f. sp. cubense (Li et al. 2012), banana—
Mycosphaerella musicola (Passos et al. 2013). Recently, a large number of candi-
date pathogen response genes were identified by comparing the ginger and mango
ginger transcriptomes and expression profiling based on read per exon kilobase per
million (RPKM) (Prasath et al. 2014; IISR 2013). Many defense related genes dif-
ferentially expressed in two species of Piper viz. Piper nigrum and P. colubrinum
on challenging with Phytophthora capsici were identified through transcriptome
data analysis (Johnson et al. unpublished; IISR 2013). SNP detection is also a com-
mon application of RNA-Seq.
Table 5.4 Bioinformatics tools/databases for functional genomics and transcriptome data analysis
Software Description URL
ABMapper RNA-seq data alignment http://hkbic.cuhk.edu.hk/software/
abmapper
Bowtie RNA-seq data alignment http://bowtie-io.sourceforge.net/bowtie2/
index.shtml
Cufflinks Transcript assembly http://cufflinks.cbcb.umd.edu/
DEGseq Differential gene expression http://www.bioconductor.org/
detection packages/2.11/bioc/html/DEGseq.html
Infernal RNA-seq data alignment http://infernal.janelia.org/
Oases De novo assembly www.ebi.ac.uk/~zerbino/oases/
Tophat RNA-seq data alignment and http://tophat.cbcb.umd.edu/
alternative splicing detection
Trans-AByss De novo assembly http://www.bcgsc.ca/platform/bioinfo/
software/
Trinity De novo assembly http://trinityrnaseq.sourceforge.net/
FungiDB Functional genomics of fungi http://fungidb.org
PAMGO Controlled vocabulary for the http://pamgo.vbi.vt.edu/
interaction of microbes with
their hosts
PHI-base Fungal pathogen host interactions http://www.phi-base.org/
PLEXdb Gene expression resources for http://www.plexdb.org
plants and plant pathogens
PathoPlant® Signal transduction related to http://www.pathoplant.de/
plant–pathogen interactions
COGEME Phytopathogenic fungi and http://cogeme.ex.ac.uk/
oomycete EST database
DFVF Database of fungal virulence factors http://sysbio.unl.edu/DFVF/
5.4.4 Proteomics
Detailed analysis of fungal biochemistry is now enabled by multiple technologies

including protein mass spectrometry, genome and transcriptome sequencing and
advances in bioinformatics. Unraveling intricacies of more complex proteomic
interactions that involve fungi, oomycetes, PGPRs and symbiotic fungi, which
strengthen plant defenses will generate valuable information on how pathosystems
actually function in nature, and thereby provide clues to solving disease problems
that engender major losses in crops every year. Yet, the assignment of function to
fungal proteins, encoded either by in silico annotated, or unannotated genes, remains
problematic. Recent reviews (González-Fernández et al. 2010; Gonzalez-Fernandez
and Jorrin-Novo 2012) clearly illustrates that proteomics has also been exploited,
but perhaps not to its potential, by the fungal phytopathogen community. A lack of
genome sequence information has frustrated proteomics researchers and has largely
contributed to this technique not fulfilling its potential. A combination of high-
throughput, quantitative proteomics, allied to transcriptomic sequencing, are set to
reveal much about protein function in fungi (Doyle 2011). They allow screening and
analysis, at the sub-cellular level, of peptides and proteins resulting from plants,
pathogens, and their interactions. They also highlight post-translational modifica-
tions to proteins, e.g. glycosylation, phosphorylation, or cleavage. Recent literature
testifies the usefulness of novel, gel-free techniques in protein identification and
quantification in pathogenic fungi like Botrytis cinerea (Gonzalez-Fernandez et al.
2013) and P. infestans (Lim et al. 2013).
5.4.5 Metabolomics
Metabolomics is the most recent of these techniques to emerge and is concerned

with the non-targeted profiling of all metabolites in a given system. It consists of
strategies to quantitatively identify cellular metabolites and to understand how traf-
ficking of these biochemical messengers through the metabolic network influences
phenotype. Metabolomics plays a key role in functional genomics and strain classi-
fication (Michael et al. 2006). The availability of data from fungal genome sequenc-
ing projects has facilitated the discovery and characterization of new compounds and
their biosynthetic pathways. Despite their medical and agricultural importance, most
putative gene clusters in fungal genomes have been predicted manually. Knowledge
of the genetic background of endophytic natural product biosynthesis is discussed in
detail by Staniek et al. (2008). Of late, the complex biosynthetic pathways associated
with secondary metabolites are resolved by combining in silico pathway analysis
with metabolite profiling (Forster et al. 2002; Nora et al. 2010). A few tools for pre-
dicting fungal secondary metabolites (SMURF, antiSMASH, etc.) biosynthesis are
already available online (Khaldi et al. 2010; Blin et al. 2013). A list of proteomic
tools currently in use is given in Table 5.5. Metabolomics studies on fungal plant
pathogens are only just beginning to appear, although their potential to dissect many
facets of the pathogen and disease will see its popularity increase quickly. There are
a few metabolomic studies done on crops with fungal infection (Figueiredo et al.
2008; Parker et al. 2009; Aliferis and Jabaji 2012; Hong et al. 2012).
5.4.6 Systems Biology
The tools of systems biology can be successfully employed in understanding the

complex ensemble of molecular interactions underlying pathogen–plant interac-
tions. Systems biology enables studying virulence factors as pathosystem compo-
nents, and pathosystems for their emergent properties (Schneider and Collmer
2010). Wherever genomic information is available, genome-scale metabolic recon-
struction (GEMR), along with flux balance analysis, can be used to study host meta-
bolic network phenotype during the interaction with pathogens. Alternatively,
targeted metabolic reconstruction, where network reconstruction is guided by
transcriptomic data instead of genomic information. A systems-level framework
Table 5.5 Bioinformatics resources commonly used in fungal proteomic studies

Program/Database Description URL
Mascot Website for both peptide mass http://www.matrixscience.com
fingerprint and MS/MS
database searches
SEQUEST For correlating tandem mass http://fields.scripps.edu/sequest/
spectra of peptides with index.html
amino acid sequences from
protein and nucleotide
databases
X!Tandem Protein identification tool by http://www.thegpm.org/TANDEM/
matching tandem mass index.html
spectra with peptide
sequences
Expasy A portal for proteomic http://www.expasy.org/
resources
UniprotKB/SwissProt/ A central hub for functional http://www.uniprot.org/help/
TrEMBL information on proteins and uniprotkb
their annotation
Protein Information A centralized resource for http://pir.georgetown.edu/
Resource (PIR) protein sequences and
functional information
RCSB Protein Data Bank A portal for biological http://www.rcsb.org/pdb/download/
(RCSB PDB) macromolecular structures download.do
EMBL-EBI’s Protein European resource for the http://www.ebi.ac.uk/pdbe/
Data Bank in Europe collection, organization and
(PDBe) dissemination of 3D
structural data on biological
macromolecules
SWISS-2DPAGE Data on proteins identified on http://world-2dpage.expasy.org/
various 2-D PAGE and swiss-2dpage/
SDS-PAGE reference maps
FCPD A database of fungal http://p450.riceblast.snu.ac.kr/
cytochrome P450
MPID Magnaporthe grisea protein– http://bioinformatics.cau.edu.cn/
protein interaction database cgi-bin/zzd-cgi/ppi/mpid.pl
FPPI Protein–protein interaction http://csb.shu.edu.cn/fppi
database of F. graminearum
will be highly useful for the interpretation and modelling of host–microbe

interactions mediated by effectors. This approach is being applied successfully for
the Phytophthora infestans—Solanum tuberosum pathosystem (Pinzón et al. 2011).
5.5 Metagenomics
Metagenomics (also referred to as environmental and community genomics) is the

genomic analysis of microorganisms by direct extraction and cloning of DNA from
an assemblage of microorganisms. The introduction of NGS platforms has enabled
a great expansion of the field of metagenomics. As there is no need to clonally

culture organisms before sequencing, any kind of organism can be captured in its
natural environment, and its DNA can be subjected to sequencing. The tool is now
applied to diverse habitats like ocean, soil, and human gut. NGS technologies enable
identification and relative quantification of community members and offer new
insights into fungal community ecology. These methods are currently taking over as
the primary tool to assess fungal communities of plant-associated endophytes,
pathogens, and mycorrhizal symbionts, as well as free-living saprotrophs. Species
abundance in plant-associated fungal communities has been studied through
metagenomics approaches (Unterseher et al. 2011). Lindahl et al. (2013) have
reviewed the different stages involved in fungal community analysis, from field
sampling via laboratory procedures to bioinformatics and data interpretation.
5.6 Conclusion
Next-generation sequencing is playing an increasingly high-profile role in tran-

scriptomics, diagnostics, and epidemiology. Sequencing throughput is no longer the
major limiting factor, but sequence assembly and annotation for complex genomes
as well as data integration are the challenges. The data acquisition platforms for
other “-omics”, on the other hand, are under rapid development to catch up with the
pace of genomic research. The standardization of data acquisition and storage for-
mats using strictly controlled vocabulary is also important. There cannot be any
doubt that NGS approaches are here to stay and will provide major stimuli for bio-
informatics for many years to come. Nevertheless the field of phytopathology will
be radically transformed within a decade by the inevitable flood of sequence data
and the opportunities and challenges that it affords.
References
Aliferis KA, Jabaji S (2012) FT-ICR/MS and GC-EI/MS metabolomics networking unravels
global potato sprout’s responses to Rhizoctonia solani infection. PLoS One 7:e42576
Blin K, Medema MH, Kazempour D, Fischbach MA, Breitling R, Takano E, Weber T. antiSMASH
2.0—a versatile platform for genome mining of secondary metabolite producers. Nucleic
Acids Res 2013;41(Web Server issue):W204–W212. doi: 10.1093/nar/gkt449.
Brown NA, Antoniw J, Hammond-Kosack KE (2012) The predicted secretome of the plant patho-
genic fungus Fusarium graminearum: a refined comparative analysis. PLoS One 7(4):1–14
do Amaral A, Antoniw J, Rudd JJ, Hammond-Kosack KE (2012) Defining the predicted protein
secretome of the fungal wheat leaf pathogen Mycosphaerella graminicola. PLoS One 7(12):
1–19
Doyle S (2011) Fungal proteomics: from identification to function. FEMS Microbiol Lett
321(1):1–9
Ellwood SR, Liu Z, Syme RA, Lai Z, Hane JK, Keiper F et al (2010) A first genome assembly of
the barley fungal pathogen Pyrenophora teres f. teres. Genome Biol 11:R109
Figueiredo A, Fortes AM, Ferreira S, Sebastiana M, Choi YH, Sousa L, Acioli-Santos B, Pessoa F,
Verpoorte R, Pais MS (2008) Transcriptional and metabolic profiling of grape (Vitis vinifera L.)
leaves unravel possible innate resistance against pathogenic fungi. J Exp Bot 59:
3371–3381
Fitzpatrick D (2012) Horizontal gene transfer in fungi. FEMS Microbiol Lett 329(1):1–8
Forster J, Gombert AK, Nielsen J (2002) A functional genomics approach using metabolomics and
in silico pathway analysis. Biotechnol Bioeng 79:703–712
Gonzalez-Fernandez R, Jorrin-Novo J (2012) Contribution of proteomics to the study of plant
pathogenic fungi. J Proteome Res 11(1):3–16
González-Fernández R, Prats E, Jorrín-Novo J (2010) Proteomics of plant pathogenic fungi.
J Biomed Biotechnol 2010:932527. doi:10.1155/2010/932527
Gonzalez-Fernandez R, Aloria K, Arizmendi J, Jorrin-Novo J (2013) Application of label-free
shotgun nUPLC-MS(E) and 2-DE approaches in the study of Botrytis cinerea mycelium.
J Proteome Res 12(6):3042–3056
Goss EM, Carbone I, Grunwald NJ (2009) Ancient isolation and independent evolution of the three
clonal lineages of the exotic sudden oak death pathogen Phytophthora ramorum. Mol Ecol
18:1161–1174
Grunwald NJ, Goss EM (2011) Evolution and population genetics of exotic and re-emerging
pathogens: novel tools and approaches. Annu Rev Phytopathol 49:249–267
Haridas S, Breuill C, Bohlmann J, Hsiang T (2011) A biologist's guide to de novo genome assem-
bly using next-generation sequence data: a test with fungal genomes. J Microbiol Methods
86:368–375
Hong YS, Martinez A, Liger-Belair G, Jeandet P, Nuzillard JM, Cilindre C (2012) Metabolomics
reveals simultaneous influences of plant defence system and fungal growth in Botrytis cinerea-
infected Vitis vinifera cv. Chardonnay berries. J Exp Bot 63:5773–5785
Horner DS, Pavesi G, Castrignano T, De Meo PD, Liuni S, Sammeth M, Picardi E, Pesole G (2009)
Bioinformatics approaches for genomics and post genomics applications of next-generation
sequencing. Brief Bioinform 11(2):181–197
Indian Institute of Spices Research (2013) Annual report 2012–13. Kozhikode: IISR, 92 p
Karthika R, Rosana OB, Chandrashekar A, Prasath D. In silico identification of ginger ESTs poten-
tially associated with disease resistance. In: International symposium on biotechnology and
bioinformatics, 26 Jun 2013, SV University, Tirupathi
Kawahara Y, Oono Y, Kanamori H, Matsumoto T, Itoh T, Minami E (2012) Simultaneous RNA-seq
analysis of a mixed transcriptome of rice and blast fungus interaction. PLoS One 7(11):e49423.
doi:10.1371/journal.pone.0049423
Khaldi N, Seifuddin FT, Turner G, Haft D, Nierman WC, Wolfe KH, Fedorova ND (2010) SMURF:
genomic mapping of fungal secondary metabolite clusters. Fungal Genet Biol 47:736–741
Levesque CA, Brouwer H, Cano L, Hamilton JP, Holt C, Huitema E et al (2010) Genome sequence
of the necrotrophic plant pathogen Pythium ultimum reveals original pathogenicity mecha-
nisms and effector repertoire. Genome Biol 11:R73
Li C, Deng G, Yang J, Viljoen A, Jin Y, Kuang R et al (2012) Transcriptome profiling of resistant
and susceptible Cavendish banana roots following inoculation with Fusarium oxysporum f. sp.
cubense tropical race 4. BMC Genomics 13:374
Li MW, Qi X, Ni M, Lam HM (2013) Silicon era of carbon-based life: application of genomics and
bioinformatics in crop stress research. Int J Mol Sci 14:11444–11483
Lim S, Borza T, Peters R, Coffin R, Al-Mughrabi K, Pinto D, Wang-Pruski G. Proteomics analysis
suggests broad functional changes in potato leaves triggered by phosphites and a complex
indirect mode of action against Phytophthora infestans. J Proteomics 93:207
Lindahl B, Nilsson R, Tedersoo L, Abarenkov K, Carlsen T, Kjøller R, Kõljalg U, Pennanen T,
Rosendahl S, Stenlid J, Kauserud H (2013) Fungal community analysis by high-throughput
sequencing of amplified markers—a user's guide. New Phytol 199:288–299
Littlejohn KA, Hooley P, Cox PW (2012) Bioinformatics predicts diverse Aspergillus hydropho-
bins with novel properties. Food Hydrocoll 27(2):503–516
Mardis ER (2008) Next-generation DNA, sequencing methods. Annu Rev Genomics Hum Genet
9:387–402
Michael CJ, Gerald H, Jens N (2006) Fungal metabolite analysis in genomics and phenomics. Curr
Opin Biotechnol 17:191–197
Miller JR, Delcher AL, Koren S, Venter E, Walenz BP, Brownley A et al (2008) Aggressive
assembly of pyrosequencing reads with mates. Bioinformatics 24:2818–2824
Morozova O, Hirst M, Marra MA (2009) Applications of new sequencing technologies for tran-
scriptome analysis. Annu Rev Genomics Hum Genet 10:135–151
Nan J, Yaping Y, Guilhem J, Jiao P, Xudong Z (2012) Identification and functional demonstration
of miRNAs in the fungus Cryptococcus neoformans. PLoS One 7(12):1–10
Nora K, Fayaz TS, Geoff T, Daniel H, William CN, Kenneth HW, Natalie DF (2010) SMURF:
genomic mapping of fungal secondary metabolite clusters. Fungal Gene Biol 47:736–741
Park J, Park B, Jung K, Jang S, Yu K, Choi J et al (2008) CFGP: a web-based, comparative fungal
genomics platform. Nucleic Acids Res 36:D562–D571
Parker D, Beckmann M, Zubair H, Enot DP, Caracuel-Rios Z, Overy DP et al (2009) Metabolomic
analysis reveals a common pattern of metabolic re-programming during invasion of three host
plant species by Magnaporthe grisea. Plant J 59(5):723–737
Passos M, de Cruz V, Emediato F, de Teixeira CC, Azevedo VC, Brasileiro AC et al (2013) Analysis
of the leaf transcriptome of Musa acuminata during interaction with Mycosphaerella musicola:
gene assembly, annotation and marker development. BMC Genomics 14:78
Pinzón A, Rodriguez-R LM, González A, Bernal A, Restrepo S (2011) Targeted metabolic recon-
struction: a novel approach for the characterization of plant–pathogen interactions. Brief
Bioinform 12(2):151–162
Prasath D, Amruta B, Vijay M, Rosana OB, Jayasankar S, Anandaraj M (2014) Comparative study
of pathogenesis related protein-5 of different Zingiberaceae species. Indian J Biotech 13(2): (in
press)
Prasath D, Karthika R, Habeeba NT, Suraby EJ, Rosana OB, Shaji A, Eapen SJ, Deshpande U,
Anandaraj M (2014). Comparison of the transcriptomes of ginger (Zingiber officinale Rosc.)
and mango ginger (Curcuma amada Roxb.) in response to the bacterial wilt infection. PLOS
One 9(6): e99731. doi:10.1371/journal.pone.0099731
Převorovsky M, Atkinson S, Ptáčkova M, McLean J, Gould K, Folk P, Půta F, Bähler J (2011)
N-termini of fungal CSL transcription factors are disordered, enriched in regulatory motifs and
inhibit DNA binding in fission yeast. PLoS One 6:1–11
Raffaele S, Farrer RA, Cano LM, Studholme DJ, MacLean D, Thines M et al (2010) Genome
evolution following host jumps in the Irish potato famine pathogen lineage. Science 330:
1540–1543
Reena N, Anil P, Dhanya KP, Anandaraj M, Eapen SJ (2010a) Structural and docking studies of
glucanase inhibitor protein from Phytopthora capsici with plant endo-β-1, 3 glucanses
(Abstract). In: Prasath D et al (eds). Bioinformatics: an agricultural perspective. Indian Institute
of Spices Research, Kozhikode, p 111
Reena N, Chandrasekar A, Riju A, Nima PL, Eapen SJ, Anandaraj M (2010b) Gene identification
in Phytophthora capsici through expressed sequence tags. In: ISB 2010: Proceedings of the
international symposium on biocomputing; 11–12 Oct 2010, ACM Digital Library. http://doi.
acm.org/10.1145/1722024.1722043
Rokas A, Payne G, Fedorova ND, Baker SE, Machida M, Yu J et al (2007) What can comparative
genomics tell us about species concepts in the genus Aspergillus? Stud Mycol 59:11–17
Schneider DJ, Collmer A (2010) Studying plant-pathogen interactions in the genomics era: beyond
molecular Koch’s postulates to systems biology. Annu Rev Phytopathol 48:457–479
Singh N, Kashyap S (2012) In silico identification and characterization of 1-aminocyclopropane-
1-carboxylate deaminase from Phytophthora sojae. J Mol Model 18(9):4101–4111
Soanes DM, Talbot NJ (2006) Comparative genomic analysis of phytopathogenic fungi using
expressed sequence tag (EST) collections. Mol Plant Pathol 7:61–70
Spanu PD, Abbott JC, Amselem J, Burgis TA, Soanes DM, Stüber K et al (2010) Genome expan-
sion and gene loss in powdery mildew fungi reveal functional tradeoffs in parasitism. Science
330:1543–1546
Stahl PL, Lundeberg J (2012) Toward the single-hour high-quality genome. Annu Rev Biochem
81:359–378
Staniek A, Woerdenbag HJ, Kayser O (2008) Endophytes: exploiting biodiversity for the
improvement of natural product-based drug discovery. J Plant Interact 3:75–93
Studholme DJ, Glover RH, Boonham N (2011) Application of high-throughput DNA sequencing
in phytopathology. Annu Rev Phytopathol 49:87–105
Stukenbrock EH, Banke S, Javan-Nikkhah M, McDonald BA (2007) Origin and domestication of
the fungal wheat pathogen Mycosphaerella graminicola via sympatric speciation. Mol Biol
Evol 24:398–411
Torto-Alalibo T, Collmer CW, Gwinn-Giglio M (2009) The Plant-Associated Microbe Gene
Ontology (PAMGO) Consortium: community development of new gene ontology terms
describing biological processes involved in microbe-host interactions. BMC Microbiol
9(Suppl 1):S1
Unterseher M, Jumpponen A, Opik M, Tedersoo L, Moora M, Dormann C, Schnittler M (2011)
Species abundance distributions and richness estimations in fungal metagenomics—lessons
learned from community ecology. Mol Ecol 20(2):275–285
Vijai B, Lucia P, Wen-Sheng Z, You-Liang P (2007) Review: fungal transcriptomics. Microbiol
Res 162:285–298
Vijeshkumar IP, Reena N, Anandaraj M, Eapen SJ, Johnson GK, Vinitha KB (2013) Amplification,
cloning and in silico prediction of full length elicitin gene from Phytophthora capsici, the
causal agent of foot rot disease of black pepper. J Plant Pathol 4:181
Yazawa T, Kawahigashi H, Matsumoto T, Mizuno H (2013) Simultaneous transcriptome analysis
of sorghum and Bipolaris sorghicola by using RNA-seq in combination with de novo transcrip-
tome assembly. PLoS One 8(4):e62460
Zhong SS, Leng YY, Friesen TL, Faris JD, Szabo LJ (2009) Development and characterization of
expressed sequence tag-derived microsatellite markers for the wheat stem rust fungus Puccinia
graminis f. sp. tritici. Phytopathology 99(3):282–289
Zhou J, Fu Y, Xie J, Li B, Jiang D, Li G, Cheng J (2012) Identification of microRNA-like RNAs in
a plant pathogenic fungus Sclerotinia sclerotiorum by high-throughput sequencing. Mol Genet
Genomics 287(4):275–282
Chapter 6
Pre and Post Harvest Diseases of Potato
and Their Management
R.K. Arora and Sanjeev Sharma
6.1 Introduction
Potato, an important food crop plant has the potential to meet food demand of the
fast growing human population. Management of diseases and pests is important to
realize full potential of the crop. Potato can be affected by many diseases which
affect at both pre and post harvest stage of the crop. Major fungal diseases which
affect the crop are late blight, early blight, black scurf, fusarium dry rot, wart, pow-
dery scab and charcoal rot. Such diseases are prevalent in many countries and cause
a significant reduction in potato production. A brief description of these diseases
and their management is given in this chapter.
6.2 Late Blight
Late blight is the most destructive disease which poses a great threat to potato culti-
vation worldwide. Worldwide loss due to Phytophthora infestans has been esti-
mated to €12 billion per annum of which the losses in developing countries have
been estimated around €10 billion per annum (Haverkort et al. 2009). A survey
carried out to estimate the impact of late blight on potato yield and fungicide use in
the USA revealed that use of the fungicides alone costs $77.1 million and an
R.K. Arora, Ph.D. (*)

Central Potato Research Station, Post Bag No. 1, Model Town Post Office,
Jalandhar, Punjab 144003, India
e-mail: rkacpri@yahoo.com
S. Sharma, Ph.D.
Division of Plant Protection, Central Potato Research Institute,
Shimla, Himachal Pradesh, India

150 R.K. Arora and S. Sharma
Fig. 6.1 Potato leaves

infected with late blight
(Phytophthora infestans)
average cost of around $507 per ha which do not include non-fungicide control
practices (Guenthner et al. 2001). Late blight is a potential threat and can raise the
fear of famine in vast areas of Eastern Europe and Russia where millions of people
are subsisting on potatoes (Mackin 1998). Information on various aspects of late
blight has been reviewed by different workers (Erwin et al. 1983; Neiderhauser
1986; CIP 1989; Lucas et al. 1991; Ingram and Williams 1991; Arora and Khanna
1997; Singh and Shekhawat 1999; Fry 2008; Cooke et al. 2011).
6.2.1 Symptoms
The disease appears as water-soaked irregular pale green lesions mostly near tip
and margins of leaves which rapidly grow into large brown to purplish black
necrotic spots. A white mildew, which consists of sporangia and sporangiophores
of the pathogen, can be seen on lower surface of the infected leaves especially
around the edges of the necrotic lesions (Fig. 6.1). Light to dark brown lesions
encircle the stems. The affected stems and petioles become weak at such locations
and may collapse. Entire crop gives blackened blighted appearance especially
under disease favourable conditions and may be destroyed within a week (Fig. 6.2).
Tubers in soil become infected by rain borne sporangia coming from the diseased
foliage. Late blight infected tubers show irregular reddish brown to purplish areas
which extend into internal tissues of the tubers (Fig. 6.3). The infected tubers usu-
ally are hard, dry and firm but may get attacked by soft rot causing bacteria and rot
in field and stores.
6 Pre and Post Harvest Diseases of Potato and Their Management 151
Fig. 6.2 A potato field infected with late blight
Fig. 6.3 Potato tubers

infected with Phytophthora
infestans
6.2.2 The Pathogen
Late blight is caused by Phytophthora infestans (Mont.) de Bary. It belongs to the

oomycetes, a diverse group of eukaryotic microorganisms in a group called the
Stramenopiles, clustering together with others in a super group, the Chromalveolata
(Adl et al. 2005). The position of the oomycetes as a unique lineage of eukaryotes
unrelated to true fungi but closely related to heterokont (brown) algae and diatoms,
is well established through molecular phylogenies and biochemical studies (Baldauf
et al. 2000). The pathogen is characterized by lemon shaped detachable, papilliate
sporangia produced on sympodially branched sporangiophores of indeterminate

growth. The sporangiophores exhibit a characterized swelling at junction where
sporangia are attached with the sporangiophores. Ultrastructure of hyphae and
haustoria has been studied in detail by Ehrlich and Ehrlich (1966).
Phytophthora infestans is heterothallic and requires two mating types A1 and A2
for sexual reproduction. Prior to 1984 the A2 mating type was restricted to Mexico
and Andean mountains the centre of origin of cultivated potatoes. First report of A2
mating type outside Mexico was from Switzerland (Hohl and Iselin 1984) followed
by reports from other countries (Malcolmson 1985; Mosa et al. 1989; Fry et al.
1989; Singh et al. 1994). This is considered as second migration of P. infestans out-
side Mexico (Fry et al. 1999), the first being from Europe and America during the
historical potato famine around the year 1845. The new strains of the pathogen have
been found to be more aggressive than the old population (Fry et al. 1999).
Turkensteen and Mulder (1999) have reported that pathogen during the last 20 years
have developed a shorter life cycle (by 30 %), ability to cause more leaf spots,
shorter infestation period (6 instead of 8 h), tolerance to a greater temperature range
(5–27 °C instead of 10–25 °C), form stem lesions more frequently, develops
oospores and sporulation on tubers and is more inclined to develop resistance to
fungicide metalaxyl.
Population of P. infestans in most countries has changed dramatically and origi-
nal A1 has almost been displaced by more virulent A2 strain. Occurrence of both A1
and A2 strains at the same location has also opened up the possibility of develop-
ment of thick walled oospores which could survive extreme winter (Medina and
Platt 1999) or summer conditions. The oospores may act as an another source of
primary inoculum, in addition to the already known sources such as infected seed
tubers, waste heaps and volunteer plants etc. The impact of potato late blight
increased greatly during the 1990s following the migration of more genetically
diverse and more aggressive genotypes of P. infestans from Mexico (Goodwin et al.
1994). Recent work has indicated that the new P. infestans clones, especially the
US-8 and US-14 genotypes, are more aggressive (Lambert and Currier 1997; Kirk
et al. 2001, 2009). The new genotypes of late blight are 10 times more likely to
produce infected sprouts than their predecessor, US-1 (Marshall and Stevenson
1996). Before 1980s, worldwide populations of P. infestans were dominated by a
single clonal lineage, the US-1 genotype with Ib mtDNA haplotype (Goodwin et al.
1994). This lineage has since been displaced by the other haplotypes (Ristaino et al.
2001). Since 2002, in India most isolates studied were of Ia mtDNA haplotype
(Chimote et al. 2010). Displacement of old Ib mtDNA haplotype population by new
Ia haplotypes is consistent with the global trend of mt haplotype distribution.
Migration and sexual recombination can play an important role in enhancing genetic
diversity in P. infestans. Chowdappa et al. (2013) have recently reported that migra-
tion of 13_A2 genotype that was responsible for outbreak of destructive late blight
epidemics in Karnataka state of India since 2009 and have suggested the importance
of bio-security in agricultural trade.
6.2.3 Epidemiology
Persistence of P. infestans from year to year is a critical component of late blight

epidemics. An understanding of pathogen survival is a major goal in developing
management strategies for the disease. Infected seed tubers serve as overwintering
and the primary source of inoculum (Kirk 2003). The pathogen over winters as
mycelium in infected tubers, in refuse piles and volunteer plants or over summer in
subtropical zones through tubers kept in cold stores (Pushkarnath and Paharia 1963;
Boyd 1981). Potato tubers left in the field after harvest and cull potato tubers can
produce volunteer plants which can carry over the pathogen to the next season
(Zwankhuizen et al. 1998). Latent infection of potato tubers by P. infestans has been
implied in development of the disease in Ecuadorian highlands (Kromann et al.
2008). Latent infection was demonstrated when the pathogen was detected with the
aid of polymerase chain reaction (PCR) in asymptomatic tubers (Appel et al. 2001;
Hussain et al. 2005; Sharma et al. 2010). Johnson and Cummings (2009) demon-
strated presence of latent infection in seed tubers and production of viable sporangia
of P. infestans after cold storage of infected potato tubers. Survival of pathogen as
oospores in soil serves as another source of primary inoculum. However, its exact
role and extent of contribution is not clear. Movement of pathogen from infected
tubers to new plant could be indirect through soil. Tubers in soil get infected by
contact with sporangia coming from infected haulms through rain water. The infec-
tion can also occur during washing of tubers.
Forecasting appearance of the disease in advance can greatly help potato farm-
ers to take prophylactic sprays and prevent or delay appearance of the disease and
thus reduce the losses. Weather conditions such as temperature, relative humidity,
rainfall, dew, sunshine hours etc. have a direct effect on P. infestans. These param-
eters have been exploited to develop different models to forecast the disease both
in India and elsewhere (Van Everdingen 1926; Beaumont 1947; Hyre 1954; Wallins
1962; Ulrich and Schrodter 1966; Krause et al. 1975; Braun and Fry 1981;
Bhattacharyya et al. 1982). Similarly, potato late blight alert networks have been in
operation in some countries with satisfactory results (Chow and Bernard 1999;
Hensen et al. 2000). Different methods and weather criteria are required for fore-
casting potato blight for different regions. Based on local weather parameters a
computerized forecast for late blight named as ‘JHULSACAST’ has been devel-
oped for western subtropical plains of India (Singh et al. 2000). Recently the
JULSACAST model was modified to forecast late blight under Punjab conditions
in India (Arora et al. 2012). JHULSACAST model was implemented in western
Uttar Pradesh using Wireless Sensor Networks (WSN), which is web based, to
forecast late blight and the model could forecast the same well in advance in com-
parison to other forecasting models tested. An internet based decision support sys-
tem (PhytoPRE+2000) has been developed in Switzerland which is an improved
version of PhytoPRE where weather conditions on major infection and sporulation
period (MISP) have been incorporated (Cao et al. 1996). Comparing to original
PhytoPRE programme, it can save about 30–50 % chemical usage.
International Potato Centre has been linked to disease forecasting models,

Blitecast and Simcast to climate database in a geographical information system
(GIS) to estimate global severity of potato late blight. Tropical highlands are the
zone of high late blight severity. Major production zones with a low late blight
severity include Western Plains of India, where irrigated potato is produced in the
cool dry season, North Central China and North-Western USA. Average number of
sprays calculated for different countries using GIS database of potato production
compared with estimated current fungicide use revealed that the estimated number
of sprays in developing countries whether from Blitecast or Simcast, predicted opti-
mum number of sprays much higher as compared with the actual number observed.
On the basis of GIS database it was suggested that an increased access to host resis-
tance and fungicides in developing countries could have a strong economic impact
on potato production (Hijmans et al. 2000). Decision support system for organic
potato farming (Bio-PhytoPRE) has also been developed by Agroscope FAL
Reckenholz to assist Swiss Organic potato producers to control late blight with
reduced amounts of copper (Musa-Steenblock and Forrer 2005).
6.2.4 Management
Reduction of the primary sources of inoculum is the first step in management of late
blight. Control of contaminated sources such as waste heaps, infected tubers, volun-
teer plants, disease in neighbouring fields and re-growth after haulms destruction
can help in management of the disease (Turkensteen and Mulder 1999). In
Switzerland, it has been estimated that onset of epidemic can be delayed by 3–6
weeks if all primary infection from early potato can be eliminated (Forrer et al.
2000). It has been shown that during most years late blight epidemics start from
infected plants on dumps (Zwankhuizen et al. 2000), therefore, covering of dumps
with black plastic sheet throughout the season and preventing seed tubers from
becoming infected is an important step in reducing the primary inoculum (Cooke
et al. 2011). The sheeting must be kept in place and remain intact until the tubers are
no longer viable. This will prevent re-growth and the proliferation of spores on the
piles, reducing the risk to nearby crops. Oospores are a threatening primary inocu-
lums source, especially with short crop rotation. Sandy and clay soils contaminated
with oospores remained infectious for 48 and 34 months, respectively (Turkensteen
et al. 2000). Use of early-maturing cultivars, pre-sprouting the seed and early plant-
ing can help to manage late blight. Avoiding excess nitrogen and use of moderate
nitrogen fertilization is often recommended as a cultural practice to delay the devel-
opment of late blight. Use of systemic fungicides early in the season is an effective
strategy to manage late blight if source of primary infection is infected seed
(Hermansen and Naestad 2009). Increased application of nitrogen can lead to
increase in disease severity and use of more and more fungicides. Higher dose of
phosphorus and potassium has been found to give a higher yield in a late blight year
(Roy et al. 2001).
Importance of oospores as soil-borne inoculum is determined both by their

formation in plant tissue and their survival in soil. There is a correlation between
crop rotation and late blight infections. Infection usually start early in fields which
are not subjected to crop rotations. The decline in early infection was most pro-
nounced in fields subjected to crop rotations for three or more year between the
potato crops (Bodker et al. 2006; Hannukkala et al. 2007). This indicated that a
sound crop rotation is important and is an effective way of reducing the risk of
soil-borne infections of P. infestans. Choice of suitable cultivars, well aerated
fields, pre-sprouting of tubers, early planting and use of resistant varieties are
some of the measures against foliar blight while planting potatoes on large steep
ridges, right time of mechanical weeding and harvesting, avoiding rapid shift of
harvested tubers and long transports could minimize tuber blight (Meinck and
Kolbe 1999).
Development of resistant cultivars has played an important role in the control of
late blight. Solanum demissum, a hexaploid wild species, has extensively been used
to confer resistance against P. infestans. Field resistance is polygenic and more
durable. Solanum bulbocastanum, S. microdontum, S. verrucosum and S. chacoense
have been used as a source of field resistance in breeding programmes. Since the
pathogen is quite plastic and mutable matching races against major R genes develop
readily and overcome the resistance of the new cultivars. However, major genes
which have evolved naturally in S. demissum population for thousands of years
where late blight occurs annually still hold their importance. A multilineal combi-
nation of 11 resistant genes (R genes) identified so far, into commercial varieties
has significant potential in management of late blight (Niederhauser et al. 1996).
Disease resistance in potato varieties together with use of fungicides can slow
down the development of late blight. A variety with field resistance to late blight in
tubers and a medium to high resistance in the foliage can help in reducing the use
of fungicides.
Use of host density as a tool for management of late blight has also been used for
control of late blight. Tuber yield from both resistant and susceptible cultivar
increases when these were grown in mixture as compared to the single genotype
stands (Garret and Mundt 2000). Strip cropping of potatoes significantly reduced
late blight severity in organic production when planted perpendicular to the wind
neighbored by grass clover (Bounes and Finckh 2008).
Spraying with an effective fungicide has been a standard practice for control of
late blight. Bordeaux mixture, which consists of copper sulphate, hydrated lime
and water was a standard fungicide for many years. Subsequently organic fungi-
cides especially carbamates which controlled both early and late blight replaced
Bordeaux mixture. Metalaxyl—a phenylamide group of fungicides specific to
oomycetes however, revolutionized late blight control (Bruck et al. 1980). Since it
was most effective its use increased rapidly and this became one of the major fun-
gicides used world over but strains of P. infestans which do not respond to metal-
axyl appeared worldwide (Dowley and O’Sullivan 1981; Gisi and Cohen 1996). In
India, resistance to metalaxyl in P. infestans wild population was first observed in
Nilgiri hills of South India in 1989. Metalaxyl resistant strains appeared towards
the end of summer crop season and their frequency increased to 13 % in autumn
season (Arora et al. 1992a). Metalaxyl in mixture with unrelated contact fungicide
however, could retard development of resistance in the pathogen (Gangawane et al.
1993). Cymoxanil mixtures have been found effective for managing metalaxyl
resistant strains (Samoucha and Cohen 1988). A synergism between cymoxanil and
mancozeb has also been reported by Evenhuis et al. (1996). Fluazinam (Shirlan),
cyazofamid (Ranman) and mandipropamid (Revus) have been used for the disease
management. Spraying with effective fungicides (cyazofamid and mandipropamid)
before periods with high risk of infections can give very effective control of late
blight. Studies conducted in Denmark in 2009 showed that use of cyazofamid and
mandipropamid could be reduced by 30 % by adjusting the dose according to resis-
tance level in a variety and used according to the infection pressure (Cooke et al.
2011). Application of sub-phytotoxic concentration of boron with reduced rate of
fungicide propineb + iprovalicarb has been reported as more effective as compared
to plants treated with fungicide alone (Frenkel et al. 2010).
Heavy dependence on fungicides could pose threat to environment and human
population (Bradshaw et al. 2000). Biocontrol agents and biopesticides could be a
safe option to the use of synthetic fungicides. Antagonism to P. infestans by some
naturally occurring microorganisms such as Trichoderma viride, Penicillium viridi-
catum, P. aurantiogriseum, Chaetomium brasiliense (Arora et al. 1992b; Gupta
et al. 2004), Acremonium strictum (CPRI 1998–1999), Myrothecium verrucaria,
Penicillium aurantiogriseum (Roy et al. 1991), Epiccocum purpurascens,
Stachybotrys coccodes, Pseudomonas syringae, Fusarium graminearum (Kim et al.
1996) and Pythium ultimum (Kuzuestova et al. 1995) have been observed in labora-
tory and field studies. The biocontrol agents in general have been found to be very
effective under laboratory and glasshouse conditions but less effective under field
conditions (Arora 2000b). However, an integrated use of biocontrol agents along
with low dose of fungicides could help to reduce the quantity of fungicides used in
the management of late blight (CPRI 2000–2001).
6.3 Early Blight
Early blight affects both potato and tomato. It is a ubiquitous disease of potato
prevalent in many countries in Asia, Africa, Australia, Europe, North, Central and
South America (Millar and Pollard 1976). The disease used to appear earlier than
late blight in the USA hence the name early blight. However, the name is misleading
because the disease rarely attacks young growing plants and more often affect
mature old plants showing loss of vigour. The disease is particularly severe under
alternate dry and wet climate where the annual loss from this disease could range
between 10 and 25 %.
Fig. 6.4 Potato leaves infected with early blight (Alternaria solani)
6.3.1 Symptoms
Small, round, oval or angular, dark brown to black, dry and papery necrotic spots
which have angular margins appear on leaves. These spots are generally limited by
leaf veins. Concentric rings of raised and depressed tissue within the leaf spot give
it a bull’s eye or target board appearance. Early blight lesions are less prone to sec-
ondary infections. Leaf tissues around the spots often become chlorotic and yellow
suggesting involvement of toxins. The leaf spots may coalesce and the affected field
appears severely blighted (Fig. 6.4). The disease also affects the tubers. On tubers,
the lesions are dark, sunken, circular to irregular in shape, shallow and separated by
healthy tissue by purplish-brown dry cork layer.
6.3.2 The Pathogen
Early blight is caused by Alternaria solani Sorauer (Ellis and Martin). Other species
of Alternaria which attack potato are Alternaria alternata (Fries) Keissler, and
A. consortialis (Conners 1967). In Germany, the frequency of Alternaria alternata
and A. solani is almost equal (Hauslanden and Bassler 2004) while in Poland the
occurrence of A. alternata has been reported more than that of A. solani (Kapsa
2007). A. solani has septate mycelium and bears conidia on erect and septate conid-
iophores. Cultural characters vary widely on potato dextrose agar medium. Colonies
of the fungus are spreading, grey brown to black occasionally with yellow red pig-
ment in the media. The mycelium sporulates sparingly in media however
sporulation can be induced by mutilation of mycelium or exposing the culture to

different light sources (Singh 1967; Barksdale 1969). Conidia are obclavate, olive
brown with tapering long filiform beak. The conidia are multicellular and possess
3–14 cross septa and 0–18 longitudinal septa (Western 1971). Spores germinate in
water within an hour at optimum range of temperature between 24 and 30 °C. Genetic
diversity among isolates of A. solani in South Africa indicated that fungus has high
potential to adapt to resistant cultivars and fungicides (Waals et al. 2003).
6.3.3 Epidemiology
Alternaria solani survives in crop debris, soil, infected tubers or alternate hosts
which act as primary source of inoculum. The disease is favoured by short rotation,
continuous cropping of potatoes and tomato. Infection is favoured by warm tem-
perature and alternating high relative humidity provided by heavy dew, light rains or
irrigation. Temperature in the range of 25–30 °C is congenial for the disease
(Barclay et al. 1973). A positive correlation exists between minimum temperature,
afternoon relative humidity and rainfall with early blight (Behera et al. 2009).
Actively growing, properly fertilized young plants do not exhibit the disease.
A delay of 10–15 days between haulm destruction and harvest prevents infection in
tubers. Late maturing cultivars are generally more resistant than the early varieties.
Predisposition of plants to injury, poor nutrition or other stresses could favour dis-
ease development (Singh et al. 1987b).
6.3.4 Management
Cultivation of solanaceous crops, being collateral hosts, near potato fields must be
avoided. Removal and destruction of diseased haulms from infected fields reduces
sources of primary inoculum for the next crop. Applying recommended dose of
fertilizers especially nitrogen ensures healthy and vigorous growth and less disease.
Permitting tubers to mature in soil and avoiding bruises at harvest minimizes tuber
infection. Sprinkler irrigation favours disease and should not be used more often
than necessary. Crop sprayed with one percent urea at 45 days of growth improves
plant vigour and prevents onslaught of early blight and other leaf spots. Fungicides
such as maneb, zineb, mancozeb, captafol, chlorothalonil provide good control of
the disease. First spray should be applied as soon as lower leaves develop the spots
which coincide with the secondary spread of the disease. Use of thidiazuron (TBZ)
a growth regulator having cytokinin like activity with mancozeb and chlorothalonil
resulted in delay of disease progress (Pavlista 2003). Similarly, the use of Pyton
Consento 450SC @2l/ha (Bernat 2004), Zoxamide + mancozeb, fenamidone + man-
cozeb (Osowski 2004); potassium or sodium bicarbonate alone or in combination
with Nerol (Abd-El-Kareem 2007) and kresoxim-methyl (Chakraborty and Roy

2012) have been found effective against early blight. Franc et al. (1988) have devel-
oped a prediction model based on accumulated day-degree above 7.2 °C from plant-
ing. This model forecasts beginning of secondary spread of the pathogen. Fungicides
used according to the forecast model helps in reducing the use of fungicides. An
integrated management of both early and late blight by combined application of
fungicides have been suggested by Shtienberg (2001).
Decision support systems are important tools in reducing the large amount of
fungicides applied to suppress disease intensity. FAST, CUFAST, TOMCAST and
PLANT-Plus are the potential useful tools for integrated management of early blight
(Waals et al. 2003; Batista et al. 2006). Beside chemicals, biopreparations have
shown potential against early blight. The biopreparation Gluticid (Pseudomonas
aeruginosa) and alirin-B and gamair (Bacillus subtilis) were found as effective as
mancozeb (Rodriguez-Maza and Stefanova-Narimova 2005; Bairambekov and
Korneva 2009).
Resistance to Alternaria solani is available in Solanum phureja and S. chacoense
which can be exploited in breeding varieties resistant to early blight. A few varieties
such as Kufri Sindhuri developed in India shows good resistance to early blight.
Four synthetic peptides viz. pep 6, pep 7, pep 11 and pep 20 have been found to
inhibit both A. solani and P. infestans on potato leaves. Expression of these peptides
in transgenic potato plants could lead to enhanced disease resistance against these
pathogens (Ali and Reddy 2000). Wild species of Solanum are excellent sources of
disease resistance genus that may be incorporated into S. tuberosum through breed-
ing. Clone C545 exhibited improved resistance to early blight (Jansky and Rouse
2003). No cultivar has been reported immune or resistant to early blight but large
number of cultivars across the world possesses moderately resistance to early blight.
These are Quaggy Joe (Reeves et al. 1999), Alta Russet (Lynch et al. 2004), Sazava,
Nikoleta, Marcela (Voral 2005), MegaChip (Groza et al. 2007), Picasso, Victoria,
Provento, Ramus and Milva (Alexandrov 2008).
The shift in sensitivity of A. solani to strobilurin fungicides has been observed in
the USA (Pasche et al. 2002). A highly significant and strong correlation among the
isolates tested for fungicide cross-sensitivity was detected between azoxystrobin
and pyraclostrobin (Pasche et al. 2004). Isolates possessing reduced sensitivity to
azoxystrobin were also less sensitive to famoxadone and fenamidone (Pasche et al.
2005). The repeated exposure of A. solani populations to chlorothalonil resulted in
considerable variability in sensitivity causing isolates to have decreased sensitivity
to the fungicide at the end of growing season. Five out of seven field isolates of A.
solani collected by the end of season were found significantly less sensitive to chlo-
rothalonil than isolates collected at the beginning of the season in the USA (Holm
et al. 2003). Similarly, isolates of A. solani have been shown to possess resistance to
mancozeb fungicide in Jordan (Al-Mughrabi 2004). Recently the resistance to
boscalid fungicide has been reported in the USA which is widespread in Idaho
(Wharton et al. 2012).
Fig. 6.5 Black scurf of potato caused by Rhizoctonia solani
6.4 Black Scurf and Stem Canker
Black scurf of potato caused by Rhizoctonia solani is a well-known disease of

potato with worldwide distribution. It causes damping off of seedlings, stem canker
in growing plants and black scurf on potato tubers. The disease kills potato sprouts,
delays crop emergence, reduces crop stand, affects tuber quality and marketability
of the produce (Errampalli and Johnston 2001). Significant yield losses primarily
due to reduced crop stand has been reported by some workers (Carling et al. 1989).
6.4.1 Symptoms
The most common symptoms are on tubers as black irregular lumpy encrustations
of fungal sclerotia which stick to the surface of tubers (Fig. 6.5). Other symptoms
on tubers could be cracking, malformation, pitting and stem end necrosis. The
pathogen produces a growth regulating toxin that may be partially responsible for
tuber malformation. The fungus may kill emerging sprouts in soil which results in
reduced crop stand. Reddish brown lesions may develop on stems and often girdle
them. Partial or complete girdling of the stems could result in resetting of plant tops,
purple pigmentation, upward curling or rolling of leaves. Formation of aerial tubers
in axis of leaves due to interference with starch translocation is often also observed
in plants infected with R. solani (Fig. 6.6).
6.4.2 The Pathogen
Rhizoctonia solani Kuhn is the imperfect stage of the pathogen where as

Thanatephorus cucumeris (Frank) Donk (syn. Corticum vagum Berk. & Curt) is
the perfect basidial stage. The sexual or perfect stage appears on stem just above
soil line as whitish grey mat or mycelial felt. These mats are often located above
Fig. 6.6 Formation of aerial tubers in axis of leaves due to Rhizoctonia solani
a lesion on the below ground portion of stem and are generally visible later in the
growing season under favourable weather conditions. The isolates have also
been characterized on basis of sclerotial patterns and cultural characteristics
(Raj et al. 1974). Mycelium of the pathogen is generally dark brown in colour.
The hyphae are large multinucleate and branch near distal septum of the cell.
They show right angle branching and constriction at the point of origin and a
prominent septal pore. Early infection are initiated by differentiation of hyphal
tips to T-shaped branches followed by formation of cushion like structure and
development of appressoria from where thin infection hyphae arise and penetrate
the underlying stem or stolon tissues. These cushions serve as additional food
basis for colonization of underground plant parts and are pre-requisite for devel-
opment of lesions on stems or stolons (Keijer et al. 1996). Rhizoctonia solani
populations are distinguished by anastomosis between hyphae of the isolates
belonging to the same ‘anastomosis group’ (AG). Fourteen different anastomosis
groups’ viz., AG-1 to AG-10, AG-BI (Sneh et al. 1991), AG-11 (Carling et al.
1994), AG-12 (Carling et al. 1989), and AG-13 (Carling et al. 2002) have been
recognized. Several AGs have been subdivided further into subgroups that differ
for one or more biochemical, genetic or pathogenic characteristics (Carling and
Leiner 1990; Johnk and Jones 1993; MacNish et al. 1993).
Rhizoctonia solani isolated from potato mostly belong to anastomosis group 3
(AG-3) (Bandy et al. 1988). Eight subgroups have been identified within group AG-3
based on variations in isozyme patterns (Laroche et al. 1992). However, other anasto-
mosis groups (AG-1, AG-2-1, AG-2-2, AG-4, AG-5, AG-7 and AG-9) also have been
isolated from potato stems, stolons, roots and tubers, as well as from soils in which
potatoes were grown (Carling and Leiner 1986; Chand and Logan 1983; Abd-Elsalam
et al. 2009). In Central Mexico, in addition to AG-3, isolates of AG -2-2, -5, and -7
have been collected from potato plants and / or tubers from fields.
6.4.3 Epidemiology
Seed-borne (i.e. tuber borne) inoculum is the main source of primary infection
leading to stem canker symptoms on the underground plant parts. The pathogen is
both soil and seed borne but the disease spreads to new growing areas through
sclerotia-covered seed tubers (Tsror and Perezt-Alon 2005). The disease gets estab-
lished in fields wherever the untreated infected tubers are used as seed. Secondary
inoculum of the Rhizoctonia disease is soil borne and accomplished by R. solani
mycelia and sclerotia already inhabiting soil where the potato crop is planted (Balali
et al. 1995). Soil-borne infection emerges later in the season since the fungus needs
some time to grow into proximity with its potato host (Carling and Leiner 1986).
Sclerotia of the pathogen germinate between 8 and 30 °C and invade emerging
sprouts or potato stems. Optimum temperature for germination of sclerotia is 23 °C
and for development of stem lesions is 18 °C (Walker 1969). Sclerotial development
on tubers is initiated depending on environmental conditions. Late harvested crop
shows more black scurf incidence since maximum development of sclerotia takes
place in the period between dehaulming and harvest of the crop.
6.4.4 Management
Use of healthy seed free from sclerotia of the pathogen helps in disease manage-
ment (Frank and Leach 1980). The disease can best be managed in an integrated
manner by following proper cultural practices together with seed disinfestations.
Soil solarization with transparent polyethylene mulching during hot summer months
in Indian subtropical plains has been found to be very effective for control of the
soil-borne part of the disease (Arora et al. 1997). Crop rotation offers an effective
protection against soil-borne inoculum of R. solani (Carling et al. 1989). Planting of
potato should be carried out in relatively dry and warm soil to achieve rapid crop
emergence and an appropriate crop rotation programme should be followed to man-
age the disease (Anderson 1982; Bandy et al. 1988; Carling and Leiner 1990).
Shallow covering of seed tubers allows less opportunity for the fungus to attack the
susceptible sprouts and thus less disease. Two to four year crop rotation with cereals
and legumes leads to decline in the population levels of the R. solani. Cereals are
good rotational crops since R. solani affecting cereals have different AGs and can-
not affect potato (Anderson 1982).
Biocontrol agents such as Trichoderma viride (Arora 1999), T. harzianum
(Mishra et al. 2000), Bacillus subtilis (Schmiedeknecht et al. 1998), non-pathogenic
binucleate Rhizoctonia (Tsror et al. 2001), Trichoderma atroviride (Huang-Mc
Breath 2001), Gliocladium virens, G. catenulatum and others have been identified
to be effective against R. solani. Biocontrol products developed to manage the dis-
ease (Nieme and Lahdenpera 2000; Yakhin et al. 1998) have been found effective
against black scurf disease. Trichoderma spp. are well documented for their ability
to protect plants from R. solani infection by production of antibiotics, antifungal

chemicals and hydrolytic enzymes. Some Trichoderma spp. have been reported to
provide plant growth enhancement as well as crop protection (Verma et al. 2007).
A bioformulation developed at Central Potato Research Institute from T. viride
strain A-7 and evaluated in several field trials in India was found very effective
when used as seed treatment before planting potatoes (Arora and Somani 2001).
Efficacy of Trichoderma viride, Bacillus subtilis and Bacillus cereus in consortium
for control of Rhizoctonia solani was evaluated in field trials in India and the bio-
control agents used in combination were found to control the disease better than the
biocontrol agents used alone (Somani and Arora 2010). An integrated use of
Trichoderma viride and boric acid significantly improved disease control (Arora
2008). Experimental results of Wilson et al. (2008) suggest that combining chemi-
cal control with antagonist treatment can protect potato during the whole growing
season.
Various fungicides such as benomyl, thiabendazole, carboxin, pencycuron and
azoxystrobin (Virgen-Callerus et al. 2000), fenpiclonil (Welsh and Callaghan 1996)
are effective for control of the disease. Seed treatment with 3 % boric acid has been
identified as a safe and effective chemical treatment for the control of black scurf
(Arora et al. 2006a). Seed treatment with 3 % boric acid as atomized application on
infected tubers was found more economical than the dip treatment for control of
seed inoculum (Khanna and Sharma 1996). Spray treatment of boric acid was
equally effective in washed or unwashed seed tubers (Arora 2005). A combination
of soil solarization carried out in north Indian Plains during summer months together
with seed treatment with 3 % boric acid or Trichoderma viride was found very
effective for control of black scurf in Rhizoctonia infested soils (Arora 2000a; Arora
et al. 2006b, 2008).
6.5 Fusarium Dry rot
Fusarium dry rot, an important post harvest disease of potato tubers, causes signifi-
cant losses in storage and transit of both seed and table potatoes. The disease is
distributed worldwide and occurs wherever potatoes are grown (Stevenson et al.
2001). Healthy tubers become infected through bruises and wounds occurring dur-
ing harvest, handling and transport. The symptoms of dry rot generally become
evident 1–2 months after storage of the tubers. The affected tubers if used as seed
can cause fusarial wilt in field. Fusarium spp. are present in abundance in soil and
can infect surfaces of cut tubers when used as seed. Planting of un-suberized cut
pieces of potato tubers which gets infected with fusaria can result in seed piece
decay. Under such conditions losses by Fusarium rots may go up to 50 %
(Chelkowski 1989). Fusarium spp. are known to produce toxins that cause myco-
toxicoses in humans and animals (Senter et al. 1991).
Fig. 6.7 Fusarium spp. developing in dry rot affected tubers
6.5.1 Symptoms
The disease symptoms on potato tubers are generally visible in about a month after
storage. The symptoms appear as small brown lesions on surface of the affected
tubers. The lesions subsequently enlarge, appear dark, sunken, and wrinkled pro-
ducing white, pink, or blue pustules (Stevenson et al. 2001). In later stages a cavity
often develops in the centre of the concentric ring and whitish, pinkish or dark
brown growth of fungal mycelium may become visible (Fig. 6.7). Rotten tubers
may shrivel and get mummified. Under high relative humidity the secondary organ-
isms such as Erwinia spp. can invade the infected tubers and cause soft rot (El-Gholl
et al. 1985). Exudates containing bacteria come out from such tubers and further rot
the surrounding tubers.
6.5.2 The Pathogen
About thirteen species of Fusarium have been reported to cause dry rot of potatoes
(Cullen et al. 2000; Gachango et al. 2011). F. sulphureum Schlechtend (syn. F. sam-
bucinum Fuckel) is the most common pathogenic species in North America and
some regions of Europe (Hanson et al. 1996; Mecteau et al. 2002; Stevenson et al.
2001), whereas F. coeruleum (Libert) Sacc. (syn. F. solani var. coeruleum) is con-
sidered to be the predominant causal agent in the United Kingdom (Hide et al. 1992;
Peters et al. 2004) and F. oxysporum Schlechtend in plains of India (Singh et al.
1987a). Other pathogenic species associated with dry rot include F. avenaceum (Fr.)
Sacc., F. culmorum (Wm. G. Sm.) Sacc., F. acuminatum Ellis & Everh.
Fig. 6.8 Dry rot caused by

F. sambucinum
F. crookwellense L. W. Burgess, P. E. Nelson & T. A. Toussoun, F. equiseti (Corda)

Sacc., F. graminearum Schwabe, F. scirpi Lambotte & Fautrey, F. semitectum Berk.
& Ravenel, F. sporotrichioides Sherb., and F. tricintum (Corda) Sacc. (Hide et al.
1992). Recently, F. sambucinum has been reported to cause dry rot of potatoes in
cold stores in India (Fig. 6.8, Sagar et al. 2011).
White fluffy mycelial cushions may develop on surface of infected tubers.
Mycelium of the pathogens consist of branched and septate hyphae which are pres-
ent inter or intra cellular in the host tissue. Conidiophores arise from the mycelium
and produce 1 to 4 celled sickle shaped conidia of variable size. Chlamydospores,
the propagules of the pathogen which can survive in unfavourable conditions,
develop in pustules. These may be intercalary or terminal. The fungus remains
viable in soil for 9–12 months. Fusarium spp. has good saprophytic ability to
survive in soil.
6.5.3 Epidemiology
Fusaria are always present in soil, in air, on implements, containers and it is practi-
cally not possible to eradicate them. They cannot infect intact periderm and lenticels
of tubers. Cuts and wounds created during harvest, grading, transport and storage
predispose them to infection. An increase in interval between haulm destruction and
the harvest increases strength of tuber skin and is generally believed to reduce dry
rots but the contrary view also exists Carnegie et al. (2001). Dry rot development is
affected by tuber damage, degree of curing, tuber size and storage conditions. Use
of herbicide paraquat, used for destruction of halums at maturity of the crop, has
been observed to increase dry rots (Somani and Chohan 1994). The pathogen enters
the tubers through wounds and proper wound healing could reduce the infection.
Tubers cured for wound healing at 21 °C with adequate aeration develop wound
periderm in 3–4 days but it takes more time at lower temperature. Development of
disease is also affected by moisture and temperature. The fungus grows well
between 15 and 28 °C. F. oxysporum has been reported to become non-pathogenic
below 10 °C. However, disease development continues at low temperature in cold
stores. Storage period and relative humidity have been found to be positively cor-
related with dry rot whereas maximum temperature was negatively correlated
(Singh 1986). Large sized tubers are more susceptible than small tubers.
Susceptibility to tubers may also increase with tuber age during storage. No signifi-
cant correlation exists between chemical composition of tubers and susceptibility to
dry rots (Singh 1986; Percival et al. 1999). Some volatile compounds are produced
by dry rot affected tubers and an early warning system based on sensors to detect
these volatile compounds has also been developed by de Lacy-Costello et al. (2001).
Infected and rotting tubers are main source of spread of the inoculum of Fusarium
spp. and results in soil infestation (Choiseul et al. 2001). Fusarium spores can sur-
vive in soil for several years and can infect the cut or damaged surfaces of seed
potatoes whenever these come in contact with the spores infested soil. The patho-
gen may also get introduced to new locations through contaminated soil which
adheres to the farm implements, through wind and irrigation water etc. Studies have
demonstrated that transmission of F. sulphureum to progeny tubers was greater
from highly contaminated seed than from rotting seed whereas in case of F. coeru-
leum, the disease transmitted readily from the rotted mother tuber (Carnegie et al.
2001; Choiseul et al. 2001). This was attributed to the different capacity of each
species of the pathogen to sporulate underground on seed tubers and on stem bases.
F. coeruleum sporulates profusely on the surface of rotting seed tubers, whereas
F. sulphureum sporulates more readily on stem bases (Adams and Lapwood 1983;
Choiseul et al. 2001).
6.5.4 Management
Avoiding bruises and damage to potato tubers by careful handling of the produce
minimize the dry rots. This can be done by delaying harvesting for about 2 weeks
after haulm destruction when skin of the tubers have matured. Harvesting on cold
frosty morning predisposes potato to bruises. Bruises can also be avoided by taking
suitable precaution with machinery, proper adjustment and padding etc. of the
equipments. Washing of tubers to remove contaminated soil that adheres the tubers
and drying these in shade can reduce the risk of infection. Harvested potatoes should
be stored at around 13–18 °C and moderate humidity for 2–3 weeks for bruises to
heal before putting the potato to cold stores. Planting of healthy seed, adopting sani-
tation measures to avoid soil contamination through farm implements, irrigation
water and reducing soil inoculum through crop rotation and eliminating volunteer
potatoes are some of the measures which can reduce the risk of dry rot.
Most potato cultivars are susceptible to Fusarium spp., though some are less
susceptible than the others (Corsini and Pavek 1986; Lees et al. 1998). Breeding
lines possessing higher degree of resistance to dry rot have been reported by
Wharton and Kirk (2007). Transgenic potato plants constitutively over expressing
beta 1-3-glucanase gene from Nicotiana plumbaginifolia have been developed for
resistance against F. oxysporum (Libantova et al. 1998). Management of Fusaria
through biocontrol agents such as Trichoderma spp. (Pinzon-Perea et al. 1999),
Pseudomonas fluorescens (Schisler et al. 2000; Zin-Woo et al. 1998), P. aeruginosa
(Gupta et al. 1999), Bacillus subtilis (Kim et al. 1995) have been found effective.
Commercial biopreparations from Pseudomonas fluorescens have been developed
(Ermakova and Shterushis 1994). Combination of biocontrol genera Enterobacter
and Pseudomonas and two chitinolytic enzymes from Trichoderma harzianum had
inhibitory effect on spore germination of F. solani (Lorito et al. 1993). Bacteria
capable of binding to the fungal cell walls and expressing fungal genes coding cell
wall degrading enzymes may act as powerful biocontrol agents.
Avoiding planting of cut tubers or treating the cut tubers with dithiocarbamates
can reduce Fusarium seed piece decay (Rich et al. 1960). Tuber treatment with
1,200 ppm thiabendazole or benomyl can reduce the disease incidence (Leach 1976;
Leach and Nelson 1975). However, resistance to thiabendazole in Fusarium has been
reported by Hanson et al. (1996). Fungicides such as imazalil and mixtures contain-
ing TBZ have also found effective for control of dry rot (Carnegie et al. 1990, 1998).
6.6 Wart
Wart disease of potato caused by a fungus Synchytrium endobioticum (Schilberszky)

Percival is an important and serious disease of potato worldwide (Franc 2001).
It has been reported in Asia, Africa, Europe, Oceania, North America, and South
America (EPPO 2006). It caused great damage to potato in Europe until immune
varieties were introduced. The disease once established is difficult to eradicate since
the resting sporangia can survive inter-host periods for up to 20 years (Hampson
1993). The disease can be managed by enforcing strict quarantine legislation and
growing potato varieties immune to the wart. Potato is the principal host of the
pathogen and plants other than potato apparently do not play an important role in
the disease cycle of the pathogen. However, experimentally some of species of
Solanum take infection upon artificial inoculation (Phadtare and Sharma 1971) and
survival of the pathogen in such hosts could not be ruled out.
6.6.1 Symptoms
Warts are mostly spherical outgrowths or protuberances that appear on buds and
eyes of tubers, stolons, or underground stems or at stem base. Tubers may get com-
pletely replaced by warts which desiccate or decay at harvest (Fig. 6.9). The disease
Fig. 6.9 Warty growths on underground potato stems and tubers
may appear occasionally on above ground stem, leaf or flowers. Underground galls
are white to light pink when young and become brown or light black with age.
Above ground galls are green to brown or black. The wart tissues are soft and spongy.
6.6.2 The Pathogen
The fungus Synchytrium endobioticum (Schilberszky) Percival is the cause of wart

of potato. It is a member of Chytridiales. The fungus does not produce hyphae and
is an obligate, holocarpic, endobiotic parasite (Hampson 1993a, b; Walker 1983).
Numerous pathotypes of the fungus exist and are defined by their virulence on dif-
ferential potato cultivars. More than 40 pathotypes have been described from Europe
(Baayen et al. 2006). The fungus lack mycelium and has a thin walled summer
sporangium stage and a thick walled ‘winter’ or resting sporangium stage. Both
summer and winter sporangium produce an extended vesicle called sorus from
where zoospores are produced. The zoospores are pear shaped and possess a poste-
rior flagellum. These sporangia can remain viable in soil for 2–3 decades even in the
absence of suitable hosts. The resting sporangia under wet soil conditions and tem-
perature between 10 and 27 °C germinate to release haploid uni-nucleate zoospores.
The zoospores swim in soil, encyst and infect epidermal cells of meristematic tis-
sues of growing buds, stolons tips or leaf primordia by means of an infection peg
within 1–2 h of their formation. After successful infection a uni-nucleate thallus
develops within the infected cell which enlarges to form a prosorus. A vesicle devel-
ops from prosorus and contents of the prosorus pass on to the vesicle to form a sorus
within an infected cell. The sorus divides repeatedly to form several sporangia in
which zoospores develop. Finally wall of the sorus breaks releasing sporangia and
zoospores in soil. New infection results from the zoospores. This process continues
throughout the growing season. Growth of the fungus within host stimulate
hypertrophy and hyperplasia of neighbouring host cells without actively infecting
them which result in increase in meristematic activity and development of warts of
variable size depending upon the degree of stimulation (Lapwood and Hide 1971).
6.6.3 Epidemiology
Warty growths disintegrate releasing abundant resting sporangia in soil which serve
as primary inoculum. The pathogen spreads from one locality to another through
infected seed tubers, infested soil adhering tubers, machinery and other carriers of
contaminated soil. Resting sporangia survive passage through the digestive track of
animals fed with the infected potatoes, and the contaminated manure, therefore, can
disperse the inoculum. Earthworms have been found to serve as means of inoculum
dispersal. The resting sporangia can also be dispersed by wind-blown soil or by
flowing surface water. Wart is favoured by periodic flooding followed by drainage
and aeration since free water is required for germination of sporangia and dispersal
of zoospores. Temperature favourable for germination of resting sporangia to zoo-
spores ranges between from 14 to 24 °C. Both summer sporangia and resting spores
can germinate between 12 and 28 °C. Mean temperature below 18 °C and annual
precipitation of about 70 cm favour disease development.
6.6.4 Management
Rotational crops such as bean and radish and intercropping of potato with maize
have been found to reduce population of viable resting spores in soil (Singh and
Shekhawat 2000). Amendment of infested soil with 4 and 8 % crabshell (w/w)
reduces population of the pathogen (Hampson and Coombs 1995). Application of
fungicides and chemicals to soil is costly and not practical (Hodgson et al. 1974;
O’Brien and Rich 1976). Effective control of the disease has been achieved through
cultivation of wart immune varieties. Many varieties resistant or immune to wart
have been developed throughout the world. In resistant varieties the pathogen infects
the plants but symptom development is suppressed while in immune varieties a
hypersensitive reaction occurs upon infection with zoospores of the fungus get
killed in the process. Development and introduction of wart immune varieties such
as Kufri Jyoti, Kufri Bahar, Kufri Sherpa and Kufri Kanchan to wart infested region
of Darjeeling Hills of India coupled with domestic quarantine had a great impact in
containing wart in this region (Sharma et al. 1976; Singh 1998). The disease has
been successfully managed by sanitation, long crop rotation, growing resistant and
immune varieties and by enforcing strict quarantine legislation in countries of EPPO
region (Mc Namera and Smith 1998), Canada (Hampson 1993a, b), Maryland USA
(Putnam and Sindermann 1994) and India (Singh and Shekhawat 2000). However,
periodic surveys need to be carried out to monitor viability of the pathogen in soil.
6.7 Powdery Scab
Powdery scab of potato causes scab like lesions on tubers and seriously reduces
tuber quality and marketability, resulting in significant economic loss (Qu et al.
2011). It is prevalent worldwide (Harrison et al. 1997). It is a problem in northern
Asia, Europe, North and South America, Australia and New Zealand (Walker 1969;
Merz 2008). The disease is prominent in cool, wet climates and may cause extensive
losses in seed and ware potato crops under such conditions (Wale 2000). Apart from
potato and related species, powdery scab pathogen can affect other crop plants such
as oilseed rape, sugar beet, spinach, and a large number of common weeds including
chickweed, poppy, nettle and fat hen. However, the role of non-solanaceous hosts in
contributing to the inoculum for the disease is not well established (Wale 2000).
6.7.1 Symptoms
Powdery scab is confined to underground parts of potato plants. Symptoms on

potato tubers appear as purplish brown sunken lesions which later turn to scab like
lesions. However, unlike common scab the lesions of powdery scab are round,
raised, filled with powdery mass of spores and surrounded by ruptured remains of
epidermis (Fig. 6.10). Under certain conditions wart like protuberances may develop
(O’Brien and Rich 1976; Bhattacharyya and Raj 1978). The infected tuber may
shrivel or develop dry rot type symptom in storage. The powdery mass consists of
cytosori or balls of spores. Each spore ball contains several spores which adhere to
one another along with their walls.
Fig. 6.10 Powdery scab lesions on potato tubers surrounded by ruptured remains of epidermis
6.7.2 The Pathogen
The disease is caused by Spongospora subterranea (Wallr.) Lagerh. f. sp.

subterranea Tomlinson, a biotrophic pathogen belonging to plasmodiophorales,
characterized of having multinucleate plasmodia and biflagellate zoospores and
resting spores (Karling 1968; Harrison et al. 1997). The powdery mass consists of
cytosori or balls of spores. Each spore ball contains several spores which adhere to
one another along with their walls. The spores of the pathogen are yellow to brown,
thin walled, polyhedral, uni-nucleate structures which germinate to produce a sin-
gle primary zoospore. S. subterranea is an important vector of potato mop-top
furovirus (Kirk 2008).
6.7.3 Epidemiology
The pathogen can survive for many years in a quiescent form as uni-nucleate or
binucleate thick walled resting spores (Lahert and Kavanagh 1985). The spores can
survive passage through the alimentary canal of farm animals (Morse 1914). The
application of slurry or manure from stock fed on powdery scab infected tubers can
provide an additional source of inoculum for the disease (Harrison et al. 1997). The
pathogen survives winter as sporangia in infected potato tubers. It can also survive
in soil up to 6 years. The zoospores of the pathogen penetrate roots, stolons, tubers
and produce multinucleate sporangial plasmodium in the host. In roots, the plasmo-
dium produces sporangia which further produce up to 8 secondary zoospores. The
zoospores re-infect the host tissue and several such generations of zoospores may be
produced in a single season under ideal environment. The plasmodium produces
resting spore which can overcome winter and persist in tuber and soil for a long
period. Powdery scab pustules also predispose the tubers to P. infestans pathogen
(Bonde 1955). The cytosori can initiate the disease on the seed tubers in soil. The
disease can spread through contaminated farm implements and irrigation water.
6.7.4 Management
The disease can be managed by avoiding conditions leading to flooding of the fields
through proper drainage and by following crop rotation with non-solanaceous hosts.
Growing trap crops such as Datura stramonium immediately before planting potato
could reduce powdery scab incidence (Winter and Winiger 1983). Use of healthy
seed from disease free area and avoiding planting of potatoes in fields having previ-
ous history of the disease can help in management of powdery scab. Light-skinned
and red-skinned potato varieties in general are most susceptible (Christ 1993).
Cultivars resistant to the disease have been developed in Germany, Russia and Chile
(Manzer et al. 1964).
Control of powdery scab with fungicides is not successful under field conditions
(Burnett 1991). However, low tuber infections were observed when infested soils
were treated with soil fumigants such as methyl bromide, metam sodium, and chlo-
ropicrin. Seed treatments in general are not effective.
6.8 Charcoal Rot
Charcoal rot caused by Macrophomina phaseolina is an important disease of potato

and many other vegetable crops in tropical and subtropical countries. The disease is
favoured by temperature exceeding 28 °C (Chupp and Sherf 1960). The affected
tubers rot both in field and in country stores and can cause severe losses under
unusually warm wet weather. The disease is prevalent in the Mediterranean region,
warmer areas of India and Peru (French 2001), Hawaii and Southern USA (O’Brien
and Rich 1976). The fungus survives on a wide range of plants, at least 284 hosts
have been recorded which are both cultivated and wild (French 2001).
6.8.1 Symptoms
Macrophomina phaseolina attacks growing potato plants and tubers both at harvest
and storage. Affected plants in field exhibit stem blight or shallow rot similar to
black leg and cause the affected foliage to wilt and turn yellow. Early symptoms on
tubers develop around eyes, lenticels and stolon end where a dark light grey, soft,
water soaked lesion develop on the surface of the tuber (Fig. 6.11). Subsequently,
the lesions become filled with black mycelium and sclerotia of the pathogen.
Secondary organisms may develop in such lesions especially under wet conditions
causing significant losses (Pushkarnath 1976). Under low moisture the lesions may
shrink and develop symptoms similar to dry rots.
Fig. 6.11 Charcoal rot of potato tubers

6.8.2 The Pathogen
The pathogen Macrophomina phaseolina (Tassi) Goidanich Syn. M. phaeoli Maubl.

(O’Brien and Rich 1976) develops smooth, hard 0.1–1.0 mm sized sclerotia within
roots, stems, tubers and leaves. The perfect stage of the fungus is Botryodiplodia
solani-tuberosi Thiram. (Thirumalachar and O’Brien 1977) which may develop in
stems of potato, jute, sun hemp and maize. Pycnidia may develop on leaves and
stems depending upon the strain of the fungus. Conidia are single, hyaline and
ellipsoid to obovoid.
6.8.3 Epidemiology
The fungus M. phaseolina is a weak parasite. The pathogen survives in soil as

sclerotia present in plant debris, on weeds and alternate host crops. Both soil and
infected tubers serve as source of inoculum. M. phaseolina persists on dead or dying
plant tissues and survives the unfavourable periods by forming microsclerotia
(French 2001). The pathogen spreads through the infected seed tubers and through
the infested soil carried along with the implement. Temperature around 30 °C is
optimum for growth and infection of the fungus. Poor plant nutrition and wounds
predispose the plants to charcoal rot. Temperature around 30 °C or above is very
favourable for infection, the rot is slow at 20 to 25 °C and stops at 10 °C or below.
Fungal growth stops in tubers placed in cold stores but it resumes the growth after
cold storage.
6.8.4 Management
Soil temperature preceding harvest is crucial for development of charcoal rot.

Disease can be managed through planting early-maturing cultivars, frequent
irrigations to keep the soil temperature down and harvesting potato tubers
before the soil temperature exceeds 28 °C (Thirumalachar 1955). Rotation with
non-host crops, use of seed from disease free area, avoiding cuts and bruises at
harvest are some of the measures which can be followed to further reduce the
disease incidence. Use of biocontrol agent such as Bacillus subtilis through
seed treatment has been reported to reduce the disease (Thirumalachar and
O’Brien 1977). Resistance against charcoal rot has been identified in Solanum
chacoense which could be utilized in developing varieties resistant to charcoal
rot (French 2001).
References
Abd-El-Kareem F (2007) Potassium or sodium bicarbonate in combination with Nerol for

controlling early blight disease of potato plants under laboratory, greenhouse and field condi-
tions. Egypt J Phytopathol 35(1):73–86
Abd-Elsalam KA, Moslem MA, Bahkali AH (2009) First morpho-molecular identification of
Rhizoctonia solani AG-7 from potato tuber-borne sclerotium in Saudi Arabia. Afr J Microbiol
Res 3:952–956
Adams MJ, Lapwood DH (1983) Transmission of Fusarium solani var. coeruleum and F. sulphu-
reum from seed potatoes to progeny tubers in the field. Ann Appl Biol 103:411–417
Adl SM, Simpson AGB, Farmer MA, Andersen RA, Anderson OR, Barta JR et al (2005) The new
higher level classification of eukaryotes with emphasis on the taxonomy of protists. J Eurkaryot
Alexandrov V (2008) Response of different potato varieties to causal agent of early blight disease
(Alternaria solani). J Balkan Ecol 11(4):391–395
Ali GS, Reddy ASN (2000) Inhibition of fungal and bacterial plant pathogens by synthetic inhibi-
tion of disease progression. Mol Plant Microbe Interact 13:847–859
Al-Mughrabi KI (2004) Sensitivity of Jordanian isolates of Alternaria solani to mancothane.
Phytopathol Mediterr 43(1):14–19
Anderson NA (1982) The genetics and pathology of Rhizoctonia solani. Annu Rev Phytopathol
20:329–347
Appel R, Adler N, Habermeyer J (2001) A method for the artificial inoculation of potato tubers
with Phytophthora infestans and polymerase chain reaction assay of latently infected sprouts
and stems. J Phytopathol 149:287–292
Arora RK (1999) Evaluation of bioagents for control of soil and tuber borne diseases of potato.
Indian Phytopathol 52:310 (Abstr.)
Arora RK (2000a) Combined effects of soil solarization and seed treatments on control of potato
black scurf. In: Paul Khurana SM, Shekhawat GS, Singh BP, Pandey SK (eds) Potato global
research and development. Vol. I. Proceedings of global conference of potato, New Delhi,
December 6–11, 1999. Indian Potato Association, Central Potato Research Institute, Shimla,
pp 390–392
Arora RK (2000b) Bio-control of potato late blight. In: Paul Khurana SM, Shekhawat GS, Singh
BP, Pandey SK (eds) Potato global research and development. Vol. I. Indian Potato Association,
Central Potato Research Institute, Shimla, pp 620–623
Arora RK (2005) Efficacy of boric acid spray for control of black scurf in unwashed and washed
potato tubers. Potato J 32:183–184
Arora RK (2008) Management of black scurf of potato with the integrated use of Trichoderma
viride and boric acid. Potato J 35:130–133
Arora RK, Khanna RN (1997) Phytophthora blight of potato an age old problem. In: Agnihotri VP,
Sarbhoy AK, Singh DV (eds) Management of threatening diseases of national importance.
Malhotra Publishing House, New Delhi, pp 96–109
Arora RK, Somani AK (2001) A bioformation for control of black scurf disease of potato. J Indian
Potato Assoc 28:88–89
Arora RK, Kamble SS, Gangane LV (1992a) A resistance to metalaxyl in Phytophythora infestans
in Nilgiri hills of southern India. Phytophthora Newslett 18:8–9
Arora RK, Rose de Leema J, Paulraj F (1992b) Phylloplane microflora in biocontrol of potato late
blight. In: National symposium on non-chemical methods for the management of plant dis-
eases. Indian Phytopathological Society, Bhavnagar, p 49
Arora RK, Sharma J, Garg ID, Singh RK, Somani AK (2006a) Boric acid for control of tuber borne
diseases. In: Technologies in aid of healthy seed production. Part II. Technical Bulletin No. 35,
Central Potato Research Institute, Shimla, pp 1–4
Arora RK, Trehan SP, Sharma J, Khanna RN (1997) Soil solarization for improving potato health
and production. Proceedings Indian Phytopathological Society–Golden Jubilee International
Conference on Integrated Plant Disease Management for Sustainable Agriculture. Vol. II
pp.1190–1191
Arora RK, Sharma J, Singh RK (2006b) Soil solarization. In: Technologies in aid of healthy seed
production. Part I. Technical Bulletin No. 35, Central Potato Research Institute, Shimla, pp 1–7
Arora RK, Sunaina V, Somani AK (2008) Eco-friendly technologies to manage soil and tuber
borne diseases of potato. In: Pandey SK, Chakrabarti SK (eds) Twenty steps towards hidden
treasure—technologies that triggered potato revolution in India. Central Potato Research
Institute, Shimla, pp 137–150
Arora RK, Ahmed I, Singh BP (2012) Forecasting late blight of potato in Punjab using
JHULSACAST model. Potato J 39:173–176
Baayen RP, Cochius G, Hendriks H, Meffert JP, Bakker J, Bekker M et al (2006) History of potato
wart disease in Europe—a proposal for harmonisation in defining pathotypes. Eur J Plant
Pathol 116:21–31
Bairambekov SB, Korneva OG (2009) Using bio-preparations against early blight of potato.
Zaschita-i-Karantin-Rastenii 8:30–31
Balali GR, Neate SM, Scott ES, Whisson DL, Wicks TJ (1995) Anastomosis group and pathoge-
nicity of isolates of Rhizoctonia solani from potato crops in South Australia. Plant Pathol
44:1050–1057
Baldauf SL, Roger AJ, Wenk-Siefert I, Doolittle WF (2000) A kingdom level phologeny of eukary-
otes based on combined protein data. Science 290:972–977
Bandy BP, Leach SS, Tavantzixs SM (1988) Anastomosis group 3 is the major cause of Rhizoctonia
disease of potato in Maine. Plant Dis 72:596–598
Barclay GM, Murphy HJ, Manzer FE, Hutchinson FE (1973) Effects of differential rates of nitro-
gen and phosphorus on early blight of potatoes. Am Potato J 50:42–48
Barksdale TH (1969) Resistance of tomato seedlings to early blight. Phytopathology 59:443–446
Batista DC, Lima MA, Haddad F, Maffia LA, Mizubuti ESG (2006) Validation of decision support
system for tomato early blight and potato late blight under Brazilain conditions. Crop Prot
25(7):664–670
Beaumont A (1947) The dependence of weather on the dates of outbreak of potato blight epidem-
ics. Trans Br Mycol Soc 31:45–53
Behera B, Senapati S, Pattanaik KK, Biswal G (2009) Prediction of potato early blight in coastal
tract of Orissa. J Plant Prot Environ 6(1):79–85
Bernat E (2004) New possibilities of chemical protection against early and late blights in potato
crops using a fungicide Pyton Consento 450SC. Biuletyn-Instytutu Hodowli i Aklimatyazacji-
Roslin 233:303–308
Bhattacharyya SK, Raj S (1978) Studies on powdery scab of potatoes: factors affecting disease
development. J Indian Potato Assoc 5:1–6
Bhattacharyya SK, Raj S, Singh DS, Khanna RN, Ram S (1982) Forecasting late blight of potato
in Indian hills. In: Nagaich BB, Shekhawat GS, Gaur PC, Verma SC (eds) Potato in developing
countries. Indian Potato Association, Shimla, pp 414–424
Bodker L, Pedersen H, Kristensen K, Moller L, Lehtinen A, Hannukkala A (2006) Influence of
crop history of potato on early occurrence and disease severity of potato late blight caused by
Phytophthora infestans. In: Westerdijk CE, Schepers HTAM (eds) Proceedings of the 9th
workshop of an European network for development of an integrated control strategy of potato
late blight. PPO special report no. 11, pp 53–56
Bonde R (1955) The effect of powdery scab on the resistance of potato tubers to late blight rot.
Maine Agriculture Experimental Station Bulletin, No. 538
Bounes H, Finckh MR (2008) Effects of strip intercropping of potatoes with non-hosts on late
blight severity and tuber yield in organic production. Plant Pathol 57:916–927
Boyd AEW (1981) Development of potato blight (Phytophthora infestans) after planting infected
seed tubers. Ann Appl Biol 77:259–270
Bradshaw NG, Elcock SJ, Turner JA, Hardwick NV (2000) Are potato blight fungicides being used
rationally? In: Proceedings BCPC-international conference: pests and diseases, UK, 13–16
November 2000, vol 3, pp 847–852
Braun JA, Fry WE (1981) Analysis of potato blight epidemiology by simulation modeling.
Bruck RI, Fry WE, Apple AE (1980) Effect of metalaxyl an acylalanine fungicide on development
of Phytophthora infestans. Phytopathology 70:567–601
Burnett F (1991) The Biology and Control of Powdery Scab (Spongospora subterranea) of
potatoes. Aberdeen, UK: University of Aberdeen, PhD Thesis
Cao KQ, Fried PM, Ruckstuhl M, Forrer HR (1996) Ereignisorientierte Krautfaeuleprognose nit
PhytoPRE + 2000. Agrarforschung 3(7):325–328
Carling DE, Leiner RH (1986) Isolation and characterization of Rhizoctonia solani and binucleate
Rhizoctonia solani-like fungi from aerial stems and subterranean organs of potato plants.
Carling DE, Leiner RH (1990) Effect of temperature on virulence of Rhizoctonia solani and other
Rhizoctonia on potato. Phytopathology 80:930–934
Carling DE, Leiner RH, Westphale PC (1989) Symptoms, signs and yield reduction associated
with Rhizoctonia disease of potato induced by tuberborne inoculum of Rhizoctonia solani
AG-3. Am Potato J 66:693–701
Carling DE, Rothrock CS, MacNish GC, Sweetingham MW, Brainard KA, Winters SW (1994)
Characterization of anastomosis group 11 (AG-11) of Rhizoctonia solani. Phytopathology 84:
1387–1393
Carling DE, Baird RE, Gitaitis RD, Brainard KA, Kuninaga S (2002) Characterization of AG-13,
a newly reported anastomosis group of Rhizoctonia solani. Phytopathology 92:893–899
Carnegie SF, Ruthven AD, Lindsay DA, Hal TD (1990) Effects of fungicides applied to seed potato
tubers at harvest or after grading on fungal storage diseases and plant development. Ann Appl
Biol 116:61–72
Carnegie SF, Cameron AM, Lindsay DA, Sharp E, Nevison IM (1998) The effect of treating seed
potato tuber with benzimidazole, imidazole and phenylpyrrole fungicides on the control of rot
and blemish diseases. Ann Appl Biol 133:343–363
Carnegie SF, Cameron AM, Haddon P (2001) The effect of date of haulm destruction and harvest
on the development of dry rot caused by Fusarium solani. Phytopathology 84:1387–1393
Chakraborty A, Roy R (2012) Efficacy of Kresoxim methyl 500 SC against late and early blight of
potato. Ann Plant Prot Sci 20(1):248–249
Chand T, Logan C (1983) Cultural and pathogenic variation in potato isolates of Rhizoctonia
solani in Northern Ireland. Trans Br Mycol Soc 81:585–589
Chelkowski J (1989) Toxinogenic of Fusarium species causing dry rot of potato tubers. In:
Chelkowski J (ed) Fusarium mycotoxin, taxonomy and pathogenicity. Elsevier Publishing Co.,
New York, pp 435–440
Chimote VP, Kumar M, Sharma PK, Singh PH, Singh BP (2010) Characterization of changes in
phenotype and genotype of Phytophthora infestans isolates from India. J Plant Pathol
92:669–677
Choiseul JW, Allen L, Carnegie SF (2001) The role of stem inoculum in the transmission of
Fusarium sulphureum to potato tubers. Potato Res 44:165–172
Chow TL, Bernard G (1999) A versatile, fully automated, real time potato late blight unit. Comput
Electron Agr 23:55–69
Chowdappa P, Kumar NBJ, Madhura S, Kumar MSP, Myers KL, Fry WE, Squires JN, Cooke DEL
(2013) Emergence of 13_A2 blue lineage of Phytophthora infestans was responsible for severe
outbreaks of late blight on tomato in south west India. J Phytopathol 161:49–58
Christ BJ (1993) Powdery scab of potatoes-what we know. In: Proceedings of 12th Annual National
Potato Council Seed Seminar, pp 24–25
Chupp C, Sherf AT (1960) Vegetable diseases and their control. Ronald Press, New York
CIP (1989) Fungal diseases of potato. International Potato Centre, Lima, p 216
Conners IL (1967) An annotated index of plant diseases in Canada. Research Branch Publication,
Canada Department of Agricultural, Toronto, p 1251
Cooke LR, Schepers HTAM, Hermansen A, Bain RA, Bradshaw NJ, Ritchie F et al (2011)
Epidemiology and integrated control of potato late blight in Europe. Potato Res 54:183–222
Corsini DL, Pavek JJ (1986) Fusarium dry-rot resistant potato germplasm. Am Potato J
63:629–638
CPRI (1998–1999) Annual scientific report. Central Potato Research Institute, Shimla, pp 72–75
CPRI (2000–2001) Annual scientific report. Central Potato Research Institute, Shimla
Cullen DW, Lees AK, Toth IK, Bell KS, Duncan JM (2000) Detection and quantification of fungal
and bacterial potato pathogens in plant and soil. Bulletin OEPP 30:485–488
de Lacy-Costello BPJ, Ewans P, Ewens RJ, Gunson HE, Jones PRH, Ratcliffe NM, Spencer-
Phllips PTN (2001) Gas chromatography—mass spectrometry analysis of volatile compounds
for potato tubers inoculated with Phytophthora infestans or Fusarium coeruleum. Plant Pathol
50:489–496
Dowley LJ, O’Sullivan E (1981) Metalaxyl resistant strains of Phytophthora infestans in Ireland.
Potato Res 24:417–421
Ehrlich MA, Ehrlich HG (1966) Ultrastructure of hyphal and haustoria of Phytophthora infestans
and hyphae of Phytophthora erythroseptica. Can J Bot 44:1495–1504
El-Gholl NE, Schubert TS, Alfieri SA, Graham AE (1985) Dry rot of potato tubers. Fla. Dept.
Agric. & Consumer Serv., Div. of Plant Ind., Pathol. Circ. No. 267
EPPO (2006) A2 list of pests recommended for regulation as quarantine pests (version 2006-09).
Online. Quarantine info. European and Mediterranean Plant Protection Organization (EPPO),
Paris, France
Ermakova NE, Shterushis MV (1994) New biological preparation of RIT’s against plant diseases.
Zashchita Rastonii Moskva 12:18
Errampalli D, Johnston HW (2001) Control of tuber-borne black scurf [Rhizoctonia solani] and
common scab [Streptomyces scabies] of potatoes with a combination of sodium hypochlorite
and thiophanate methyl pre-planting seed tuber treatment. Can J Plant Pathol 23:68–77
Erwin DCS, Bartnicki-Garcia S, Tsao PH (1983) Phytophthora, its biology, taxonomy and pathol-
ogy. The American Phytopathological Society, St. Paul
Evenhuis A, Scheepers HTAM, Bus CB, Stegeman W (1996) Synergy of cymoxanil and mancozeb
when used to control potato late blight. Potato Res 39:551–559
Forrer HR, Hecker A, Steenblock T, Alfoidi T, Llockeretz W, Niggli U (2000) Hot water treatment
of potato seed tubers—a practicable means to prevent primary foci and delay epidemics of
potato late blight. IFOAM 2000: the world grows organic. In: Proceedings of 13th international
IFOAM scientific conference, Basel, Switzerland, 28–31 August 2000
Franc GD (2001) Wart. In: Stevenson WR, Loria R, Franc GD, Weingartner DP (eds) Compendium
of potato diseases. American Phytopathological Society, St. Paul, pp 46–47
Franc GD, Harrison MD, Lahman LK (1988) A simple day degree model for initiating chemical
control of potato early blight in Colorado. Plant Dis 72:851–854
Frank JA, Leach SS (1980) Comparison of tuber-borne and soil-borne inoculum of Rhizoctonia
disease on potato. Phytopathology 70:51–53
French ER (2001) Charcoal rot. In: Stevenson WR, Loria R, Franc GD, Weingartner DP (eds)
Compendium of potato diseases. American Phytopathological Society, St. Paul, pp 46–47
Frenkel O, Yermiyahu U, Forbes GA, Fry WE, Shtienberg D (2010) Restriction of potato and
tomato late blight development by sub-phytotoxic concentrations of boron. Plant Pathol
59:626–633
Fry W (2008) Phytophthora infestans: the plant (and R gene) destroyer. Mol Plant Pathol
9(3):385–402
Fry WE, Tooley PW, Spielman LJ (1989) The importance of perfect stage of Phytophthora infes-
tans from the stand point of epidemiology and adaptation. In: Proceedings of fungal diseases
of potatoes: report planning conference on fungal diseases of potato, CIP, Lima Peru, 21–25
September 1987, pp 117–130
Fry WE, Smart CD, Monti L, Leone A, Struik PC, Hide GA, Storey RMJ (1999) The return of
Phytophthora infestans, a potato pathogen that just won’t quit. In: Struik PC, Hide GA (eds)
Proceedings of the 14th triennial conference of the European Association for Potato Research;
Sorrento, Italy May 2–7, extra edition 42, pp 279–282
Gachango E, Kirk WW, Hanson LE, Rojas A, Tumbalam P, Shetty K (2011) First report of
Fusarium torulosum causing dry rot of seed potato tubers in Michigan. Plant Dis 95:1194
Gangawane LV, Arora RK, Kamble SS (1993) Effect of passage on the development of metalaxyl
resistance in Phytophthora infestans. In: Gangawane LV, Mukadam DS, Papdiwal PB, Shindi
SR (eds) Proceedings of symposium chemical management of plant pathogen in Western India.
Marathwada University, Aurangabad, pp 27–30
Garret KA, Mundt CC (2000) Host diversity can reduce potato late blight severity for focal and
general patterns of primary inoculum. Phytopathology 90:1307–1312
Gisi U, Cohen Y (1996) Resistance to phenylamide fungicides: a case study with Phytophthora
infestans involving mating types and race structure. Annu Rev Phytopathol 34:547–592
Goodwin SB, Cohen BA, Deahl KL, Fry WE (1994) Migration from northern Mexico as the
probable cause of recent genetic changes in populations of Phytophthora infestans in the
United States and Canada. Phytopathology 84:553–558
Groza HI, Bowen BD, Bussan AJ, Stevenson WR, Navarro F, Kichefski D et al (2007) MegaChip—a
new potato variety of chipping. Am J Potato Res 84(4):343–350
Guenthner JF, Michale KC, Nolte P (2001) The economic impact of potato late blight on U.S.
growers. Potato Res 44:121–125
Gupta CP, Sharma A, Dubey RC, Maheshwari DK (1999) Pseudomonas aeruginosa. (GRCI) as a
strong antagonist of Macrophomina phaseolina and Fusarium oxysporum. Cytobios 99:
183–189
Gupta H, Singh BP, Mohan J (2004) Biocontrol of late blight of potato. Potato J 31:39–42
Hampson MC (1993) History, biology and control of potato wart disease in Canada. Can J Plant
Pathol 15:223–244
Hampson MC, Coombs JW (1995) Reduction by potatoes wart disease with crushed crabshell:
suppression or eradication. Can J Plant Pathol 17:69–74
Hannukkala AO, Kaukoranta T, Lehtinen A, Rahkonen A (2007) Late blight epidemics on potato
in Finland 1933-2002; increased and earlier occurrence of epidemics associated with climate
change and lack of rotation. Plant Pathol 56:167–176
Hanson LE, Schwager SJ, Loria R (1996) Sensitivity to thiabendazole in Fusarium species associ-
ated with dry rot of potato. Phytopathology 86:378–384
Harrison JG, Searle RJ, Williams NA (1997) Powdery scab disease of potato—a review. Plant
Pathol 46:1–25
Hauslanden H, Bassler E (2004) Early blight disease in potatoes. What are the causes? Kartaffelbau
6:210–212
Haverkort AJ, Struik PC, Visser RGF, Jacobsen E (2009) Applied biotechnology to control late
blight in potato caused by Phytophthora infestans. Potato Res 52:249–264
Hensen JG, Bodker L, Nielson BJ (2000) Decision support for the control of potato late blight. In:
Proceeding of 17th Danish Plant Protection Conference. II. Site specific crop protection, deci-
sion support, pests and diseases, early blight, DJF Rapport, Markbrug, vol 24, pp 87–99
Hermansen A, Naestad R (2009) Bekjemping av potettorrate. Gartneryrket 107(7):20–23
Hide GA, Read PJ, Hall SM (1992) Resistance to thiabendazole in Fusarium species isolated from
potato tubers affected by dry rot. Plant Pathol 41:745–748
Hijmans RJ, Forbes GA, Walker TS (2000) Estimating the global severity of potato late blight with
GIS-linked disease forecast models. Plant Pathol 49:697–705
Hodgson WA, Pond DD, Munro J (1974) Diseases and pests of potatoes. Canadian Department of
Agriculture, Ottawa
Hohl HR, Iselin K (1984) Strains of Phytophthora infestans from Switzerland with A2 mating type
behavior. Trans Br Mycol Soc 83:529–530
Holm AL, Rivera VV, Secor GA, Gudmestad NC (2003) Temporal sensitivity of Alternaria solani
to foliar fungicides. Am J Potato Res 80(1):33–40
Huang-Mc Breath J (2001) Biocontrol and growth promotion with cold tolerant Trichoderma. IPM
Practitioner 23:1–6
Hussain S, Lees AK, Duncan JM, Cooke DEL (2005) Development of a species-specific and sensi-
tive detection assay for Phytophthora infestans and its application for monitoring of inoculums
in tubers and soil. Plant Pathol 54:373–382
Hyre BA (1954) Progress of forecasting late blight of potato and tomato. Plant Dis Report
38:245–253
Ingram DS, Williams PH (eds) (1991) Advances in plant pathology. Phytophthora infestans, the
cause of late blight of potato, vol 7. Academic Press, New York
Jansky SH, Rouse DI (2003) Multiple disease resistance in interspecific hybrids of potato. Plant
Dis 87(3):266–272
Johnk JS, Jones RK (1993) Differentiation of populations of AG-2-2 of Rhizoctonia solani by
analysis of cellular fatty acids. Phytopathology 83:278–283
Johnson DA, Cummings TF (2009) Latent infection of potato seed tubers by Phytophthora
infestans during long-term cold storage. Plant Dis 93:940–946
Kapsa J (2007) Application of the Burkard spore trap to determine a composition of the genus
Alternaria in potato crops. Biuletyn Instytutu Hodowli i Aklimatyazacji-Roslin 244:223–229
Karling JS (1968) The plasmodiophorales, 2nd edn. Hafner Publishing Co, New York
Keijer J, Houterman PM, Dulhemans AM, Korsman MG (1996) Heterogeneity in electrophoretic
karyotype within and between anastomosis groups of Rhizoctonia solani. Mycol Res 100:
787–797
Khanna RN, Sharma J (1996) Effect of boric acid treatment on seed and soil borne Rhizoctonia
solani inocula and rhizosphere microflora. J Indian Potato Assoc 23:1–7
Kim BS, Cho KC, Cho KY (1995) Antifungal effects of plant pathogenic fungi and characteristics
of antifungal substances produced by Bacillus subtilis SJ-2 isolated from sclerotia of
Rhizoctonia solani. Kor J Plant Pathol 11:165–172
Kim BS, Kim K, Lee J, Lee Y, Cho KY, Kim BS (1996) Isolation and purification of several sub-
stances produced by Fusarium graminearum and their antimicrobial activities. Kor J Plant
Pathol 11:158–164
Kirk WW (2003) Thermal properties of overwintered piles of cull potatoes. Am J Potato Res
80:145–149
Kirk HG (2008) Mop-top virus, relationship to its vector. Am J Potato Res 85:261–265
Kirk WW, Felcher KJ, Douches DS, Coombs J, Stein JM, Baker KM, Hammerschmidt R (2001)
Effect of host plant resistance and reduced rates and frequencies of fungicide application to
control potato late blight. Plant Dis 85:1113–1118
Kirk WW, Abu-El Samen F, Thumbalam P, Wharton P, Douehes D et al (2009) Impact of different
US genotypes of Phytophthora infestans on potato seed tuber rot and plant emergence in a
range of cultivars and advanced breeding lines. Potato Res 52:121–140
Krause RA, Massie IB, Hyre RA (1975) BLITECAST: a computerized forecast of potato blight.
Plant Dis Rep 59:95–98
Kromann P, Taipe A, Andrade-Piedra JL, Munk L, Forbes GA (2008) Pre-emergence infection of
potato sprouts by Phytophthora infestans in the highlands tropics of Ecuador. Plant Dis
92:569–574
Kuzuestova MA, Sschcherbakova LA, Ihnskaya LI, Filippov AV, Ozeretekovskay OL (1995)
Mycelium extract of the fungus Pythium ultimum is an efficient preventive of Phytophthora
infection. Microbiology 64:422–424
Lahert H, Kavanagh JA (1985) The fine structure of cytosorus of Spongospora subterranea, the
cause of powdery scab of potato. Can J Bot 63:2278–2282
Lambert DH, Currier AJ (1997) Differences in tuber rot development for North American clones
of Phytophthora infestans. Am Potato J 74:39–371
Lapwood DH, Hide GA (1971) Potato diseases. In: Western JH (ed) Diseases of crop plants.
Willey, New York, pp 89–122
Laroche JP, Jabagi- Hare SH, Charent PH (1992) Differentiation of two anastomosis groups of
Rhizoctonia solani by isozyme analysis. Phytopathalogy 82:1387–1393
Leach SS (1976) Increasing storability of potatoes by chemical treatments at the time of storage.
Am Potato J 53:364
Leach SS, Nelson LW (1975) Elimination of Fusarial contamination on seed potatoes. Am Potato
J 9:211–218
Lees AK, Bradshaw JE, Stewart HE (1998) Inheritance of resistance to Fusarium spp. and to
Phytophthora infestans in crosses between Neotuberosum and Tuberosum potatoes estimated
by seedling tests. Potato Res 41:267–275
Libantova J, Bauer M, Mlynarova L, Moracikova J (1998) Bekesiova 1. Tobacco and potato plants
expressing basic vacuolar beta-1,3-glucanase from Nicotiana Plumbaginifolia. Biologia
Bratislara 53:739–748
Lorito M, Di Pietro A, Hayes CK, Woo SL, Harman GE, Di Pletro A (1993) Antifungal, synergistic
interaction between Trichoderma harzianum and Enterobacter cloacae. Phytopathalogy
83:721–728
Lucas JA, Shattock RC, Shaw DS, Coope R (eds) (1991) Phytophthora. British Mycological
Society, Cambridge. Cambridge University Press, Cambridge
Lynch DR, Kawchuk LM, Chen Q, Konschuh M, Holley J, Fujimoto DK et al (2004) Alta Russet:
an early—maturing high quality Russet cultivar for wedge cut French fry production. Am J
Potato Res 81(3):195–201
Mackin J (1998) Potato late blight raise fears of a famine. Cornell Focus 7:12–17
MacNish GC, Carling DE, Brainard KA (1993) Characterization of Rhizoctonia solani AG-8 from
bare patches by pectic isozyme (Zymogram) and anastomosis techniques. Phytopathology
83:922–927
Malcolmson JF (1985) Phytophthora infestans A2 compatibility type recorded in Great Britain.
Trans Br Mycol Soc 85:531
Manzer FE, Akeley RV, Merrian D (1964) Resistance to powdery scab in Solanum tuberosum
L. Am Potato J 41:374–376
Marshall KD, Stevenson WR (1996) Transmission of Phytophthora infestans from infected seed
potato tubers to developing sprouts. Am J Potato Res 73:370–371
Mc Namera DG, Smith IM (1998) National control measures for Synchytrium endobioticum.
Bulletin OEPP 20:507–511
Mecteau MR, Arul J, Tweddell RJ (2002) Effect of organic and inorganic salts on the growth and
development of Fusarium sambucinum, a causal agent of potato dry rot. Mycol Res 106:
688–696
Medina MV, Platt HW (1999) Viability of oospores of Phytophthora infestans under field condi-
tions in northeastern North America. Can J Plant Pathol 21:137–143
Meinck S, Kolbe H (1999) Control of leaf and tuber blight in ecological potato cultivation.
Kartoffelbau 50:172–175
Merz U (2008) Powdery scab of potato—occurrence, life cycle and epidemiology. Am J Potato
Res 85:241–246
Millar PR, Pollard HL (1976) Multilingual compendium of plant diseases. American
Phytopathalogical Society, St. Paul
Mishra RC, Singh R, Singh HB, Dikshit A (2000) In situ efficacy of Trichoderma harzianum as
mycoparasite on Sclerotium rolfsii and Rhizoctonia solani. Trop Agric 77:205–206
Morse WJ (1914) Powdery scab of potatoes. Maine Agr Exp Stat Tech Bull 227:89–104
Mosa AA, Kato M, Sato N, Kobayashi K, Ogoshi A (1989) Occurrence of A2 mating type of
Phytophthora infestans on potato in Japan. Ann Phytopath Soc Jpn 55:615–620
Musa-Steenblock T, Forrer HR (2005) Bio-PhytoPRE- a decision support system for late blight
control in organic potato production in Switzerland. In: Ende der Niche. Beitrage zur 8.
Wissenschaftstagung zum Okologischer Landban, Kassel University Press, Kassel; pp 133–136
Neiderhauser JS (1986) Late blight of potato in Mexico, its place of origin and solution. Revista
Mexicana de Fitopatologia 4:31–36
Niederhauser JS, Alvarez-Luna E, Mackenzie DR (1996) Retona. A new strategy in the control of
potato late blight. Am Potato J 73:225–229
Nieme M, Lahdenpera ML (2000) Gliocladium catenulatum JI 446- a new biofungicide for horti-
cultural crops. 17th Danish plant protection conference, Horticulture D. J. F.-Rapport,
Hareburg, vol 12, pp 81–88
O’Brien MJ, Rich AE (1976) Potato diseases. U.S. Department of Agriculture Handbook,
Washington, DC
Osowski J (2004) The effectiveness of different fungicides containing mancozeb in reducing
development of early blight of potato in field and laboratory investigations. Biuletyn-Instytutu
Hodowli i Aklimatyazacji-Roslin 233:295–302
Pasche JS, Wharam CM, Gudmestad NC (2002) Shift in sensitivity of Alternaria solani (potato
early blight) to strobilurin fungicides. In: Proceedings of international conference on pests and
diseases, Brighton, UK, 18–21 November 2002, pp 841–846
Pasche JS, Wharam CM, Gudmestad NC (2004) Shift in sensitivity of Alternaria solani in response
to QoI fungicide. Plant Dis 88:181–187
Pasche JS, Piche LM, Gudmestad NC (2005) Effect of the F129L mutation in Alternaria solani on
fungicides affecting mitochondrial respiration. Plant Dis 89(3):269–278
Pavlista AD (2003) Thidiazuron a cytokinin-like compound enhances fungicidal activity against
early blight in potato. Acta Hortic 619:145–152
Percival GC, Karim MS, Dixon GR (1999) Pathogen resistance in aerial tubers of potato cultivars.
Peters JC, Stroud GS, Lees A, Cullen DW, Sullivan L (2004) Results from a survey of Fusarium
spp. on GB potatoes. In: Duvauchelle S (ed) Abstracts of the European Association of Potato
Research, pathology section meeting, Lille, France
Phadtare SG, Sharma KP (1971) Additional hosts of Synchytrium endobioticum. Indian Phytopathol
24:389–392
Pinzon-Perea L, Salgado R, Martineg-Lopez G (1999) Antagonism between different isolates of
Trichoderma spp. and Fusarium oxysporum f. sp. dianthi (Prill. and Del.) Snyd. and Hans.
Fitopatol Colomb 23:7–11
Pushkarnath (1976) Potato in subtropics. Orient Longman, New Delhi
Pushkarnath, Paharia KD (1963) Survival of Phytophthora infestans on infected tubers in cold
storage in the plains of India. Indian Potato J 5:48–51
Putnam ML, Sindermann B (1994) Eradication of potato wart from Maryland. Am Potato
J 71:734–747
Qu XS, Wanner LA, Christ BJ (2011) Multiplex real-time PCR (TaqMan) assay for the simultane-
ous detection and discrimination of potato powdery and common scab diseases and pathogens.
J Appl Microbiol 110:769–777
Raj S, Dull BL, Sahai D (1974) Cultural variations in potato isolates of Rhizoctonia solani Kuhn.
Acta Phytopathol Acad Sci Hung 9:71–79
Reeves AF, Olanya OM, Hunter JH, Well JM (1999) Evaluation of potato varieties and selections
for resistance to bacterial soft rot. Am J Potato Res 76:183–189
Rich AE, Campbell CS, Mullany RE, Manzer FE, Blood PT (1960) The influence of various fun-
gicides and antibiotics on cut seed potatoes. Am Potato J 37:351
Ristaino JB, Grovers CT, Parra GR (2001) PCR amplification of the Irish potato famine pathogen
from historic specimens. Nature 411:695–697
Rodriguez-Maza F, Stefanova-Narimova M (2005) Biological control of early blight (Alternaria
solani Sorouer) in potato (Solanum tuberosum) crop in field conditions. Fitosanidad 9:35–37
Roy S, Singh BP, Bhattacharyya SK (1991) Biocontrol of late blight of potato. Phytophthora
Newsl 17:18
Roy SK, Sharma RC, Trehan SP (2001) Integrated nutrient management by using farmyard manure
and fertilizers in potato-sunflower-paddy rice rotation in the Punjab. J Agric Sci 137:271–278
Sagar V, Sharma S, Jeevalatha A, Chakrabarti SK, Singh BP (2011) First report of Fusarium sam-
bucinum causing dry rot of potato in India. New Dis Rep 24:5
Samoucha Y, Cohen Y (1988) Synergistic interactions of cymoxanil mixtures in the control of
metalaxyl resistant Phytophthora infestans of potato. Phytopathology 78:636–640
Schisler DA, Slininger PJ, Hanson LL, Loria R (2000) Potato cultivar, pathogen isolate and antag-
onist cultivation medium influence the efficiency and ranking of bacterial antagonist of
Fusarium dry rot biocontrol. Sci Technol 10:267–269
Schmiedeknecht G, Bochow H, Jungo H (1998) Use of Bacillus subtilis as biocontrol agent-
II. Biological control of plant diseases. Zeit Pflanzen Pflanzenschutz 105:376–386
Senter LH, Sanson DR, Corley DG, Tempesta MS, Rottinghaus AA, Rottinghaus GE (1991)
Cytotoxicity of trichothecenemycotoxins isolated from Fusarium sporotrichioides (MC-
72083) and Fusarium sambucinum in baby hamster kidney (BHK-21) cells. Mycopathologia
113:127–131
Sharma KP, Phadtare SG, Kishore H (1976) Now you have wart immune varieties. Indian Farm
25:13–15
Sharma S, Jeevalatha A, Sagar V, Sharma NN, Chakrabarti SK, Singh BP (2010) Detection of
latent infection of Phytophthora infestans in potato seed tubers. In: Annual meeting of Indian
Phytopathological Society (NZ) and symposium on emerging plant diseases in North India:
status and management strategies held at CCS HAU, Hisar w.e.f. 28-29 October 2010
Shtienberg G (2001) Integrated management of early and late blight of potatoes in Israel. Afr Crop
Sci J 9:203–207
Singh BM (1967) Inducing sporulation in different strains of Alternaria solani. Effect of visible
light. Mycopath Mycol Appl 31:144–150
Singh BP (1986) Studies on fusarial wilt and dry rot of potatoes (S. tuberosum). PhD Dissertation.
Aligarh Muslim University, Aligarh, India
Singh PH (1998) Present status of wart diseases of potato in Darjeeling hills. J Indian Potato Assoc
25:135–138
Singh BP, Shekhawat GS (1999) Potato late blight in India. Technical Bulletin No. 27 (revised)
C.P.R.I., Shimla
Singh PH, Shekhawat GS (2000) Wart diseases of potato in Darjeeling hiils. Technical Bulletin No.
19, p 73
Singh BP, Nagaich BB, Saxena SK (1987a) Fungi associated with dry rot of potatoes, their fre-
quency and distribution. Indian J Plant Pathol 5:142–145
Singh BP, Prasad B, Wallia MS (1987b) Effect of date of planting, crop age and environmental
factors on potato leaf spots. Indian Phytopathol 40:70–75
Singh BP, Roy S, Bhatthcharyya SK (1994) Occurrence of A2 mating type of Phytophthora infes-
tans in India. Potato Res 37:227–231
Singh BP, Ahmed I, Sharma VC, Shekhawat GS (2000) A computerized forecast of potato late
blight in western Uttar Pradesh. Potato J 27:25–34
Sneh B, Burpee L, Ogoshi A (1991) Identification of Rhizoctonia species. American
Phytopathological Society, St. Paul
Somani AK, Arora RK (2010) Field efficacy of Trichoderma viride, Bacillus subtilis and Bacillus
cereus in consortium for control of Rhizoctonia solani causing black scurf disease of potato.
Indian Phytopathol 63:23–25
Somani AK, Chohan RKS (1994) Herbicide paraquat spray as a predisposing factor for dry rot
development in freshly harvested potatoes. In: Shekhawat GS, Paul Khurana SM, Pandey SK,
Chandla VK (eds) Potato present and future. Indian Potato Association, Shimla, pp 219–220
Stevenson WR, Loria R, Franc GD, Weingartner DP (2001) Compendium of potato diseases, 2nd
edn. The American Phytopathological Society, St. Paul
Thirumalachar MJ (1955) Incidence of charcoal rot of potato in Bihar (India). In relation to cul-
tural conditions. Phytopathalogy 456:608–610
Thirumalachar MJ, O’Brien MJ (1977) Suppression of charcoal rot of potato with a bacterial
antagonist. Plant Dis Rep 61:543–546
Tsror L, Perezt-Alon I (2005) The influence of inoculum source of Rhizoctonia solani on develop-
ment of black scurf on potato. J Phytopathol 153:240–244
Tsror L, Balak R, Sneh B (2001) Biological control of black scruf on potato under organic amend-
ment. Crop Prot 20:145–1509
Turkensteen LJ, Mulder A (1999) The potato disease Phytophthora infestans. Gewasbescherming
30:106–112
Turkensteen J, Flier WG, Wanningen R, Mulder A (2000) Production, survival and infectivity of
oospores of Phytophthora infestans. Plant Pathol 49:688–696
Ulrich J, Schrodter H (1966) Nachrbl. dt. Pflaschutzdienst. Stuffa 18:33–40
Van Everdingen E (1926) Het berband tusschen der weersgesteld held on de aarda ppelziekte
(Phytophthora infestans) (the relation between weather conditions and Phytophthora infes-
tans). Tijdscher Pfziet 32:129–140
Verma M, Brar SK, Tyagi RD, Surampalli RY, Valéro JR (2007) Antagonistic fungi, Trichoderma
spp.: panoply of biological control. Biochem Eng J 37:1–20
Virgen-Callerus G, Olalde-Portugal V, Carling DE (2000) Anastomosis group of Rhizoctonia
solani on potato in central Mexico and potential for biological and chemical control. Am Potato
J 77:214–219
Voral V (2005) Potato Sazava. Czech J Genet Plant Breed 41(4):175–176
van der Waals JE, Denner FDN, van Rij N, Korsten L (2003) Evaluation of PLANT-Plus a decision
support system for control of early blight on potatoes in South Africa. Crop Prot 22(6):
821–828
Wale SJ (2000) Summary of the session on national potato production and the powdery scab situ-
ation. In: Merz U, Lees AK (eds) Proceedings of First European Powdery Scab Workshop,
SAC, Aberdeen, Scotland, July 20–22, 2000. SCRI, Dundee, pp 3–9
Walker JC (1969) Plant pathology, 3rd edn. McGraw-Hill, New York
Walker JC (1983) Synchytrium endobioticum. CMI descriptions of pathogenic fungi and bacteria.
No. 755. CAB International, Wallingford
Wallins JR (1962) Summary of recent progress in predicting late blight epidemics in United States
and Canada. Am Potato J 39:306–312
Welsh RD, Callaghan MO (1996) Evaluation of fenpiclonil, as a potato seed treatment for the
control of Rhizoctonia solani and Helminthosporium solani. In: Proceeding of 49th
New Zealand plant protection conference. New Zealand, pp 152–156
Western JH (ed) (1971) Diseases of crop plants. Wiley, New York
Wharton P, Kirk W (2007) Fusarium dry rot. http://www.potatodiseases.org/contact.html
Wharton P, Fairchild K, Belcher A, Wood E (2012) First report of in vitro boscalid-resistant iso-
lates of Alternaria solani causing early blight of potato in Idaho. Plant Dis 96(3):454–455
Wilson PS, Ahvenniemi PM, Lehtonen MJ, Kukkonen M, Rita H, Valkonen JPT (2008) Biological
and chemical control and their combined use to control different stages of the Rhizoctonia
disease complex on potato through the growing season. Ann Appl Biol 153:307–320
Winter W, Winiger FA (1983) Einflusverschiedener Fangpflenzensowie von Kalk und Kalkstickstoff
auf die Bondenverseuchungmit Spongospora subterraneadem Erreger des Pulverschorfesbei
Kartoffeln. Mitteilungenfur die Schweizerische Landwirtschaft 31:190–206
Yakhin IA, Ibragimov RI, Yakhin OI, Isaev RF, Vakhitov VA (1998) The induced effect of bio-
preparation stifun on the accumulation of trypsin inhibitors in potato tubers in storage. Russ
Agr Sci 8:5–8
Zin-Woo K, Park BK, Hawang IY, Park CS (1998) Antifungal activity of root colonizing
Pseudomonas fluorescens MCOT is responsible for its disease suppressing ability. Kor J Plant
Pathol 14:606–611
Zwankhuizen MJ, Govers F, Zakoks JC (1998) Development of potato late blight epidemics: dis-
ease foci, disease gradients, and infection sources. Phytopathology 88:754–763
Zwankhuizen MJ, Govers F, Zadoks JC (2000) Inoculum sources and genotypic diversity of
Phytophthora infestans in Southern Flevoland, The Netherlands. Eur J Plant Pathol 106:
667–680
Chapter 7
Host–Pathogen Interaction, Plant Diseases,
Disease Management Strategies, and Future
Challenges
Chakravarthula Manoharachary and Indra Kala Kunwar
7.1 Host–Pathogen Barriers: Some Issues
World population has been increasing enormously and is marching towards ten
billion by 2050. The natural resources have been dwindling and getting exhausted
due to over exploitation and anthropogenic activities. Diseases caused by fungi,
bacteria, virus, mycoplasma, nematodes and other microbes on crop plants form the
limiting factors in realizing the yield potential of crop plants thus resulting in about
10–25 % losses leading to famines, hunger, poverty and economic crisis. It is also
known from literature that diseases of unknown etiology like Karnal bunt of wheat,
sheath blight in rice, citrus die back, mango malformation, wilt of coconut, wilt of
guava, brown blast of rubber and other such diseases are of great concern by virtue
of their resurgence capabilities resulting in a change of cropping system, climate
patterns, etc. Critical issues have become evident due to over and non-judicial use of
chemicals to control diseases and pests including toxicity, residual effect and health
problems besides resistance towards chemical by plant pathogens and insects.
Successful management of diseases is the need of the hour to provide food security
to the billions of people living around the world. Disease management practices
must be safe, efficient, eco-friendly and cost effective.
Plant disease is defined as any disturbance that prevents normal development of
plant and reduces its economic value besides having deviation in normal physiology
and biochemical mechanisms that lowers the yields and reduces quality. Diseases
are caused by pathogenic microorganisms, fungi, nematodes and insects. Parasitic
plants and abiotic stresses are also known to cause diseases.
Disease production is not a simple process but involves many steps and critical
issues. A susceptible host, virulent pathogen and congenial atmospheric conditions
C. Manoharachary, M.Sc., Ph.D., D.Sc. (*) • I.K. Kunwar, M.Sc., D.Phil.

Department of Botany, Osmania University, Hyderabad, Telangana 500007, India
e-mail: cmchary@rediffmail.com

186 C. Manoharachary and I.K. Kunwar
are essential. The pathogen enters into the host through wounds, stomata, mechanical
injuries, direct penetrations and also by degrading cell wall materials. The patho-
genic fungi do produce several enzymes such as cutinases, cellulases, petinases,
lignases and several other such biological weapons which degrade the complex cell
wall materials of host and make successful entry into host tissues. However, there is
a requirement of spore load for successful infection called inoculum potential. After
the successful entry and establishment of pathogen, several toxins namely phytotox-
ins, vivotoxins and pathotoxins are released by the fungal pathogens into the host
tissues which derail the host metabolism. Lycomarasmin is the example of phyto-
toxins and Fusaric acid is one of the toxins cited for vivotoxins. Pathotoxins include
piricularin, tabotoxin, and victorin is the host specific toxin. Alteration of plant
physiological and biochemical functions due to host–pathogen interaction results in
disease syndrome formation. The sequential steps as mentioned above result in
symptom production. Symptoms include leaf spots, cankers, galls, rusts, smuts,
malformation, wilts, root and stem rots, blights, and others. Thus, various diseases
on diversified crops result in heavy losses leading to epidemics and famines. In view
of huge losses incurred in crop productivity, there is a necessity of plant disease
control and management.
In the process of host–pathogen interaction several impediments and hurdles
need to be faced both by fungal pathogens and host. The host plants defend them-
selves through defense structures that exist before infection. These include waxes,
cuticles, multiple epidermis, closed stomata, formation of cork layers, tyloses
formation, abscission layer formation, gum deposition, hyphal sheathing, etc.
Biochemical defense mechanism which offers resistance in host against patho-
gen being the release of inhibitors such as chlorogenic acid, phenolic compounds
absence of nutrients, absence of common antigens and others. Phytoalexins are the
fungicidal/fungistatic substances which serve the purpose of antibody. These are
low molecular weight antimicrobial compounds that accumulate in plants as a result
of infection or stress. Ipomeamarone and many other compounds play important
role. In addition to phenolic substances produced in plant tissues in response to
infection, induced synthesis of proteins and enzymes seems to play a key role in
disease resistance. Pathogen related proteins are generally a group of plant proteins
that are toxic to invading fungal pathogens or other pathogens. Signal transduction
and several other genetic mechanisms have a greater role. There are also preformed
chemicals (prohibitins) which prevent disease production.
Host–pathogen interaction is a struggle for survival between two organisms and
there exists a state of balance and surviving plants and their parasites are capable of
coexistence. Resistance and susceptibility are the major factors that play an impor-
tant role in host–parasite interaction.
Interactions between a host and pathogen are medicated by environmental condi-
tions, but are ultimately determined by genotype. Flor (1956) studied the genetics of
flax cultivars and isolates of the linseed rust pathogen. The concept being that for
each gene conditioning virulence or virulence in the pathogen, there is a corre-
sponding gene conditioning resistance or susceptibility in the plant.
7 Host–Pathogen Interaction, Plant Diseases, Disease Management Strategies… 187
Genes for the resistance in the host are dominant (R) and those for susceptibility
(lack of resistance) are recessive (r). Genes for virulence are dominant (A) and
recessive (a). Gene for gene hypothesis operates therefore; four gene combinations
are possible in host–pathogen interaction. These combinations are R-a, r-A, r-a, and
R-A. Three combinations R-a, r-A, and r-a give rise to compatible reaction and
infections are successful. One combination R-A results in an incompatible reaction
and no infection occurs.
7.2 Plant Pathogen Diagnosis: Molecular Approach
Identification and diagnosis of plant pathogens in the process of early infection can
help for the better management of the diseases. Martin et al. (2000) have discussed
the molecular diagnosis of pathogen at length. Farmer is interested in the early and
rapid detection of pathogen and disease diagnosis. It must be simple and cost effec-
tive. Symptoms and identification of plant pathogens based on morpho-toxonomic
criteria have been used since ages. However, this kind of methodology is time con-
suming; hence DNA probes have been developed. RAPD, RLFP, ISSR, URP, EIISA,
PCR, Q-PcR, DNA array technology membrane-based microarrays (Zhang et al.
2006) and others are developed for the detection of multiple pathogens present in the
field samples. For understanding disease epidemics and their management, under-
standing variability in pathogen population is critical. Applications of DNA markers
and probes have become very effective and less time consuming (Jalali 2008).
7.3 Host–Pathogen Interaction (Genetic Resistance

and Biochemical Aspects)
Plants are known to posses preformed (constitutive) as well as inducible defense

system to inhibit attack by pathogenic bacteria, fungi, viruses, nematodes and
insects through metabolic, biochemical and molecular defenses, as well as by physi-
cal/structural barriers (Hammerschmidt 2007). Many studies also showed that
chemicals or physical barriers are known to involve in preformed resistance. The
exogenous applications of biotic or abiotic elicitors inducing resistance are catego-
rized either as systemic acquired resistance (SAR) or induced systemic resistance
(ISR) (Pieterse and Van Loon 2007). Induced resistance (SAR and ISR) involves in
the activation of multiple genes and/or defense signaling pathways. Signal-
transduction pathways are mediated by salicylic acid (SA), jasmonic acid (JA), and
ethylene (ET) which are involved in regulating appropriate defense responses. The
crosstalk between these different signal-transduction pathways allows the plant to
fine-tune its defenses against different types of fungal microbial pathogens and
insects (Pieterse and Van Loon 2007). Recently developed biotechnological tools
are very helpful in recognizing the complex nature of plant defense mechanisms
(Xing and Jordan 2000).
7.3.1 Passive Resistance
The cell wall is an important barrier monitoring its integrity and allows plants to
quickly activate pathways to minimize pathogen entry and reduce the spread of
disease (Hematy et al. 2009). Epidermal cell wall penetration and cell walls con-
stituency are found to resist Magnaporthe graminis in resistant host varieties than
susceptible host species. The alterations in cuticular structure lead to the release of
fungitoxic substances and changes in gene expression that form a multifactorial
defense response in Arabidopsis thaliana against Botrytis cinerea (Chassot et al.
2008). Variation in pectin composition of cell wall has been associated with stem
rust (Puccinia graminis) resistance in wheat (Wietholter et al. 2003). In addition to
these structural barriers, preformed antifungal compounds considered as prohibiting
such as phenols and phenolic glycosides, unsaturated lactones, sulphur compounds,
saponins, cyanogenic glycosides and glucosinolates (Khan et al. 2011) offer defense
to plants against a variety of pathogenic microorganisms. In plants some defensins
are known to be of antifungal or occasionally anti-bacterial activity. Salicylic acid
synthesis pathway is shown to be responsible for accumulation of phenolics in
plants after microbial infection in plants (Liu et al. 2007).
7.3.2 Induced Defense Responses
Many plants respond to pathogen attack by activating an array of inducible defense

responses. Plant genotypes have specific R genes that are able to recognize patho-
gens to the corresponding avr genes. The R gene products are polymorphic and are
coded by multigene families covering at least 150 loci in the Arabidopsis genome
(The Arabidopsis Genome Initiative, 2000).
Many R genes confer resistance to various plant species against a range of
pathogens and have been identified, isolated and cloned. R genes have been divided
into five categories based on their structural features (Hammond-Kosack and Jones
1997). The first category encodes cytoplasmic serine/threonine protein kinases, sug-
gesting their role in signaling mechanism via protein phosphorylation (Martin et al.
1993). The second category encodes cytoplasmic proteins with leucine-rich repeats
(LRR), leucine zippers (LZ) and nucleotide binding sites (NBS) suggesting a model
role for these molecules in intracellular signaling (Ori et al. 1997). The third cate-
gory is very similar to the second class but in addition to LRR and NBS these R gene
products contain N-terminal homology to Toll and the interleukin receptors (TIR) in
Drosophila and mammals, respectively (Parker et al. 1997). Genes in the fourth
category encode extracytoplasmic LRRs protein with membrane anchors and short
C-terminal cytoplasmic tails. The fifth categories of R genes encode proteins with a
clear extracellular LRR domain and an intracellular serine/threonine kinase domain
(Song et al. 1995).
Avirulent (Avr) genes have dual functions namely pathogens containing Avr
genes that are avirulent to plants carrying the matching R genes, while they are
virulent in race, strain, pathovar or species-specific manner to plants without carrying

the matching R genes. Selection pressure exerted by virulent pathogens on host
plants might have resulted in the co-evolution of these R genes. Since R gene medi-
ated resistance requires a corresponding avr gene, this resistance is also considered
as gene-for-gene resistance. Triggering defense of responses by R genes occurs
much faster than the responses to virulent pathogens and this leads to an effective
expression of resistance. Several alterations in cellular metabolism occur as an
outcome of R-avr binding, which finally results in the expression of resistance.
The following are the alterations:
7.3.2.1 Cell Wall Fortification
Formation of new cell wall material adjacent to the site of infection in plants is an
important defense response to pathogen penetration. These cell wall appositions
(papillae) can occur even before the pathogen passes through the cell wall (Soylu
et al. 2005). Callose offers defense against many pathogenic fungi and is manifested
at the stage of penetration by the formation of papilla (Böhlenius et al. 2010).
Silencing of callose synthase genes in Arabidopsis was to bring about a higher
penetration rate of the pathogen Hyaloperonospora parasitica. Reduction in cellu-
lose biosynthesis induces production of phytohormones, jasmonic acid (JA),
salicylic acid, and ethylene which enhances pathogen resistance, and leads to
changes in cell wall composition/structure, as well as causing ectopic lignin produc-
tion (Hamann et al. 2009).
7.3.2.2 Phytoalexin Synthesis
Pathogen attack on specific host or diversified hosts that results in the synthesis of
protective compounds (phytoalexins) which include a range of phenolics, terpe-
noids, hydroxycoumarins and hydroxycinnamate conjugates (Karou et al. 2005).
7.3.2.3 Oxidative Burst and Antioxidative Enzyme System
Studies related with the role of reactive oxygen species (ROS) during plant–pathogen
interaction have been carried out in all kinds of interactions including in hemibio-
trophic interaction (Shetty et al. 2007), necrotrophic interaction and biotrophic
interaction (Romero et al. 2008).
During host–pathogen interaction production of ROS (mostly O2, H2O2 and HO)
at the cell surface called the ‘oxidative burst’ is the earliest event (Mendoza 2011)
(Table 7.1). ROS plays a critical role in inducing tolerance by activating or inducing
stress response related factors, such as mitogen-activated protein kinases (MAPKs),
transcription factors, antioxidant enzymes, dehydrins, and low temperature induced
shock, and pathogenesis-related proteins (Yoshioka et al. 2001). The primary
Table 7.1 Plant system generating ROS when challenged with various pathogens elicitors
Plant Pathogen AOS observed
Hordeum vulgare Blumeria graminis H2O2
Lycopersicum esculentum Fusarium oxysporum H2O2
Mimosa pudica Ergosterol O2
Cicer arietinum Fusarium oxysporum H2O2
Arabidopsis thaliana Botrytis cinerea H2O2
Nicotiana tabacum Botrytis cinerea H2O2
Arabidopsis thaliana Fusarium oxysporum H2O2
Arabidopsis thaliana Colletotricum lindemuthianm H2O2
Phaseolus vulgaris C. lindemuthianum H2O2
Brassica spp. Alternaria brassicae H2O2
Bean C. lindemuthianum H2O2
Soybean Verticillium dahliae H2O2
Cotton Verticillium dahliae H2O2
Tomato Cladosporium fulvum H2O2 and O2
Rice N-Acetylchito-Oligosaccharides H2O2, O2 and OH
Tobacco Phytophthora crytogea, pure H2O2, O2 and OH
cryptogein and capsicein
protein elicitor
Rose Phytophthora sp., crude cellwall H2O2 and O2
preparation
Cucumber Phytopthora sojae H2O2
Parsley Rhizosphaera kalkhoffii H2O2
Soybean Pseudomonas syringae H2O2
Arabidopsis thaliana Protein elicitor harpin H2O2 and O2
response to elicitors is indicated by changes in membrane permeability and activa-

tion of specific ion channels leading to the influx of Ca2+ and H+ and the efflux of
Cl− and K+ (Cervone et al. 1997) and the production of ROS, sequentially followed
by defense gene activation and phytoalexin accumulation (Jabs et al. 1996). Out of
two oxidative bursts occurring in plant–pathogen interactions, the first phase, which
occurs within a few minutes of encounter with the pathogen, is a general response
observed in both compatible and incompatible plant–pathogen interactions. The
second oxidative burst that is observed 3–6 h after the first one is characteristic of
incompatible interactions and correlates with the expression of resistance. Cell wall
located enzymes have been proved to be responsible for apoplastic ROS overexpres-
sion in sunflower or rape. They induced an increase in H2O2 levels following patho-
gen inoculation compared with wild-type plants (Dong et al. 2008). Pathogen
induced oxidative burst is known to involve the expression of enzymes like NAD(P)
H oxidase, peroxidase, oxalate oxidase and lipoxygenase. NAD(P)H oxidase
brought about the generation of AOS in soybean suspension cultures treated with an
elicitor from Phytophthora sojae (Mithofer et al. 1997).
Plants posses very efficient enzymatic (superoxide dismutase, SOD (EC 1.15.1.1);
catalase, CAT (EC 1.11.1.6); ascorbate peroxidase, APX (EC 1.11.1.11); glutathione
reductase, GR (EC 1.8.1.7); monodehydroascorbate reductase, MDHAR (EC 1.6.5.4);
dehydroascorbate reductase, DHAR (EC 1.8.5.1); glutathione peroxidase, GPx (EC

1.11.1.9); guaiacol peroxidase, GPX (1.11.1.7) and glutathione-S-transferase, GST
(EC 2.51.18) and non-enzymatic systems such as ascorbic acid, ASH; glutathione,
GSH; phenolic compounds, alkaloids, non-protein amino acids, and antioxidant
defense systems which work to control the cascades of uncontrolled oxidation and
protect plant cells from oxidative damage by scavenging of ROS (Shao et al. 2008).
SOD plays an important role in first line of defense, it converts superoxide radicals into
hydrogen peroxide and oxygen which is less toxic to plant cell whereas CAT, APX and
POD convert these hydrogen peroxide into water to nullify the toxic effect of ROS.
Pathogen infection also leads to an increase in the antioxidant enzymes, SOD
and guaiacol-dependent peroxidase (GDP) in Brassica variety HC1 (Joshi et al.
2010). Botryosphaeria berengriana f. sp. piricola (BBP) and Monilinia fructigena
(MFH) inoculated pear calli showed significantly increased antioxidant enzymes
SOD, POD and CAT and expression of their isozymes were also increased as com-
pared to control (Zhao et al. 2012).
Researchers have indicated that the resistance inducing chemicals can improve
resistance in all of the sunflower genotypes to downy mildew and increase enzyme
activities of peroxidase and polyphenol oxidase, as well as accumulation of mRNAs
of glutathione S-transferase, defensin and catalase. The activity of SOD and guaia-
col peroxidase (GPX) increased in the mungbean yellow mosaic India virus
(MYMIV) infected and SA treated Vigna mungo plants when compared with con-
trol (Kundu et al. 2012).
Tomato defense genes, such as PR-1, β-1, 3-glucanase (GLU), polyphenol oxi-
dase (PPO), peroxidase (POD), and SOD, were rapidly and significantly up-
regulated by exogenous ABA treatment. There was a significant increase in the
activities of defense enzymes like phenylalanine ammonia lyase, peroxidase and
β-1, 3-glucanase on two chemical elicitors (acibenzolar-S-methyl benzo-[1,2,3]–
thiadiazole-7-carboxylic acid S-methyl ester) and salicylic acid treatments in tea
leaves challenged with the blister blight disease caused by Exobasidium vexans
pathogen than on unchallenged leaves (Ajay and Baby 2010).
Antioxidants have different types of isozymes and the purpose of isozymes is to
allow fine adjustment of metabolism for the proper functioning during any type of
stress. Numerous reports have demonstrated the relationship between the expres-
sion pattern of POD isozymes and their different antifungal abilities. High intensi-
ties of SOD, POD and PPO isozymes in RM (mixture of riboflavin and Methionine)
pretreated and powdery mildew (Sphaerotheca fuliginea) infected cucumber plants
clearly indicated an important host defensive mechanism against the infection (Nam
2008).
7.3.2.4 PR Protein Synthesis
The pathogenesis-related (PR) proteins are synthesized in response to pathogens.

Currently 17 families of inducible pathogenesis-related proteins have been recog-
nized (Van Loon et al. 2006) (Table 7.2). PR-2 family is identified as β-1,
3-endoglucanases and the PR-3,-4,-8 and -11 ad endochitinases which act against
Table 7.2 Families of pathogensis-related proteins in plants and their functions

Molecular mass
Family Type member Function range (kDa)
PR-1 Tobacco PR-1a Unknown 15–17
PR-2 Tobacco PR-2 β-1,3-glucanase 30–41
PR-3 Tobacco P, Q Chitinase type-I, II, 35–46
IV, V, VI, VII
PR-4 Tobacco ‘R’ Chitinase type I, II 13–14
PR-5 Tobacco ‘S’ Thaumatin-like 16–26
PR-6 Tomato Inhibitor I Proteinase-inhibitor 8–22
PR-7 Tomato P69 Endoproteinase 69
PR-8 Cucumber chitinase Chitinase type III 30–35
PR-9 Tobacco ‘lignin-forming Peroxidase 50–70
peroxidase’
PR-10 Parsley ‘PRI’ Ribonuclease like 18–19
PR-11 Tobacco ‘class V’ chitinase Chitinase, type I 40
PR-12 Radish Rs-AFP3 Defensin 5
PR-13 Arabidopsis THI2.1 Thionin 5–7
PR-14 Barley LTP4 Lipid-transfer protein 9
PR-15 Barley OxOa (germin) Oxalate oxidase 22–25
PR-16 Barley OxOLP Oxalate-oxidase-like 100 (Hexamer)
PR-17 Tobacco PRp27 Unknown Not known
Source: Modified from Van Loon et al. (2006)
bacterial and fungal pathogens, respectively. The chitinases as well as proteinase

inhibitors (PR-6) have been reported to target nematodes and herbivorous insects.
Members of the PR-8 family show lysozyme activity and are directed against bacte-
rial pathogens, whereas defensins (PR-12) and thionins (PR-13) have broad antibac-
terial and antifungal activities. Some lipid-transfer proteins (PR-14) have antifungal
and antibacterial activities and members of PR-1 thaumatin-like PR-5 families have
been associated with activity against oomycetes. PR-7 is an endoproteinase that is
the most conspicuous PR in tomato. PR-9 is a specific peroxidase that is thought to
act in cell wall reinforcement by catalyzing lignification. PR-10 shows homology to
ribonucleases and is thought to play a role in resistance against viral pathogens
PR-15 and -16, comprise families of germin like oxalate oxidases and SODs respec-
tively. PR-17 proteins have been found in infected tobacco, wheat and barley and
contain sequences resembling the active site of zinc-metalloproteinases. A putative
novel family (PR-18), which comprises of fungus and SA-inducible carbohydrate
oxidases has been reported from sunflower (Custers et al. 2004).
7.3.2.5 Signal Transduction Leading to Expression

of Defense Response Genes
Interconnected signaling pathways operate within the infected plant cells and this
leads to expression of defense genes and intermediates include molecules like SA,
JA, and ET (Von Dahl and Baldwin 2007). Other plant hormones, including ABA,
brassinosteroids and auxin, have been implicated in plant defense, but their significance
is less studied. Genetic dissection of the signaling pathway using mutants showing
alteration in defense responses has led to the identification of signaling components
and their interactions.
7.3.2.6 SA Signaling Pathway
Salicyclic acid (SA) plays an important signaling role in the activation of plant
defense response due to pathogenic invasion, including both systemic (termed
systemic acquired resistance) and localized responses usually characterized by
HR. The role of SA in signal transduction has been studied by genetic dissection of
the pathway using mutants. Some mutants show constitutive expression of PR
genes, enhanced SA accumulation (cpr1, cpr5, cpr6) and spontaneous lesion forma-
tion similar to those observed during expression of a hypersensitive response.
Several potential components of the SA signaling pathway initially were identified
and cloned in tobacco including the bZIP transcription factors (Zhou et al. 2000).
The bZIP transcription factors bind to SA-responsive elements in the promoters of
defense genes, primarily those of pathogenesis-related or PR genes. This coupled
with increasing genetic and biochemical crosstalk between SA-, ethylene and
JA-associated defence pathways, underlie the crucial significance of salicylic acid
signalling in plant resistance (Pedley and Martin 2003).
7.3.2.7 JA Signaling Pathway
Jasmonic acid (JA) is a lipid-derived hormone that plays an important regulatory

role in various features of plant development and defense. In tomato, gene coding
for leucine aminopeptidase, coronatine-insensitive 1 (COII) and allene oxide
cyclase (AOC) are crucial in the proper functioning of JA signaling. Leucine modu-
lates immunity against herbivores by inducing wound responsive genes and acting
downstream of JA (Fowler et al. 2009). However, induction of the gene can be
observed upon local and systemic wounding or treating with JA and system in or
glucose, suggesting temporal regulation of JA biosynthesis (Stenzel et al. 2008).
7.3.2.8 ET Signaling Pathway
Role of ethylene in defense can be said as dual since it has been implicated as both
a signal molecule during plant resistance and a virulence factor that can lead to
pathogenesis, symptom expression and plant susceptibility (Chagué et al. 2006).
There, ethylene is thought to have differential effects during plant defense in differ-
ent pathosystems. Regulation and control of events during ethylene signaling
mostly happen at the level of ethylene biosynthesis. In tomato, key genes in
ethylene biosynthesis have been cloned and described, including those encoding
1-amincyclopropane carboxylic acid (ACC) oxidase and ACC synthase. However,

emerging data show that regulation occurring at the level of ethylene receptors is
also important. Ethylene biosynthesis shows interplay with certain MAP kinase
cascades (Kim et al. 2003b) demonstrates the undeniable role of ethylene during
plant defense.
7.3.2.9 ABA Signaling Pathway
More recently abscisic acid (ABA) was shown to play role in pathogen-associated
defense responses. Exogenous application of ABA was seen to increase susceptibil-
ity of plants to pathogens, suggesting that ABA is a negative regulator of defense
responses. Mutants affected in ABA synthesis (aba1-2, aba2-1) or ABA signaling
(abi1-1, abi2-1) displayed enhanced resistance to pathogen and also an expression
of JA/ET responsive genes (PDF1.2). ABA signaling therefore appeared to antago-
nize the JA-ET signaling pathway. However, ABA was seen to bring about enhanced
resistance to pathogens through rapid callose deposition during early stages of
infection in Arabidopsis–Alternaria interactions (Ton and Mauch-Mani 2004).
7.3.2.10 Cross Talk
Cross talk between pathways provides a regulatory potential for activating multiple
resistance mechanisms in varying combinations and may help the plant to prioritize
the activation of particular defense pathways thereby providing optimal defense
(Pieterse et al. 2001). Global expression-profiling studies provided ample evidence
that SA, JA, and ET pathways interact, either positively or negatively (Mur et al.
2006). SA-mediated suppression of JA-inducible gene expression is blocked in
mutant npr1 plants, demonstrating a crucial role for NPRI in the cross talk between
SA and JA signaling. WRKY transcription factors are important regulators of
SA-dependent defense responses. ET was shown to enhance the response of
Arabidopsis to SA, resulting in a potentiated expression of the SA-responsive
marker gene PR-1 (De Vos et al. 2006).
7.3.2.11 Induced Resistance
Induced resistance is not based on direct defense activation by the inducing agent,
but on a faster and stronger activation of inducible defense mechanism once the
plant is exposed to the pathogen. This enhanced capacity to express basal defense
mechanisms is called sensitization, potentiation, or priming. Elicitors of biotic (glu-
cans, proteins, lipids, etc.) and abiotic origin, signaling intermediates like SA, JA,
ET, ABA, as well as other chemicals like the non-protein amino acid β-aminobutyric
acid (BABA) were also shown to induce resistance in many plants against various
pathogens (Cohen 2002). Different types of induced resistance and their mechanism
are as follows.
Pathogen-Induced Resistance. Induced resistance is often activated after primary
infection with a necrotizing pathogen and renders the distant, uninfected plant parts
more resistant towards a broad spectrum of virulent pathogens including viruses,
bacteria and fungi (Durrant and Dong 2004; Heil and Ton 2008). This form of
induced resistance is often referred to as SAR and has been demonstrated in many
plant–pathogen interactions (Sticher et al. 1997) mediated through SA accumulation.
SA has an important role in signaling pathogen leading to ISR. After infection,
endogenous levels of SA increase locally and systemically. The identity of the long
distance signals that travels from the site of primary infection to the remote parts of
the plant to induce PR gene expression and SAR, however is still unclear (Grant and
Lamb 2006). Over the past few years, several other signaling molecules have
emerged as possible candidates for the endogenous long distance signal for
SAR. These include methyl salicylate (MeSA), glycerolipids (Chaturvedi et al.
2008), azeleic acid, and glycerol-3-p (Chanda et al. 2011).
The exact nature of the systemic SAR signal in Arabidopsis (Arabidopsis thali-
ana) after localized infection by avirulent Pseudomonas syringae remains complex
and has been a matter of debate. In tobacco, SAR activation by the primary patho-
gen resulted in a significant reduction of disease symptoms caused by the fungi
Phytophthora parasitica, Cercospora nicotianae and Peronospora tabacina.
Resistance Induced by Non-pathogenic Organisms. ISR was first described in leaves
of Arabidopsis plants that were subjected to prior inoculation of roots with non-
pathogenic Pseudomonas fluorescens strain WCS 417r. Subsequently researchers
have shown that specific strains of PGPR not only improve plant growth, but also
induce ISR against a wide range of pathogens (Baker et al. 2003).
Interaction of plants with beneficial microorganisms other than those causing
ISR can also result in systemic, broad-spectrum resistance. The symbiosis between
barley roots and the endophytic basidiomycete Piriformospora indica confers sys-
temic resistance to the necrotrophic root-rot fungus Fusarium culmorum and the
biotrophic fungus Blumeria graminis f. sp. hordei (Waller et al. 2005). Systemic
resistance induced by the endophytic fungus Trichoderma asperellum T34 protected
Arabidopsis against a wide range of pathogens through engagement of the same
signaling components as used in Pseudomonas fluorescens (Strain WCS417r)-
mediated ISR. Transcript profiling of the shoots of Medicago truncatula plants
whose roots had been colonized by the arbuscular mycorrhizal fungus Glomus
intraradices revealed both systemic expression of various defense associated genes
and establishment of an IR response to the bacterium Xanthomonas campestris pv.
alfalfa (Liu et al. 2007).
Resistance Induced by Exogenous Application of Signaling Intermediates and other
Chemicals. Exogenous application of signaling intermediates like SA, JA and ET
and their derivatives as well as other chemicals like the non-protein amino acid
BABA were seen to induce resistance in plants against a variety of pathogens. These
chemicals did not show any antimicrobial activity in vitro, but activated plant
defense responses which led to the expression of resistance.
7.3.2.12 SA and SA Analogues
Salicylic acid plays a critical signaling role in the activation of disease resistance in
plants. Exogenous application of SA induced resistance in tomato against tomato
stem canker disease. Also foliar application of low concentration of SA induced
priming in lettuce (Lactuca sativa) plants against pill-bugs (Armadillidium vulgare)
(Nancy et al. 2011). SAR-like state of enhanced disease resistance can be induced
without an HR in plants by treatment with solutions of SA or certain other chemi-
cals. SA could induce systemic protection against Botrytis elliptica in lily cv. Star
Gazer, and that is one of the few cases of SA-induced disease resistance demon-
strated in monocots. Exogenous application of 200 mM salicylic acid through root
feeding and foliar spray induced resistance against Fusarium oxysporum f. sp. lyco-
persici (Fol) in tomato (Mandal et al. 2009). Similarly exogenous application of SA
or its analogs on plants has been shown to induce SA-mediated plant defenses to a
broad range of pathogens. The effect of two chemical elicitors acibenzolar-S-methyl
benzo-(1,2,3)-thiadiazole-7-carboxylic acid S-methyl ester and salicylic acid
showed inducing resistance in tea plants against blister blight disease caused by
Exobasidium vexans.
SA analog ASM was reported as induces of SAR in many plant–pathogen inter-
actions like, pepper-Phytophthora capsici, tomato-Xanthomonas euvesicatoria,
cyclamen-Fusarium oxysporum f.sp. cyclaminis and tobacco-Peronospora tabaci
(Perez et al. 2003). Application of BTH also induced resistance in a number of
plants such as wheat, cotton, tomato, pea, tobacco and Arabidopsis (Kohler et al.
2002) against a variety of pathogens. BTH treatment protected melon seedlings
against two soil-borne pathogens Didymella bryoniae and Sclerotinia
sclerotiorum.
7.3.2.13 JA and Related Compounds
Genes in the biosynthetic pathway of JA namely lox 1 and lox 2 (encoding two
liposygenases) were activated on exogenous application of JA. Treatments with
methyl jasmonate, the methyl ester of jasmonic acid, induce the accumulation of
alkaloid compounds in jaborandi leaves (Pilocarpus microphyllus) and phytoalex-
ins in Cupressus lusitanica cell cultures (Zhao et al. 2004). In grapevine, MeJA has
been shown to stimulate deposition of callose and accumulation of PR proteins in
leaves. Belhadj et al. (2006) showed that MeJA treatment of grapevine in the vine-
yard induces the production of stilbene phytoalexins, the accumulation of PR pro-
tein related RNAs, and triggers enhanced resistance to Erysiphe necator. Moreover,
jasmonic acid pathway was found to contribute to the sulfated laminarin-induced
resistance against Plasmopara viticola (Trouvelot et al. 2008).
7.3.2.14 Ethylene
Ethylene is involved in the activation of plant defense-related processes such as the

production of PR proteins, and phytoalexins. Diaz et al. (2002) demonstrated that
ethylene pre-treatment of tomato plants resulted in an increased resistance to
Botrytis cinerea. Recently Belhadj et al. (2008) showed that ethephon treatment of
grapevine foliar cutting triggers enhanced resistance to Erysiphe necator by induc-
ing expression of various PR protein genes and the production of stilbenes. In
transgenic pepper seedlings overexpressing endogenous P R 10 or esterase genes,
which are induced by the ET treatment, completely resisted the infection, which
corroborated the importance of these genes in the defense response (Nunez-
Pastrana et al. 2011).
7.3.2.15 Abscisic Acid
Exogenous application of Abscisic acid (ABA) prior to inoculation increased the

susceptibility of tomato, Arabidopsis or grapevine when inoculated by various
pathogens indicates the role of ABA as a negative regulator of plant defense
responses. Susceptibility of tomato plants to Botrytis cinerea was enhanced by ABA
treatment (Audenaert et al. 2002) and a high ABA concentration was observed in
grapevine shoots with Pierce’s disease symptoms compared to healthy shoots. In
contrast exogenous application of ABA prior to inoculation induced resistance
against necrotrophic pathogens in Arabidopsis. Exogenous ABA also enhanced dis-
ease resistance against A. solani infection in tomato (Song et al. 2011).
7.3.2.16 Probenazole
Probenazole and its active metabolite 1, 2-benzisothiazole-1, 1-dioxide induces

SAR by triggering signaling at a point upstream of SA accumulation. Probenazole
(PBZ) is the active ingredient of Oryzemate, an agrochemical which is used for the
protection of rice plants from Magnaporthe grisea (Iwai et al. 2007). Probenazole
has been used as practical crop protectant in wet land rice cultivation to control blast
fungus (Yoshioka et al. 2001).
7.3.2.17 β-Aminobutryic Acid
Various amino acids have been shown to induce resistance in plants (Kuc 2001).
Among these, the non-protein amino acid β-aminobutyric acid (BABA) has received
a lot of attention. The compound was shown to be a potent inducer of resistance
against abiotic stress and microbial pathogens (Cohen 2002). BABA-protected
potato plants against Phytophthora infestans, especially when applied early in crop
development and also provided some protection in tubers against late blight
(Altramiranda et al. 2008).
Table 7.3 Plants exhibiting β-aminobutryic acid (BABA) induced resistance against viral,
bacterial, fungal and nematode pathogen
Plant Pathogen
Potato Phytophthora infestans, Alternaria solani
Tomato Phytophthora infestans, Botrytis cinerea, Fusarium oxysporum f. sp.
lycopersici, Meloidogyne javanicum, Clavibacter michiganensis
Tobacco Peronospora tabacina, Phytophthora parasitica var. nicotianae,
Tobacco mosaic virus
Pepper Phytophthora capsici, Colletotrichum coccodes
Melon Pseudoperonospora cubensis
Arabidopsis Peronospora parasitica, Botrytis cinerea, Pseudomonas syringae
Cauliflower Peronospora parasitica
Broccoli Alternaria brassicicola
Sunflower Plasmopara halstedii
Lettuce Bremia lactucae
Maize Fusarium moniliforme
Pearl millet Sclerospora graminicola
Pea Aphanomyces euteiches
Peanut Cercosporidium personatum
Grapes Plasmopara viticola
Cotton Verticillium dahliae
Sweet orange fruit Penicillium spp.
BABA action was seen to be mediated through signaling intermediates like SA

and JA. BABA treatment led to an increase in SA levels and SA-induced PR pro-
teins like PR-1 in pepper plants infected with Phytophthora capsici and in tobacco
plants infected with TMV (Siegrist et al. 2000).
In BABA-treated apple plants priming is associated with the production of
phenolics, peroxidase, callose, lignin and other defense reactions against pathogen
(Table 7.3). Exogenous application of BABA primed a rapid increase in peroxidase
activity within 24 h in Jute against Macrophomina phaseolina (Ray et al. 2011).
Various cellular defense responses are induced following attack by either patho-
gens or insects or in response to abiotic stress. Various natural and synthetic chemi-
cals are involved to induce priming in plants. Microarray analysis revealed that 22
genes were significantly up-regulated in BABA-treated Arabidopsis at 22 h
post-inoculation with Pseudomonas syringae pv. tomato DC3000. The primed state
in Arabidopsis (Arabidopsis thaliana) was still functional in the next generation
without additional treatment (Slaughter et al. 2012).
7.3.2.18 Transcription Factors
Elicitors or pathogen activated transcription factors play an important role in con-

trolling defense gene expression and plant resistance responses. Five major families
of plant transcription factors (bZIP, WRKY, MYB, EREBF, and homeodomain pro-
teins) have been shown to participate in the regulation of plant defense responses
(Rushton and Somssich 1998). Several members of various transcription factor

families such as TGA-bZIP, ERF, Myb, Whirly and WRKY, are shown to be linked
with plant defense responses and specific gene regulation (Desveaux et al. 2005).
Many transcription factors involved in JA and ET signal transduction are members
of the AP2/ERF group and SA signal transduction involves mostly WRKY and
bZIP members. Transcription of the genes encoding these transcription factors can
be either up or down regulated by the treatments.
AP2/ERF Transcription Factors. AP2/ERF transcription factors are characterized
by a 58- to 60-amino acid DNA-binding domain first identified in APETALA2
(AP2) and the ethylene-response factors (ERF). In Arabidopsis the subgroup of
AP2/ERF transcription factors that are rapidly induced by JA is known as
Octadecanoid-responsive Arabidopsis AP2/ERF (ORA). This indicates that
Arabidopsis AP2/ERF transcription factors can be divided into a group that inte-
grates JA and ET pathways to activate defense gene expression, a group that selec-
tively represses JA-responsive genes, and a group that induces gene expression
through ER only. Phosphorylation can be important for AP2/ERF transcription
factor activity was also shown for the rice AP2/ERF transcription factor. Ethylene-
responsive element binding protein (OsEREBP1) after phosphorylation showed an
enhanced binding to GCC-boxes (Cheong et al. 2003).
MYB Transcription Factors. Plants have very large MYB (myeloblastosis) families;
for example, Arabidopsis contains 125 MYB genes. Most plant MYB factors belong
to the R2R3 group, which is divided in two types that can bind different DNA
sequences. Type I binds the DNA sequence (T/C)AAC(T/G)G, while type II binds
to G(G/T)T(A/T)G(G/T)T. In Arabidopsis, only a few R2R3-MYB proteins are
involved in defense-related pathways. Defense responses regulated by MYB
transcription factors seem to cover all signaling pathways and act against many
types of pathogens. MYB transcription factors also play a role in the defense
response against insects (De Vos et al. 2006).
bZIP Transcription Factors. bZIP transcription factors are characterized by their
basic leucine zipper (bZIP) domain. Two of the ten groups of bZIP transcription
factors in Arabidopsis have been implicated to play a role in plant innate immunity.
AtbZIP10 is controlled by Lesions simulating disease resistance 1 (LSD1), a plant-
specific zinc-finger protein that negatively regulates cell death by inhibiting nuclear
translocation of AtbZIP10. BZI-1 transcription is up-regulated in response to
pathogen attack and pathogen-induced phosphorylation of BZI-1 related proteins
has been described (Kuhlmann et al. 2003).
WRKY Transcription Factors. WRKY proteins are recently identified as a class of
DNA-binding proteins that recognize the TTGAC(C/T) W-box elements found in
the promoters of a large number of plant defense-related genes. In plants, many
WRKY proteins are involved in the defense against attack by phytopathogens such
as bacteria (Deslandes et al. 2002; Dong et al. 2003), and fungi (Kalde et al. 2003).
Plant resistance to pathogens can be classified into two main types from the
breeding point of view. Vertical resistance or race-specific, pathotype-specific
resistance is generally determined by major genes (R genes) and is characterized by

pathotype-specificity. Race-specific resistance is usually expressed in a quantitative
manner and is often highly effective against a given race. It is usually determined by
one or a few genes, which makes it easier to work within a breeding programme.
However it may have certain disadvantages from the epidemiological and durability
point of view since the pathogen may evolve new pathogenicity genes which are not
counteracted by the existing R genes.
Horizontal resistance on the other hand is generally controlled by polygenes and
is pathotype-non-specific. Horizontal resistance does not prevent the development
of symptoms of the disease, but it slows down the rate of spread of the disease in the
population. It is mostly inherited polygenically and is more difficult and time con-
suming to incorporate into breeding programs. However the selection pressure lead-
ing to evolution of new races of pathogen is considerably reduced in breeding for
improved horizontal resistance.
Induced resistance may be considered as a type of horizontal resistance. It can be
induced in plants irrespective of their genetic background and the presence of resis-
tance genes. The fact that pathogens cannot overcome horizontal resistance due to
its polygenic nature makes it an attractive option to breeding for disease resistance.
Induced resistance not only diminishes the use of toxic chemicals for disease
control but offers an alternative, long-lasting, non-biocidal and eco-friendly
approach for plant protection and thus contributing to the development of sustain-
able agriculture.
7.4 Plant Diseases
Since times immemorial it is known that humans are dependent on plants for food,
fiber, shelter, drugs and others. Further plants are also important because they utilize
CO2 in photosynthesis and release O2. Numerous diseases are produced by bacteria,
viruses, mycoplasma, fungi, nematode, insects and others. An example of the
greater impact on human existence is by the late blight of potatoes caused by
Phytophthora infestans in the year 1845 that lead to Irish famine in Ireland. Similarly
coffee rust in Ceylon (Sri Lanka) and leaf spot of rice in India have caused huge
losses in respective crop yields. This is followed by Plasmopara viticola which
causes downy mildew of grapes and threatened the wine industry in France. Apple
scab caused by Venturia inaequalis first reported in 1819 in Sweden has played
havoc with apple cultivation in the Kashmir valley during 1973. Panama disease of
banana, wilt disease of pigeon pea, castor, guava and also smut and rust of cereals
have become challenges to plant pathologists. However, the chance discovery of
Bordeaux mixture by PA Millardet in France made a beginning to the chemical
control of plant diseases. In due course of time major diseases could be controlled
employing fungicides, integrated disease management (IDM), biocontrol agents,
breeding for resistance and several other methods. Unfortunately the diseases of
minor nature not only have become major diseases but posing a threat to crop
productivity. Newly emerging fungal, viral, mycoplasmal, bacterial, nemotode and

insect pests are posing serious threats to crops and challenges to phytopathologists.
The phytopathologists have to protect the environment and also have to ensure the
safety and security of farmers in the field by making concerted and concentrated
efforts to minimize crop losses due to fungi and other microbes. Several diseases
listed in Table 7.4 clearly indicate that epidemics and plant diseases result in crop
loss which in turn results in hunger, poverty and death of people besides dwindling
of economy. Wheat rusts have caused heavy losses in wheat and posed serious threat
to wheat production world over.
Table 7.4 Important crop diseases caused by pathogenic fungi

Crop Disease Pathogen
Rice Blast Magnaporthe grisea
Leafspot Helminthosporium oryzae
Wheat Rusts Puccinia graminis f. sp. tritici, P. striiformis
f. sp. tritici, P. recondita
Smuts Ustilago tritici
Karnal bunt Neovossia indica
Foliar blight Alternaria tritici
Pearl millet Downy mildew Sclerospora graminicola
Ergot Claviceps fusiformis
Smut Tolyposporium penicillariae
Sorghum Grain mold Sphacelotheca sorghi
Corn Stalk rot Macrophomina phaseolina, Fusarium
graminearum
Head smut Sphacelotheca cruenta
Pigeonpea Wilt Fusarium udum
Blight Phytophthora drechsleri f.sp. cajani
Chickpea Ascochyta blight Ascochyta rabiei
Pea Powdery mildew Erysiphe polygoni
Potato Late blight Phytophthora infestans
Black wart Synchytrium endobioticum
Groundnut Leafspot Cercospora arachidicola, Cercosporidium
personatum
Rust Puccinia arachidis
Root rot Aspergillus flavus
Mustard White rust Albugo candida
Mango Mango malformation Complex disease with many pathogens, mainly
Fusarium moniliforme var. subglutinans
Banana Sigatoka disease Mycosphaerella musicola (yellow sigatoka),
Mycosphaerella fijiensis (black sigatoka)
Guava Wilt Fusarium oxysporum f. sp. psidii
Apple Scab Venturia inaequalis
Tea Blister blight Exobasidium vexans
Coconut Budrot Phytophthora palmivora
Wilt Ganoderma lucidum
(continued)

Crop Disease Pathogen
Sugarcane Redrot Colletotrichum falcatum
Smut Ustilago scitaminea
Cotton Wilt Fusarium oxysporum f. sp. vasinfectum
Tobacco Blackleg Phytophthora nicotianae
Ginger Rhizome rot Pythium aphanidermatum
Coffee Rust Hemileia vastatrix
Rubber Leaf fall Phytophthora palmivora
Pink disease Pellicularia salmonicolor
Jute Stalk rot Macrophomina phaseolina
Black pepper Wilt Phytophthora sp.
Grapes Downy mildew Plasmopara viticola
Flax Rust Melanospora lini
Dutch elm Wilt Ophiostoma ulmi
Chilly Anthracnose Colletotrichum capsici
Cabbage Club root Plasmodiophora brassicae
7.4.1 Plant Diseases and Their Impact
Millets are grown on 35.5 million hectares in the world resulting in the production
of 28.5 million tonnes. Millets are important in the arid and semi-arid regions and
offer some promise of food security to humans and livestock. Millets include pearl
millet, sorghum, finger millet, foxtail millet, little millet, etc. However, pearl millet
and sorghum are the most important and nutritionally valuable. Downy mildew,
rusts, blast, smut, ergot, foliar diseases, soil/seed/root-borne diseases have resulted
in huge losses both at field site, in the market and storage. The future challenges
include effective monitoring of the pathogen, use of DNA markers in the character-
ization of virulence besides there is a need to develop near isogenic R-lines with
different R-genes and also identification of new resistant genes.
Fruits form an important component in our daily diet as they provide sugars,
vitamins, minerals and medicinally important compounds such as flavonoids which
prevent cancer and heart related diseases. Fruits suffer from various diseases and
contamination caused by fungi and other microbes both at pre-harvest and post-
harvest stages. Unfortunately still we have yet to find new techniques and fungicide
formulations to control several fruit diseases including bunch rot of grapes (Botrytis
cinerea), apple scab (Venturia inaequalis), wilt of guava (Fusarium solani), Panama
disease of banana (Fusarium cubense), mango malformation (F. moniliforme), blue
mold of citrus (Penicillium citrinum), anthracnose of papaya (Colletotrichum
papayae) and others. The overall post-harvest losses range from 5 to 15 % world
over. Further there are no scientifically developed storage godowns/houses/containers
in many countries.
The management practices of fungal pathogens of fruit crops include cultural
practices, hot water treatment, hot vapour exposure, ionizing irradiation, UV
illumination, wrapping in disease resistant paper impregnated with sodium ortho-

phenyl butyrate and sodium metabisulphite, use of volatile compounds, coating
with oil, waxes and colloidal solution, biocontrol agents, use of botanicals as anti-
fungal agents, use of gels and latex derived from plants, inducing resistance, grow-
ing disease resistant varieties, host defense through gene silencing and others
(Arya 2010; Tripathi 2005).
Wheat is an important cereal crop and is cultivated worldwide and requires 40 %
increase to meet global food requirements. Various diseases associated with wheat
are the important limiting factor in its productivity. Fungal diseases include
Fusarium head blight, wheat rusts (stem rust, leaf rust, yellow rust), Karnal bunt and
powdery mildew cause heavy losses in yield and quality. The development of resis-
tant varieties is the only solution to overcome this problem. Chemical treatment
with triazole, cultural practices, removal of alternate and collateral hosts and others
are the methods used to control rust disease. Control of Karnal bunt involves cul-
tural practices, sowing of disease-free seeds and use of resistant varieties etc. (Arya
and Perello 2010).
Sugarcane is one of the cash crops grown worldwide and contributes 70 % of
world sugar. This commercial crop is attacked by fungi, viruses, bacteria, myco-
plasma, nematodes, insects etc. The most challenging fungal diseases which cause
huge losses in the crop yield include whip smut (Ustilago scitaminea), rust (Puccinia
melanocephala), red rot (Glomerella tucumanensis, Colletotrichum falcatum), eye
spot (Bipolaris sacchari), Fusarial rot (Fusarium moniliforme) and others. The
quantitative and qualitative losses due to above fungal diseases can be minimized
using resistant varieties, fungicide (mancozeb, metalaxyl, carboxin), thermother-
apy, biocontrol, maintaining soil health and minimum fertilizer application.
Pulses form an important source of protein since time immemorial besides being
of multiple utility as human food, animal feed and soil health. Chickpea, pigeon
pea, green gram, black gram, lentil and pea are the pulse crops grown in different
parts of the world. The challenging diseases include wilt, root rot, Ascochyta blight,
Phytophthora blight, leafspot, mildews, rust, anthracnose and others which limit
yields. IDM is an eco-friendly approach which suppresses the pathogen and seems
to be the right approach to mitigate the huge losses incurred due to these diseases.
Besides the above, application of fungicides, crop rotation, inter-cropping, cultural
practices, use of bio-agents etc. are some other alternate strategies employed for
disease control.
Fungal pathogens in oil seed crops have been found to cause heavy economic
losses. Oils form economically important household commodity required in day
today affairs and some oils are also used as therapeutic agents. The losses of oil seed
crops due to fungal and microbial diseases ranges from 5 to 20 %. Diseases of
important oilseed crops are presented in Table 7.5.
Vegetable crops suffer from a number of diseases caused by fungi and other
microbes. Major diseases include wilt of tomato, powdery mildew and anthracnose
of pepper. Potato wart, Phomopsis blight of eggplant, powdery mildew of cucum-
bers, anthracnose and wilt of cucurbits, and Fusarium wilt of okra. Onion suffers
from basal rot, purple blotch, white rot, anthracnose and Stemphylum blight.
204
Table 7.5 Diseases of important oilseed crops and their control

Crop Symptom Pathogen Control
Groundnut Leafspot Mycosphaerella arachidicola Tolerant varieties; inter-cropping with sorghum, pearl millet; foliar
spray of Carbendazim etc.
Phacoisariopsis personata Resistant varieties; Carbendazim + Mancozeb; deep burrowing of crop
residues and removal of volunteer plants
Sunflower Leaf spot Alternaria helianthi Removal of plant debris
Blight Alternaria alternata Early sowing resistant varieties
Downy mildew Plasmidiophora halstedii Mancozeb spray Seed treatment with Metalaxyl Apron 35
Rust Puccinia helianthi Altering the sowing date, deep summer ploughing, resistant varieties
Safflower Leaf blight Alternaria carthami Triazoles, Hexaconazole, Thiram; hot water treatment; tolerant varieties
Root rot Phytophthora drechsleri Avoidance of mono cropping; use of resistant varieties
Rust Puccinia carthami Destruction of crop debris; collateral host; crop rotation; spraying of
tridemorph; resistant varieties
Sesamum Blight Phytophthora parasitica var. sesame Inter-cropping; application of farmyard manure; biocontrol; seed
treatment with Captan
Wilt Fusarium oxysporum f. sp. sesami Seed treatment with Benlate; biocontrol
Castor Blight Alternaria carthami Mancozeb application; judicious use of fertilizer
Grey rot Botrytis ricini Spacing; Carbendazim spray
Root rot Macrophomina phaseolina Crop rotation; Thiram, Topsin M-70
Wilt Fusarium oxysporum Healthy seeds; Biocontrol; Carbendazim, Thiram
f. sp. ricini
C. Manoharachary and I.K. Kunwar
Vegetable legumes are known to suffer from rust, powdery mildew, root rot and others.
Carrot the common root crop mainly suffers from powdery mildew, Cercospora leaf
spot and Alternaria blight. Cultural practices, IDM and breeding for resistance are
some of the successful methods employed to control vegetable crop diseases.
The population is growing beyond expectations particularly in China and India
besides improvement in life expectancy. Further, the world population has doubled
from three billion in 1960 and by 2080 it will be varying from 8.1 to 14.0 billion
certainly it will cross 9.0 billion by 2050. Land is basic to agriculture, is finite and
fragile. Water is getting polluted despite scanty rain, pollution, human interference,
degradation of land, soil fertility loss, erosion of soil, increase in waste land, pro-
ductivity loss, dwindling economy, ground water depletion and biodiversity erosion.
Seventy percent increase in grain yield would be required to feed increasing popula-
tion by 2050. There is a necessity to control the diseases caused by fungi and other
diseases as they have become stumbling block for crop productivity.
Securing food for everyone under the ever increasing population under shrinking
resources without compromising the environment and health is the foremost impor-
tant task for everybody. About 20 % food production is lost due to plant diseases at
various stages. The famines in the history are consequences of either natural calami-
ties or epiphytotic disease appearance. We need to be very attentive as the pathogens
are evolving very fast and new diseases are developing rapidly. The misery is
getting augmented further with the climate changes making the situation diverse for
the crops and favorable for the diseases development.
7.4.2 Epidemiology and Forecasting
Epidemiology and forecasting of diseases, host–pathogen interaction in a given

environment is an important aspect for disease development. Virulent pathogen,
susceptible host and congenial environmental variables are responsible for disease
production and disease advancement. Epidemiology deals with dynamics of plant
pathogen infecting host population. Late blight disease of potato caused by
Phytophthora infestans awakened the plant pathologists to look into reasons behind
the same. Discovery of barberry as an alternate host of Puccinia graminis var. tritici
and its eradication has led to the beginning of phyto-epidemiological approach for
plant disease management (Mehta 1933). Waggoner and Horsfall (1969) simulated
plant disease epidemic on computer followed by Van der Plank (1963) who consid-
ered that the epidemiology and forecasting need multidisciplinary approach. Plant
disease forecasting is a management system used to predict the occurrence or
change in severity of plant diseases. It is important to note that the potential yield
and the yield realized at farmer’s field are not the same. This yield gap has been due
to severity of diseases, potential and abiotic stresses that affect crops. Crop predic-
tion models forewarn these menaces.
There is a necessity to develop disease forecasting models which are nothing but
set of formulae, algorithm pattern after a detailed study of biology of specific patho-
gen. Keeping in view the host and crop management practices, forecast models
provide an alternate calendar spray schedule to bring need-based precision.
Forecasts may be based on initial inoculums, meteorological parameters and their
combinations. There are several disease forecasting networks available across globe
for maize (EPICORN—Southern corn leaf blight), tomatoes (EPIDEM Tomcost),
potatoes (BLITE CAST for early blights), apple (EPIVEN—Scab) followed by
weather-based location specific forewarning models. An artificial neural network
(ANNS) is another tool for disease forecasting. ICAR and ISRO have demonstrated
identification of coconut wilt using aerial false colour photography; remote sensing
has also been used to forecast the diseases. Forecasted information has to be simple
and user friendly. Online decision support systems to forecast different diseases are
in use across the globe viz. tan spot, Septoria leaf blotch, leaf rust, Fusarium head
blight. Therefore, accurate information in yield losses due to occurrence of a disease
is needed by growers or plant protection specialists to decide on cost-effective
control measures.
7.4.3 Impact of Climate Change
Climate change due to variability in CO2 emissions, rise in temperature, anthropo-

genic activities, natural calamities, rise in sea level and other related changes will
have impact on cropping system, disease incidence, agricultural productivity and
sustainability. Temperature, moisture and green house gases are considered as
important variables. It is expected that global temperature may rise between 0.9 and
3.5 °C in the year 2100 (IPCC 2007), bringing changes in rainfall pattern and green
house gases. All these will influence the management of plant diseases and epi-
demics caused by fungi, microbes and insects. The available data indicates that the
climate change (temperature, moisture, increased CO2, rainfall) will affect the
geographical range of pathogen, its population, generations, loss of resistance in
cultivation, changes in crop disease cycle, impact on pathogen interaction, affect the
morphology, physiology and biomass of crops besides affecting the virulence of
pathogens and their evolution.
Some of the examples include dry rot of chickpea caused by Rhizoctonia batati-
cola becoming severe in rain fed environment and also increased incidence of stem
rot in soybean by Sclerotinia sclerotiorum with increased temperature and wetter
conditions. Geographic information system (GIS) has been used to evaluate and
model the spatial distribution of plant disease in relation to environmental factors.
This information will be useful to the crop growers, scientists, extension agencies
and others (Serge et al. 2011).
7.5 Plant Disease Management
Plant pathogens gained momentum since the Irish famine epidemic caused by
Phytophthora infestans in Ireland during the 1840s which resulted in the death of a
million people. This has awakened the scientific and farming community to begin
search for plant protection measures. The discovery of Bordeaux mixture, the first
generation fungicide by Millardet in 1885 to control the downy mildew of grapes is
considered as the landmark in the history of chemical control of plant diseases. It is
estimated that around 20 % losses are recorded in the yield of food and cash crops
worldwide. Out of 100 thousand fungi described in the world, at least 20,000 are
known to cause diseases on crop plants. Though the crop losses get reduced through
disease resistant varieties, crop rotation and phytosanitation, fungicides offer better
control of diseases and maximize crop yields.
Plant diseases have been playing an important role in agricultural productivity
and influencing the world’s economy. The annual world crop loss has been around
25,000 million dollars. In spite of having phytosanitation, biological control,
cultural practices, growing disease resistant varieties, seed treatment with chemi-
cals, solarization and other such ancient and modern methodologies employed in
disease control, still chemical control holds the key.
Diagnosis of disease and identification of fungal pathogens have to be established
accurately for plant disease management. The following are the five categories of
plant disease management.
1. Avoidance of pathogen through exclusion of the pathogen from a geographical
area, either voluntarily or by legislations and by evasion so as to prevent the
pathogen from coming into contact with the host.
2. Eradication of the pathogen from the host, soil, other sources so as to reduce the
inoculum rather than the total eradication of the pathogen.
3. Protection of plants from pathogens through physical and chemicals methods.
4. Use of disease resistant varieties.
5. Chemotherapy.
7.5.1 Fungicides and Fungicidal Resistance
Along with growing population which will be around 8.3 billion by 2030, it is
essential to offer food security which is the greatest challenge posed. Therefore, it
has become a necessary evil to use chemical fungicides for the control of plant
diseases though the problems of residual effect, toxicity and fungicidal resistance
among pathogens exist.
Millardet at Bordeaux in France used Bordeaux mixture for the control of
downy mildew of grapes in 1882 and this copper fungicide has been considered
as the oldest fungicide. However, some fungal pathogens have also developed
fungicidal resistance. This fungicidal resistance has opened up new challenges to

the plant pathologists.
The fungicides used for disease control have been classified as protectants, eradi-
cants and therapeutants. A successful fungicide is the one which has consistency in
action and constant characters. These include effective action, soluble enough to
function, adhesiveness, non-phytotoxic, safe for handling, purity, good shelf life, with
no or less residual effect and other parameters need to be satisfied. The fungicides
which are in use belong to inorganic copper components, inorganic mercury com-
pounds, sulphur sprays, organic sulphur compounds, quinine and phenolic fungicides,
heterocyclic nitrogen compounds, benzene compounds, organomercurials, systemic
fungicides, organophosphorus compounds, antibiotics and fumigants. All the above
chemicals have proved to be effective at one or other concentration against a particular
disease. Furthermore, lethal levels have been identified for each fungicide.
From 1934, the dithiocarbamates along with organotins, low soluble copper
compounds, quinine, captan, chloronil, PCNB, surface protectants like inorganic
fungicides and others made an entry as second generation fungicides which offered
some hope of disease control. The third generation chemicals include
2-aminopyrimidene, benzimidazoles, carboxamides, organophosphorus com-
pounds, triazoles and others which are able to penetrate the host tissue and kill the
pathogen. Later strobilurins, phenylpyrazoles, quinooxyfen, oxazolidinediones, spi-
roxamine, valinamides, cyanoimidazoles, thiocarbamates, amidoximes and others
which are eco-friendly, possess broad-spectrum activity at low dose rates and are
promising have offered a promise to protect the crops from fungal diseases.
Interestingly breeding for disease resistance offered a greater hope to protect plants
from diseases and the fungicides are now considered to be second line of defense
(Klittich 2008). Thind (2011) reported that around 52 fungicides are registered for
use in India and a good number of fungicides are under evaluation (Table 7.6). He
has also stated that Azoxystrobin and fenamidone have been registered for control
of grape downy mildew and potato blight. Mandipropamid, iprovalicarb, benthia-
valicarb, fluopicolide, famoxadone, cyazofamid, pyraclostrobin and picoxystrobin
are some of the fungicides which are being tested against different diseases. A new
thrust has been on the following areas:
1. Combinational chemistry
2. High throughput screening
3. Advanced formulation and
4. Molecular toxicology and environmental safety
Further, the discovery of crop protection chemicals like pyrethroids, ascomec-
tins, spinosyns and others as natural products offered new avenue for the discovery
of new chemical molecules offering plant protection against disease causing
pathogen.
The fungicidal research has to focus on the following in future:
1. Environmental and public safety, impact on soil and air environments.
2. Role of fungicidal resistance among pathogens and impact on host health.
Table 7.6 Some plant diseases and their chemical control

Crop Disease Fungicide
Sorghum Smut Carboxin 2 g/kg seed dressing
Rice Blast Carbendazim 1 g/L water
Sheath blight Carbendazim 1 kg/100 L water
Brown spot MnCo3 2 kg/ha
Wheat Loose smut 2.5 g Carboxycin/kg seed
Karnal bunt 2.5 g Thiram and Bavistin/kg of seeds
Rust 2 kg of Mancozeb/ha
Pearl millet Rust 2 kg Mancozeb/ha in 800 L water
Sugarcane Wilt Carbendazim
Coconut Root wilt 1 kg MgSO4/ha
Banana Panama disease 2 g Captan/L water
Sigatoka 1 g Thiophanate methy/L water
Citrus Dry root rot 0.1 % Carbendazim and 0.25 % Mancozeb
Mango Anthracnose Bordeaux mixture
Powdery mildew
3. Reduction of time and effective control of diseases.

4. Discovery of new antifungal compounds with high efficacy.
5. Preparation of disease diagnostic kits and host/pathogen specific fungicide.
6. Critical analysis of fungicidal residues and toxicity.
7. Purity and shelf life of fungicide.
8. Limiting the diseases levels.
9. Bringing out suitable laws to control adulteration and marketing of spurious
fungicides.
Fungicides have come into existence since the discovery of Bordeaux mixture by
Millardet in order to control the downy mildew of grapes in France. Fungicides have
become important in modern agriculture for the management of various diseases in
agricultural crops. In spite of having cultural practices, growing resistant varieties,
use of botanicals and biocontrol agents, nonetheless farmers are showing keen inter-
est for the use of fungicides as they result in the disease control within a short period
of application. However, farmers believe in immediate gains and no realization pre-
vails on them about the impact of chemicals on most plants. It is also important to
note that all other alternate methods are time consuming and results obtained at field
site are variable but for growing disease resistant varieties. Around 150 chemicals
of different classes are employed to control different diseases in various countries.
It is also known that a fungicide may fail to control a particular disease under certain
circumstances which may be due to insufficient dosage, low effectiveness, improper
timing of application, defective method of application, expiry of product, adultera-
tion, at times excessive wash off in monsoon and many other reasons. Environmental
conditions, crop cultivation, geographic location and chemical constitution of
fungicide are crucial in the management of disease. The side effects like fungicidal
residue in the host, toxicity, retention capacity, shelf life of fungicide, physiological
and biochemical changes in host, potentiality of chemical and genetic constitution

of host to accept the fungicide have become important. Fungal pathogens show
resistance to fungicides which may be due to innate capacity of fungal pathogen to
the chemical into simpler compounds or may be due to fungicidal inaction on patho-
gen as the fungicide not being specific (Brent 1995; Thind 2008). This kind of
resistance was shown towards benomyl, dimethrimol and others. Mancozeb or
copper fungicides are still in use to control diseases. However, strobilurins, phenyl-
pyrroles, anilinopyrimidines, spiroxamines, quinolines and phenylpyridylamines
have shown more potent action against diverse fungal pathogens at much lower
rates. Interestingly sudden failures and inaction of dithiocarbamates and some other
fungicides has been reported with reference to powdery mildews, apple scab, peanut
leaf spot and Botrytis gray mould (Brent 1995). The fungicidal resistance has been
interpreted as genetic adjustment by a fungus resulting in reduced sensitivity to a
fungicide. The fungicide does not induce resistance but it only selects the resistant
propagules already present in low frequency in a natural population of the pathogen.
Fungicidal resistance evolves from a mutation in genes, although resistance can
originate from mutation in mitochondrial genes of the pathogen as evidenced in
strobilurins.
Early fungicides developed during 1950–1960 did not cause much damage to
crops but increased yields at lower dosage. Site specific systemic fungicides like
benzamidine, phenylamines and others were more effective than classical protec-
tants. These fungicides being site specific have brought the problem of resistance
development in target pathogens. New fungicides like azoles introduced during
1980–1990 have proved remarkable but with a caution that the modern synthetic
chemistry presents a risk of resistance.
The buildup of resistant strain is caused by the frequent use of site specific fun-
gicide which exerts a selection pressure on population. The fungicide selectively
inhibits sensitive strains but allows the increase of resistant strains. The shift towards
building resistance occurs at different rates depending on the number of genes con-
ferring resistance. In some like benzimidazoles and phenylamides which are highly
selective fungicides, development of resistance is often sudden and the process is
called disruptive selection. This has been due to mutation of a single major gene in
a pathogen that is not affected by fungicide. Such fungicide resistance is referred as
qualitative resistance or as discrete or black and white resistance. Such pathogen
populations can remain resistant for many years even if pathogen is withdrawn. It
may take 2–7 years or a fungicide to lose its sensitivity of fungal population and
cause decline in disease control (Brent and Hollomon 2000). The risk of resistance
development depends greatly upon the chemical nature to which it belongs and the
mode of action of member fungicides. In the last 30–40 years the problems of
acquired resistance have affected performance of fungicides. Estimates of resis-
tance risk in different chemical classes of fungicides are shown in Table 7.7.
Management of fungicide resistance can be achieved by:
1. Management of timing of fungicide application, spray intervals and area treated
2. Optimum use of fungicide
Table 7.7 Fungicides, their mode of action, target site and resistance risk
Fungicide Mode of action Target site Resistance risk
Benzimidazoles Mitosis and cell β-tubulin High
division
Strobilurins Respiration Complex III cytochrome High
Carboxamides Nucleic acid Complex II succinate Moderate
synthesis dehydrogenase
Morpholines Sterol biosynthesis D 8-7 dimethylase Moderate
Copper and Sulphur Multisite disruption Reaction with enzymes Low function
compounds, of cell
Dithiocarbamates
Table 7.8 Fungicide affecting the host and the pathogen

Fungicide Host Pathogen affected
Benomyl Grapes Botrytis cinerea
Carbendazim Apples Venturia inaequalis
Iprodione Grapes Botrytis cinerea
Edifenphos Rice Magnaporthe grisea
Dimethirimol Cucumber Sphaerotheca fuliginea
Myclobutanil Barley Erysiphe graminis
Metalaxyl Potato Phytopthora infestans
Source: Brent and Hollomon (1998) and Thind (2008)
3. Avoiding sole use of harmful fungicides

4. To alternate the application of risk fungicides with those of multisite contact
fungicides
5. Integration with cultural practices
6. Avoiding post-symptom curative treatments
7. Reduction in number of applications
There is a necessity of risk assessment for newly developed fungicides before
marketing. Further it is essential to understand the implications involved between
fungal pathogen and fungicide interaction (Table 7.8). Molecular approaches may
help in clearing certain unsolved problems.
7.5.2 Breeding Resistant Varieties
Plants are varied in their action towards fungal pathogens and this character is con-
trolled by genes associated with different genera and species. Many plants showing
natural resistance to disease have long been used by plant geneticists in their breed-
ing programmes. Resistance and susceptibility of a host plant to a fungal pathogen
are largely inherited characteristics. The use of hybrids and disease resistant
varieties not only gives more yields, but it is free from disease incidence, eliminates
fungicidal interference, pollution, health hazards, etc.
However, the performance of a disease resistant variety or hybrid is also depen-
dent upon edaphic and meteorological factors. The breeding for disease resistance
is based on the laws of inheritance. Some diseases got introduced into one or other
country due to transport of crop or its seeds. Further, some important diseases have
been imported into countries where there was no existence of such diseases. For
example, the potato tubers from South America to England have introduced
Phytophthora infestans in 1880s. The resistance gene of a cultivar may persist for a
period of 5 or 10 years as documented in rust resistant variety of wheat by Borlaug
(1965). Monogenic resistance is governed by single gene whereas oligogenic and
polygenic resistance are governed by two or many genes.
Extra-chromosomal inheritance gene interaction, modifier genes and reversal
dominance play an important role in offering diseases resistance. If a variety is
resistant to some pathogenic races than other, such resistance is called vertical resis-
tance whereas when resistance is uniformly spread against all races of pathogen is
called horizontal resistance.
A breeder while working for disease resistance has to follow:
1. Selection from existing crops
2. Selection from crops that escape damage in infected fields
3. Pure line selection
4. Plant introduction
5. Hybridization
6. Selection from wild varieties
7. Induced mutations
7.5.3 Alternate Disease Management Strategies
Chemical control has become essential for the control of several diseases caused by
fungal pathogens. The non-judicious and careless application of chemicals has led
to damage of crops and created fungicidal resistance among fungal pathogens.
Chemicals either kill or inhibit germination, growth and multiplication of the patho-
gen. However, the residual/toxic effects remain in some hosts. Further environmen-
tal pollution has increased due to toxic gaseous chemicals besides affecting soil
health. Adulteration of fungicides and their application lead to ineffective manage-
ment of diseases, natural resources of raw materials used for the manufacturing of
fungicides/pesticides have depleted and labour has become costly. All such reasons
made the scientists to think of alternate methods for disease control.
In addition to chemical methods and breeding for resistant varieties several alter-
nate methods are used singly or in combination to control plant diseases, and one of
the common methods being biocontrol. Von Tubeuf (1914) coined the term ‘bio-
logical control’ in relation to plant pathogens. Biocontrol of root diseases in plants
was reported for the first time by Hartley (1921). According to Cook and Baker
(1983) biological control was defined as ‘the reduction of inoculum or disease pro-
ducing activity of a pathogen accomplished by one or more organisms other than
man’. Baker (1987) defined that biological control is the decrease of pathogen activ-
ity accomplished by one or more organisms including host plant excluding humans.
The biocontrol agents reported are Trichoderma, Gliocladium, Aspergillus,
Neurospora, Chaetomium, Dactylella, Arthrobotrys, Glomus, Penicillium etc.
Important biocontrol agents that serve as antagonistic agents against plant patho-
genic fungi include Ampelomyces, Aspergillus spp., Chaetomium globosum,
Fusarium sp., Gliocladium virens, Penicillium citrinum, Peniophora gigantea,
Trichoderma harzianum and others.
The mechanisms of biological control of plant diseases being:
1. Competition: Competition being between micro-organisms for space or nutrition
and this is applied for biocontrol agents.
2. Antibiosis: This process is the inhibition of an organism through a metabolic
product from another organism. The root disease caused by Heterobasidion
annosum can be controlled by Peniophora gigantea.
3. Hyperparasitism and mycoparasitism: Biocontrol can be achieved through direct
parasitism. This involves the direct utilization of food of one organism by another
organism. Hyperparasites are parasitic on other parasites. Few hyperparasites
include Darluca filum parasitizing rust fungi. Ampelomyces quisqualis parasit-
izes powdery mildew fungi. Tuberculina maxima parasitize Cronartium ribicola.
Trichoderma viride and other species are known to parasitize hyphae of
Rhizoctonia solani.
7.5.3.1 Trichoderma as Biocontrol Agent
Trichoderma is the anamorphic state of Hypocrea and is represented by more than

110 species. It colonizes mostly soil, organic debris, litter and other such substrates.
Various species are identified based on morpho-taxonomic criteria and molecular
tools. The most successful antagonistic species being Trichoderma harzianum fol-
lowed by T. atroviride, T. asperellum, T. hamatum, T. longibrachiatum, T. reesei,
T. virens and others. The plant diseases caused by Fusarium, Phytophthora, Pythium,
Rhizoctonia, Sclerotium and many other soil-borne and root-borne diseases have
been controlled using Trichoderma spp. as biocontrol agents. The commercial
products of Trichoderma spp. are listed in Table 7.9.
7.5.3.2 Hypovirulence
It is a term used to describe reduced virulence found in some strains of pathogens.

This process has been reported in many pathogens like Rhizoctonia solani,
Gaeumannomyces graminis var. tritici and Ophiostoma ulmi, but the transmissible
elements responsible for hypovirulence or reduced vigour of fungi are subject to
debate and may be due to dsRNA viruses or plasmids.
Table 7.9 Commercial products of Trichoderma spp., their use for control of various types
of diseases and companies commercializing them
Disease
Product Fungus controlled Commercialization
Trichodex T. harzianum Botrytis on Makhteshim chemical
grape vine Works Ltd, USA
Trieco T. viride Soil/root-borne Jeypee Biotechs, India
disease
TY Tusal Trichoderma spp. Soil/root-borne Mycocontrol Ltd, Israel,
disease Spain
T22g, t-22 HB T. harzianum Soil/root-borne THT Inc, USA
disease
Soil Gard, RUTOPIA Trichoderma sp. Soil/root-borne NaEx Corp, USA Inc
disease
Ecofit T. viride Soil/root-borne Hoechst Schering Agro
disease Evo Ltd, India
Bio-trek 22G T. harzianum Soil/root-borne Bioworks Inc of Geneva,
disease NY
Biofungus Trichoderma sp. Soil/root-borne Grondortsmettingen De
disease Cuester n. v. Belgium
Bioderma T. harzianum Soil/root-borne Biotech International
T. viride disease Ltd, India
Binab T T. harzianum Soil/root-borne Bio-innovation AB, UK
T. polysporum disease
7.5.3.3 PGIPs-Plant Immunity
In the process of host–pathogen interaction a number of changes, actions, and reac-

tions do occur. These include defense reactions such as formation of antifungal
proteins, enzymes, and other biochemical physiological alterations.
Polygalacturonase inhibiting proteins (PGIPs) are the extracellular host-plant pro-
tein inhibitors and these are helpful in stopping the infection process of host-plant
tissues by fungal pathogen. PGIPs are the better choice of developing hyperactive
PGIPs. Further transformation of crop plants with these modified PGIPs or with
more than two PGIPs will result in wide fungal resistances (Dangs and Jones 2001).
7.5.3.4 Endophytes as Biocontrol Agents
Endophytes are the microorganisms (bacteria, actinomycetes, algae, fungi) that

reside in healthy plant tissue without causing any disease symptoms besides spend-
ing whole life or a period of their life cycle in plant tissue. Often plant tissues harbor
one or more microorganisms. The harboring fungi and other microbes have a great
potential to produce novel natural products which also include compounds useful as
plant protectants from disease causing pathogens. Several antimicrobial compounds
have been isolated from endophytic fungi (Strobel 2003) (Table 7.10).
Table 7.10 Antimycotic compounds of some endophytic fungi effective against some
pathogenic fungi
Endophytic fungi Compound Pathogenic fungi
Fusarium oxysporum Cyclosporine Sclerotinia sclerotiorum
Cryptosporiopsis quercina Cryptocandin Botrytis cinerea
Cryptosporiopsis quercina Cryptocin Magnaporthe grisea
Colletotrichum gloeosporioides Colletotric acid Helminthosporium sativum
Oomycetes Oocytin Water moulds
Table 7.11 Commercially available products formulated

from fungi for the biocontrol of plant pathogens
Biocontrol fungus Commercial product
Ampelomyces quisqualis AQ10
Coniothyrium minitans Contans
Fusarium oxysporum Fusaclean, Biofax C
Gliocladium sp. Soilgard, primastorp
Myrothecium verrucaria DiTera
Paecilomyces lilacinus Paecil
Taxol has been a well-known compound isolated from endophytic fungus

Taxomyces andreanae of Taxus baccata. One hundred and eighty-seven endophytic
fungi isolated from woody plants were antifungal against Phytophthora infestans
(Park et al. 2005). Duijff et al. (1998) have reported induced resistance against
Fusarium wilt in tomato using endophytic fungus Fusarium oxysporum. Phomopsis
cassiae, an endophytic fungus in Cassia spectabilis produces ethyl 2,4-dihydroxy-5,
6-dimethyl benzonate and phomopsilactone, which is antifungal to Cladosporium
cladosporioides and C. sphaerospermum.
7.5.3.5 Induced Resistance and Cross Protection
There are many fungi, microbes and abiotic agents that induce resistance. The local-
ized and systemic induced resistance can act against whole range of pathogens.
Localized resistance occurs in many plants and systemic resistance is limited to
some plants. The inoculation with avirulent strains of pathogen or either microbes,
both inducing resistance and challenge pathogens occur on or within the protected
tissue. Such process is called cross protection. For example, non-pathogenic Fusaria
when inoculated into soils supporting fusarium wilt diseased plants, resulted in the
control of wilts. Commercially available products formulated for the biocontrol of
plant pathogen and inducting the defense in host are given in Table 7.11.
Table 7.12 Plant extracts/oils/products inhibitory to plant pathogens

Plant extracts/oils/products Pathogens controlled
Extracts
Datura innoxia Colletotrichum capsici
Achyranthes aspera Alternaria pisi
Catharanthus roseus Magnaporthe grisea
Garlic Aspergillus flavus
Neem Alternaria sesame
Cabbage, alfalfa, garlic Phytophthora capsici
Oils
Emulsified rape seed oil Apple powdery mildew
Rape seed oil Grape powdery mildew
Marigold oil Damping off of seedling
Eucalyptus oil Candida infections
Products
Nimin from Neema Clubroot of crucifers
Neemasse from Neem Black arm of cotton
Triact 70 from Neem Powdery mildew, rust of wheat
Fungastop from Mint Soil-borne pathogen
a
Neem = Azadirachta indica
7.5.3.6 Botanicals
Attention has been drawn for the exploitation of plant products as novel chemo-
therapeutants in plant protection. Plant products are non-phytotoxic, biodegrad-
able and not harmful to host metabolism. The secondary metabolites of plants
include phenols, flavonoids, quinines, tannins, essential oils, alkaloids, saponins
and sterols (Varma and Dubey 1999). However, scientifically accurate data on
botanicals is essential pertaining to pathogen specific action, purity of com-
pound, shelf life and residual toxicity effect on the host plant. Some of the
extracts, essential oils and other plant products used as plant protectants are
given in the Table 7.12.
7.5.3.7 Organic Farming in Disease Control
Organic farming has received the needed attention of farmers as it helps in disease
management and supports plant growth. In fact it reduces the dependence on chemi-
cal inputs besides being an eco-friendly approach. According to the FAO/WHO
organic agriculture is a holistic approach for food production management systems,
which promotes and enhances agro-ecosystem health, including biodiversity, bio-
logical cycles and soil biological activity. It includes the use of management prac-
tices in preference to the use of off farm inputs, taking into account the regional
conditions required for locally adapted systems. This is accomplished by using
wherever possible agronomic, biological and mechanical methods as opposed to
Table 7.13 Eco-friendly control measures for the management of diseases

Crop Disease/pathogen Treatment/amendment
Wheat Loose smut—Ustilago tritici Solar heat treatment
Bajra Ergot disease—Claviceps fusiformis Salt water treatment
Grape wine Petri disease—Phaeoacremonium sp. Hot water treatment at 51 °C
Wheat/barley Erysiphe graminis Compost added to soil
Beans Rhizoctonia sp. Compost added to soil
Cucumber Powdery mildew Compost mix
Pea Damping off Seeds soaked in different compost
extracts and dried before sowing
Soybean Phytophthora spp. Application of 40 tons of compost per
hectare
Banana Wilt—Fusarium oxysporum f. Sugarcane bagasse added to soil
sp. cubense
Wheat Take all—Gaeumannomyces graminis Rape/pea greens added to soil
Crops Wilts and rots—Fusarium spp., Oil cake (neem, groundnut etc.) added
Rhizoctonia spp. to soil
Potato Black scurf—Rhizoctonia solani Saw dust, oil cakes added to soil
Potato Wilt—Verticillium albo-atrum Wheat straw, barley straw added to soil
using synthetic materials, to fulfill any specific function within the system. Organic
farming with reference to disease management includes:
1. Growing crops that are resistant to disease or proper selection of sowing times
that prevents the disease incidence.
2. Hygiene/sanitation, clean cultivation improving soil health to resist soil patho-
gens and promote plant growth, application of naturally occurring biocontrol
agents for control of diseases.
3. Site selection and appropriate cultivation.
4. Use of disease-free seed.
5. Application of suitable cropping system.
6. Input of organic matter, efficient water management, safe and minimum applica-
tion of organically approved chemical protectants.
7. Use of botanicals, oils, etc.
8. Diseases controlled by alternate methods (solar, hot water, compost amend-
ments) (Table 7.13).
Soil solarization is a novel and eco-friendly technique tested for treatment of soil
to combat soil-borne diseases through solar heat. The moisturized soil is covered
under transparent polythene film during summer to prevent dissipation of the
trapped solar heat. The temperature of soil rises, at time 13 °C higher than outside
temperature reaching 55 °C at 8 cm depth thus killing fungal propagules. Organically
approved bicarbonate salts have demonstrated good activity against powdery mil-
dew and other diseases. Thermophilic and other extremophile plant pathogens have
to be controlled by other means.
Organic farming is the economically and ecologically viable method of disease
management as a preventive process besides being cost-effective method for sus-
tainable agriculture.
Table 7.14 Arbuscular mycorrhizal (AM) fungi as biocontrol agents against some plant diseases
AM fungi Host Disease Pathogen
Glomus fasciculatum Tomato Wilt Fusarium oxysporum f. sp.
lycopersici
Glomus fasciculatum Green gram, chick pea Root rot Macrophomina phaseolina
Glomus mosseae Tomato Blight Phytophthora parasitica
Glomus mosseae Tomato, egg plant Wilt Verticillium dahliae
Glomus intraradices Common bean Rot Fusarium solani
Glomus geosporum Dalbergia sissoo Wilt Fusarium solani
Glomus fasciculatum Tea Brown rot Fomes lamaoensis
7.5.3.8 Arbuscular Mycorrhizal Fungi and Plant Protection
Arbuscular mycorrhiazal fungi (AMF) are cosmopolitan and ubiquitous micro-

scopic living organisms associated symbiotically with 70–80 % of plants. The roots
of plants get colonized by these soil fungi and produce mycelium, arbuscules and
vesicles. Mycorrhiza forms an important link between the plant roots and soil.
Arbuscular mycorrhizal (AM) fungi help in the mobilization of phosphorus and
other nutrients from soil to root followed by their upward movement besides
increasing plant growth offering resistance against pathogens and abiotic stress.
Further, AM fungi help in the alleviation of salt stress, water stress tolerance,
maintaining plant health and soil fertility. Multiple signals and differential induction
of gene expression mediate the complex interaction between AMF and plant cells.
AMF prevent root infections by reducing the access sites. Concentrated efforts can
be made for formulations, product development and stringent quality measures be
adopted. Different theories have been proposed to explain protection by AM fungi
against fungal pathogens (Table 7.14). These include:
1. Improvement of plant nutrition and root biomass in inoculated plants resulting in
increased plant tolerance and compensates the root damage caused by the
pathogen.
2. Change of root morphology.
3. Modification of mycorrhizosphere microflora.
4. Competition between AM fungi and pathogenic fungi besides inducting resistance.
7.5.3.9 Chitinase as an Agent for Disease Control
Chitinase elaborated by many fungi can serve as potential disease control agent of
several fungal pathogens. Most probably chitinase application can serve as alternate
source for disease control. Further the genes encoding chitinase can be incorporated
into host plant either to resist pathogens from invasion or suppress the pathogen.
Genetic transformation of existing biocontrol of fungi that are well adjusted to their
environment is likely to enhance their biocontrol capability.
7.5.3.10 Role of Transgenics in Disease Management
Transgenic plants are those plants which contain, within its genome, a foreign DNA
that does not belong to it and has been introduced artificially via genetic engineering.
Resistance genes can also be introduced in that way from unrelated plant species.
Desirable target genes are isolated from fungi or other plants and introduced into the
plants. Powell et al. (1994) reported transgenic tomato that has been resisted to
Botrytis cinerea. The fungal resistant gene Hml has been isolated from maize con-
ferring resistance to Helminthosporium carbonum. DNA markers are used for assist-
ing the transfer of genes from one variety to another. In the absence of resistance
genes, it is necessary to search for resistance genes in other species followed by their
identification and cloning. Such genes can be deployed in crop varieties by using
transgenic approaches. The genes responsible for offering dosages or resistance
through β-1,3-glucanases, chitinases, thaumatin-like proteins, ribosome inactivating
protein (RIPs) and thionins are introduced through genetic engineering methods.
The expression of such genes in transgenic plants render disease resistance to many
fungal pathogens and this has been proved in wheat against powdery mildew and
rust (Bieri et al. 2003; Oldach et al. 2001). Chitinase gene introduction resulted in
increased protection in rice against sheath blight and blast (Kim et al. 2003a).
7.6 Nanotechnology and Its Application
Nanotechnology has been in use in recent times for the detection of plant pathogens
and biosensor related disease management through nano-formulations of agro-
chemicals around the world (Gopal et al. 2011a). Silver nanoparticles got applica-
tion in a number of fields including in the control of wilt pathogens Fusarium
culmorum, Rhizoctonia solani, Magnaporthe grisea and others (Gopal et al. 2011b)
(Table 7.15). Antifungal action of fluconazole, a triazole fungicide was improved by
using biologically synthesized Ag NP for combating fungal pathogens like Candida
albicans, Phoma glomerata and Trichoderma sp. Nano-Gro and Nano-5 were also
released into the market to control grape mold, rice blast, early and late blight, pow-
dery mildews (Gogoi et al. 2010). Gopal et al. (2011b) have developed nano-hexa-
conazole to control powdery mildew of vegetables and Rhizoctonia solani.
Table 7.15 Control of plant pathogens by metallic nanoparticles

Source Metallic nanoparticle Location Size (nm)
Candida glabrata Ag Intercellular 20
Fusarium oxysporum Ag Extracellular 20–40
Aspergillus niger Ag Extracellular 5–25
Trichoderma asperellum Ag Extracellular 5–25
Phanerochaete chrysosporium Ag Extracellular 50–200
Source: Modified from Gopal et al. (2011b)
7.7 Transcriptomics
Genomics and proteomics are now applied in understanding plant–pathogen

interactions and also to address the hypothesis in the context of biochemical path-
ways, phylogeny, gene network and others. This kind of approach is more applica-
ble to the non-culturable pathogen. It is also known that molecular signaling between
fungal pathogen and hosts plays a fundamental role both in pathogenesis and in the
establishment of beneficial interactions between symbiotic or parasitic partners,
respectively. These interactions have profound effect for designing of new strategies
to combat diseases. It is evident that Flor’s gene for gene hypothesis explained the
genetics of disease phenotypes incited by plant pathogenic fungi and others as well
as failures and success of certain plant-pathogen/insect interactions.
Transcriptomics is a revolutionary functional genomic tool for deciphering
plant–pathogen interaction in the pathogenomics era. A total of 2,977 full
genomic sequences have been published (Gold Statistics 2011). It is essential to
analyze more than a single genome sequence of a pathogen species to understand
the mechanisms of pathogenesis. The sequencing of hundreds of fungal and
microbial genomes including that of pathogen initiated development of novel
approaches for the study of functional genomics. Technologies such as gene
expression, DNA micro-array analysis and others enable the analysis of gene
expression profiles in a single experiment and provide deeper insight into host–
pathogen interactions. The transcriptome is the set of all RNA molecules includ-
ing mRNA, rRNA, tRNA and the non-coding RNA produced in a cell or a tissue.
It can vary with external environmental conditions including the state of the
pathogen and pathogenesis. Further the transcriptome reflects the genes that are
active at any given time.
Transcriptome is also called expression profiling which examines the expression
load of mRNAs in a given cell population. The next generation sequencing technol-
ogy is also known as RNA-sequencing. Transcriptome data also elaborates about
the activity of genes that change their expression pattern in response to a signal
originated from the host plant or in the host tissue and may reveal mechanisms of
pathogenesis as initiated by fungal/microbial pathogens. Global transcriptome anal-
ysis is also of much importance in order to understand the interaction between
plants genome and its environment along with fungal–pathogen interaction.
Microarray provided basis information for many transcriptomic studies besides the
serial analysis of gene expression technique.
Future challenges in this area are:
1. Identification of genes and gene clusters involved in the host–pathogen interaction.
2. Exploitation of pathway analysis within fungal pathogen for culturing non-
culturable pathogens.
3. Understanding of changes in the host due to fungal pathogen invasion at
molecular level.
4. Unveil the intricacies of molecular cross talk between host and the pathogen.
7.8 Integrated Disease Management
The integrated disease management (IDM) is a system approach that combines a

wide variety of crop production and protection methods to minimize the yield losses
caused by fungal pathogens or other microbes. It covers dynamic monitoring of
diseases and conservation of their natural enemies (biocontrol agents).
In IDM, various components of management are so tailored so as to get cost-
effective and eco-friendly approach without any adverse effects on ecosystem. The
IDM is a dynamic approach which includes host resistance, cultural practices, soil
solarization, removal of infected plants, crop rotation, biocontrol agents, etc.
(Table 7.16).
Further, non-lethal dosages of fungicides are also used for the control of specific
fungal diseases. Following is the chart showing different components of Integrated
Plant Diseases Management or IDM (Fig. 7.1).
Table 7.16 Integrated disease management of some plant diseases

Crop Symptom Pathogen Control
Groundnut Leafspot Mycosphaerella Tolerant varieties; inter-cropping with
arachidicola sorghum, pearl millet; foliar spray
of Carbendazim etc.
Phacoisariopsis Resistant varieties; Carbendazim + Mancozeb;
personata deep burrowing of crop residues and
removal of volunteer plants
Sunflower Leaf spot Alternaria helianthi Removal of plant debris
Blight Alternaria alternata Early sowing resistant varieties
Downy Plasmidiophora Mancozeb spray Seed treatment with
mildew halstedii Metalaxyl Apron 35
Rust Puccinia helianthi Altering the sowing date, deep summer
ploughing, resistant varieties
Safflower Leaf blight Alternaria carthami Triazoles, Hexaconazole, Thiram; hot water
treatment; tolerant varieties
Root rot Phytophthora drechsleri Avoidance of mono cropping; use of resistant
varieties
Rust Puccinia carthami Destruction of crop debris; collateral host;
crop rotation; spraying of tridemorph;
resistant varieties
Sesamum Blight Phytophthora parasitica Inter-cropping; application of farmyard
var. sesami manure; biocontrol; seed treatment with
Captan
Wilt Fusarium oxysporum f. Seed treatment with Benlate; biocontrol
sp. sesami
Castor Blight Alternaria carthami Mancozeb application; judicious use of
fertilizer
Grey rot Botrytis ricini Spacing; Carbendazim spray
Root rot Macrophomina Crop rotaion; Thiram, Topsin M-70
phaseolina
Wilt F. oxysporum f.sp. ricini Healthy seeds; Biocontrol; Carbendazim,
Thiram
Management
Genetic Resistance 1. Chemotherapy

Resistant cultivars 2. Systemic chemicals
Quality of seed
Avoidance of Prevention Legislation

pathogen
Eradication of
1. Site selection eradication of pathogen pathogen
2. Growing season’s pathogen
3. Pruning date
Quarantine regulations
4. Seed stock selection
Environmental Protection of host Chemical

manipulation
1. Moisture(Irrigation control) 1. Threshold level
2. Use of soil mixture 2. Action threshold level
3. Slope or terrace 3. Rational control level
4. Solarization
Fig. 7.1 Integrated plant disease management. (Modified from Smith et al. 1976)
7.9 Future Challenges
1. Exhaustive studies are necessary to be attempted on fungal pathogens and in

particular from extreme habitats and different agro-climatic conditions.
2. Attention needs to be given to develop cost-effective, less time consuming and
scientifically accurate disease diagnostic kits including molecular approaches.
3. Innovative methods have to be developed for cultivating non-culturable fungi
and fungal culture collections are to be strengthened.
4. Use of reliable tools to forecast disease epidemics, application of IPM strate-
gies and effective quarantine systems may become important in the future.
Further strengthening of survey and surveillance system is needed.
5. Efforts to be continued to trace out and tag many other novel genes that contrib-
ute towards the disease resistance.
6. Emphasis has to be laid on development of efficient strains of bio-agents
through biotechnological interventions which are cost-effective, efficient with
reasonable shelf life, eco-friendly, non-toxic formulation and suitable to differ-
ent agro-climatic conditions.
7. Scientifically accurate research is essential on the impact of climate change on
disease scenario, succession severity and strategies to overcome the changing
disease situation.
8. Advanced research has to be conducted on functional genomics in relation to

virulence, resistant genes, multiple disease resistance breeding and introduc-
tion of disease resistance in transgenics.
9. Lack of user-friendly bio-informatics platform that supports the integration and
use of available data on major plant pathogens.
10. Survey, surveillance, identification, disease diagnosis and control of fungal dis-
eases which were earlier of minor importance but may become major, hence
emphasis is needed.
11. The synergistic interaction of resistance genes with the IPM is least known and
this holistic approach for plant protection has to be strengthened.
12. Risk assessment is critical for the newly developed fungicides before these are
introduced for commercial use by the farmers. International organizations need
to make more concerted efforts to prepare guidelines for resistance manage-
ment strategies for different groups of fungicides. Further, it requires active
co-operation from farmers, extension pathologists and advisors.
13. Proper understanding of host–pathogen interaction and population level for the
deployment of best genes in different agro-climatic zones and also help in mak-
ing pyramids of best gene combinations in agronomically superior cultivars.
14. Plant compounds that have antifungal activity need to be studied in depth.
15. Plant protection clinics are to be established.
16. Advances in nanotechnology and sensor design suggest that these challenges
should be met in the near future.
17. Proteomics and genomics help in unraveling the mechanisms of fungal patho-
genicity and this understanding needs to be strengthened as these processes
help in development of novel disease tolerant varieties of agriculturally impor-
tant crops.
18. The science of ‘omics’ including transcriptomics will be the functional genom-
ics tools for deciphering plant–pathogen interactions at molecular level. Such
studies will also trigger the process of some unknown host–pathogen interac-
tion, hence proper understanding is necessary.
19. There is a necessity of bringing out an International Agricultural Biosecurity
System for sustainable agriculture.
Acknowledgement One of the authors (CM) is grateful to NASI for financial support.
References
Ajay D, Baby UI (2010) Induction of systemic resistance to Exobasidium vexans in tea through
SAR elicitors. Phytoparasitica 8:53–60
Altramiranda EAG, Andreu AB, Daleo GR, Olivieri FP (2008) Effect of β-aminobutyric acid
(BABA) on protection against Phytophthora infestans throughout the potato crop cycle.
Australas Plant Pathol 37:421–427
Arya A (2010) Recent advances in the management of fungal pathogens of fruit crops. In: Arya A,
Analia E. Perello (eds) Management of fungal pathogens, pp 3–13. www.cabi.org.uk
Arya A, Perello AE (2010) Management of fungal plant pathogens. CABI, Wallingford, p 388
Audenaert K, Demeyer G, Hofte M (2002) Abscisic acid determines basal susceptibility of tomato
to Botrytis cinerea and suppresses salicylic acid-dependent signaling mechanisms. Plant
Physiol 128:491–501
Baker KF (1987) Evaluating concepts of biological control of plant pathogens. Annu Rev
Baker PAHM, Ran LX, Pieterse CMJ, VanLoon LC (2003) Understanding the involvement of
rhizobacteria-mediated induction of systemic resistance in biocontrol of plant diseases. Can J
Belhadj A, Saigne C, Telef N, Cluzet S, Bouscaut J, Corio-Costet F, Mérillon J (2006) Methyl
jasmonate induces defense responses in grapevine and triggers protection against Erysiphe
necator. J Agric Food Chem 54:9119–9125
Belhadj A, Telef N, Cluzet S, Bouscaut J, Coriocostet MF, Mérillon JM (2008) Ethephon elicits
protection against Erysiphe necator in grapevine. J Agric Food Chem 56:5781–5787
Bieri S, Potrykus I, Futterer J (2003) Effects of combined expression of antifungal barley seed
proteins in transgenic wheat on powdery mildew infection. Mol Breed 11:37–48
Böhlenius H, Mørch SM, Godfrey D, Nielsen ME, Thordal-Christensen H (2010) The multivesicu-
lar body-localized GTPase ARFA1b/1c is important for callose deposition and ROR2 syntaxin-
dependent preinvasive basal defense in barley. Plant Cell 22:3831–3844
Borlaug NE (1965) Wheat, rust, and people. Phytopathology 55:1088–1098
Brent KJ (1995) Fungicide resistance in crop pathogens. How can it be managed? FRAC mono-
graph no. 1. Global Crop Protection Federation, Brussels, p 48
Brent KJ, Hollomon DW (1998) Fungicide resistance: the assessment of risk. FRAC monograph
II. Global Crop Protection Federation, Brussels
Brent KJ, Hollomon DW (2000) Fungicide resistance management. Plant Dis Res 15:1–13
Cervone F, Castoria R, Leckie F, De Lorenzo G (1997) Perception of fungal elicitors and signal
transduction. In: Aducci P (ed) Signal transduction in plants. Birkhauser, Basel, pp 153–177
Chagué V, Danit LV, Siewers V, Gronover CS, Tudzynski P, Tudzynski B, Sharon A (2006)
Ethylene sensing and gene activation in Botrytis cinerea: a missing link in ethylene regulation
of fungus-plant interaction? Mol Plant Microbe Interact 19:33–42
Chanda B, Xia Y, Mandal MK, Yu K, Sekine K, Gao Q, Selote D, Hu Y, Stromberg A, Navarre D,
Kachroo A, Kachroo P (2011) Glycerol-3-phosphate is a critical mobile inducer of systemic
immunity in plants. Nat Genet 43(5):421–427. doi:10.1038/ng.798
Chassot C, Buchala A, Schoonbeek HJ, Métraux JP, Lamotte O (2008) Wounding of Arabidopsis
leaves causes a powerful but transient protection against Botrytis infection. Plant J 55:555–567
Chaturvedi R, Krothapalli K, Makandar R, Nandi A, Sparks A, Roth M, Welti R, Shah J (2008)
Plastid omega 3-fatty acid desaturase-dependent accumulation of a systemic acquired resis-
tance inducing activity in petiole exudates of Arabidopis thalliana is independent of jasmonic
acid. Plant J 54:106–117
Cheong YH, Moon BC, Kim JK, Kim CY, Kim MC, Kim IH, Park CY, Kim CJ, Park BO, Koo SC,
Yoon HW, Chung WS, Lim CO, Lee SY, Cho MJ (2003) BWMK1, a rice mitogen-activated
protein kinase, locates in the nucleus and mediates pathogenesis-related gene expression by
activation of a transcription factor. Plant Physiol 132:1961–1972
Cohen Y (2002) β-Aminobutyric acid-induced resistance against plant pathogen. Plant Dis
86:448–457
Cook RJ, Baker RF (1983) The nature and practices of biological control of plant pathogens. APS
Books, St Paul, p 530
Custers JH, Harrison SJ, Sela-Burrlage MB, van Deventer E, Lageweg PW et al (2004) Isolation
and characterization of a class of carbohydrate oxidases from higher plants, with a role in active
defence. Plant J 39:147–160
Dangs JL, Jones JDG (2001) Plant pathogens and integrated defence responses to infections.
Nature 411:826–833
De Vos M, Van Zaanen W, Koornneef A, Korzelius JP, Dicke M, Van Loon LC, Pieterse CMJ
(2006) Herbivore-induced resistance against microbial pathogen in Arabidopsis. Plant Physiol
142:352–363
Deslandes L, Olivier J, Theulieres T, Hirsch J, Feng D, Bittner-Eddy P, Beynon J, Marco Y (2002)

Resistance to Ralstonia solanacearum in Arabidopsis thaliana is conferred by the recessive
RRSI-R gene, a member of a novel family of resistance genes. Proc Natl Acad Sci U S A
99:2404–2409
Desveaux D, Maréchal A, Brisson N (2005) Whirly transcription factors: defense gene regulation
and beyond. Trends Plant Sci 10:95–102, PubMed ID: 15708347
DeVos M, Van Zaanen W, Koornneer A, Korzelius J, Dicke M, Van Loon L, Pieterse C (2006)
Herbivore-induced resistance against microbial pathogens in Arabidopsis. Plant Physiol
142:352–363
Diaz J, ten Have A, van Kan JL (2002) The role of ethylene and wound signaling in resistance of
tomato to Botrytis cinerea. Plant Physiol 129:1341–1351
Dong J, Chen C, Chen Z (2003) Expression profiles of the Arabidopsis WRKY gene super family
during plant defense response. Plant Mol Biol 51:21–37
Dong X, Ji R, Guo X, Foster SJ, Chen H, Dong C, Liu Y, Hu Q, Liu S (2008) Expressing a gene
encoding wheat oxalate oxidase enhances resistance to Sclerotinia sclerotiorum in oilseed rape
(Brassica napus). Planta 228:331–340
Duijff BJ, Poulain D, Olivain C, Alabouvette C, Kamancean C (1998) Implication of systemic
induced resistance in the suppression of Fusarium wilt of tomato by Pseudomonas fluorescens
WCS417r and by non-pathogenic Fusarium oxysporum Fo47. Eur J Plant Pathol 104:903–910
Durrant W, Dong X (2004) Systemic acquired resistance. Annu Rev Phytopathol 42:185–209
Flor HH (1956) The complementary genetic systems in flax and flax rust. Adv Genet 8:29–53
Fowler D, Freedman E, Scannella J (2009) Predatory functional morphology in raptor: interdigital
variation in talon size is related to prey restraint and immobilisation technique. PLoS One
4:1–9
Gogoi R, Singh PK, Kumar R, Nair KK, Alam I, Srivastava C, Yadav S, Subramanyam B, Gopal
M, Roy Choudhury S, Pradhan S, Goswami A (2010) Nano-sulphur offers better protection of
vegetables against powdery mildew caused by Erysiphe cichoracearum. In: 63rd annual meet-
ing national symposium perspective in the plant health management. Indian Phytopathological
Society, 14–16 December 2010, p 41
Gold Statistics (2011) http://www.genomesonline.org/cgi-bin/GOLD/bin/gold. Cgi as accessed on
6 Nov 2011
Gopal M, Gogoi R, Srivastava C, Kumar R, Singh PK, Nair KK, Yadav S, Goswami A (2011a)
Nanotechnology and its application in plant protection. In: Plant pathology in India: vision
2030, IPS, New Delhi, pp 224–232
Gopal M, Roy Choudhury S, Pradhan S, Srivastava, Gogoi R, Kumar R, Goswami A (2011b)
Nanocapsulated hexaconazole: a novel fungicide and the process for making the same. Patent
submitted to ITMU, IARI, Patent application No: 2021/Del/2011
Grant M, Lamb C (2006) Systemic immunity. Curr Opin Plant Biol 9:414–420
Hamann T, Bennet M, Mansfield J, Somerville CR (2009) Identification of cell-wall stress as a
hexose-dependent and osmosensitive regulator of plant responses. Plant J 57:1015–1026
Hammerschmidt R (2007) Introduction: definitions and some history. In: Walters D, Newton A,
Lyon G (eds) Induced resistance for plant defense: a sustainable approach to crop protection.
Blackwell Publishing, Oxford, pp 1–8
Hammond-Kosack K, Jones J (1997) Plant disease resistance genes. Annu Rev Plant Physiol Plant
Mol Biol 48:575–607
Hartley C (1921) Damping off in forest nurseries. U.S. Dept Agric Bull 934. pp 1-99
Heil M, Ton J (2008) Long-distance signaling in plant defense. Trends Plant Sci 13:264–272
Hematy K, Cherk C, Somerville C (2009) Host-pathogen warfare at the plant cell wall. Curr Opin
Plant Biol 12:406–413
IPCC (2007) Climate change 2007. The physical science basis. Contribution on working group I
to the fourth assessment report of the IPCC. In: Solomon SD, Qin D, Manning M, Chen Z,
Marquis M, Averyt KB, Tignor M, Miller HL (eds) Report of the intergovernmental panel on
climate change. Cambridge University Press, Cambridge, p 996
Iwai T, Seo S, Mitsuhara I, Ohashi Y (2007) Probenazole-induced accumulation of salicylic acid
confers resistance to Magnaporthe grisea in adult rice plants. Plant Cell Physiol 48:915–924
Jabs T, Dietrich R, Dangl J (1996) Initiation of runaway cell death in an Arabidopsis mutant by
extracellular superoxide. Science 273:1853–1856
Jalali BL (2008) Molecular plant pathology: where do we stand? J Mycol Plant Pathol 38:
419–429
Joshi S, Chavan V, Kamble A, Bhargava S (2010) Role of salicylic acid and oxidative burst in
expression of resistance to Alternaria blight. Arch Phytopathol Plant Prot 43:1198–1207
Kalde M, Barth M, Somssich IE, Lippok B (2003) Members of Arabidopsis WRKY group III
transcription factors are part of different plant defense signaling pathways. Mol Plant Microbe
Karou D, Dicko M, Simpore J, Traore A (2005) Antioxidant and antibacterial activities of polyphe-
nols from ethnomedicinal plants of Burkina Faso. Afr J Biotechnol 4:823–828
Khan A, Qureshi R, Gillani S, Ullah F (2011) Antimicrobial activity of selected medicinal plants
of Margalla Hills, Islamabad. Pakistan J Med Plants Res 5:4665–4670
Kim JK, Jang IC, Wu R, Zuo WN, Bostan RS, Lee YH, Ahn IP, Nahm BH (2003a) Co-expression
of a modified maize ribosome-inactivating protein and a rice basic chitinase gene in transgenic
rice plants confers enhanced resistance to sheath blight. Transgenic Res 12:475–484
Kim C, Liu Y, Thorne E, Yang H, Fukushige H, Gassmann W, Hildebr D, Sharp R, Zhang S
(2003b) Activation of a stress-responsive nitrogen-activated protein kinase cascade induces the
biosynthesis of ethylene in plants. Plant Cell 15:2707–2718
Klittich CJ (2008) Milestones in fungicide discovery: chemistry that changed agriculture. Plant
Health Progr. doi:10.1094/PHP-2008-0418-01-RV
Kohler A, Scchwindling S, Conrath U (2002) Benzothia diazole-induced priming for potentiated
responses to pathogen infection, wounding and infiltration of water into leaves requires the
NPRI/NIMI gene in Arabidopsis. Plant Physiol 128:1046–1056
Kuc J (2001) Concepts and direction of induced systemic resistance in plants and its application.
Eur J Plant Pathol 107:7–12
Kuhlmann M, Horvay K, Strathmann A, Heinekamp T, Fischer U, Bottner S, Droge-Laser W
(2003) The α-helical D1 domain of the tobacco bZIP transcription factor BZI 1 interacts with
the Ankyrin-repeat protein ANK1 and 1S important for BZI-1 function, both in auxin signaling
and pathogen response. J Biol Chem 278:8786–8794
Kundu S, Chakravarthy D, Pal A (2012) Salicylic acid ameliorates susceptible Vigna mungo culti-
var to Mungbean yellow mosaic virus. Sci Cult 78:5–6
Liu J, Maldonado-Mendoza I, Lopez-Meyer M, Cheung F, Town C, Harisson M (2007) Arbuscular
mycorrhizal symbiosis is accompanied by local and systemic alterations in gene expression and
an increase in disease resistance in the shoots. Plant J 50:529–544
Mandal S, Mallick N, Mitra A (2009) Salicylic acid-induced resistance to Fusarium oxysporum f.
sp. lycopersici in tomato. Plant Physiol Biochem 47:642–649
Martin G, Brommonschenkel S, Chunwongse J, Frary A, Ganal M, Spivey R, Wu T, Earle E,
Tanksley S (1993) Map-based cloning of a protein kinase gene conferring disease resistance in
tomato. Science 262(5138):1432–1436
Martin RR, James D, Levesgue CA (2000) Impact of molecular diagnostic technologies on plant
disease management. Annu Rev Phytopathol 38:207–237
Mehta KC (1933) Rusts of wheat and barley in India—a study of their annual recurrences, life
histories and physiologic forms. J Agric Sci 31:939–962
Mendoza M (2011) Oxidative burst in plant-pathogen interaction. Biotecnol Veg 11:67–75
Mithofer A, Daxberger A, Fromhold-Treu D, Ebel J (1997) Involvement of an NAD(P)H oxidase
in the elicitor-inducible oxidative burst of soybean. Phytochem 45:1101–1107
Mur L, Kenton P, Atzorn R, Miersch O, Wsternack C (2006) The outcomes of concentration-
specific interactions between salicylate and jasmonate signaling include synergy, antagonism,
and oxidative stress leading to cell death. Plant Physiol 140:249–262
Nam JK (2008) Inhibition of powdery mildew development and activation of antioxidant enzymes
by induction of oxidative stress with foliar application of a mixture of riboflavin and methio-
nine in cucumber. Sci Hortic 118:181–188
Nancy T, Patricia S, Irineo T, Rosalia O, Enrique R, Sandra M, Ana F, Adan M, Marcela V, Genero
S, Ramon G (2011) Effect of foliar salicylic acid and methyl jasmonate applications on protec-
tion against pill bugs in lettuce plants (Lactuca sativa). Phytoparasitica 39:137–144
Nunez-Pastrana R, Arcos-Ortega G, Souza-Perera R, Sanchez-Berges C, Nakazava-Ueji Y, Garcia-
Villalobos F, Guzman-Antonio A, Zuniga- Agquilar J (2011) Ethylene, but not salicylic acid or
methyl jasmonate, induces a resistant response against Phytophthora capsici in Habanero pep-
per. Eur J Plant Pathol 131:683–699
Oldach KH, Becker D, Lorz H (2001) Heterologous expression of genes mediating enhanced fun-
gal resistance in transgenic wheat. Mol Plant Microbe Interact 14:832–883
Ori N, Eshed Y, Paran I, Presting G, Aviv D, Tanksley S, Zamir D, Fluhr R (1997) The 12C family
from the wilt disease resistance locus 12 belongs to the nucleotide binding, leucine-rich repeat
super family of plant resistance genes. Plant Cell 9:521–532
Park JH, Choi GJ, Lee HB, Kim KM, Jung HS, Lee SW, Jang KS, Cho KY et al (2005) Griseofulvin
from Xylaria sp. strain F0010, an endophytic fungus of Abies holophylla and its antifungal
activity against plant pathogenic fungi. J Microbiol Biotechnol 15:112–117
Parker J, Coleman V, Szabo V, Frost L, Schmidt R, van der Biezen A, Moores T, Dean C, Daniels
M, Jones J (1997) The Arabidopsis downy mildew resistance gene RPP5 shares similarity to
the toll and interleukin-1 receptors with N and L6. Plant Cell 9:879–894
Pedley K, Martin G (2003) Molecular basis of pro-mediated resistance to bacterial speck disease
in tomato. Annu Rev Phytopathol 41:215–243
Perez L, Rodriguez M, Rodriguez F, Roson C (2003) Efficacy of acibenzolar-S-methyl, an inducer
of systemic acquired resistance against tobacco blue mold caused by Peronospora hyoscyami
f. sp. tabacina. Crop Prot 22:405–413
Pieterse C, Van Loon L (2007) Signaling cascades involved in induced resistance. In: Walter S,
Newton A, Lyon G (eds) Induced resistance for plant disease control: a sustainable approach to
crop protection. Blackwell Publishing, Oxford, pp 65–88
Pieterse C, Ton J, Van Loon L (2001) Cross-talk between plant defence signalling pathways: boost
or burden? Ag Biotech Net 3:1–8
Powell ALT, Hallewin DG, Hall BD, Stotz H, Labavitch JM, Bennett AB (1994) Glycoprotein
inhibitors of fungal polygalacturonases expression of pear PGIP improves resistance in trans-
genic tomatoes. Plant Physiol 105:159
Ray R, Ghosh A, Bera A, Dutta N, Chattopadhyay D, Chakrabarti K (2011) Analysis of differen-
tially expressed transcripts in jute upon fungal infection and beta-amino butyric acid treatment.
Romero D, Rivera M, Cazorla F, Codina J, Fernandez-Ortuno D, Tores J, Perez-Garcia A, de
Vicente (2008) Comparative histochemical analyses of oxidative burst cell wall reinforcement
in compatible and incompatible melon-powdery mildew (Podosphaera fusca) interaction.
J Plant Physiol 165:1895–1905
Rushton PJ, Somssich IE (1998) Transcriptional control of plant genes responsive to pathogens.
Curr Opin Plant Biol 1:311–315
Serge S, Andrew N, Sparks A, Willocquet HL, Duveiller E, Madhuku G, Forbes G, Garrett K,
Hudson D, Padgham J, Pande S, Sharma M, Yuen J, Djurie A (2011) International agricultural
research tackling the effects of global and climate changes on plant diseases in the developing
world. Plant Dis 59:1204–1216
Shao H, Chu L, Shao M, Jaleel C, Mi H (2008) Higher plant antioxidants and redox signaling
under environmental stresses. C R Biol 331:433–441
Shetty N, Mehrabi R, Lutken H, Haldrup A, Kema G, Collinge D, Jorgensen H (2007) Role of
hydrogen peroxide during the interaction between the hemibiotrophic fungal pathogen Septoria
tritici and wheat. New Phytol 174:637–647
Siegrist J, Orober M, Buchenauer H (2000) α-Aminobutyric acid mediated enhancement of resis-
tance in tobacco to tobacco mosaic virus depends on the accumulation of salicylic acid. Physiol
Mol Plant Pathol 56:95–106
Slaughter A, Daniel X, Flors V, Luna E, Hohn B, Mauch-Mani B (2012) Descendants of primed
Arabidopsis plants exhibit resistance to biotic stress. Plant Physiol 158:835–843
Smith RI, Apple JL, Bottrell DG (1976) Broad based integrated plant disease management. In:
Apple JL, Smith RF (eds) The origins of integrated pest management concepts for agricultural
crops integrated pest management. Plenum Press, New York, pp 1–16
Song W, Wang G, Chen L, Kim H, Pi L, Holsten T, Garden J, Wang B, Zhai W, Zhu L, Fauquet C,
Ronald P (1995) A receptor kinase-like protein encoded by the rice disease resistance gene,
Xa21. Science 270:1804–1806
Song W, Ma X, Tan H, Zhou J (2011) Abscisic acid enhances resistance to Alternaria solani in
tomato seedlings. Plant Physiol Biochem 49:693–700
Soylu S, Brown I, Mansfield J (2005) Cellular reaction in Arabidopsis following challenge by
strains of Pseudomonas syringae from basal resistance to compatibility. Physiol Mol Plant
Pathol 66:232–243
Stenzel I, Hause B, Proels R, Miersch O, Oks M, Roitsch T, Wasternack C (2008) The AOC pro-
moter of tomato is regulated by developmental and environmental stimuli. Phytochemistry
69:1859–1869
Sticher L, Mauch-Mani B, Metraux J (1997) Systemic acquired resistance. Annu Rev Phytopathol
35:235–270
Strobel GA (2003) Endophytes as sources of bioactive products. Microbes Infect 5:535–544
The Arabidopsis Genome Initiative (2000) Analysis of the genome sequence of the flowering plant
Arabidopsis thaliana. Nature 408:796–815
Thind TS (2008) Fungicide resistance: a potential challenge in disease control. J Mycol Plant
Pathol 38:407–418
Thind TS (2011) Agricultural fungicides: present scenario and future needs. In: Plant pathology in
India: vision 2030, IPS, New Delhi, pp 206–211
Ton J, Mauch-Mani B (2004) β-aminobutyric acid-induced resistance against necrotrophic patho-
gen is based on ABA-dependent priming for callose. Plant J 38:119–130
Tripathi P (2005) Botanical pesticides in the management of post harvest fruit diseases. Daya
Publishing House, New Delhi, p 174
Trouvelot S, Varnier AL, Allègre M, Mercier L, Baillieul F, Around C, Gianazzi-Pearson V,
Klarzyynski O (2008) A β-1,3 glucan sulfate induces resistance in grapevine against
Plasmopara viticola through priming of defense responses, including HR-like cell death. Mol
Plant Microbe Interact 21:232–243
Van der Plank JE (1963) Plant disease epidemics and control. Academic, New York, p 349
Van Loon L, Rep M, Pieterse C (2006) Significance of inducible defense-related proteins in
infected plants. Annu Rev Phytopathol 44:135–162
Varma J, Dubey ND (1999) Prospectives of botanical and microbial products as pesticides of
tomorrow. Curr Sci 76:172–179
Von Dahl C, Baldwin I (2007) Deciphering the role of ethylene in plant herbivore interactions.
J Plant Growth Regul 26:201–209
Von Tubeuf CF (1914) Biologische Bekämpfung von Pilzkrankheiten der Pflanzen. Naturw Z
Forst-Landw 12:11–19
Waggoner PE, Horsfall IG (1969) Epidem—a simulator of plant disease written for a computer In:
Bull Conn Agric Expt Stn No 698. Connecticut, p 80
Waller F, Achatz B, Baltruschat H, Fodor J, Becker K, Fischer M, Heier T, Hu Chelhoven R,
Neumann C, Von Wettstein D, Franken P, Kogel K (2005) The endophytic fungus Piriformospora
indica reprograms barley to salt-stress tolerance, disease resistance and higher yield. Proc Natl
Acad Sci U S A 102:13386–13391
Wietholter N, Graebner B, Mierau M, Mort A, Moerschbacher B (2003) Differences in the methy-
lester distribution of homogalacturonans from isogenic wheat lines resistant and susceptible to
the wheat stem rust fungus. Mol Plant Microbe Interact 16:945–952
Xing T, Jordan M (2000) Genetic engineering of plant signal transduction mechanisms. Plant Mol
Biol Rep 18:309–318
Yoshioka K, Nakashita H, Klessig D, Yamaguchi I (2001) Probenazole induces systemic acquired
resistance in Arabidopsis with a novel type of action. Plant J 25:149–157
Zhang HW, Sarg YC, Tan RX (2006) Biology and chemistry of endophytes. Natl Prod Rep
23:753–771
Zhao J, Zheng SH, Fujita K, Sakai K (2004) Jasmonate and ethylene signaling and their interaction
are integral parts of the elicitor signaling pathway leading to beta-thujaplicin biosynthesis in
Cupressus lusitanica cell cultures. J Exp Bot 55:1003–1012
Zhao J, Wang Y, Zhang J, Han Y, Yang Z, Feng W (2012) Induction of defensive enzymes
(isozymes) during defense against two different fungal pathogens in pear calli. Afr J Biotechnol
11:13670–13677
Zhou J, Trifa Y, Silva H, Pontier D, Lam E, Shah J, Klessig D (2000) NPRI differentially interacts
with members of the TGA/OBF family of transcription factors that bind an element of the PR-1
gene required for induction by salicylic acid. Mol Plant Microbe Interact 13(2):191–202
Chapter 8
Ug99-Future Challenges
Subhash Chander Bhardwaj, Mohinder Prashar, and Pramod Prasad
8.1 Introduction
Wheat, the second most important staple food crop after rice as a source of calories
and first as a source of protein in the diets of developing country consumers, is
grown on about 225 million ha worldwide from the equator to latitudes of 60°N and
44°S and at altitudes ranging from near sea level to more than 3,000 m.
Approximately 600 million tons of wheat is produced annually, roughly half of
which is in the developing countries (Aquino et al. 2002). Wheat provides 21 % of
the food calories and 20 % of the protein to the tune of more than 4.5 billion people
across 94 developing countries (Braun et al. 2010). The projected demand for
wheat is estimated to increase by 60 % by 2050 in developing countries; at the same
time, climate change-induced temperature increases, diseases and other pests are
expected to reduce wheat production by more than 29 % in developing countries
(Rosegrant et al. 1995). The major fungal diseases of wheat that are caused by bio-
trophs, include the three rusts, powdery mildew, bunts and smuts; whereas, those
caused by hemi-biotrophs include blotches, foliar blight, tan spot and Fusarium
head blight (scab).
Among the rusts, stem or black rust, caused by Puccinia graminis Pers. f. sp.
tritici Eriks. & Henn., is infamous for causing severe losses to wheat (Triticum aes-
tivum L. and T. turgidum var. durum) production. Historically, the most damaging
disease of wheat has the capacity to turn a healthy looking crop, only weeks away
from harvest, into nothing more than a tangle of black stems and shrivelled grains at
S.C. Bhardwaj, Ph.D. (*) • P. Prasad, Ph.D.

Regional Station, Directorate of Wheat Research, Flowerdale,
Shimla, Himachal Pradesh 171002, India
e-mail: scbfdl@hotmail.com
M. Prashar, Ph.D.
Maharashtra Hybrid Seeds Company Limited, Aurangabad Road, At Dawalwadi,
Tq Badnapur, PO Box 76, Dit. JALNA 431203 Jalna, Maharashtra, India

232 S.C. Bhardwaj et al.
harvest. Under severe conditions, yield losses of 100 % are possible (Anonymous
1992). Stem rust is known for causing severe devastations periodically in all
wheat-growing countries of the world.
The causal organism of stem rust was named Puccinia graminis in 1797 by
Persoon and the first detailed reports about this pathogen were given independently
by Italian Scientists Fontana (1932) and Tozetti and Alimurgia (1952). Stakman and
Piemeisel (1917) showed that stem rust pathogen had various forms or races. Many
devastating epidemics of stem rust of wheat are reported to have occurred in the past
around the globe. The notable ones being the epidemics of North America in 1904
and 1916. In 1993 and 1994, the last major stem rust epidemic occurred in Ethiopia
(Shank 1994), where Enkoy, a popular wheat variety, suffered major losses; how-
ever, the rest of the world has remained unscathed by stem rust for over four decades.
Puccinia graminis tritici (Pgt) is a basidiomycetous rust fungus, having a broad
host range with an ability to infect about 365 species of plants (Anikster 1984).
P. graminis has been broken into subspecies and formae speciales based on spore
morphology, fertility crosses and host range. Urban (1967) separated the species
into two subspecies based on morphology. Subspecies graminicola contained stem
rusts found on non-cereal grasses while subspecies graminis contained the stem
rusts found on cereal crops. Subspecies graminis was then further divided into vari-
ety stakmanii, found on barley, oat and rye and variety graminis, which is found
mainly on wheat. The subspecies proposed by Urban are in disagreement with for-
mae speciales designations based on fertility crosses. Crosses between formae spe-
ciales tritici and secalis and between avenae and poae were found to produce viable
offspring (Johnson 1949). Pgt infects cereal crops as urediniospores during the warm
months. Urediniospores are dikaryotic (n + n) and spread via agitation of the host
plant such as from rain or wind. These spores can land on other cereal hosts and
germinate to cause new infection. This process is the asexual stage of the fungus
and can result in rapid increase of the organism. Near late summer when tempera-
tures begin to drop teliospores are produced. These teliospores undergo karyogamy
before overwintering (Boehm et al. 1992). In early spring the teliospores germinate
producing four haploid basidiospores per spore cell. Basidiospores are carried by
agitation to Berberis species where they directly penetrate the leaf tissue forming
pycnia. Pycnia produce receptive hyphae, haploid pycniospores belonging to one of
the two mating types (Johnson and Newton 1946). The pycniospores can be wind
and water dispersed as well as transferred by insects that are attracted to the exu-
dates (Leonard and Szabo 2005). When pycniospores of one mating type are trans-
ferred to receptive hyphae of a pycnium of the compatible mating type, aecia are
formed below the pycnium (Johnson and Newton 1946). The aecia produce diploid
aeciospores, which infect wheat and form uredia (Roelfs 1985). In the presence of
water urediniospores (uredospores) germinate producing a germ tube (Leonard and
Szabo 2005). The germ tube grows along the epidermis toward the stoma. If the
germ tube comes in contact with a stoma, it will form an appressorium. From the
base of the appressorium a penetration peg grows into the substomatal cavity and
forms a vesicle. The substomatal vesicle then elongates and hyphae grow inside the
8 Ug99-Future Challenges 233
plant tissue. Once a hypha comes in contact with a cell wall a haustorial mother cell
is formed. The haustorial mother cell exudes enzymes in order to dissolve the plant
cell wall. Upon invaginating the cell, a haustorium is produced. The haustoria are
responsible for the exchange of nutrients and proteins with the plant and are required
for sustaining the growth of the fungus. The genome of Pgt was determined to be
made of 18 chromosomes (Boehm et al. 1992) and was estimated by genome
sequence assembly to be 88.6 Mb (Duplessis et al. 2011). No evidence for whole
genome duplication was found but the larger than expected genome seems to be a
result of a large number of transposable elements, which composed 45 % of the
genome (Duplessis et al. 2011). About 17,773 protein coding genes were predicted,
of which only 35 % showed significant homology to known proteins (Duplessis
et al. 2011).
An important finding came from the pioneering work of Dr. E.C. Stakman
(Stakman and Piemeisel 1917) who showed that the stem rust pathogen had various
forms or races. These races differ in their ability to infect different wheat varieties
which were later found to carry distinct resistance genes or their combinations.
At present wheat scientists use wheat lines that usually carry a single race-specific
resistance gene to determine avirulence/virulence characteristics of a race. The
races of Pgt are determined by phenotypic avirulence/virulence testing on a stan-
dard set of wheat differentials. Nomenclature used for designating Pgt races has
evolved, starting with a chronological numbering system by Stakman (Stakman and
Levine 1922) into the current system (Roelfs and Martens 1988). This system is
based on the infection types produced on different isolates of Pgt lines of wheat.
Infection types are classified as: 0—no infection; flecking, 1—small uredia often
surrounded by necrosis; 2—small to medium size uredia surrounded by necrosis or
chlorosis; 3—medium uredia associated with chlorosis; 4—large uredia without
chlorosis or necrosis (Roelfs and Martens 1988). An infection type of 0, 1 or 2 was
designated to be a resistant reaction where as 3 or 4 a susceptible reaction. In India,
binomial system for designating the pathotypes of Pgt is followed (Bahadur et al.
1985) and which is being updated from time to time (Bhardwaj 2012).
8.2 Stem Rust Epidemiology in India
In India cyclonic movement that forms in the Bay of Bengal in November, crosses
over to the Arabian Sea around 10°N, subsequently such deep depression re-
curves and hits the western coast enabling a long distance dispersal of Pgt uredin-
iospores from Nilgiris to central India (Nagarajan et al. 1976). Nagarajan and
Singh (1975) developed the Indian Stem Rust Rules (ISR) to define the climatic
situation that enables long distance spread of Pgt. North Indian hills do not play
much role in the recurrence of stem rust in India (Bhardwaj et al. 2012), as very
weak and primitive type of pathotypes were observed in these areas, which do not
occur elsewhere in India.
8.3 Emergence and distribution of Ug99
Many sources of resistance including the alien sources have been used for stem rust
resistance. Introduction of rye (Secale cereale L.) gene (1B/1R translocation or sub-
stitution) into bread wheat (Mettin et al. 1973; Zeller 1973) which carries
Lr26/Sr31/Yr9, completely linked resistance gene has not only contributed 12–20 %
yield jump but also imparted resistance to major biotic and abiotic stresses (Cox
et al. 1995). During many years, Sr31 and other stem rust resistance genes kept the
stem rust fungus under control, thus it was believed that genetic resistance had over-
powered this ancient plague of stem rust. Stem rust of wheat had became a disease
of past, unfortunately a new race of Pgt was observed in Uganda in 1998 (Ug99) that
has the ability to overcome the resistance imparted by majority of the resistance
genes including Sr31, which have provided protection for the last 60 years (Singh
et al. 2011). The Ug99 race of Pgt was discovered by William W. Wagoire in an
experimental wheat field from the Buginyanya Zonal Agricultural Research and
Development Centre in Uganda. Ravi Singh at CIMMYT quickly recognized Ug99’s
potential to devastate wheat crops (Fig. 8.1) and thereafter it was confirmed as a new
strain of P. graminis by Zacharias A. Pretorius from the University of the Free State
in Bloemfontein, South Africa. Initially the collections of Ug99 were designated
as TTKS based on the North American nomenclature system and redesignated as
TTKSK after adding a fifth set of differentials in the nomenclature system (Jin et al.
2008). The emergence of Ug99 is considered a highly significant event having far
reaching consequences not only for India but also for global wheat production due
to susceptibility of most of the wheat cultivars against Ug99 (Fig. 8.2).
It has been estimated by Singh et al. (2008) that the area under the risk of Ug99
amounts to around 50 Mha of wheat grown globally, i.e. about 25 % of the world’s
wheat area. Varieties of Indian subcontinent like PBW343, PBW373 and few others
are susceptible to these races. The race is expected to move further in coming years to
other areas, where wheat is one of the major food crops. Germplasm with resistance
to Ug99 is available in many parts of the world including India (Singh et al. 2008).
Fig. 8.1 Stem rust infection

on PBW343 in Ethiopia
Fig. 8.2 Shrivelled seeds produced in a wheat variety infected with Ug99 (Source Dr. Rabi Singh,
CIMMYT, Mexico)
Being wind borne, the stem rust pathogen is capable of causing explosive
epidemics. They are known to produce millions of urediniospores and these spores
are transferred from one plant to other plant or from one area to the other. The long-
distance dispersal (LDD) through the agency of air and may be unintended human
interactions is well documented for wheat rusts. A major mode of dispersal for
wheat rusts is stepwise range expansion through wind. It usually occurs over shorter
distances, i.e. within country or region, and has a much higher probability of suc-
cessful dispersal of the disease than other possible modes of dispersal. One interest-
ing example of such type of dispersal mechanism is the spread of stripe rust by
Yr9-virulent race of P. striiformis that evolved in Eastern Africa. This race migrated
to South Asia through the Middle East and West Asia in a stepwise manner over
about 10 years, and caused severe epidemics in its path (Singh et al. 2004).
Some of the important examples of LDD include the introduction of sugarcane
rust into the America from Cameroon in 1978 and a wheat stem rust introduction
into Australia from southern Africa in 1969. More recently, the arrival of Asian
soybean rust into the USA in 2004 from North to South America/Caribbean was
most likely carried by hurricane Ivan (Anonymous 2005). At present, assisted long-
distance dispersal is also believed to occur by the clothing of travellers or infected
plant material. There is strong evidence to support an accidental introduction of
wheat yellow rust into Australia in 1979, probably on travellers clothing from
Europe (Steele et al. 2001). Spread of stem rust race from Antarctic to New Zealand
is well documented (McEvans 1969)
Ug99 has the similar story of its dispersal. According to Singh et al. (2008), the
Ug99 race had been confirmed in Uganda, Kenya, Ethiopia, Sudan and Yemen up to
2007. By then, occurrence in Yemen was considered particularly significant, as it
Fig. 8.3 Movement and distribution of different variants of Ug99 (Source Dr. Ravi Singh,
CIMMYT, Mexico)
provided strong evidence that Ug99 was moving toward the important wheat areas
of the Middle East and Asia (Singh et al. 2011). Subsequently, Ug99 race (TTKSK)
was reported from Iran, by FAO (Food and Agriculture Organization) in March
2008 (FAO 2008). In 2009 Ug99 was reported from Khuzestan, one of the provinces
in southern Iran. There were few reports of the occurrence of Ug99 in Pakistan dur-
ing 2009, but pathotyping on differentials and DNA analysis of those samples con-
vincingly indicated the absence of Ug99 (Mirza et al. 2010). So far it is not reported
to occur in India also. The Ug99, is evolving very fast and till date eight variants
have been documented as the progenies of this race (Singh et al. 2011) as given in
Fig. 8.3. The highlands of east Africa have historically been a hot spot for the devel-
opment of highly virulent races of Puccinia sp. Factors contributing to the develop-
ment of highly virulent races of wheat rust include the year-round cultivation of
susceptible wheat genotypes creating ideal conditions for disease development.
All the variants differ slightly in their avirulence/virulence profiles but genetically
they are closely interrelated with nearly related DNA fingerprints. Simple sequence
repeats marker similarity of Ug99 races have revealed that they evolved from a com-
mon ancestor. Race TTKSK (Ug99) is the only known pathotype of the lineage
group, which is reported outside of Africa, but it is very likely that other members
of the group may appear in the areas outside Africa. Race Ug99 has further evolved
and the family has now eight members (Table 8.1).
Table 8.1 Variants in Ug99 over the years

Common Key virulence (+) Year of
Race alias or avirulence (−)a identification Confirmed countries (year)
TTKSK Ug99 +Sr31 1999 Uganda (1998/1999), Kenya
(2001), Ethiopia (2003),
Sudan (2006), Yemen (2006),
Iran (2007), Tanzania (2009)
TTKSF – −Sr31 2000 South Africa (2000), Zimbabwe
(2009)
TTKST Ug99 + Sr24 +Sr31, +Sr24 2006 Kenya (2006), Tanzania (2009),
Eritrea (2010)
TTTSK Ug99 + Sr36 +Sr31, +Sr36 2007 Kenya (2007), Tanzania (2009)
TTKSP – −Sr31, +Sr24 2007 South Africa (2007)
PTKSK – +Sr31, −Sr21 2007 Uganda (1998), Ethiopia (2007),
Kenya (2009)
PTKST – +Sr31, +Sr24, −Sr21 2008 Ethiopia (2007), Kenya (2008),
South Africa (2009), Eritrea
(2010), Mozambique (2010),
Zimbabwe (2010)
TTKSF+ – −Sr31 2012 South Africa (2010), Zimbabwe
(2010)
a
Characteristic features not the complete avirulence/virulence given
Till now Ug99 race migration has followed gradual stepwise range expansion,
following the predominant West-East air flows. Moreover, there is well-recognized
evidence connecting East Africa with West and South Asia as a single epidemio-
logic zone for migration of rust races, with East African origin (Singh et al. 2004).
Keeping these facts in view, a group of wheat rust experts had forecasted in the year
2005 that within few years Ug99 shall reach across the Saudi Arabian peninsula and
into the Middle East, South Asia, and eventually East Asia and the Americas
(Anonymous 2005). Interestingly, recent evidences also support their forecast. The
data obtained from GIS tools determines two potential air-borne migration routes
for Ug99 to south Asia (Hodson et al. 2005). The first route matches the route
described by Singh et al. (2004) for the Yr9-virulent race of P. striiformis and is
considered the most likely route. The second route that connects East Africa directly
with southern Pakistan/western India has no known precedence and is highly specu-
lative and of much low probability (Joshi et al. 2008). So far, the movement of Ug99
has followed the first route and as mentioned above has reported to cross the Arabian
Gulf in the 2006 crop season. Thus, predicting the exact route of the Ug99 move-
ment for near future is not going to be that easy as the disease outcomes would
depend on host susceptibility, prevailing environmental conditions and many other
factors. Keeping in view the facts and figures, it may not be an issue in North
Western Plain Zone of India (Nagarajan 2012).
More detailed analysis of further potential movements of Ug99 have been
undertaken using the HYSPLIT (Hybrid Single-Particle Lagrangian Integrated
Trajectory), an air-borne particle trajectory model developed by National Oceanic
and Atmospheric Administration (NOAA), USA (Draxler and Rolph 2003), which
supports the hypothesis that Yemen could be a staging post for onward movement
into the Middle East and Asia. Expanding known range of Ug99 across continent
and high mobility of people nationally and internationally, make us to think of the
need for continuous monitoring and surveillance in all wheat-growing regions of
the world.
8.4 History Repeats Itself
When Lr26 was incorporated through 1B/1R translocation for rust resistance, it not
only conferred resistance to stem and stripe rust but also gave many advantages
(Mettin et al. 1973; Zeller 1973). Few years of its introgression-virulent mutants
were identified in Europe (Bartos et al. 1984), India (Nayar et al. 1987), North
America (Kolmer 1991) and elsewhere, mostly these were independent mutations
for gain in virulence for Lr26. In India first variant of P. triticina was identified in
1986 (Nayar et al. 1987) and now there are 19 pathotypes with virulence to Lr26 and
10 with combined virulence to Lr23 and Lr26 (Bhardwaj 2012). Likewise, virulence
to Sr24 was identified in South Africa in 1984 (Roux and Rijkenberg 1987) whereas
in India an independent mutation in pathotype 40A resulted in pathotypes 40-1 with
virulence for Sr24 (Bhardwaj et al. 1990). Prior to that, Sr24 used to confer resis-
tance for stem rust in India. Many incidents of independent mutations for virulence
for one gene are well known in wheat rusts, example of Yr9 (McIntosh et al. 1995)
is well documented. Nagarajan (2012) has classified North Pakistan and NW India
zone (Indo-Gangetic Plains) comprising more than 14 Mha under bread wheat, as
Epidemiological zone III. Referring to earlier publications (Mehta 1940, 1952;
Joshi et al. 1971; Nagarajan and Joshi 1985) the proposed threat due to Pgt Ug99
(Singh et al. 2006, 2008, 2011 and Stokstady 2007) is not relevant to wheat produc-
tion of NWPZ. Thus, keeping an eye on independent mutation and proneness of
Peninsular and Central India and adjoining areas a long-term strategy is in place to
combat this threat.
8.5 Ug99-Risk Mitigation Strategies
The estimated feasible area under the risk of Ug99 along its natural migration path
in North Africa, Middle East and Asia (excluding China) might amount to 50 mil-
lion ha of wheat, that is, about 25 % of the world’s wheat area and accounting for an
estimated 19 % of global production amounting to about 117 million tons (Reynolds
and Borlaug 2006). If somehow the Ug99 reaches to these regions, it would affect
estimated one billion people living in these parts of the world. To avoid such type of
catastrophe, one of the best strategies is to identify and deploy resistant wheat geno-
types that can prove suitable for the regions, which are really prone to Ug99.
Extensive screening of wheat genotypes across the hotspots for Ug99 can be done
to identify area-specific potential wheat genotypes with resistance to Ug99.
8.6 Borlaug Global Rust Initiative
Borlaug Global Rust Initiative (BGRI) (earlier Global Rust Initiative) was implemented
on September 9, 2005 at Nairobi, Kenya with the objectives: to monitor the spread of
wheat stem rust race Ug99, to screen the released varieties and germplasm for resis-
tance to Ug99, to distribute the sources of resistance worldwide, breeding to incorpo-
rate diverse resistance genes and adult plant resistance gene into high-yielding
adapted varieties. Under the framework of BGRI, the evolution and migration of the
Ug99 group of races are being monitored carefully so as to provide early warning to
the farmers and wheat rust researchers in case of an epidemic. It will help the farmers
as well as researchers in decision making. India, one of the strong partners of BGRI,
is actively participating in the germplasm testing in Kenya and Ethiopia along with
that from CIMMYT, ICARDA and various other countries. The success of BGRI lies
in a timely replacement of stem rust susceptible cultivars with resistant ones having
equal or better yield potential and other necessary characteristics.
Global Cereal Rust Monitoring System (GCRMS) has been implemented under
the umbrella of BGRI, Consultative Group on International Agricultural Research
(CGIAR) centres, advanced research labs, national agricultural programmes and
UN-FAO to integrate and disseminates up-to-date information on stem rust inci-
dence, severity, as well as races. It has resulted in to emergence of strong, rapidly
expanding, coordinated international rust surveillance network. So far more than 15
countries are reporting standardized field survey and surveillance data on wheat rust
disease incidence and severity, and this number is expected to rise further in near
future (Singh et al. 2011).
8.7 Durable Rust Resistance in Wheat Project
In April 2008 a collaborative effort began, the Durable Rust Resistance in Wheat
(DRRW) Project led by Cornell University, seeks to mitigate the threat posed by
Ug99 and other potential races causing wheat rust through the coordinated activities
that will replace susceptible varieties with durably resistant varieties. The DRRW
also aims to harness recent advances in genomics to introduce non-host resistance
(immunity) into wheat. The major goal of the project is to improve international
collaboration in wheat research to meet growing world food demand, which is esti-
mated as 50 % production increase in wheat by 2020.
8.8 Screening and Deployment of Ug99 Resistant Global

Wheat Varieties
As preparedness for combating the probable threat of Ug99, more than 250,000
wheat varieties, germplasm collections, and advanced breeding materials from
wheat producing countries of Africa and Asia, were screened for resistance to stem
rust race Ug99 and its derivatives at Njoro, Kenya and to a lesser extent, at Kulumsa
and Debre Zeit, Ethiopia from 2005 to 2012. Out of total materials screened more
than 85 % of materials from various countries were found to be susceptible to the
Ug99 group of races. During 2005 and 2006, about 10 % wheat material from
South America, Australia, USA and CIMMYT was documented as resistant to
Ug99 race, possessing resistance gene Sr24, linked to leaf rust resistance gene
Lr24. Unfortunately, during 2006 TTKST, another race in Ug99 lineage with viru-
lence to Sr24 was detected in Kenya (Jin et al. 2008) and by 2007 it had built up
sufficiently to cause an epidemic on the Sr24-carrying variety Mwamba, with
about 30 % of the wheat area in Kenya at that time. TTKST is now the predominant
stem rust race in Kenyan fields, and a majority of wheats carrying Sr24, including
many hard red winter wheats that were resistant to the original Ug99, are now
showing high susceptibility to TTKST in field screening nurseries (Singh et al.
2011). Similarly, in 2007 resistance rendered to Ug99 race by Sr36 gene for US
wheats and for some spring wheats from Australia was knocked out by TTTSK, a
new variant of Ug99 group. Interestingly, during the screening for Ug99 race resis-
tance, it was observed that in contrast to bread wheat, a larger proportion of durum
wheat varieties and germplasm were showing resistance to all the races of the
Ug99 lineage. This phenomenon was attributed to the presence of stem rust resis-
tance gene Sr13 in most of the durum wheat germplasm. Again the Ug99 race got
mutated to produce two new races TRTTF and JRCQC in the Ug99 lineage from
Ethiopia; both of them were able to breakdown the resistance to durum wheat pro-
vided by Sr13. TRTTF race, with virulence to Sr13, SrTmp, and Sr1A.1R has been
reported from Africa, the Middle East, and Asia, thus reducing the focus in the
utilization of these resistance genes in breeding programmes. It is predicted that
most of the wheat-growing regions of the world will suffer more and more in the
future because of existing favourable environmental conditions for stem rust build
up and unavailability of suitable Ug99 race resistance wheat germplasm, which
could lead to epidemic build up.
8.9 Exploring Available Ug99 Resistance Genes
To date, 58 genes have been designated for resistance to wheat stem rust (McIntosh
et al. 2011; Mc Intosh personal comm). Over the last century, these genes have been
identified within common wheat and wild relatives. Many Sr genes of common
wheat origin have been deployed during major efforts to incorporate genetic resis-
tance to stem rust in wheat cultivar development. Of the designated Sr genes many
are single-locus major genes (McIntosh et al. 2011) conferring resistance at all
stages of plant development, sometimes with varying effectiveness at the adult plant
stage. Resistance can also be conferred by multiple minor genes that individually
contribute small effects but together contribute significantly to the resistance pheno-
type. Stem rust resistance from two genes Sr2 and Sr55 are unique in a way that they
confer quantitative adult plant resistance to stem rust and are pleiotropic (McIntosh
et al. 1995); conferring resistance to diseases including leaf rust, stripe rust and
powdery mildew. Major gene resistance to rust pathogens of wheat generally oper-
ates in a gene-for-gene manner where a single disease resistance gene corresponds
to a single avirulence factor in the pathogen. Most stem rust seedling resistance
genes confer a strong defence response involving chlorosis or necrosis that limit the
formation and spread of fungal hyphae and uredia in host tissues. The type of
defence response and the presence of either chlorosis or necrosis differ, sometimes
greatly, between individual Sr genes and are used to classify the phenotypic expres-
sion of resistance (Stakman et al. 1962). Sr5, Sr17, Sr27, Sr35 and Sr36 all confer
low, hypersensitive infection types whereas Sr22, Sr29 and Sr33 confer low chlo-
rotic infection types (McIntosh et al. 1995).
In contrast, major gene resistance to stem rust that is race specific and observed
at the seedling stage, stem rust resistance conferred by adult plant resistance (APR)
genes is non-race specific and is expressed in adult plants. Most APR genes are
minor genes acting as quantitative trait loci (QTL). The accumulation of multiple
minor genes contributing to resistance has the effect of generating high levels of
resistance in adult plants (Singh et al. 2011). One of the most widely utilized adult
plant resistance genes is Sr2. The gene is most effective in combination with other
resistance genes with small effects. The “Sr2-Complex” comprising Sr2 in combi-
nation with up to five additional stem rust resistance genes with small effects con-
tinues to be bases of adult plant resistance to stem rust in international breeding
efforts (Singh et al. 2011). Although there are several genes showing considerable
amount of resistance to Ug99 group of stem rust races yet, only Sr22, Sr26, Sr35
and Sr50 are known to be effective against all currently reported races of the group.
Sr25 is known to confer high level of resistance only in some specific genetic
backgrounds, especially when present with adult plant resistance gene; Misr 1 in
Egypt and Muquawin 09 in Afghanistan are the example of such varieties with gene
combination of Sr25 and Sr2. Jain and co-workers (2009) reported PKTSC, a race
of stem rust from Nilgiri Hills of India in 2007, possessing virulence to Sr25 and
several other resistance genes; it reduced the utility of Sr25 in future breeding pro-
grammes. Sr26 gene transferred to wheat chromosome 6AL from Triticum elonga-
tum is likely to be utilized in many breeding programmes because of its availability
in adapted genetic backgrounds. Screening of genes Sr29, Sr32, Sr37, Sr39, Sr40
and Sr44 have not been done that widely for their effectiveness to races in Ug99
lineage, which could be useful in breeding programme for stem rust resistance.
A resistance gene temporarily designated as SrCad, located on chromosome
6DS and present in Canadian wheat varieties AC Cadillac and Peace, confers mod-
erate resistance to the Ug99 group of races when present alone and a high level of
resistance when present together with slow rusting leaf rust resistance gene Lr34
(Hiebert et al. 2010). Similarly, a few other temporarily designated genes (SrSha7
derived from Chinese cultivar Shanghai#7, SrND643 from ND643 and SrHuw234
from HUW234) are present in improved wheat materials and, when present alone,
confer moderate levels of resistance to the Ug99 group of races (Singh et al. 2011).
8.10 Breeding Approaches and Meeting Durable

Resistance Against Ug99
Both major gene and minor gene resistance drive evolution of Pgt populations.
Major genes, when deployed singly, have the effect of generating directional selec-
tion toward virulence resulting in boom and bust cycles. The result of continuous
boom and bust cycles are a diminished gene pool of effective stem rust resistance
genes. Minor genes also exert selection on Pgt populations. However, the result of
selection is not a qualitative change as a single mutation from Avr to avr but as a
quantitative increase in aggressiveness. Presumably, resistance from minor genes
does not involve the recognition of Avr gene products to trigger resistance and will
not induce selection pressure in pathogen populations for mutations in major gene
targets. Both mechanisms of resistance show the potential to break down but quan-
titative resistance has shown to be more durable over time and space.
Single genes deployed over large acreages have short lifespans. Pyramids of
stem rust resistance genes show promise in prolonged durability of major gene
resistance. A genotype with multiple genes together, to which no virulence exists in
the pathogen population, should in theory prolong the effectiveness of each indi-
vidual gene. The virulence may not persist in the pathogen population as individuals
with the acquired virulence cannot reproduce because of the presence of additional
resistance genes to which they are avirulent. To cause disease on a cultivar carrying
three major genes for resistance, a pathogen would have to acquire virulence to all
three genes simultaneously which may be a very low probability. In order to assure
that multiple modes of pathogen recognition are active, more than two major genes
present together in a single genetic background should be sufficient to provide mul-
tiple modes of pathogen recognition and thereby prevent the simultaneous mutation
to virulence. A mutation in a pathogen virulence component to overcome resistance
could compromise pathogen fitness resulting in fitness cost (Bahri et al. 2009). This
could potentially increase the durability of a resistance gene product that recognizes
a virulence component that, if lost, confers a fitness penalty to the pathogen.
Therefore, it is always advisable to introduce durable resistance in current wheat
cultivars and recent wheat germplasm as a long-term strategy.
Sr2 gene, transferred from Triticum turgidum L. f. sp. dicoccum Schrank ex.
Schübler (cv. Yaroslav) into hexaploid wheat by McFadden, one of the Sr gene
deployed in modern wheat stem rust management, is reported to provide durable
resistance to stem rust (McIntosh 1988). Hope cultivar of wheat with Sr2 gene was
used in Mexico during the 1940s as the donor for developing the stem rust resis-
tant wheat cultivar Yaqui 50, since then, the Sr2 gene has been employed widely
by CIMMYT in Mexico and spread to many wheat production regions of the
world. The gene has provided durable, broad-spectrum rust resistance effective
against all isolates of P. graminis worldwide for more than 50 years. US wheat
cultivar Chris, which is not known to carry Sr2 but possesses Sr7a (Singh and
McIntosh 1987) also displayed high level of resistance and hence its adult plant
resistance may involve interaction of moderately effective gene Sr7a and other
unknown adult plant resistance genes. These observations, give researches an

opportunity to look into possibility of deploying these sources of durable resis-
tance in current day wheat cultivars available with them. The breeding strategies
to combat the havoc of Ug99 for the foreseeable future would be to use race-spe-
cific resistance genes in combinations and not alone. However, by doing so we
might have to compromise yield and other quality parameters (Singh et al. 2006).
If two resistance genes are to be incorporated, a three-way cross strategy needs to
be followed keeping adapted cultivar as the third parent (Singh et al. 2011). It is
desirable to use large population size for increasing the chances of transgressive
segregants. Molecular markers can be used in segregating generations to select
superior segregants for resistance in the background of desired agronomic perfor-
mance. Limited back crossing can also be followed to restore the characteristics of
the recurrent parent (Singh et al. 2011).
8.11 Indian Preparedness for Ug99
Although the stem rust prone area in India is less than 25 % of the total area, the
possible implications of entry of Ug99 race into the country or independent muta-
tion for Sr31 cannot be ignored. In a study on diversity for stem rust resistance in
Indian wheat, commendable diversity was observed (Bhardwaj et al. 2003). Seven
different types of resistance to stem rust were observed in wheat lines evaluated
during 2000–2001. Further we have preparedness to combat the threat named Ug99.
We have already initiated activities in collaboration with CIMMYT and BGRI to
identify and develop suitable resistant cultivars for rapid deployment in its different
wheat zones.
So far more than 947 lines have been screened against Ug99 type of races in
Kenya and Ethiopia (Table 8.2). During summer (off season) crop of 2005, a set of
19 Indian wheat varieties and 3 genetic stocks were screened under natural outbreak
of Ug99 at Njoro, Kenya. Wheat variety HW 1085, developed by IARI Regional
station, Wellington for South Hill zone and three genetic stocks, i.e. FLW 2 (PBW
343 + Sr24), FLW 6 (HP 1633 + Sr24) and FLW 8 (HI 1077 + Sr25), developed at
DWR Regional Station, Shimla, India, were found resistant against Ug99 race under
natural conditions in Kenya. After the detection of TTKST, a new variant of Ug99 in
2006 from Kenya the usefulness of the gene Sr24 was reduced. However, it has been
still reported effective against other races of Ug99 lineage.
Table 8.2 Number of Indian Year Number of lines

wheat entries screened
2005–2006 19
in Ethiopia and Kenya
2006–2007 248
2008–2009 250
2009–2010 241
2010–2011 189
Total 947
In the year 2006, out of 102 Indian lines along with lines from other neighbouring
countries (Nepal, Pakistan and Bangladesh), screened at Kenya; GW273, GW322,
HD2781, HI1500, MP4010, HI8498, MACS2846 and HD4672 showed satisfactory
level of resistance. The cultivars UP2338 and HUW510, carrying Sr24, showed accept-
able level of resistance in the year 2005 but lost usefulness next year due to the detection
of TTKST. During testing in Kenya, it was observed that most of the varieties (PBW343,
PBW373 and others carrying Sr31) grown in India are susceptible to Ug99.
Likewise, there is need to promote durum wheat cultivars (HI8498, MACS2846,
HD4672) in the central and peninsular zones that showed good to moderate resis-
tance against Ug99 (Joshi et al. 2008). Based on the studies conducted so far, rust
resistance in durum wheat seems to be conditioned by genes different from the
known ones, and hence, can provide the much needed diversity in gene deployment.
A perusal of available data for Central and Peninsular India indicate that Lok1,
HI9498, WH147, GW 322, HI 1531, HI 8627, HD 4672, DL 788-2 and MPO 1215
are in cultivation whereas in Peninsular Zone Lok 1, NI 5439, NIDW 295, MACS
2846, HI 8663, UAS 321 and UAS 431 are being cultivated. All of these are resis-
tant to moderately resistant to Ug99 races. Lok 1 occupies at least 50 % area and
others cover nearly 30 % area in two zones. Ug99 resistant varieties in the two zones
work out to be 80 % of the ~7.0 million ha, i.e. 5.6 million ha.
8.12 Conclusion
Though Ug99 type of races have posed a threat for wheat cultivation throughout the
world, however, with the collaboration of BGRI, Govt. of India through ICAR, New
Delhi has taken proactive steps to meet this challenge. Evaluation in Kenya and
Ethiopia has helped in identifying Ug99 resistant germplasm. Keeping into consid-
eration the harsh cool weather in main wheat belt in India, Ug99 type of virulence
may not be a threat in this area, however, our preparedness and pre-emptive efforts
are in place. In much prone Central and Peninsular India, a sizeable area is under
Ug99 resistant varieties.
References
Anikster Y (1984) The formae speciales. In: Bushnell WR, Roelfs AP (eds) Cereal rusts, vol 1.
Academic Press, Orlando, FL, pp 115–130
Anonymous (1992) The wheat rust patrol—striking at a fast moving target. Partners in research for
development. No. 5: 20–24. ACIAR, GPO Box1571, Canberra, ACT, 2001, Australia
Anonymous (2005) NCSRP. Soybean Asian rust—research update, 2005. http://www.planthealth.
info/pdf_docs/AsianRust_screen.pdf. Accessed 1/4/07
Aquino P, Carrion F, Calvo R (2002) Selected wheat statistics. In: Ekboir J (ed) CIMMYT 2000–
2001 world wheat overview and outlook: developing no-till packages for small scale farmers.
CIMMYT, Mexico, DF, pp 52–62
Bahadur P, Nagarajan S, Nayar SK (1985) A proposed system of virulence analysis in India II
Puccinia graminis tritici. Proc Indian Acad Sci 95:19–33
Bahri BO, Kaltz M, Leconte CD, Vallavieille-Pope C, Enjalbert J (2009) Tracking costs of viru-
lence in natural populations of the wheat pathogen, Puccinia striiformis f. sp. tritici. BMC Evol
Biol 12:1–12
Bartos P, Stuchlikova E, Kubova R (1984) Wheat leaf rust epidemics in Czechoslovakia in 1993.
Cereal Rusts Bull 12:40–41
Bhardwaj SC (2012) Wheat rust pathotypes in Indian subcontinent then and now. In: Singh SS,
Hanchinal RR, Singh G, Sharma RK, Tyagi BS, Saharan MS, Sharma I (eds) Wheat productiv-
ity enhancement under changing climate. Narosa Publishing House Pvt Ltd, New Delhi,
pp 227–238
Bhardwaj SC, Nayar SK, Prashar M, Kumar J, Meven MK, Singh SB (1990) A pathotype of
Puccinia graminis f. sp. Tritici on Sr24 in India. Cereal Rusts Powder Mild Bull 18:35–38
Bhardwaj SC, Nayar SK, Prashar M, Jain SK, Singh SB (2003) Diversity of resistance for Puccinia
graminis tritici in wheat (Triticum aestivum) and triticale mutant. Indian J Agric Sci 73(12):
676–679
Bhardwaj SC, Gangwar OP, Singh SB, Saharan MS, Sharma S (2012) Rust situation and pathot-
ypes of Puccinia species in Leh Ladakh in relation to recurrence of wheat rusts in India. Indian
Boehm EWA, Wenstrom JC, McLaughlin DJ, Szabo LJ, Roelfs AP, Bushnell WR (1992) An ultra-
structural pachytene karyotype for Puccinia graminis f. sp. tritici. Can J Bot 70:410–413
Braun HJ, Atlin G, Payne T (2010) Multi-location testing as a tool to identify plant response to
global climate change. In: Reynolds MP (ed) Climate change and crop production. CABI,
London, pp 115–138
Cox TS, Gill BS, Sears RG (1995) Notice and release of KS94WGRC32 leaf rust resistant hard red
winter wheat germplasm. Ann Wheat Newslett 41:241
Draxler RR, Rolph GD (2003) HYSPLIT (hybrid single-particle lagrangian integrated trajectory).
http://www.arl.noaa.gov/ready/hysplit4.html. Accessed 29 November 2007. NOAA Air
Resources Laboratory, Silver Spring, MD
Duplessis S, Cuomo CA, Lin Y, Aerts A, Tisserant E, Veneault-Fourrey C et al (2011) Obligate
biotrophy features unraveled by the genomic analysis of rust fungi. Proc Natl Acad Sci U S A
108:9166–9171
FAO (2008) Wheat killer detected in Iran. http://www.fao.org/newsroom/en/news/2008/
1000805/index.html
Fontana F (1932) Observations on the rust of grain. P.P. Pirone, Translated Phytopathologic
Classics, No.2, Amer Phytopathol Soc, Washington, DC (Originally published in 1767)
Hiebert CW, Fetch TG, Zegeye T, Thomas JB, Somers DJ et al (2010) Genetics and mapping of
seedling resistance to Ug99 stem rust in Canadian wheat cultivars ‘Peace’ and ‘AC Cadillac’.
Theor Appl Genet 121:1083–1091
Hodson DP, Singh RP, Dixon JM (2005) An initial assessment of the potential impact of stem rust
(race Ug99) on wheat producing regions of Africa and Asia using GIS. In: Absts of the 7th
international wheat conference, Mar del Plata, p 142
Jain SK, Prashar M, Bhardwaj SC, Singh SB, Sharma YP (2009) Emergence of virulence to Sr25
of Puccinia graminis f. sp. tritici on wheat in India. Plant Dis 93:840
Jin Y, Pretorius ZA, Singh RP, Fetch T Jr (2008) Detection of virulence to resistance gene Sr24
within race TTKS of Puccinia graminis f. sp. tritici. Plant Dis 92:923–926
Johnson T (1949) Inter varietal crosses in Puccinia graminis. Can J Res Sec C 27:45–65
Johnson T, Newton M (1946) Specialization, hybridization, and mutation in the cereal rust. Bot
Rev 12:337–392
Joshi LM, Saari EE, Gera SD (1971) Epidemiology of wheat rusts in India. INSA Bull 373:
449–453
Joshi AK, Mishra B, Prashar M, Tomar SMS, Singh RP (2008) Ug99 race of stem rust pathogen:
challenges and current status of research to sustain wheat production in India. Indian J Genet
68(3):231–241
Kolmer JA (1991) Physiologic specialization of Puccinia recondite f. sp. triticina in Canada in
1990. Can J Plant Pathol 13:371–373
Leonard K, Szabo LJ (2005) Stem rust of small grains and grasses caused by Puccinia graminis.
Plant Mol Pathol 6:99–111
McEvans JM (1969) The races of stem rust infecting New Zealand wheat crops. N Z J Agric Res
19:536–541
McIntosh RA (1988) The role of specific genes in breeding for durable stem rust resistance in
wheat and triticale. In: Simmonds NW, Rajaram S (eds) Breeding strategies for resistance to
the rust of wheat. CIMMYT, DF, Mexico, p 1–9
McIntosh, Wellings RC, Park R (1995) Wheat rusts, an atlas of resistance genes. CSIRO, East
Melbourne
McIntosh RA, Yamazaki Y, Dubcovsky J, Rogers J, Morris C, Somers DJ (2011) Catalogue of gene
symbols for wheat: 2011 supplement. Annu Wheat Newslett 57:303–321
Mehta KC (1940) Further studies on cereal rusts in India. Part 1. Scientific monograph No. 15.
Imperial Council of Agricultural Research, New Delhi, p 244
Mehta KC (1952) Further studies on cereal rusts in India. Part II. Scientific monograph No. 18.
Indian Council of Agricultural Research, New Delhi, p 368
Mettin D, Bluthner WD, Schlegel R (1973) Additional evidence on spontaneous 1B/1R, wheat Rye
substitutions and translocations. In: Sears ER, Sears LMS (eds) Proceedings of the 4th interna-
tional wheat genetics symposium. Agricultural Experimental Station, University of Missouri,
Columbia, MO, pp 179–184
Mirza JI, Rattu A, Khanzada KA, Ahmad I, Fetch T et al (2010) Race analysis of stem rust isolates
collected from Pakistan in 2008–09. In: McIntosh R, Pretorius Z (eds) Proceedings of BGRI
2010 technical workshop, St Petersburg, May 30–31, p 5
Nagarajan S (2012) Is Puccinia graminis f. sp. tritici virulence Ug99 a threat to wheat production
in North Western Plain Zone of India. Indian Phytopathol 65:219–226
Nagarajan S, Joshi LM (1985) Epidemiology in Indian subcontinent. Roelfs AP, Bushnell WR
(eds) Cereal rust, vol II. Academic, New York, NY, pp 371–402
Nagarajan S, Singh H (1975) Indian stem rust rules an epidemiological concept on the spread of
wheat stem rust. Plant Dis Rep 59:133–136
Nagarajan S, Joshi LM, Saari EC (1976) Meteorological conditions associated with long distance
dissemination and deposition of Puccinia graminis f. sp. tritici urediospores in India.
Nayar SK, Nagarajan S, Bahadur P, Singh SB (1987) Occurrence of new virulent pathogenic forms
in race 77 of Puccinia recondita f. sp. tritici in India. Curr Sci 56:844–845
Reynolds MP, Borlaug NE (2006) Applying innovations and new technologies from international
collaborative wheat improvement. J Agric Sci 144:95–110
Roelfs AP (1985) Wheat and rye stem rust. In: Roelfs AP, Bushnell WR (eds) The cereal rusts, vol
2. Academic, Orlando, FL, pp 3–37
Roelfs AP, Martens JW (1988) An international system of nomenclature for Puccinia graminis f.
sp. tritici. Phytopathology 78:526–533
Rosegrant MW, Agcaoili Sombilla M, Perez ND (1995) Global food projections to 2020: implica-
tions for investment. Food, Agriculture and the Environment Discussion, Paper 5. International
Food Policy Research Institute, Washington, DC, p 54
Roux L, Rijkenberg FHJ (1987) Pathotypes of Puccinia graminis f. sp. tritici with increased viru-
lence for Sr24. Plant Dis 77:1115–1119
Shank R (1994) Wheat stem rust and drought effects on bale agricultural production and future
prospects. In: Report on February 17–28 assessment. United Nations Emergencies Unit for
Ethiopia, Addis Ababa. http://www.africa.upenn.edu/eue_web/Bale_mar.txt
Singh RP, McIntosh RA (1987) Genetics of resistance to Puccinia graminis tritici in ‘Chris’ and
‘W3746’ wheats. Theor Appl Genet 3:846–855
Singh RP, William HM, Huerta-Espino J, Rosewarne G (2004) Wheat rust in Asia: meeting the
challenges with old and new technologies. In: New directions for a diverse planet: Proceedings
of the 4th International Crop Science Congress, Brisbane, Australia, 26 Sep–1 Oct 2004. 2004
ISBN 1 920842 20 9. http://www.cropscience.org.au/icsc2004/symposia/3/7/141singhrp.htm.
Accessed 1/4/07
Singh RP, Hodson DP, Yue J, Huerta-Espino J, Kinyua MG, Wanyera R, Njau P, Ward RW (2006)
Current status, likely migration and strategies to mitigate the threat to wheat production from
race Ug99 (TTKS) of stem rust pathogen. CAB Rev Perspect Agric Vet Sci Nutr Nat Resour
1:1–13
Singh RP, Hodson DP, Huerta-Espino J, Jin Y, Njau P (2008) Will stem rust destroy the world’s
wheat crop? Adv Agron 98:271–309
Singh RP, Hodson DP, Huerta-Espino J, Jin Y, Bhavani S, Njau P, Herrera-Foessel S, Singh PK,
Singh S, Govindan V (2011) The emergence of Ug99 races of the stem rust fungus is a threat
to world wheat production. Annu Rev Phytopathol 49:465–481
Stakman EC, Levine, MN (1922) The determination of biologic forms of Puccinia graminis on
Triticum spp. Minnesota Agricultural Experimental Station Technical Bulletin, Minneapolis,
MN, p 8
Stakman EC, Piemeisel FJ (1917) A new strain of Puccinia graminis. Phytopathology 7:73
Stakman E, Steward D, Loegering W (1962) Identification of physiologic races of Puccinia grami-
nis var. tritici. US Department of Agriculture, ARS (E-617), Washington, DC
Steele KA, Humphreys E, Wellings CR, Dickinson MJ (2001) Support for a stepwise mutation
model for pathogen evolution in Australasian Puccinia striiformis f. sp. tritici by use of
molecular markers. Plant Pathol 50:174–180
Stokstady E (2007) Deadly wheat fungus threatens world’s breadbaskets. Science 315:1786–1787
Tozetti GT, Alimurgia V (1952) True nature, causes and sad effects of the rusts, the bunts, the
smuts, and other maladies of wheat and oats in the field. In: Tehon LR (ed) Translated
phytopathological classics no. 9. American Phytopathology Society, St Paul, MN (originally
published 1767), p 139
Urban Z (1967) The taxonomy of some European graminicolous rusts. Ceska Mykologia 21:12–16
Zeller EJ (1973) 1B/1R wheat rye chromosome substitutions and translocations. In: Sears ER,
Sears LMS (eds) Proceedings of the 4th International Wheat Genetics Symposium. Agricultural
Experiment Station, University of Missouri, Columbia, MO, pp 209–211
Chapter 9
Increased Virulence of Wheat Rusts
and the Threat to Global Crop Production
Thomas Fetch and Brent McCallum
9.1 Characteristics of Wheat Rust Diseases
Cereal rust diseases are caused by fungi in the genus Puccinia, and are distinct from
most other fungi in that they are biotrophic and require a living plant host for their
growth and reproduction, although they have been grown in axenic culture (Williams
et al. 1967). Rust diseases are extremely dangerous because they cycle very rapidly
on the plant (reproduce from infection to new spores in 7–14 days) depending on
temperature (Roelfs 1985b). They produce prodigious numbers of spores (over two
trillion stem rust spores per hectare at moderate infection levels (Rowell and Roelfs
1971), and are commonly transported hundreds of kilometers by wind (Roelfs
1985a). Rust fungi are highly specialized on the hosts they attack (known as formae
speciales or f. sp.), which was first described by Eriksson in 1894 (Anikster 1984).
For example, wheat leaf rust cannot infect corn and corn rust cannot infect wheat,
but some species such as P. graminis have many f. sp. that can infect many host
genera (Cummins 1971). Cereal rust fungi are also specialized in their ability to
infect different genotypes within a host species. This was initially described by
Stakman and Piemeisel (1917) as strains and later became known as physiological
races, which vary in their ability to attack specific resistance genes and can attack
some wheat cultivars but not others (Stakman et al. 1962).
The variability among strains or races to attack specific resistance genes was sum-
marized by Flor (1971) in his gene-for-gene hypothesis where “For each gene that
conditions reaction in the host, there is a corresponding gene in the parasite that
conditions pathogenicity.” A strain or race that is highly virulent can attack (produces
a susceptible reaction) many specific resistance genes, whereas an avirulent race
attacks only a few genes. Rust races have the ability to change in virulence, by both
sexual and asexual mechanisms. Sexual recombination of virulence in the cereal
T. Fetch, Ph.D. (*) • B. McCallum, Ph.D.

Agriculture and Agri-Food Canada, 101 Route 100, Morden, MB, Canada R6M 1Y5
e-mail: Tom.Fetch@agr.gc.ca

250 T. Fetch and B. McCallum
rusts involves alternate host species (Barberry and Mahonia spp. for stem and stripe
rust, Thalictrum spp. for leaf rust) to complete the life cycle (Jackson and Mains
1921; Craigie 1927; Jin et al. 2010). The barberry alternate host is highly significant
in generating new stem rust races (Roelfs 1982) and causing major epidemics, result-
ing in a major eradication campaign in the USA and Canada (Campbell and Long
2001). However, mutation is the primary source of new variation in virulence (Groth
1984) and can account for most or all changes in virulence that occur (Samborski
1985b). While in many countries there have not been significant outbreaks of rust for
many years, recently there has been an emergence of new highly virulent races that
threaten the worldwide production of wheat. Discussion of the threat of new stem,
leaf, and stripe rust races to wheat production will be presented.
9.2 Wheat Stem Rust (Puccinia graminis f. sp. tritici)
Stem rust of wheat (Triticum aestivum and T. durum), caused by the fungus Puccinia
graminis f. sp. tritici, has historically been the most damaging disease of wheat
worldwide. Stem rust epidemics date back to biblical times where it caused “mil-
dewing and blasting of wheat” (Arthur 1929). One of the first published descrip-
tions of black rust was by Fontana (1767) which described a devastating epidemic
in Tuscany, Italy in 1766. Another excellent treatise of this epidemic was written by
Targioni-Tozzetti, who wrote that “rust is the most serious and formidable malady
of wheat” and described the physiology of infection of the spores through the plant
stomata (Peterson 2001). Many scientists in several countries have studied the tax-
onomy, life cycle, cytology, epidemiology, host–plant resistance, physiology, and
virulence in the cereal rusts and numerous reference books have been published
since the 1800s (Schafer et al. 1984). More is known about stem rust epidemiology,
physiology, histology, and virulence than all other plant diseases (Roelfs 1985b),
due to the significant damage to crops that it can cause.
Stem rust can cause complete crop loss within a few weeks in a seemingly
healthy-looking crop (Fetch et al. 2011), due to tremendous water loss from large
pustules that rip open the epidermis on the stems (Fig. 9.1). Losses to stem rust
occur in all continents where wheat is grown, and several major epidemics have
been documented in Australia and North America (Saari and Prescott 1985). Stem
rust caused numerous losses in wheat in Canada and the USA in the first half of the
twentieth century (Roelfs 1978), with the most significant epidemics occurring in
1916, 1935, and 1953–1954 (Stakman and Harrar 1957). The epidemics from 1953
to 1954 due to the new race 15B were the most damaging in the history of North
America, causing estimated losses of 2.5 and 2.1 million tons in the USA (Stakman
and Harrar 1957) and 1.7 and 5.5 million tons in Canada (Peturson 1958), respec-
tively. In Australia, the most severe epidemic in history occurred in 1973, causing
an estimated $200–300 million loss, which led to the establishment of the Australian
Cereal Rust Control Program (Park 2007). In Ethiopia, a new race of stem rust
caused between 65 and 100 % yield loss in the cultivar Enkoy from 1993 to 1994
(Dubin and Brennan 2009), and in 2013 near total losses were reported on 10,000 ha.
9 Increased Virulence of Wheat Rusts and the Threat to Global Crop Production 251
Fig. 9.1 Ug99 stem rust

infection on wheat in Kenya
of wheat due to regional epidemics of race TKTT (D. Hodson, pers. comm.).
In South America, stem rust caused a severe epidemic in 1950 by a variant of race
15, and widespread epidemics occurred during 1975–1976 (Germán et al. 2007).
In India, an epidemic during 1946–1947 caused 20 % losses estimated at 2 million
tons (Dubin and Brennan 2009).
Epidemics of cereal rusts occur when there is a combination of a widely grown
susceptible host, virulent race(s), early infection of the crop, and favorable environ-
ment (Roelfs 1985a). An environment that favors rust infection and spread com-
bines high humidity for spore germination and frequent winds that can rapidly
disperse urediniospores over hundreds of kilometers. The movement of uredinio-
spores on prevailing wind currents from maturing crops to green hosts is known as
the “Puccinia path” (Stakman 1934), and has been described in Australia (Luig
1985), India (Nagarajan and Joshi 1985), and North America (Fetch et al. 2011).
A “Puccinia pathway” can also extend across countries and even oceans, with pub-
lished reports of stem rust migration from Africa to western Australia (Watson and
de Sousa 1982). There also appears to exist a “Puccinia pathway” from west Africa
to South America (Saari and Prescott 1985), and the frequent wind movement from
South Africa to South America (Isard and Russo 2011) may vector the dangerous
stem rust strain Ug99 into the western hemisphere. This has serious implications for
the threat of stem rust to worldwide wheat production, as we shall see later.
Changes in virulence of Puccinia graminis can occur both by sexual and asexual
mechanisms. The sexual mechanism requires a functional alternate host (Berberis
and Mahonia spp.) to complete the life cycle (Craigie 1927). In Australia, native
barberry does not exist and the sexual cycle is unimportant (Watson and Luig 1958).
In contrast, common barberry was imported into North America by European
colonists and contributed significantly in the development of new virulent races and
early season infection of wheat, which led to reoccurring epidemics of stem rust in
the late 1800s and early 1900s. This led to the development of barberry eradication
programs in both Canada and the USA in 1916 (Campbell and Long 2001).
Currently, the role of barberry in the rust life cycle has been almost entirely elimi-
nated in North America (Roelfs 1982). While importation and movement of bar-
berry is still regulated in Canada, the US government terminated their program in
1978 and turned over regulatory responsibilities to state agencies. It has been specu-
lated that it is a matter of time before the sexual stage of P. graminis f. sp. tritici will
revive and again produce new strains of wheat stem rust in North America (Leonard
2000). Eradication of ornamental barberry was critical because it resulted in: (1)
elimination of initial spore inoculum coming from the barberry bushes that can
directly infect emerging wheat crops; and (2) reduced the ability of the fungus to
recombine into new virulent races. Species of barberry are present in Russia
(Skolotneva et al. 2010), Central Asia, and Turkey (Mert et al. 2012) near wheat
production areas, which may be a factor in developing new races of stem rust.
The other mechanism in the development of new stem rust races is by mutation in
asexual populations. Mutation in asexual rust populations has traditionally been
thought of as occurring is a stepwise fashion, by accumulation of one additional viru-
lence factor at a time (Muller 1932; Roelfs and Groth 1980). However, in large asex-
ual populations two mutations can occur more quickly than anticipated because of
recurrent rather than unique events (Maynard 1968). The deployment of resistant
wheat varieties in many countries has been a huge factor in reducing the overall
amount of stem rust inoculum, thus limiting asexual population size and mutations in
virulence. This can be seen in the overall reduction in variability in asexual popula-
tions of P. graminis tritici in North America since resistant cultivars began to be
deployed in the 1950s, which have been documented in numerous virulence surveys.
Johnson and Newton (1946) stated that “new physiologic races with different
pathogenic traits different from those of known races may arise at any time” and
that “the price of security from rust damage is a continuous vigilance in the form
of surveys to detect any pathogenic changes in the economically important rusts
and unrelenting efforts to develop cereal varieties resistant to any virulent races
that may arise.” Annual surveys of virulence in P. graminis tritici were initiated in
1919 in Australia, Canada, and the USA (Kolmer 2000; Park 2007) and have con-
tinued without interruption to date. Surveys of virulence in P. graminis tritici have
been conducted sporadically in South Africa (Pretorius et al. 2007), South America
(Germán et al. 2007), and many other countries. In North America, the variability
in P. graminis tritici has dropped from an average of about 20 races per year in the
1920s to few races in recent years (Roelfs and Groth 1980; Fetch et al. 2011),
attributed primarily to the eradication of barberry (Roelfs 1982). In Australia,
pathotype diversity increased from six races in 1919 to over 50 races in the 1950–
1960s, but has declined both in inoculum level and diversity since the last major
epidemic in 1973 (Park 2007). Changes in virulence in other countries are difficult
to document since long-term surveys have not been conducted. The last interna-
tional survey of virulence in P. graminis tritici was conducted in 18 countries from
1969 to 1971 (Luig 1983), but comparison of races was difficult because of differ-
ences in the nomenclature and rust differential lines that were used. New global
rust surveillance protocols for stem rust have been proposed (Park et al. 2011)
using 20 standard differential lines, the letter-code system of nomenclature (Fetch

et al. 2009), and DNA profiling. This was an outcome of the identification of the
highly virulent strain known as Ug99.
A novel stem rust race identified in 1999 and originating in Uganda, now known
as Ug99 (Pretorius et al. 2000), is currently a major threat to wheat production world-
wide (Singh et al. 2008). Ug99 is virulent on most deployed wheat stem rust resis-
tance (Sr) genes, and an estimated 85–95 % of wheat lines worldwide are susceptible
to Ug99 (Jin et al. 2007; Singh et al. 2011). With the exception of the 1993–1994 and
2013 epidemics in Ethiopia, stem rust has not been a disease problem for decades
(Singh 2006). This resulted in a significant decline in stem rust research and surveil-
lance, with a concomitant reduction in worldwide facilities and abilities to conduct
race analysis (Park et al. 2011). However, the broad virulence spectrum of Ug99 has
raised a worldwide alarm to this threat, resulting in the establishment of a global rust
initiative (now Borlaug global rust initiative, or BGRI) to monitor the spread and
detect changes in virulence of rusts that threaten wheat, including Ug99.
Currently, Ug99 stem rust is mutating and migrating. The original isolate of
Ug99 from Uganda was identified as race TTKSK (Jin et al. 2007) on the interna-
tional standard set of 20 wheat differential lines (Fetch et al. 2009). The exact origin
of Ug99 is unknown, but may have evolved via step-wise mutation from an ances-
tral race that appears to have been present since the early 1970s (Park et al. 2011).
Alternatively, new strains could have arisen on barberry that is present near Mt.
Kenya (Jin unpublished data). Six additional variants of Ug99 (races TTKSF,
TTKSP, TTKST, TTTSK, PTKSK, PTKST) are now known and their evolutionary
relationships have been described (Park et al. 2011). Ug99 has spread from Uganda
to Kenya (2001), Ethiopia (2003), Sudan and Yemen (2006), Iran (2007), Tanzania,
Zimbabwe, South Africa (2009), and Eritrea (2010), primarily on regional winds
(Hodson 2011; Singh et al. 2011; Wolday et al. 2011). Rust fungi have been docu-
mented to travel hundreds or even thousands of kilometers by wind (Brown and
Hovmoller 2002). Stem rust has previously been reported to migrate from central
Africa to Australia (Watson and de Sousa 1982), and coffee rust migrated from west
Africa to Brazil in 1970, resulting in the removal of all coffee trees in a 50 × 800 km
area in an effort to prevent establishment of the disease (Bowden et al. 1971). Since
Ug99 stem rust is now prevalent across east Africa and into South Africa and Iran,
spore movement by prevailing winds threatens wheat production in Australia, South
America, and southern Asia (Pakistan and India). If Ug99 was vectored by wind to
South America, it could cause significant epidemics as current wheat cultivars rely
mainly on genes Sr24 and Sr31 (Germán et al. 2007), which are ineffective to race
PTKST that is present in South Africa (Pretorius et al. 2010). Further movement of
Ug99 from South America to North America could occur quickly as is exemplified
by the movement of soybean rust from its introduction to Paraguay in 2001 to intro-
duction into the southern USA in 2004 (Pan et al. 2006). Additionally, rust spores
can be carried on clothing of tourists and establish exotic introductions of virulent
races (see section on stripe rust). With the millions of tourists that travel to countries
known to harbor Ug99 spores, introduction to other countries via this mechanism
could happen at any time and is unpredictable.
In addition to Ug99, there are other dangerous races of stem rust that exist and
could threaten wheat production if they migrated. A highly virulent race of stem rust
detected in Pakistan from 2005 to 2009 was initially thought to be Ug99, but was
subsequently pathotyped to race RRTTF (Iqbal et al. 2010). This race is also present
in Ethiopia, Eritrea, and Yemen and is highly virulent to most Canadian wheat cul-
tivars (Fetch et al. 2012). In Turkey, several races with high virulence (e.g., TKTTC,
RTTTF) were identified in surveys conducted in 2007 and 2008 (Mert et al. 2012).
Since the advent of the BGRI in 2005, there has been renewed interest in studying
virulence and movement of cereal rusts worldwide. A new web-based system called
“Rust SPORE” is now available (http://www.fao.org/agriculture/crops/rust/stem/
rust-report/en/) that provides pathotype information and maps to locate races of
stem rust worldwide, based on virulence data provided by international collabora-
tors (Hodson 2011). This system in tandem with increased worldwide survey data
of stem rust races would be highly useful in documenting new races with high viru-
lence that threaten global wheat production.
9.3 Wheat Leaf Rust (Puccinia triticina)
Wheat leaf rust, caused by Puccinia triticina Eriks., is the most common and widely
distributed of the wheat rusts (Huerta-Espino et al. 2011). Typical symptoms of leaf
rust infection are small round orange pustules on plant leaves (Fig. 9.2). Although
damage caused by leaf rust is not as dramatic as stem or stripe rust, the annual losses
are higher because of the wide distribution and frequent presence of the disease. In
order to identify effective leaf rust resistance (Lr) genes to develop resistant wheat
cultivars, many countries initiated virulence surveys that are either conducted annu-
ally, at regular intervals, or sporadically. Virulence surveys around the world have
revealed that P. triticina is a highly variable pathogen (Huerta-Espino et al. 2011).
This variation can result from a number of different sources including introduction or
movement of P. triticina, mutation, sexual recombination, and parasexual or somatic
recombination followed by selection due to resistance in the host (Johnson 1961).
Fig. 9.2 Leaf rust infection

on flag leaf of wheat
Sexual recombination is relatively rare for P. triticina in most parts of the world
since the alternate or sexual host, Thalictrum speciosissimum L., is native to south-
ern Europe and southwest Asia, but is absent from most wheat growing areas
(Kolmer 2013). Therefore, P. triticina is confined mostly to asexual or clonal repro-
duction, with the relatively rare occurrence of parasexual recombination (Park and
Wellings 2012). Where P. triticina populations have been analyzed in detail with
virulence and molecular markers, they are usually described as a collection of clonal
groups (Singh et al. 2004a; Ordonez and Kolmer 2009; Kolmer et al. 2011, 2012a).
These groups are distinct from each other, and members within a group have more
similarity to each other than to members of other groups (Wang et al. 2010; Kolmer
2013). However, there can be significant diversity within groups, due to mutation
and selection. Saari and Prescott (1985) and Huerta Espino (1992) divided the world
into 11 major epidemiological zones including South Africa, North Africa and
Western Europe, West Asia (including the middle east), South Asia, South East
Asia, Far East, North America, Mexico, South America, Australia and New Zealand,
and Eastern Europe and Egypt. These regions were defined by the wind patterns
which determine the spread of rust pathogens. Within each region, subdivision can
occur due to the crop species and cultivars grown, or to physical barriers to move-
ment such as mountain ranges.
Virulence changes in P. triticina populations are most evident in countries that
have conducted annual surveys over a long period of time such as Australia, Canada,
and the USA. One of the earliest studies on physiologic specialization in P. triticina
was done in the USA by Mains and Jackson (1926), which described 12 different
races of the fungus differentiated by their virulence on a set of 11 standard differen-
tial lines. Johnston et al. (1968) summarized annual race surveys conducted in the
USA between 1926 and 1960 and found 100 different races described over that
period using eight of the differentials described by Mains and Jackson. There were
a small number of relatively common races that were found repeatedly over a num-
ber of years, but most races were relatively rare and were only found either once or
a few times. They also noted that the various regions of the country differed in the
prevalent races that were found. By 1961 there were 183 different races reported
worldwide (Johnston 1961). Virulence analysis in the USA and other countries sub-
sequently moved away from using differential cultivars, which often contained
more than one resistance gene, to near-isogenic lines that only had a single Lr gene
in a susceptible genetic background (Long et al. 1985). Changes in the pathogen
population could now be tracked by changes in virulence frequency to each Lr gene
as well as changes in frequency of races. An expanded set of 12 near-isogenic lines
were used to distinguish races in North America after 1986, along with the
development of a letter-code nomenclature system (Long and Kolmer 1989). This
system is currently used in Canada and the USA, with the addition of one more set
of four differential lines. Although hundreds of unique races have been identified in
annual virulence surveys, they were found to form six distinct groups or race clus-
ters (Ordonez and Kolmer 2009). While there is considerable variation within a
group, the differences between races within the same group were smaller than those
between groups. The groups tend to stay isolated because of asexual reproduction,
and to some extent because of geographic isolation. Variation within each race
group is thought to be primarily due to mutation and selection.
Virulence surveys of P. triticina were initiated in Canada in 1931 (Johnson 1956)
and have been conducted annually since that time. In reviewing the virulence spec-
trum found between 1931 and 1955, Johnson (1956) reported 51 different races.
Most were relatively rare and different races tended to predominate in eastern
Canada compared to western Canada. From 1956 to 1987, there was selection for
virulence in the Canadian P. triticina population over time on Lr genes used in
North American cultivars, although virulence also existed for Lr genes that were not
used in commercial wheat production (Kolmer 1989). From 1987 to 1997, the east-
ern and western populations in Canada were clearly distinct based on virulence
differences. The effects of host selection were more apparent in western Canada
because of the higher use of Lr genes within the wheat cultivars of the Great Plains
(Kolmer 1999). The Canadian population from 1997 to 2007 resembled the popula-
tion in the USA with six race clusters based on virulence phenotype, but was less
clearly distinguished using molecular markers (Wang et al. 2010).
The 11 different global epidemiological zones tend to have leaf rust populations
that are geographically isolated from each other (Huerta-Espino et al. 2011).
However, an important component to changes in P. triticina populations is the move-
ment of the pathogen between zones. Puccinia triticina co-evolved with wheat in
Middle East and spread throughout the world along with wheat production. The
introduction of both wheat and P. triticina into areas such as North and South
America, Australia, and New Zealand has been relatively recent. The race groups in
South America were found to closely resemble those in North America, because both
populations were likely derived from European introductions (Ordonez et al. 2010).
In North America, the MBDS race cluster first appeared in 1996 and was rapidly
selected due to virulence on Lr17, which was present in many of the USA wheat
cultivars (Ordonez and Kolmer 2009). Race MBDS became prevalent in both the
USA and Canada between 1996 and 2004. This race cluster was thought to be an
exotic introduction (Kolmer 2001) because it is unique from the other previously
existing race groups for a number of virulence and molecular markers (Ordonez and
Kolmer 2009; Wang et al. 2010). This race group appeared in South America in
1999 (Ordonez et al. 2010), and it is speculated that this race group could have
originated from Mexico and spread to both North and South America.
Virulence surveys for leaf rust have been conducted in Australia and New Zealand
since the 1920s (Park et al. 1995). Exotic introductions have occurred several times.
Race 53-1,(6),(7),10,11 appeared in New Zealand in 1981, and differed from previ-
ous races for many virulence genes and also had a unique isozyme allele pattern
(Luig et al. 1985). In 1984, race 104-2,3,(6),(7),11 was detected, which differed
from previous races in at least nine virulence genes and two isozyme loci (Park et al.
1995). The original race also diversified rapidly through mutation to virulence on
additional resistance genes and selection to form a group of related races.
In many areas of the world durum wheat is highly resistant to the resident P. tri-
ticina populations. In Mexico, durum was grown for over 25 years without losses to
leaf rust. However, in 2001 a new P. triticina race (BBG/BN) started to cause serious
leaf rust epidemics (Singh et al. 2004a). This race was highly virulent on Mexican
durum cultivars and also on those from many other countries, but was very avirulent
on bread wheat. Increased virulence was also noticed in other durum growing coun-
tries. When P. triticina isolates found on durum from various regions around the
world were compared for virulence they were very similar, although very different
from P. triticina isolated from bread wheat in the same regions, suggesting a com-
mon origin (Ordonez and Kolmer 2007).
Changes in the virulence of P. triticina and other rust fungi are most commonly
attributed to mutation that allows a formerly avirulent race to become virulent and
infect specific wheat cultivars. Mutation to virulence may be a relatively rare event,
but the effective enormous size of the pathogen population increases the occurrence
(Samborski 1985a). New mutant virulent races increase rapidly in frequency
because of host selection. The evolution from avirulence to virulence is often a two-
step process because of the dikaryotic nature of P. triticina. Races that have mutated
at one of the two loci controlling avirulence to a particular resistance gene often
have an intermediate phenotype and a partial level of virulence (Samborski 1963;
Kolmer and Dyck 1994) because of partial dominance. A number of genetic studies
on P. triticina have found that avirulence loci are heterozygous, but if avirulence is
fully dominant then the phenotypic change from avirulence to virulence is not
observed until both loci have mutated (Samborski 1985a).
A series of mutational virulence changes from a single progenitor can lead to the
development of race clusters typically found in many regions of the world. This
process is illustrated by Park et al. (1995) who postulated seven different mutational
changes for virulence to create seven new races from one originally introduced race.
The appearance of a damaging Lr24 virulent race in Australia in 2000 was attributed
to mutation, since the new race was very similar to a previously existing race with
the addition of Lr24 virulence (Park et al. 2002). In North America, races virulent to
Lr21 recently appeared after many years of complete effectiveness of this gene
(McCallum et al. 2011b; Kolmer et al. 2012b). These races most likely are mutants
from preexisting races because of their close similarity apart from Lr21 virulence.
The evolution of Lr21 virulence is a major problem for wheat breeders in the north
central USA and Canadian prairies because of extensive use of this resistance gene
in wheat cultivars. A number of other virulence changes in P. triticina populations
have been attributed to this step-wise mutation process (Kolmer et al. 2009).
Parasexual or somatic hybridization is another mechanism of variation in
P. triticina and other rust fungi (Park and Wellings 2012). The frequency of this
mechanism of recombination in nature is unknown. However, a strong case for
the occurrence of somatic hybridization involves the appearance of race
64-(6),(7),(10),11 in Australia in 1990 (Park and Wellings 2012). This race combined
a number of different virulence features and isozyme alleles that were previously
detected in two different races. DNA marker analysis strengthened the hypothesis
that race 64-(6),(7),(10),11 was a somatic hybrid from the two previously existing
races (Park and Wellings 2012). The actual mechanism of somatic hybridization and
recombination in rust fungi is not fully understood, and attempts to replicate this pro-
cess under controlled conditions have had mixed success (Park and Wellings 2012).
However, hyphae of different P. triticina races are capable of vegetative fusion, and
nuclei from the paired strains come into very close association suggesting a nuclear
fusion process (Wang and McCallum 2009). It is unknown how common somatic
hybridization is in P. triticina, but in the absence of the alternate host it represents a
powerful mechanism for rapid recombination of the genomes of reproductively iso-
lated races.
Sexual recombination in P. triticina is only possible in those areas of the world
with an alternate host, primarily Thalictrum speciosissimum L., although a small
number of other species have been reported to function as alternate hosts (Samborski
1985a). Thalictrum speciosissimum is native to southern Europe and southwest
Asia. However, when populations from Europe (Kolmer et al. 2012a) and Central
Asia (Kolmer and Ordonez 2007) were analyzed for molecular markers and viru-
lence, there was little evidence of sexual reproduction. Sexual reproduction in
P. triticina populations has been shown to increase diversity, generate a more ran-
dom distribution of virulence, and reduce linkage disequilibrium under controlled
conditions (Kolmer 1992; Liu and Kolmer 1998). Sexual reproduction does not
appear to be functional in most P. triticina populations analyzed to date because
populations were characterized by high levels of linkage disequilibrium, heterozy-
gosity, and clonally reproducing groups of related races.
Genetic changes in P. triticina populations around the world have resulted in
virulence on wheat cultivars that were formerly resistant, leading to epidemic yield
losses. The mechanisms for this genetic change include migration or introduction,
mutation, parasexual recombination, sexual recombination, and selection. The abil-
ity for a resistance gene or a cultivar to remain resistant over a long period of time
is termed durability. Most race-specific resistance genes and the cultivars that have
only race-specific resistance genes have been overcome by genetic changes in the
P. triticina population leading to susceptibility (Kolmer et al. 2009), and therefore
have not been durable. However, the non-race-specific gene Lr34 has been deployed
globally for many years and has been durable in Canadian cultivars since the 1970s
(McCallum et al. 2011a). The wheat cultivar Pasqua (Dyck 1993) has Lr34 com-
bined with four race-specific resistance genes and has been essentially immune to
leaf rust in Canada since its release in 1991 (McCallum and Thomas 2011). While
it is difficult to control or slow the rate of genetic change in P. triticina, effective
resistance strategies based on non-race-specific genes like Lr34, Lr46, and Lr67
(Hiebert et al. 2010) are the best defense against losses to wheat leaf rust.
9.4 Wheat Stripe Rust (Puccinia striiformis f. sp. tritici)
Stripe rust, caused by Puccinia striiformis Westend. f. sp. tritici Erikss., is currently
the most damaging of the cereal rust pathogens worldwide (Singh 2004). Symptoms
of stripe rust infection are long linear chains of pustules constricted by veins on leaf
tissue (Fig. 9.3), but can also infect wheat heads. It was first described in 1777 and
its center of origin is presumed to be in the Middle East (Stubbs 1985), but has
Fig. 9.3 Stripe rust infection

on leaves of wheat
spread to all countries where wheat is grown. Although stripe rust has been said to
lack the “killing power” of stem rust, numerous epidemics have occurred sporadi-
cally across the world and losses of up to 80 % have been reported (Wellings 2011).
Stripe rust is the most important disease on wheat in China, where 80 % of the cur-
rent varieties are susceptible to the predominant races, and the last epidemic in 2002
caused losses of 1.3 million metric tons (Wan et al. 2007). Severe epidemics of
stripe rust have occurred in Australia since 2003 due to an exotic introduction of a
new race, resulting in fungicide applications estimated between AUS$40–90 annu-
ally (Wellings 2007). Stripe rust is endemic in the Pacific Northwest region of the
USA, with the most severe loss of 0.8 million metric tons occurring in 1976 (Chen
2007). Losses are often associated with new races that develop virulence for host
resistance genes in cultivars that have recently been deployed.
Virulence variation in P. striiformis is accomplished by both sexual and asexual
mechanisms. The alternate host for P. striiformis was previously unknown, but
recently has been identified as species of Berberis (Jin et al. 2010), thus the life
cycle is similar to P. graminis. Generation of new virulent races of stripe rust by
sexual means is most likely occurring in areas where species of Berberis are abun-
dant (Jin 2011), particularly in western China (Chen et al. 2009) and in the Pacific
Northwest region of the USA. Prior to the discovery of the sexual cycle, changes in
virulence were thought to be strictly by asexual means of mutation or somatic
recombination (Stubbs 1985). The high mutation rate in stripe rust may be explained
by exposure to UV irradiation during spore movement (Johnson et al. 1978), and
has been estimated at three times higher compared to stem rust urediniospores
(Maddison and Manners 1972). Stepwise mutation is the most common method of
genetic variation that leads to development of new races (Wellings 2011). This was
documented in Australia where 20 new pathotypes were derived from an exotic
introduction (Wellings 2007), and in the USA where 62 new races have been identi-
fied since 2000 (Chen 2007).
Work on identifying races of stripe rust has been conducted worldwide since the
discovery of strains by Allison and Isenbeck (1930). One significant problem in
race identification is the lack of an agreed-upon system in naming races of P. stri-
iformis. The first international nomenclature system was suggested by Johnson
et al. (1972) and used a binary notation based on nine “International” differential
lines. This has been modified by the use of a second set of eight lines denoted by the
letter “E” for the “European” differentials, plus the reaction on cultivar “Avocet” in
Australia (McIntosh et al. 1995). A similar system is in India, using seven of the
“International” set of lines and the eight “European” lines, plus two supplemental
lines (Prashar et al. 2007). In China, a numerical system with the prefix CYR
(Chinese Yellow Rust) uses 17 differential lines to determine the race (Wan et al.
2004). The numerical system is also used in the USA, with a prefix of PST and 20
differential lines (Chen 2007). Comparison of virulence across the various nomen-
clature systems is difficult since many differential lines are wheat cultivars that
contain more than one resistance gene (Yr gene). Recently, a number of near-
isogenic lines each containing a single Yr gene in the “Avocet” background has been
developed (Wellings 2009). The use of selected Yr genes in the Avocet NIL back-
ground and the letter-code nomenclature system similar to that used in stem and leaf
rust would enable the direct comparison of stripe rust virulence on a global basis.
Regardless of the systems used to characterize the races of stripe rust, new races
are migrating worldwide. Stripe rust is primarily dispersed and spread on prevailing
winds like the other cereal rusts, but also have several documented exotic introduc-
tions via human-mediated travel. Stripe rust was introduced into Australia in 1979
on the clothing of a tourist that returned from Europe (O’Brien et al. 1980). Shortly
thereafter, it spread to New Zealand on prevailing winds (Beresford 1982). A sec-
ond exotic introduction of race 64E0A− occurred in 1999, followed by a third in
2002 of race 134E16A+ in western Australia (Wellings 2007). Race 134E16A+ is
nearly identical to race PST-78, an exotic introduction into the USA in 2000, and
indicates an association of international travel in the migration of dangerous races
of stripe rust (Wellings 2011). Stripe rust also was introduced into South Africa in
1996 (Pretorius et al. 2007). Once new races are introduced or develop by mutation,
they can be rapidly spread by wind. Virulence for gene Yr9 occurred initially in East
Africa and spread rapidly across the Middle East to Pakistan and India in the 1990s
(Singh et al. 2004b). Races 134E16A+ and PST-78 spread rapidly across Australia
and the USA, respectively, shortly after their introduction. Virulence to Yr27, a gene
present in many wheat cultivars in the Central and Western Asia and Northern Africa
(CWANA) regions, initially was detected in India in 2001 but has spread to several
countries in the CWANA region resulting in severe epidemics in 2010 (Sharma-
Poudyal et al. 2013).
Most epidemics of stripe rust occurring recently are due to the increased viru-
lence seen globally in populations of P. striiformis. In China, races found recently
have a wider virulence spectrum than those found earlier (Wan et al. 2007). Races
collected in 1999 in Syria and Lebanon had greater virulence compared to those
collected only 5 years earlier (Yahyaoui et al. 2002). New stripe rust races have been
detected in India since 1995 and are evolving frequently (Prashar et al. 2007).
Numerous pathotypes with increased virulence have been detected in Australia
since the three exotic introductions beginning in 1979 (Wellings 2007). In the USA,
virulence has increased since the exotic introduction of PST-78 in 2000 (Chen
2007). Additionally, new variants of PST-78 are more aggressive and can tolerate
higher environmental temperatures (Milus et al. 2006). Wellings (2011) surveyed
25 scientists worldwide and found that regions in the USA, East Asia, South Asia,
Australia, and Kenya were the most “at risk” for stripe rust epidemics based on
incidence and severity scores. Clearly the continued evolution of new races and
their subsequent migration makes stripe rust the most damaging of all the cereal
rusts at this time on a global scale.
9.5 Conclusions
Wheat is the primary source of nutrition for about 85 % of the world’s population,
which is anticipated to grow to nine billion people by 2050 (Chaves et al. 2013).
Thus, it is critical to maximize production of this crop. The most important con-
straints to wheat production are the rust diseases, which are very explosive and can
cause severe epidemics with substantial losses in a short period of time. Rust dis-
eases are controlled mainly by deployment of resistance genes, but can be overcome
by new races with increased virulence that overcome host resistance. Although
numerous wheat cultivars have been developed with good levels of rust resistance
both before and subsequent to the Green Revolution, rusts are “shifty enemies”
(Stakman 1947) that constantly change in virulence in response to deployment of
new resistance genes. New races of stem, leaf, and stripe rust with increased viru-
lence have been recently described worldwide and present a significant threat to
global wheat production. Dr. Norman Borlaug said “Rust never sleeps,” and it is
critical that new rust scientists are trained and virulence surveys are conducted
worldwide on an annual basis. As earlier stated by Johnson and Newton (1946),
“the price of food security from rust damage is continued vigilance in the form of
surveys to detect any pathogenic changes … and unrelenting efforts to develop
cereal varieties resistant to virulent races as they arise.” Thus, we must not become
complacent after decades of research and control of rust diseases in many countries,
because we may have won the battle but have not yet won the war.
References
Allison CC, Isenbeck K (1930) Biologische Spezialisierung von Puccinia glumarum tritici, Erikss.
und Henn. Phytopathol Z (n.d.);2:87–98
Anikster Y (1984) The formae speciales. In: Bushnell WR, Roelfs AP (eds) The cereal rusts.
Academic, Orlando, pp 115–130
Arthur JC (1929) The plant rusts (Uredinales). Wiley, New York
Beresford RM (1982) Stripe rust (Puccinia striiformis), a new disease of wheat in New Zealand.
Cer Rust Bull 10:35
Bowden J, Gregory PH, Johnson CG (1971) Possible wind transport of coffee leaf rust across the
Atlantic Ocean. Nature 229(5285):500–501. doi:10.1038/229500b0
Brown JKM, Hovmoller MS (2002) Aerial dispersal of pathogens on the global and continental
scales and its impact on plant disease. Science 297:537–541
Campbell CL, Long DL (2001) The campaign to eradicate the common Barberry in the United
States. In: Peterson PD (ed) Stem rust of wheat: from ancient enemy to modern foe. APS Press,
St. Paul, pp 16–50
Chaves M, Martinelli J, Wesp-Guterres C, Graichen F, Brammer S, Scagliusi S et al (2013) The
importance for food security of maintaining rust resistance in wheat. Food Secur 5(2):
157–176
Chen XM (2007) Challenges and solutions for stripe rust control in the United States. Aust J Agr
Res 58(6):648–655
Chen WQ, Wu LR, Liu TG, Xu SC, Jin SL, Peng YL et al (2009) Race dynamics, diversity, and
virulence evolution in Puccinia striiformis f. sp. tritici, the causal agent of wheat stripe rust in
China from 2003 to 2007. Plant Dis 93(11):1093–1101
Craigie JH (1927) Discovery of the function of the pycnia of the rust fungi. Nature 120:1–7
Cummins GB (ed) (1971) The rust fungi of cereals, grasses, and bamboos. Springer, Berlin
Dubin HJ, Brennan JP (2009) Combating stem and leaf rust of wheat. IFPRI Discussion paper 910
[serial on the Internet]. http://www.ifpri.org/publication/combating-stem-and-leaf-rust-wheat
Dyck PL (1993) The inheritance of leaf rust resistance in the wheat cultivar Pasqua. Can J Plant
Sci 73:903–906
Fetch T, Jin Y, Nazari K, Park R, Prashar M, Pretorius Z (2009) Race nomenclature systems: can
we speak the same language? In: McIntosh R (ed) Proc. BGRI 2009 Technical Workshop,
Obregon, Mexico, pp 61–64. http://www.globalrust.org/sites/default/files/2009%20BGRI%20
Plenary%20papers.pdf
Fetch T, McCallum B, Menzies J, Rashid K, Tenuta A (2011) Rust diseases in Canada. Prairies
Soils Crops J [serial on the Internet] 4:86–96. http://www.prairiesoilsandcrops.ca/
Fetch T, Zegeye T, Singh D, Wanyera R, Penner M, Rashid K (2012) Virulence of Ug99 (race
TTKSK) and race RRTTF on Canadian wheat cultivars. Can J Plant Sci 92(3):602
Flor HH (1971) Current status of the gene-for-gene concept. Annu Rev Phytopathol 9:275–296
Fontana F (1767) Observations on the rust of grain. In: Phytopathological classics. American
Phytopathological Society, Washington, DC, pp 1–38
Germán S, Barcellos A, Chaves M, Kohli M, Campos P, De Viedma L (2007) The situation of com-
mon wheat rusts in the Southern Cone of America and perspectives for control. Aust J Agr Res
58(6):620–630
Groth JV (1984) Virulence frequency dynamics of cereal rust fungi. In: Bushnell WR, Roelfs AP
(eds) The cereal rusts. Academic, Orlando, pp 231–252
Hiebert CW, Thomas JB, McCallum BD, Humphreys DG, DePauw RM, Hayden MJ et al (2010)
An introgression on wheat chromosome 4DL in RL6077 (Thatcher*6/PI 250413) confers adult
plant resistance to stripe rust and leaf rust (Lr67). Theor Appl Genet 121:1083–1091
Hodson DP (2011) Shifting boundaries: challenges for rust monitoring. Euphytica 179(1):
93–104
Huerta Espino J (1992) Analysis of wheat leaf and stem rust virulence on a worldwide basis [PhD
thesis]. University of Minnesota, St. Paul
Huerta-Espino J, Singh RP, Germán S, McCallum BD, Park RF, Chen WQ et al (2011) Global
status of wheat leaf rust caused by Puccinia triticina. Euphytica 179(1):143–160
Iqbal MJ, Ahmad I, Khanzada KA, Ahmad N, Rattu AUR, Fayyaz M et al (2010) Local stem rust
virulence in Pakistan and future breeding strategy. Pakistan J Bot 42(3):1999–2009
Isard SA, Russo JM ( 2011) Risk assessment of aerial transport of rust pathogens to the western
hemisphere and within North America. In: McIntosh R (ed) Proc BGRI 2011 Tech Workshop.
St. Paul, MN, pp 25–34. http://www.globalrust.org/db/attachments/knowledge/134/2/2011%20
BGRI%20proceedings%20PAPERS-pp1-53.pdf
Jackson HS, Mains EB (1921) Aecial stage of the orange leaf rust of wheat, Puccinia triticina
Erikss. J Agric Res 22:151–172
Jin Y (2011) Role of Berberis spp. as alternate hosts in generating new races of Puccinia graminis
and P. striiformis. Euphytica 179(1):105–108
Jin Y, Singh RP, Ward RW, Wanyera R, Kinyua M, Njau P et al (2007) Characterization of seedling
infection types and adult plant infection responses of monogenic Sr gene lines to race TTKS of
Puccinia graminis f. sp. tritici. Plant Dis 91(9):1096–1099
Jin Y, Szabo LJ, Carson M (2010) Century-old mystery of Puccinia striiformis life history solved
with the identification of berberis as an alternate host. Phytopathology 100(5):432–435
Johnson T (1956) Physiologic races of leaf rust of wheat in Canada 1931 to 1955. Can J Agric Sci
36:371–379
Johnson T (1961) Man-guided evolution in plant rusts. Science 133:357–362
Johnson T, Newton M (1946) Specialization, hybridization, and mutation in the cereal rusts. Bot
Rev 12:337–392
Johnson R, Stubbs RW, Fuchs E, Chamberlain NH (1972) Nomenclature for physiologic races of
Puccinia striiformis infecting wheat. Trans Br Mycol Soc 58:475–480
Johnson R, Priestley RH, Taylor EC (1978) Occurrence of virulence in Puccinia striiformis for
Compair wheat in England. Cer Rusts Bull 6:11–13
Johnston CO (1961) Sixth revision of the international register of physiologic races of Puccinia
recondita rob. ex desm. (formerly P. rubigo-vera tritici). U.S. Department of Agriculture,
Washington, DC, pp 1–15
Johnston CO, Caldwell RM, Compton LE, Browder LE (1968) Physiologic races of Puccinia
recondita f. sp. tritici in the United States from 1926 through 1960. US Dept Agric Tech Bull
1393:1–22
Kolmer JA (1989) Virulence and race dynamics of Puccinia recondita f. sp. tritici in Canada dur-
ing 1956-1987. Phytopathology 79:349–356
Kolmer JA (1992) Effect of sexual recombination in two populations of the wheat leaf rust fungus,
Puccinia recondita. Can J Bot 70:359–363
Kolmer JA (1999) Virulence dynamics, phenotypic diversity, and virulence complexity in two
populations of Puccinia triticina in Canada from 1987 to 1997. Can J Bot 77:333–338
Kolmer J (2000) Early research on the genetics of Puccinia graminis and stem rust resistance in
wheat in Canada and the United States. In: Peterson PD (ed) Stem rust of wheat: from ancient
enemy to modern foe. APS, St. Paul, pp 51–82
Kolmer JA (2001) Molecular polymorphism and virulence phenotypes of the wheat leaf rust fun-
gus Puccinia triticina in Canada. Can J Bot 79(8):917–926
Kolmer J (2013) Leaf rust of wheat: pathogen biology, variation and host resistance. Forests
4:70–84
Kolmer JA, Dyck PL (1994) Gene expression in the Triticum aestivum-Puccinia recondita f. sp.
tritici gene-for-gene system. Phytopathology 84:437–440
Kolmer JA, Ordonez ME (2007) Genetic differentiation of Puccinia triticina populations in central
Asia and the Caucasus. Phytopathology 97:1141–1149
Kolmer J, Chen X, Jin Y (2009) Diseases which challenge global wheat production—the wheat
rusts. In: Carver BF (ed) Wheat science and trade. Wiley-Blackwell, Ames, pp 89–124
Kolmer JA, Ordonez ME, Manisterski J, Anikster Y (2011) Genetic differentiation of Puccinia
triticina populations in the Middle East and genetic similarity with populations in Central Asia.
Phytopathology 101(7):870–877
Kolmer JA, Hanzalova A, Goyeau H, Bayles R, Morgounov A (2012a) Genetic differentiation of
the wheat leaf rust fungus Puccinia triticina in Europe. Plant Pathol 62:21–31
Kolmer JA, Long DL, Hughes ME (2012b) Physiologic specialization of Puccinia triticina on
wheat in the United States in 2010. Plant Dis 96(8):1216–1221
Leonard KJ (2000) Stem rust- Future enemy? In: Peterson PD (ed) Stem rust of wheat: from
ancient enemy to modern foe. APS, St. Paul, pp 119–142
Liu JQ, Kolmer JA (1998) Molecular and virulence diversity and linkage disequilibria in asexual
and sexual populations of the wheat leaf rust fungus, Puccinia recondita. Genome 41:
832–840
Long DL, Kolmer JA (1989) A North American system of nomenclature for Puccinia recondita f.
sp tritici. Phytopathology 79:525–529
Long DL, Schafer JF, Roelfs AP (1985) Specific virulence of Puccinia recondita f. sp. tritici in the
United States from 1978 through 1983. Plant Dis 69:343–347
Luig NH (1983) editor. A survey of virulence genes in wheat stem rust, Puccinia graminis f. sp.
tritici. Adv. Plant Breed, Verlag Paul Parey, Berlin Vol. 11
Luig NH (1985) Epidemiology in Australia and New Zealand. In: Roelfs AP, Bushnell WR (eds)
The cereal rusts. Academic, Orlando, pp 301–328
Luig NH, Burdon JJ, Hawthorn WM (1985) An exotic strain of Puccinia recondita tritici in
New Zealand. Can J Plant Pathol 7(2):173–176
Maddison AC, Manners JG (1972) Sunlight and the viability of cereal rust uredospores. Trans Br
Mycol Soc 59:429–443
Mains EB, Jackson HS (1926) Physiologic specialization in the leaf rust of wheat; Puccinia tri-
ticina Erikss. Phytopathology 16:89–120
Maynard SJ (1968) Evolution in asexual and sexual populations. Am Nat 102:469–473
McCallum BD, Thomas J (2011) Effectiveness of wheat leaf rust gene combinations derived from
the cultivar Pasqua. In: Plant and animal genome conference XIX, San Diego, Jan 15–19
McCallum BD, Humphreys DG, Somers DJ, Dakouri A, Cloutier S (2011a) Allelic variation for
the rust resistance gene Lr34/Yr18 in Canadian wheat cultivars. Euphytica 183(2):261–274
McCallum BD, Seto-Goh P, Xue A (2011b) The detection of virulence to Lr21 in Canada during
2011. Can J Plant Sci 92:605
McIntosh RA, Wellings CR, Park RF (1995) Wheat rusts—an atlas of resistance genes. In:
McIntosh RA (ed). CSIRO, East Melbourne
Mert Z, Karakaya A, Düşünceli F, Akan K, Çetin L (2012) Determination of Puccinia graminis
f. sp. tritici races of wheat in Turkey. Turk J Agric For 36(1):107–120
Milus EA, Seyran E, McNew R (2006) Aggressiveness of Puccinia striiformis f. sp. tritici isolates
in the south-central United States. Plant Dis 90(7):847–852
Muller HJ (1932) Some genetic aspects of sex. Am Nat 8:118–138
Nagarajan S, Joshi LM (1985) Epidemiology in the Indian subcontinent. In: Roelfs AP, Bushnell
WR (eds) The cereal rusts. Academic, Orlando, pp 371–402
O’Brien L, Brown JS, Young RM, Pascoe T (1980) Occurrence and distribution of wheat stripe rust
in Victoria and susceptibility of commercial wheat cultivars. Australas Plant Pathol 9:14
Ordonez ME, Kolmer JA (2007) Virulence phenotypes of a worldwide collection of Puccinia tri-
ticina from durum wheat. Phytopathology 97:344–351
Ordonez ME, Kolmer JA (2009) Differentiation of molecular genotypes and virulence phenotypes
of Puccinia triticina from common wheat in North America. Phytopathology 99:750–758
Ordonez ME, Germán SE, Kolmer JA (2010) Genetic differentiation within the Puccinia triticina
population in South America and comparison with the North American population suggests
common ancestry and intercontinental migration. Phytopathology 100(4):376–383
Pan Z, Yang XB, Pivonia S, Xue L, Pasken R, Roads J (2006) Long-term prediction of soybean rust
entry into the continental United States. Plant Dis 90(7):840–846
Park RF (2007) Stem rust of wheat in Australia. Aust J Agr Res 58(6):558–566
Park RF, Wellings CR (2012) Somatic hybridization in the Uredinales. Annu Rev Phytopathol
50(1):219–239
Park RF, Burdon JJ, McIntosh RA (1995) Studies on the origin, spread, and evolution of an impor-
tant group of Puccinia recondita f. sp. tritici pathotypes in Australasia. Eur J Plant Pathol 101(6):
613–622
Park RF, Bariana HS, Wellings CR, Wallwork H (2002) Detection and occurence of a new pathot-
ype of Puccinia triticina with virulence for Lr24 in Australia. Aust J Agr Res 53:1069–1076
Park R, Fetch T, Hodson D, Jin Y, Nazari K, Prashar M et al (2011) International surveillance of
wheat rust pathogens: progress and challenges. Euphytica 179(1):109–117
Peterson PD (2001) Stem rust of wheat: exploring the concepts. In: Peterson PD (ed) Stem rust of
wheat: from ancient enemy to modern foe. APS, St. Paul, pp 1–16
Peturson B (1958) Wheat rust epidemics in Western Canada in 1953, 1954, and 1955. Can J Plant
Sci 38:16–28
Prashar M, Bhardwaj SC, Jain SK, Datta D (2007) Pathotypic evolution in Puccinia striiformis in
India during 1995–2004. Aust J Agr Res 58(6):602–604
Pretorius ZA, Singh RP, Wagoire WW, Payne TS (2000) Detection of virulence to wheat stem rust
resistance gene Sr31 in Puccinia graminis f. sp. tritici in Uganda. Plant Dis 84(2):203
Pretorius ZA, Pakendorf KW, Marais GF, Prins R, Komen JS (2007) Challenges for sustainable
cereal rust control in South Africa. Aust J Agr Res 58(6):593–601
Pretorius ZA, Bender CM, Visser B, Terefe T (2010) First report of a Puccinia graminis f. sp. tritici
race virulent to the Sr24 and Sr31 wheat stem rust resistance genes in South Africa. Plant Dis
94(6):784
Roelfs AP (1978) Estimated losses caused by rust in small grain cereals in the United States—1918
to 1976. USDA Misc Publ No 1363. U.S. Department of Agriculture, Washington, DC
Roelfs AP (1982) Effects of barberry eradication on stem rust in the United States. Plant Dis
72:177–181
Roelfs AP (1985a) Epidemiology in North America. In: Roelfs AP, Bushnell WR (eds) The cereal
rusts. Academic, Orlando, pp 403–434
Roelfs AP (1985b) Wheat and rye stem rust. In: Roelfs AP, Bushnell WR (eds) The cereal rusts.
Academic, Orlando, pp 3–37
Roelfs AP, Groth JV (1980) A comparison of virulence phenotypes in wheat stem rust Puccinia
graminis f. sp. tritici populations reproducing sexually and asexually. Phytopathology
70:855–862
Rowell JB, Roelfs AP (1971) Evidence for an unrecognized source of overwintering wheat stem
rust in the United States. Plant Dis Rep 55:990–992
Saari EE, Prescott JM (1985) World distribution in relation to economic losses. In: Roelfs AP,
Bushnell WR (eds) The cereal rusts, vol 2. Academic, Orlando, pp 259–298
Samborski DJ (1963) A mutation in Puccinia recondita Rob. ex. Desm. f. sp. tritici to virulence on
transfer, Chinese spring × Aegilops umbrellulata Zhuk. Can J Bot 41:475–479
Samborski DJ (1985) Wheat leaf rust. In: Roelfs AP, Bushnell WR (eds) The cereal rusts, vol II,
Diseases, distribution, epidemiology, and control. Academic, Orlando, pp 39–59
Schafer JF, Roelfs AP, Bushnell WR (1984) Contributions of early scientists to knowledge of
cereal rusts. In: Bushnell WR, Roelfs AP (eds) The cereal rusts: origins, specificity, structure,
and physiology. Academic, Orlando, pp 3–38
Sharma-Poudyal D, Chen XM, Wan AM, Zhan GM, Kang ZS, Cao SQ et al (2013) Virulence
characterization of international collections of the wheat stripe rust pathogen, Puccinia striifor-
mis f. sp. tritici. Plant Dis 97(3):379–386
Singh RP (ed) (2004) The cost to agriculture of recent changes in cereal rusts. In: Proc 11th Intl
cereal rusts and powdery mildews conf, 22–27 Aug, John Innes Centre, Norwich
Singh RP (2006) Current status, likely migration and strategies to mitigate the threat to wheat
production from race Ug99 (TTKS) of stem rust pathogen. CAB Rev 1:54
Singh RP, Huerta-Espino J, Pfeiffer W, Figueroa-Lopez P (2004a) Occurrence and impact of a new
leaf rust race on durum wheat in Northwestern Mexico from 2001 to 2003. Plant Dis
88(7):703–708
Singh RP, William HM, Huerta-Espino J, Rosewarne GM (eds) (2004b) Wheat rust in Asia:
meeting the challenges with old and new technologies. 4th Intl Crop Sci Congr, 26 September—1
October, Brisbane, Australia. http://www.cropscience.org.au/icsc2004/symposia/3/7/141_
singhrp.htm
Singh RP, Hodson DP, Huerta-Espino J, Jin Y, Njau P, Wanyera R et al (2008) Will stem rust
destroy the world’s wheat crop? In: Sparks D (ed) Advances in agronomy. Academic,
Burlington, pp 271–309
Singh RP, Hodson DP, Huerta-Espino J, Jin Y, Bhavani S, Njau P et al (2011) The emergence of
Ug99 races of the stem rust fungus is a threat to world wheat production. Annu Rev of
Skolotneva ES, Volkova VT, Zaitseva LG, Lekomtseva SN (2010) The virulence of wheat stem rust
pathogen in the central region of Russia. Mikol Fitopatol 44(4):367–372
Stakman EC (1934). Epidemiology of cereal rusts. In: Proc 5th Pac Sci Congr, vol 4,
pp 3177–3184
Stakman EC (1947) Plant diseases are shifty enemies. Am Sci 35:321–350
Stakman EC, Harrar JG (1957) Principles of plant pathology. Ronald, New York
Stakman EC, Piemeisel FJ (1917) Biologic forms of Puccinia graminis on cereals and grasses.
J Agric Res (Washington, DC) 10:429–495
Stakman EC, Stewart DM, Loegering WQ (1962) Identification of physiologic races of Puccinia
graminis var. tritici. US Dept Agric Res Serv Bull E617 (revised 1962), pp 1–53
Stubbs RW (1985) Stripe rust. In: Roelfs AP, Bushnell WR (eds) The cereal rusts. Academic,
Orlando, pp 61–101
Wan A, Zhao Z, Chen X, He Z, Jin S, Jia Q et al (2004) Wheat stripe rust epidemic and virulence
of Puccinia striiformis f. sp. tritici in China in 2002. Plant Dis 88(8):896–904
Wan AM, Chen XM, He ZH (2007) Wheat stripe rust in China. Aust J Agr Res 58(6):605–619
Wang X, McCallum B (2009) Fusion body formation, germ tube anastomosis, and nuclear migra-
tion during the germination of urediniospores of the wheat leaf rust fungus Puccinia triticina.
Phytopathology 99(12):1355–1364
Wang X, Bakkeren G, McCallum B (2010) Virulence and molecular polymorphisms of the wheat
leaf rust fungus Puccinia triticina in Canada from 1997 to 2007. Botany 88:575–589
Watson IA, de Sousa CNA (1982) Long distance transport of spores of Puccinia graminis tritici in
the southern hemisphere. Proc Linn Soc NSW 106:311–321
Watson IA, Luig NH (1958) Widespread natural infection of barberry by Puccinia graminis in
Tasmania. Proc Linn Soc NSW 83:181–186
Wellings CR (2007) Puccinia striiformis in Australia: a review of the incursion, evolution, and
adaptation of stripe rust in the period 1979-2006. Aust J Agr Res 58(6):567–575
Wellings CR (2009) The development and application of near—isogenic lines for monitoring
cereal rust pathogens. Proc Borlaug Global Rust Initiative Technical Workshop, BGRI Cd
Obregon, Mexico, p 77
Wellings CR (2011) Global status of stripe rust: a review of historical and current threats. Euphytica
179(1):129–141
Williams PG, Scott KJ, Kuhl JL, Maclean DJ (1967) Sporulation and pathogenicity of Puccinia
graminis f. sp. tritici grown on an artificial medium. Phytopathology 57:326–327
Wolday A, Fetch T, Hodson DP, Cao W, Briere S (2011) First report of Puccinia graminis f. sp.
tritici races with virulence to wheat stem rust resistance genes Sr31 and Sr24 in Eritrea. Plant
Dis 95(12):1591
Yahyaoui AH, Hakim MS, El Naimi M, Rbeiz N (2002) Evolution of physiologic races and virulence
of Puccinia striiformis on wheat in Syria and Lebanon. Plant Dis 86:499–504
Chapter 10
Fusarium Diseases of Canadian Grain Crops:
Impact and Disease Management Strategies
Nora A. Foroud, Syama Chatterton, Lana M. Reid, T. Kelly Turkington,

Sheryl A. Tittlemier, and Tom Gräfenhan
10.1 Fusarium Species Classification and Genetics
Species of the genus Fusarium are ascomycetes that are characterized by their typical
conidia, which are often fusiform to sickle-shaped with an elongated apical cell and
pedicellate basal (foot) cell. Several important Fusarium species, including F. avena-
ceum, F. graminearum and F. pseudograminearum, are known to produce a teleo-
morph state that was formerly classified in the genus Gibberella. In other species,
such as F. culmorum, F. oxysporum and F. sporotrichioides, no teleomorph has been
reported, so far. Geiser et al. (2013) proposed to recognize the genus Fusarium as the
sole name for a group that includes virtually all important saprophytic, plant patho-
genic, and mycotoxigenic species. Fusarium spp. can be identified by morphological
features and also by genetic analysis. Morphological species identification can be
based on microscopic and/or macroscopic characters, such as conidia, phialides,
chlamydospores, ascospores and colony characteristics of pure cultures (see
Figs. 10.1 and 10.2). Macroconidia, a form of asexual spores most often aggregated
to sporodochia, are usually ‘banana’-shaped in Fusarium species, which can also
produce microconidia in the aerial mycelium and/or chlamydospores in hyphae. The
size, shape and number of septa in the macroconidia are often used to differentiate
N.A. Foroud, Ph.D. (*) • S. Chatterton, Ph.D.

Lethbridge Research Centre, Agriculture and Agri-Food Canada,
5403 1st Ave. S, Lethbridge, AB, Canada T1J 4B1
e-mail: nora.foroud@agr.gc.ca
L.M. Reid, Ph.D.
Eastern Cereal and Oilseed Research Centre, Agriculture and Agri-Food Canada,
Central Experimental Farm, Ottawa, ON, Canada
T.K. Turkington, Ph.D.
Lacombe Research Centre, Agriculture and Agri-Food Canada, Lacombe, AB, Canada
S.A. Tittlemier, Ph.D. • T. Gräfenhan, Ph.D.
Grain Research Laboratory, Canadian Grain Commission, Winnipeg, MB, Canada

Fig. 10.1 Fusarium
graminearum: (a) Conidia
of a culture grown on potato
dextrose agar (PDA); (b) asci
and ascospores of the
teleomorph; (c) purplish-
black perithecia (teleomorph)
on barley seed; (d) close-up
of typically red mycelia with
a yellow tint; (e) colonies
growing from wheat seed as
seen from above (left) and
below (right)
Fig. 10.2 Fusarium

culmorum: (a) short and
broad conidia of a culture
grown on PDA; (b) close-up
of loose mycelium with
abundant orange and red
sporodochia; (c) fast growing
colonies from wheat seed as
below (right). Fusarium
avenaceum: (d) long and
slender conidia of a culture
grown on PDA; (e) close-up
of dense white mycelium
predominantly without
sporodochia; (f) colonies
often with white margin
growing from durum seed as
below (right)
10 Fusarium Diseases of Canadian Grain Crops… 269
between species (Leslie and Summerell 2006). The teleomorph state is characterized
by black, flask-shaped perithecia with a single ostiole (narrow opening) at the top,
from which the asci (containing the ascospores) are released. The asci of F. gra-
minearum (formerly Gibberella zeae) have been shown to be forcibly ejected through
the ostiole under conditions of high humidity (Trail et al. 2002).
Genetic analysis is a more accurate approach for species identification and is
enhanced by an increase in available Fusarium genome sequences. The genomes of
several important Fusarium species such as F. graminearum, F. oxysporum, F. pseu-
dograminearum, F. solani and F. verticillioides are publicly available through various
data portals (e.g. Broad Institute of Harvard and MIT; DOE Joint Genome Institute;
NCBI GenBank). The F. graminearum strain Ph1 was the first complete Fusarium
genome to be published and annotated (Cuomo et al. 2007). The F. graminearum
genome is 36 megabases (Mb) with over 13,000 genes. A comparison of the Ph1
strain with the partially completed genome of F. graminearum strain GZ3639 revealed
over 10,000 single-nucleotide polymorphisms found along all four chromosomes
(Cuomo et al. 2007). The complete genome sequence and assembly of F. gra-
minearum GZ3639 and seven other F. graminearum strains were recently prepared
by R. Subramaniam and colleagues (personal communications). F. graminearum has
a small number of chromosomes compared to other Fusarium spp., and this is
believed to be a result of ancestral chromosome fusion (Cuomo et al. 2007). F. verti-
cillioides strain 7600 and F. oxysporum f. sp. lycopersici strain 4287 were sequenced
and compared to F. graminearum Ph1 by Ma et al. (2010). F. verticillioides is 42 Mb
with over 14,000 genes found on 11 chromosomes. F. oxysporum f. sp. lycopersici
genome is 60 Mb, the largest of the three genomes, with over 17,000 genes encoded
on a total of 15 chromosomes. Four of the 15 chromosomes are lineage specific and
are composed primarily of transposable elements. Ma et al. (2010) also observed that
the lineage specific regions differ in sequence among different formae speciales of
F. oxysporum, and some of these regions encode virulence factors specific to the host
range of a given strain. They were able to demonstrate that chromosome 14, which
encodes host-specific virulence factors, is able to undergo horizontal transfer
between different F. oxysporum f. sp., and that this transfer leads to a change in
host-specificity. F. solani (N. haematococca MPVI isolate 77-13-4) has also been
sequenced and has 17 chromosomes with a genome size of 54.43 Mb. Of the 17
chromosomes, three (14, 15 and 17) are non-essential, and at least one of these
(chromosome 14) is involved in host-specificity (Coleman et al. 2009).
A subset of Fusarium spp. produces a series of mycotoxins, including trichothe-
cenes and fumonisins. Both of these classes of toxins are secondary metabolites and
their production is controlled by a specific set of genes found in clusters on the
genome. Fumonisins are produced by a number of Fusarium spp., including F. ver-
ticillioides, an important pathogen of maize. Over 28 fumonisins have been
identified to date, and are divided into four groups (Rheeder et al. 2002): A-, B-,
C- and P-series. Fumonisins are composed of a 19- to 20-carbon aminopolyhy-
droxyalkyl backbone, similar in structure to sphingosine (Shier 1992). The B-series
is the most abundant of the four series (where fumonisin B1 is the major fumonisin
found in Fusarium-infected grain) and forms the basic fumonisin structure.
270 N.A. Foroud et al.
The A-series is characterized by the acetylation of the amino group (Abbax et al.
1993); members of the C-series do not have a terminal methyl group (Branham and
Plattner 1993); members of the P-series have a 3-hydroxypyridinium in place of the
carbon-2 amine (Musser et al. 1996). Fumonisin toxicity is related to its ability to
disrupt sphingolipid metabolism through inhibition of ceramide synthase activity
(Voss et al. 2007). These toxins have been shown to affect mitochondrial respiration
(Domijan and Abramov 2011) and have been associated with various cancers in
humans and animals (Gelderblom et al. 1988; Müller et al. 2012). The fumonisin
biosynthetic genes are referred to as FUM genes and are found in the FUM cluster
(Proctor et al. 2003, 2006).
Trichothecenes are potent inhibitors of eukaryotic protein biosynthesis and are
expressed by Fusarium pathogens that affect cereal crops, including F. culmorum,
F. graminearum and F. sporotrichioides. Over 200 trichothecenes have been identi-
fied from a variety of fungal species (Cole and Cox 1981; Schollenberger et al.
2007). The trichothecenes are divided into four groups based on specific structural
features (reviewed in Shank et al. 2011): Types A, B, C and D. Trichothecene-
producing Fusarium spp. produce either Type A trichothecenes (such as T-2 toxin
and HT-2 toxin), or Type B trichothecene (such as nivalenol (NIV), 4-deoxynivale-
nol (DON; also known as vomitoxin) and acetylated derivatives). The genes encod-
ing trichothecene biosynthesis and metabolism (TRI genes) are mainly found in the
TRI cluster (Hohn et al. 1993; Ward et al. 2002; Brown et al. 2004), and the specific
trichothecenes produced by a given species are determined by the sequences of the
TRI genes within this cluster. A summary of TRI genes and their functions are
reviewed in Foroud and Eudes (2009). Sequence differences among specific TRI
genes, which define their trichothecene genotype (Desjardins 2008), have been used
to predict the trichothecene chemotype of a given Fusarium strain (Lee et al. 2001;
Ward et al. 2008; Alexander et al. 2011; Boutigny et al. 2011; Reynoso et al. 2011).
For example, NIV chemotypes are determined by the presence of functional
sequences of the Tri13 and Tri7 genes for NIV and 4-acetylnivalenol production,
respectively (Lee et al. 2002; Kim et al. 2003). DON producers, which do not express
functional Tri13/Tri7 genes, are divided into two chemotypes (3-acetyldeoxynivalenol
(3-ADON) and 15-acetyldeoxynivalenol (15-ADON)) determined by the esterase
specificity encoded in the TRI8 gene (Alexander et al. 2011).
From the Fusarium TRI cluster, DNA sequences of the TRI12 gene encoding a
trichothecene efflux pump have been used to develop real-time PCR assays for quan-
titative diagnostics of the 3ADON, 15ADON and NIV genotypes of F. graminearum
and F. culmorum (Kulik 2011; Nielsen et al. 2012). These assays utilize genetic
markers directly involved in the production of trichothecenes and provide a power-
ful, cost effective tool to monitor the genotype composition and shifts in pathogen
populations of mycotoxigenic Fusarium species. Over the past decade, a number of
quantitative assays for the detection and quantification of other toxin producing
Fusarium species have been published (reviewed by Morcia et al. 2013). Applications
of these quantitative diagnostic tools included traceability studies of different
Fusarium species on small cereals (Waalwijk et al. 2004, 2008; Yli-Mattila et al.
2006; Fredlund et al. 2010, 2013; Lindblad et al. 2013), grain dust (Halstensen et al.
2006), and along wheat processing chains (Terzi et al. 2007; Tittlemier et al. 2014).
For the development of species-specific detection assays, DNA sequences of bar-

code regions, including genes encoding the translation elongation factor 1α, β-tubulin,
or mating type (MAT) were successfully used for the detection and quantification of
Fusarium species (Nicolaisen et al. 2009; Demeke et al. 2010). In Fusarium, how-
ever, universal barcode markers, such as the internal transcribed spacer (ITS) regions
of the ribosomal DNA and the cytochrome oxidase 1 (COX1) gene, commonly used
for identification of other groups of fungi have been reported to be non-orthologous
and paralogous, respectively (O’Donnell and Cigelnik 1997; Gilmore et al. 2009).
Multiple copies of these barcode regions are present in Fusarium genomes, showing
a rather low degree of divergence among homologous sequences with a number of
closely related species sharing identical sequences. In metagenomic profiling of
microbial communities employing next generation sequencing (NGS), universal bar-
code markers often provide insufficient resolution at or below species level when
used for identification and semi-quantification of plant-associated Fusarium species.
Other universal barcodes, such as the protein coding chaperonin-60 (cpn60) gene
have been reported to be a robust target for species-level characterization in bacteria
(Links et al. 2012). The potential of cpn60 to identify and differentiate species of
Fusarium is currently being explored by the authors.
Studies on population dynamics based on single-nucleotide polymorphisms
(SNP) have proven to provide sufficient resolution for population- and individual-
level analyses of Fusarium species. They are adaptable to high-throughput DNA
chip-based methods, but finding markers to characterize and distinguish populations
is often problematic. Multilocus genotyping (MLGT) assays are a powerful tool that
can facilitate accurate identification of species and trichothecene chemotype for
large numbers of Fusarium isolates. Population dynamics behind adaptive shifts
observed for mycotoxin chemotypes and newly emerging pathotypes in Fusarium
graminearum were studied employing multiplex PCR assays to enable simultane-
ous determination of species identity and trichothecene chemotype (Ward et al.
2008; Gale et al. 2011). For other population studies (Suga et al. 2004), the genome
of Fusarium graminearum was mined for repeat sequences to analyze genotypes
based on variable number of tandem repeats (VNTR). A number of VNTR markers
were selected based on length polymorphisms and used to analyze population genet-
ics in F. graminearum and closely related taxa (Ward et al. 2008; Gale et al. 2011;
Zhang et al. 2012).
10.2 Fusarium Diseases of Pulse Crops
10.2.1 Pathogens
Canada is a major world exporter of pulse crops. In particular, lentil (Lens culina-
ris) and field pea (Pisum sativum) production in Canada has been rising due to the
benefits of crop diversification, nitrogen inputs into the soil, and increased
worldwide demand for pulse crops (Graham and Vance 2003). In 2012, 2.5 million
hectares of pulse crops were planted in Canada, with the majority planted to lentil
(1.0 million hectares), and peas (1.35 million hectares) (Statistics Canada). Dry
beans (Phaseolus vulgaris) and chickpeas (Cicer arietinum) comprise the remain-
der of pulse crops with 120,000 and 80,000 hectares planted, respectively, in 2012.
The goal of the Canadian pulse industry is to realize an increase of pulse acreage to
15 % of total planted area. Currently, pulse acreage accounts for an average of
5–10 % total crop area over the three main pulse-growing provinces of Manitoba,
Saskatchewan and Alberta.
As pulse acreage increases, the prevalence and incidence of root rots, caused by
Fusarium spp., have also been increasing. Most pulse crops are subject to root rot
pathogens that build up in the soil over several years and reduce plant stands and
yields (Persson et al. 1997; Bailey et al. 2003; Infantino et al. 2006; Naseri and
Marefat 2011). Root rot is a general term that describes disease symptoms which
include reddish-brown-black lesions on the hypocotyl and tap root, often accompa-
nied by vascular discolouration, foliar chlorosis and wilt (Agrios 1997; Bailey et al.
2003; Infantino et al. 2006). Yield losses of 10–30 % are commonly observed in
pulse crops affected by moderate to severe root rot, but yield loss potential can be
even higher under favourable environmental conditions (Oyarzun 1993; Schneider
et al. 2001; Schwartz et al. 2005; Cichy et al. 2007). Root rots, causing wilt and
death of mature plants, are reported throughout pulse-growing regions in Canada,
and experienced growers are increasingly challenged with yield loss due to stand
death. Annual disease surveys indicate that root rot incidence is now widespread in
most pulse-growing regions of Canada.
Root rots can be caused by a number of fungi, including Pythium, Rhizoctonia
and/or Fusarium spp. (Bailey et al. 2003). However, Fusarium root rot is considered
the most prevalent root disease in field peas, dry beans and lentils (Henriquez et al.
2012b; McLaren et al. 2012; Miller et al. 2012). In recent years, 80–100 % of pea
fields surveyed in Saskatchewan and Manitoba had plants with root rot symptoms,
with severity usually occurring at a moderate level, or 30–40 % of roots and lower
stem with symptoms (McLaren et al. 2010, 2011, 2012; Dokken-Bouchard et al.
2011). Fusarium solani f. sp. pisi and F. avenaceum (teleomorph formerly Giberella
avenacea) are the most prevalent pathogens in field pea crops, with F. avenaceum
becoming the predominant species isolated from rotted roots in recent years
(McLaren et al. 2012). Fusarium avenaceum is a common soil saprophyte in tem-
perate regions, and has traditionally been associated with crown rot and Fusarium
head blight (FHB) of cereals (Leslie and Summerell 2006; Fernandez 2009).
However, it is also very aggressive on all pulse crops, including lentils, dry bean and
field peas, and is now the principal species associated with root rot of field pea
across the prairie region (Feng et al. 2010; Chittem et al. 2012). The ‘F. solani spe-
cies complex’ comprises over 50 phylogenetic species, of which many members are
common soil-dwelling fungi, and act as saprophytes and/or plant pathogens
(Coleman et al. 2009). Pathogenic isolates in this group are further characterized by
formae speciales to indicate the specific host plants to which they are restricted,
such that F. solani f. sp. pisi is only pathogenic to pea, and F. solani f. sp. phaseoli
is only pathogenic to beans (Oyarzun et al. 1993).
F. solani f. sp. phaseoli is generally considered to be the most common pathogen

causing dry bean root rots, but recent surveys conducted in Manitoba indicate that
there is a complex of Fusarium spp. associated with root rot symptoms (Henriquez
et al. 2012a). Lentil root rot can also be caused by a number of different pathogenic
species including F. avenaceum, F. acuminatum and F. redolens (Hwang et al. 1994;
Bailey et al. 2000; Esmaeili Taheri et al. 2011). The vascular wilt pathogens F. oxy-
sporum ff. spp. pisi and f. sp. phaseoli are frequently found in pea and dry bean
fields, respectively, but are generally associated with low disease severity indexes
(Henriquez et al. 2012b; McLaren et al. 2012). Fusarium graminearum, the primary
causal agent of FHB in Canada, has also been associated with root rot of legumes
(Chongo et al. 2001; Goswami et al. 2008; Bilgi et al. 2011; Esmaeili Taheri et al.
2011; Henriquez et al. 2012a). Fusarium redolens, a Fusarium species closely
related to F. oxysporum (Bogale et al. 2007), is also frequently isolated from dis-
eased roots of pulse crops, including field pea, lentil and chickpea (Esmaeili Taheri
et al. 2011; Jiménez-Fernández et al. 2011). Fusarium redolens has a broad-host
range, and has also been shown to induce root rot symptoms in durum wheat in
Saskatchewan (Esmaeili Taheri et al. 2011).
10.2.2 Infection Pathways and Symptoms
Most of the Fusarium spp. capable of causing root rots on pulse crops produce the
same disease symptoms, making it difficult to distinguish between causal agents
(Hwang et al. 1995, 2000; Bailey et al. 2000; Bilgi et al. 2008; Feng et al. 2010).
Symptoms first appear as small reddish-brown lesions at the base of the hypocotyl
and taproot (Fig. 10.3a) (Stahl et al. 1994; Schwartz et al. 2005). As the disease
advances, lesions coalesce to form large necrotic areas which encircle the stem and
expand vertically (Fig. 10.3c) (Bailey et al. 2003). A reduction in root mass also
becomes evident at this stage. In the final stages of root rots, root mass will be reduced
by 80–100 %, the hypocotyl becomes pithy and lesions can extend vertically upwards
of 2 cm (Bilgi et al. 2008). At this point, the plant is functionally dead with obvious
signs of yellowing, wilting and collapse. Infection with F. solani and F. avenaceum
also causes red or brown streaking of the vascular system, indicating that these patho-
gens can enter the xylem (Fig. 10.3b) (Bailey et al. 2000, 2003; Feng et al. 2010). A
major impact of root-rotting fungi on pulse crops is the reduction in the number of
nodules on the roots, primarily because secondary root growth is severely impacted
(Hwang et al. 1994, 1995). This then results in a reduction in nitrogen fixation, thus
reducing the benefit of pulses to subsequent crops in a rotation.
Infection pathways of F. solani f. sp. pisi on field pea and F. solani f. sp. phaseoli
on dry bean have been well characterized. Fusarium solani survives in crop residues
and in soil as chlamydospores, which serve as the primary inoculum source (Leslie
and Summerell 2006). Chlamydospores are produced in infected tissues of host
crops at the end of the growing season, and can survive in the soil for extended
periods of time (Bailey et al. 2003; Schwartz et al. 2005). Germination of chla-
mydospores are stimulated by the presence of nutrients exuded from germinating
Fig. 10.3 Symptoms of root

rot on field pea: (a) early
symptoms with small brown
lesions at point of seed
attachment; (b) red streaking
of the vascular system
characteristic of Fusarium
infection; (c) extended
brown/black lesions on tap
root, and loss of secondary
root mass and root nodules
seeds of host crops, and thus use of rotations with non-host crops is essential to
reduce survival of chlamydospores (Mondal et al. 1996; Oyarzun et al. 1998).
Chlamydospores germinate to produce hyphae which can directly infect the devel-
oping hypocotyl and epicotyl of seedlings, or the hyphae produces macroconidia
which then infect the seedling (Nelson 2004). In vitro studies have shown that mac-
roconidia of F. solani invade root tissues by primarily colonizing the zone of elonga-
tion. The remainder of the root zones appear to be resistant to primary infection,
even in the presence of large numbers of macroconidia and fungal mycelia
(Gunawardena et al. 2005). However, Stahl et al. (1994) describe direct penetration
of the epidermis of the epicotyl. Production of cutinases by F. solani f. sp. pisi has
also been implicated in initial infection and penetration of the cuticle barrier
(Li et al. 2002; Hadwiger 2008). After penetrating the epidermis, mycelium then
advances through the cortex both inter- and intra-cellularly until it reaches the
Casparian strips present in the endodermis of epicotyl stems. At this point, degrada-
tion of the vascular parenchyma is visible in advance of the invading hyphae, sug-
gesting that cell wall degrading enzymes aid in breaking down the barrier to the
vascular system, and resulting in colonization of the vascular bundles. Studies of
F. solani on peas have shown that this pathogen will exclusively colonize the xylem
stem tissues beyond the epicotyl, while external lesions on the stem abruptly stop on
the epicotyl 1–2 cm above ground (Stahl et al. 1994). It is unknown whether the
other root-rotting fungi, such as F. avenaceum and F. graminearum, colonize and
infect tissues of all host pulse crops in a similar manner.
Unlike the other Fusarium root rot pathogens of pulses, F. avenaceum is unable
to produce chlamydospores, and thus survives in crop residues of susceptible host
crops (Leslie and Summerell 2006). Modern agronomic practices, such as reduced
tillage, increased glyphosate use and crop rotation with susceptible hosts, have
likely allowed pathogenic Fusarium spp. to accumulate to damaging levels
(Fernandez et al. 2008, 2009, 2011). The increasing prevalence of F. avenaceum
associated with both broad-leaf pulse and cereal crops in Saskatchewan suggests
that Fusarium inoculum is being maintained or even increasing on residues of these
host crops (Bailey et al. 2001; Fernandez 2007; Abdellatif et al. 2010; Feng et al.
2010). Fusarium avenaceum isolates display genetic and ecological plasticity,
allowing this fungus to occupy several ecological niches, such as root tissues of
pulses, head and root tissues of cereals and residues of host crops (Abdellatif et al.
2010). Fusarium avenaceum survived in colonized stem bases of winter wheat over
a period of 10 months in the Netherlands (Köhl et al. 2007) with DNA levels
decreasing by only 50 % over the winter months. F. graminearum survived in stand-
ing wheat stubble for up to 20 months, and provided sufficient inoculum levels to
serve as a primary inoculum for subsequent crops (Hogg et al. 2010).
10.2.3 Resistance Mechanisms
No commercial cultivars of field pea, lentil or dry beans are completely resistant to
Fusarium root rot (Bailey et al. 2003; Grünwald et al. 2003; Xue 2003). Partial
resistance to Fusarium root rot caused by both F. solani and F. avenaceum has been
reported in one commercial cultivar, ‘Franklin’ (Chittem et al. 2012). The mecha-
nism of resistance is not known, although generally genotypes of dry beans and field
peas with large, robust root systems show better resistance than those with small
root systems (Kraft and Boge 2001; Cichy et al. 2007). Partial resistance is present
in several field pea accessions, but these have not yet been transferred into lines with
desirable commercial attributes (Grünwald et al. 2003). Quantitative trait locus/loci
(QTL) that confer partial resistance to F. solani and F. avenaceum have been
described in field pea, however these QTL did not account for 60 % and 80 %,
respectively, of the observed phenotypic variation in root rot resistance (Feng et al.
2011; Li et al. 2012). This suggests that additional resistance genes or QTL are
associated with root rot resistance (Feng et al. 2011; Li et al. 2012).
In general, large-seeded Andean dry beans (e.g. kidney beans) tend to be more
susceptible to Fusarium root rot than the small-seeded Mesoamerican type beans
(e.g. black beans) (Bilgi et al. 2008). Cultivars with partial resistance to F. solani f. sp.
phaseoli also appear to have resistance to other Fusarium root rot pathogens, such as
F. graminearum (Bilgi et al. 2011). Similar to the situation in field peas, QTL have
been identified in dry bean from bean lines with different root rot resistance
sources, but these QTL generally account for a small proportion of root rot variation
(Schneider et al. 2001; Román-Avilés and Kelly 2005; Ronquillo-López et al. 2010).
Most of these QTL are present in regions of the bean genome where resistance genes,
such as pathogenesis-related proteins (PVPR-2), polygalacturonase-inhibiting pro-
tein (Pgip) and chalcone synthase (ChS) are located (Schneider et al. 2001).
This would indicate that partial physiological resistance to Fusarium root rot is
associated with generalized host defense responses that are induced upon host attack
(Schneider et al. 2001; Román-Avilés and Kelly 2005). However, markers associated
with field root rot resistance often do not correlate with greenhouse root rot screening
experiments (Román-Avilés and Kelly 2005). This lack of association suggests that
environmental variation is the most important factor contributing to disease develop-
ment and resistance responses to Fusarium root rot. As a result, breeding for resis-
tance and elucidation of genetic resistance to Fusarium root rots has been challenging,
and limited progress has been made in identifying sources of genetic resistance
(Singh and Schwartz 2010).
The pea-F. solani interaction has been studied as a model system to understand the
biochemical and molecular components of non-host resistance by comparing the dif-
ference in responses of pea to infection with F. solani ff. spp. pisi and phaseoli. This
topic has been reviewed extensively in a recent article (Hadwiger 2008), and thus will
not be reviewed again here.
10.3 Fusarium Diseases of Cereals
10.3.1 Pathogens and Associated Mycotoxins
The two main Fusarium diseases of cereal crops are FHB and Fusarium crown rot
(FCR), both of which have been observed in wheat, barley, rye, oats and triticale.
FHB is reviewed here in greater detail since it is the main Fusarium disease of
cereal crops in Canada and worldwide. Fusarium culmorum, F. graminearum and F.
pseudograminearum (teleomorph aka Gibberella coronicola) are the major species
responsible for FHB and/or FCR (O’Donnell et al. 2000; Liddell 2003; Backhouse
et al. 2004; Smiley et al. 2005; Tóth et al. 2005); although, F. pseudograminearum,
primarily responsible for FCR, is only found occasionally in Canada, as this species
prefers warmer and drier climates. The majority of Fusarium spp. involved in FHB
and FCR produce mycotoxins belonging to the trichothecene class, although other
Fusarium mycotoxins including fumonisins, moniliformin (MON) and zearalenone
(ZEA), have also been found in FHB-infected cereals worldwide (Golrnski et al.
1996; Palacios et al. 2011). Trichothecenes contaminate the kernels of FHB-infected
spikes, and can also accumulate in the kernels of FCR-infected cereals when the
fungus moves up the stem and into the spike (Mudge et al. 2006). Trichothecenes
are harmful for human and animal consumers (Eriksen and Pettersson 2004;
Godfray et al. 2010), and also interfere with downstream processing including malt-
ing (Wolf-Hall 2007). Various cytotoxic effects of trichothecenes have been
observed in mammalian and plant systems (Ueno 1983; Rocha et al. 2005; Pestka
2010; Arunachalam and Doohan 2013), although inhibition of eukaryotic protein
synthesis machinery is the main mechanism of toxicity (Ueno et al. 1968;
McLaughlin et al. 1977). Consumption of contaminated grain can lead to a condi-
tion known as alimentary toxic aleukia (ATA), where symptoms of ingestion include
gastroenteritis, abdominal and oesophageal pain, ataxia, dyspenia, and subcutane-
ous haemorrhaging (Lutsky et al. 1978; Peraica et al. 1999). The main potential
source of trichothecene contamination of food is from FHB-infected cereals, and
DON is the main trichothecene detected in grain. For this reason, limits are in place
to manage DON in food and feed, as described in Sect. 10.6.
The Fusarium spp. belonging to the F. graminearum (Fg) complex, responsible
for FHB in North America, are Type B trichothecene producers (Ward et al. 2002;
Starkey et al. 2007). Historically, Fg populations dominated by 15-ADON chemo-
types were responsible for FHB in North America. Some 3-ADON producers were
identified more frequently on the continent over 10 years ago, and have since been
replacing the 15-ADON populations (Ward et al. 2008). The 3-ADON producers
were shown to be the predominant genotype representing more than 90 % of the Fg
populations in the Canadian Maritimes (R. Clear, unpublished). Since the 1990s, the
3-ADON populations have been moving from the Red River valley in Manitoba to
eastern Saskatchewan, and currently represent up to 60 % of the Fg population in
central Alberta. The 3-ADON producers tend to be more aggressive (Foroud et al.
2012a) and produce higher levels of toxins both in culture and in planta (Ward et al.
2008; Puri and Zhong 2010; von der Ohe et al. 2010; Yli-Mattila and Gagkaeva
2010; Foroud et al. 2012a; Clear et al. 2013). The other important Type B trichothe-
cene producing species, F. culmorum (Fc), can be associated with FHB and FCR of
cereals. Its distribution in western Canada appears to depend partly on environmen-
tal factors. Especially in cooler and wet years, F. culmorum can be more frequently
detected (Fig. 10.4) and contribute significantly to DON contamination in cereal
grains (Clear et al. 1993). Similarly to F. graminearum, the 3-ADON chemotype of
F. culmorum is reported to be the more aggressive and toxigenic genotype (Miedaner
et al. 2004). In Canada, the 3-ADON genotype represents 100 % of the Fc popula-
tions found on cereals.
While DON producers are the main species in North America, other chemotypes
have also been identified in cereal crops. NIV producers, for example, encompass
79 % of the F. graminearum strains identified in Louisiana (Gale et al. 2011),
although, this is not representative of the entire population in the United States. In
Canada, the NIV chemotypes represent less than 1 % of the F. graminearum popula-
tion (Gräfenhan, unpublished). NIV has been shown to be less phytotoxic than
DON, and accumulates in lower quantities in the kernels of infected spikes in cereal
crops (Muthomi et al. 2000; Miedaner et al. 2001; Foroud et al. 2012a). However,
to animal and human health NIV is more acutely toxic than DON, with one tenth the
emetic potential compared to that of DON (Wu et al. 2013). In Canada, occasional
contamination of barley with NIV is often caused by infections with F. poae. The
Type A trichothecenes, produced by species such as F. sporotrichioides and F. poae,
tend to be more toxic in mammalian systems than Type B trichothecenes and have
also been identified in FHB-infected crops. In western Canada, trichothecene Type
A producing Fusarium species are more frequently recovered from FHB-diseased
oat and barley seeds (Gilbert and Tekauz 2011). On durum wheat, the predominant
Fusarium species found in Canada are F. graminearum and F. avenaceum (Clear
et al. 2005; Gräfenhan et al. 2013; Tittlemier et al. 2013b). Depending on the year,
the latter species can cause significant damage on heads and seed of durum, espe-
cially in the main growing areas of western Canada (Fig. 10.5). Tittlemier et al.
(2013b) demonstrated that F. avenaceum is the main producer of emerging myco-
toxins, including MON and enniatins (ENNs), on durum wheat in Canada.
Fig. 10.4 Frequency of

occurrence of Fusarium
culmorum on Fusarium
damaged kernels (FDK) of
wheat from western Canada
in the years 1995 (a), 2002
(b), and 2010 (c)
Fusarium infection of cereals is caused by inoculum build up in the soil on crop

residues. Initial FCR infection, which can be caused by Fusarium mycelium or
spores, occurs on emerging shoots, or at the crown or stem base of cereals (Burgess
et al. 2001). It has been shown that the trichothecene biosynthesis is initiated during
early stages of infection, and while trichothecene accumulation is not necessary for
symptoms to develop, a higher infection rate is observed in the presence of the toxin
Fig. 10.5 Frequency of

occurrence of Fusarium
avenaceum on Fusarium
damaged kernels (FDK) of
wheat from western Canada
in the years 1995 (a), 2002
(b), and 2010 (c)
(Mudge et al. 2006). The fungus can be isolated from the stem base, the flag leaf
node, mature heads and kernels of FCR-infected plants (Mudge et al. 2006). FCR
has been observed in cereal crops worldwide, including Canada and the United
States (Smiley et al. 2005; Fernandez et al. 2011), and tends to be a major problem
in Australia (Backhouse et al. 2004; Obanor et al. 2013).
While FHB can be caused by macroconidia or chlamydospores, ascospores
released from the perithecium under humid conditions (reviewed in Bai and Shaner
1994; Parry et al. 1995; Gilbert and Haber 2013) provide the main source of inocu-
lum under field conditions (Sutton 1982; Fernando et al. 2000; Markell and Francl
2003). Infection of cereal inflorescence occurs during anthesis and grain develop-
ment. Initial symptoms appear as brown water spots on individual spikelets, typi-
cally near the base of the glume. As infection progresses, the whole spikelet shows
signs of necrosis or premature senescence (Fig. 10.6), and sometimes white or
Fig. 10.6 Symptoms of

FHB: (a) browning/
discoloration of infected
spikelets in wheat; (b)
premature senescence of
FHB-infected wheat spike;
(c) browning/discoloration of
infected spikelets in barley
and (d) oat
pinkish mycelium is visible on the surface of the spikelet (Parry et al. 1995).
Detailed studies of Fusarium invasion of the wheat spike have been conducted using
sophisticated microscopy techniques (Kang and Buchenauer 1999, 2000a, b, c,
2002a, b, 2003; Siranidou et al. 2002; Wanjiru et al. 2002; Jansen et al. 2005; Kang
et al. 2005). Fusarium can gain access to the host cell through the stomata; however,
the primary mode of invasion is by direct penetration of the adaxial epidermal cell
walls of the spikelet (Kang and Buchenauer 2000a; Pritsch et al. 2000). Penetration
could be facilitated by cutinases and lipases which may lead to cuticle degradation,
and expression of a Fusarium gene encoding the latter has been implicated in FHB
aggressiveness (Voigt et al. 2005). While cuticle degradation has not been experi-
mentally observed, degradation of cell wall components has been observed during
Fusarium infection of wheat (Kang and Buchenauer 2000b; Wanjiru et al. 2002;
Kang et al. 2005). Furthermore, expression or accumulation of cell wall degrading
enzymes, including cellulases and pectate esterases, has been observed in the F.
graminearum secretome and upon exposure to plants or cell wall components
(Phalip et al. 2005; Paper et al. 2007; Carapito et al. 2013; Rampitsch et al. 2013).
Once established within the spikelet, hyphae can spread to other spikelets within the
head through the rachis (Parry et al. 1995). Disease spread typically occurs below
the infected spikelets, and premature senescence, or wilt, is sometimes observed
above the infected spikelets. Trichothecene biosynthesis is induced upon coloniza-
tion of the developing kernel, and again at the rachis node (Ilgen et al. 2009). DON
accumulates ahead of the growing hyphae, and by 4–6 days after inoculation the
hyphae can be found at the rachis both inside and outside of the vascular bundles
(Kang and Buchenauer 1999). The production of trichothecenes has been shown to
be necessary for Fusarium disease spread in Triticeae (Proctor et al. 1995; Eudes
et al. 2001; Bai et al. 2002; Langevin et al. 2004; Jansen et al. 2005; Maier et al.
2006). By contrast trichothecenes are not required for the establishment of initial
infection (Bai et al. 2002; Jansen et al. 2005). FHB infection of the wheat spike
leads to yield losses when infection occurs during anthesis and early stages of ker-
nel development, and the kernels that do develop are often contaminated with myco-
toxins (Bushnell et al. 2003; Steffenson 2003; Del Ponte et al. 2007).
10.3.3 Physiological Mechanisms of Resistance
The most effective means to prevent Fusarium-related damage is to cultivate crops

with high levels of resistance (Foroud and Eudes 2009). The mechanisms of FCR
resistance are not well characterized. FHB resistance mechanisms are well described,
with two major forms of resistance initially defined by Schroeder and Christensen
(1963): Type I, resistance to initial infection; and Type II, resistance to disease
spread within an infected spike. Other forms of resistance, as summarized by
Mesterházy (2003a), include: Type III, resistance to kernel infection (Mesterházy
1995); Type IV, tolerance to FHB and trichothecenes (Mesterházy 1995); and Type
V, resistance to trichothecene accumulation (Miller et al. 1985). Type V resistance
can be further subdivided into two classes based on the method of resistance, as
defined by Boutigny et al. (2008): Type V class 1 is defined as resistance to trichot-
hecene accumulation by chemical modification, and Type V class 2 is defined as
resistance to trichothecene accumulation by inhibition of its biosynthesis.
Cell wall lignification or thickening of the rachis node, accompanied with
delayed hyphal colonization of the rachis, has been implicated in Type II resistance
in wheat (Kang and Buchenauer 2000c). Jansen et al. (2005) also observed cell wall
thickening at the rachis node of susceptible wheat inoculated with a trichothecene
non-producing mutant (Proctor et al. 1995) of F. graminearum that is unable to
spread in otherwise susceptible cultivars. As previously mentioned, trichothecene
biosynthesis is induced when the hyphae reaches the rachis node (Ilgen et al. 2009),
and trichothecene production is required for disease spread to occur (Proctor et al.
1995). Thus, it is likely that accumulation of trichothecenes is involved in weaken-
ing the barrier at the rachis node, and that Type II resistant genotypes are able to
prevent and/or slow this process through enhanced cell wall thickening compared
with susceptible genotypes.
Among the major cereal crops, wheat is the most susceptible and the most heav-
ily FHB-affected crop, where tetraploid (AABB) durum wheat is more susceptible
than hexaploid (AABBDD) bread wheat (Langevin et al. 2004). Barley is the sec-
ond most affected cereal crop—although 6-row barley is nearly as susceptible as
wheat, whereas 2-row barley is more resistant. Barley has inherent Type II resis-
tance, and while unconventional mycelial spread by external routes has been
observed (Langevin et al. 2004), disease spread does not occur through the rachis
(Langevin et al. 2004; Jansen et al. 2005). Rye and oats are the most FHB resistant
among the major cereals (Langevin et al. 2004), although disease symptoms are not
as clearly discernible in standing oats as they are in other cereals (Fig. 10.6) (Tekauz
et al. 2004, 2008). Furthermore, oats tend to accumulate more DON and T-2 toxin
than wheat (Langseth and Rundberget 1999; Tekauz et al. 2004). Triticale, a hybrid
of wheat and rye which has generally been shown to have higher disease resistances
than wheat, is shown to have similar FHB-susceptibility as hexaploid wheat
(Langevin et al. 2004).
10.3.4 Genetics of Resistance
FHB resistance is polygenic and also tends to be associated with poor agronomics,
making it challenging for breeders to incorporate high levels of resistance into
favourable cultivars. Over 100 QTL have been identified in FHB resistance of hexa-
ploid wheat, and 22 of these have been reported in multiple mapping populations
(reviewed in Bürstmayr et al. 2009). One of the most widely used and best character-
ized sources of resistance is ‘Sumai3’, a Chinese cultivar with very strong Type II
resistance. Three major QTL have been identified in ‘Sumai3’: 3BS (also known as
Fhb1), which is the best source of Type II resistance; 5A, which is associated with
Type I resistance and is found in different germplasm from different regions world-
wide; and 6BS (Fhb2) (Bürstmayr et al. 2009). It has been proposed that the 3BS QTL
encodes or regulates expression of a UDP-glycosyltransferase (Lemmens et al. 2005)
or a pectin methyl esterase inhibitor (Zhuang et al. 2012). UDP-glycosyltransferases
can detoxify DON through condensation of glucose with the C-3 hydroxyl group
(Poppenberger et al. 2003). Glycosylated-DON and derivatives thereof have been
observed in Fusarium-infected cereals (Berthiller et al. 2005; Dall’Asta et al. 2005;
Lemmens et al. 2005). Pectin methylesterase inhibitors interfere with the activity of
pectin methylesterase, a key enzyme involved in pectin biosynthesis. Pectin is a major
component of the plant cell wall, and its degradation has been observed during
Fusarium infection of wheat (Kang and Buchenauer 2000b). Transgenic expression
of an Actinidia chinensis pectin methylesterase inhibitor has been shown to improve
resistance to fungal diseases (including FHB) in durum wheat (Volpi et al. 2011).
Despite the higher susceptibility and lower genome complexity of durum wheat,
only five QTL mapping studies on FHB resistance have been reported in tetraploid
wheat, and some of these were conducted in wild relatives of Triticum turgidum
subsp. durum (Ban and Watanabe 2001; Stack et al. 2002; Somers et al. 2006;
Bürstmayr et al. 2012). Several FHB-resistance QTL identified in tetraploid wheat
correspond to genomic regions of resistance QTL from hexaploid wheat, including
3B from T. turgidum subsp. durum and 6B from T. turgidum subsp. dicoccum, cor-
responding to the hexaploid 3BS and 6BS QTL, respectively (Bürstmayr et al. 2012).
In barley, FHB-resistance QTL have been identified on all seven chromosomes
(de la Pena et al. 1999; Zhu et al. 1999; Ma et al. 2000; Yu et al. 2010). The Vrs1
locus, which confers row-type, is associated with a QTL that confers the higher
FHB resistance observed in 2-row barley compared with 6-row. It is not known
whether this resistance is result of a pleiotropy or if it is directly linked to Vrs1
(reviewed in Massman et al. 2011).
In addition to QTL studies, a series of functional genomic experiments have been

conducted in wheat and barley to identify genes and/or molecular pathways involved
in mediating FHB resistance (Pritsch et al. 2000, 2001; Wang et al. 2005; Zhou et al.
2005, 2006; Boddu et al. 2006, 2007; Bernardo et al. 2007; Golkari et al. 2007, 2009;
Geddes et al. 2008; Li and Yen 2008; Jia et al. 2009; Steiner et al. 2009; Cho et al.
2012; Foroud et al. 2012b). In these studies, Fusarium-induced up-regulation of
pathogenesis-related (PR) proteins and antioxidants has been observed, and in some
cases this up-regulation was higher and/or sooner in resistant lines compared with
susceptible ones (Pritsch et al. 2000; Geddes et al. 2008; Golkari et al. 2009; Foroud
et al. 2012b). Changes in expression of genes involved in regulating plant hormone
biosynthesis and responses have also been observed. In microarray studies, comple-
mented by hormone treatment experiments, Li and Yen (2008) reported that the hor-
mones jasmonic acid (JA) and ethylene (ET) are involved in mediating FHB
resistance. Similarly, Desmond et al. (2005) reported a role for JA signalling in FCR
resistance in wheat; although, it should be noted that, a different set of host genes is
believed to be responsible for FHB and FCR resistances (Li et al. 2010). Virus-
induced gene silencing experiments in wheat, where suppression of the ET signalling
pathway leads to increased FHB-susceptibility (Gillespie et al. 2012), support results
presented by Li and Yen (2008). By contrast, genetic silencing of ET-INSENSITIVE
2 (EIN2; involved in ET signalling) by RNA-interference led to reduced FHB-
susceptibility in wheat cv. ‘Bobwhite’ (Chen et al. 2009). Furthermore, exogenous
applications of an ethylene precursor or inhibitor demonstrated that ET signalling
can enhance FHB-susceptibility in wheat and barley (Chen et al. 2009). This discrep-
ancy in results was also observed in a separate hormone silencing experiment, where
EIN2 was silenced by RNA-interference in three wheat genotypes (Foroud 2011). In
this study, ET silencing led to increased susceptibility in the susceptible genotype,
had no impact on the Type I resistant genotype, and led to increased resistance in the
Type II resistant genotype. Different outcomes were also observed in different
genetic backgrounds silenced in the JA- and salicylic acid (SA)-signalling pathways
(Foroud 2011). In the dicot plant Arabidopsis, Makandar et al. (2010) observed
crosstalk between SA and JA signalling pathways in Fusarium resistance, and pro-
posed that the timing of SA and JA signalling is critical in differentiating between
resistant and susceptible outcomes. Together, these studies suggest that the role of
plant hormones in mediating disease outcomes is genotype-dependent, and may be
dependent on crosstalk among different signalling pathways.
10.4 Fusarium Diseases of Maize
10.4.1 Pathogens and Associated Mycotoxins
Several species of Fusarium infect maize with infection of the ear and the stalk
being the most commonly found diseases. The predominant species causing ear
and stalk rot in Canada is F. graminearum (Koehler 1957, 1959; Sutton 1982;
Reid 1996). A less predominant species is F. verticillioides (previously referred to
as F. moniliforme, Seifert et al. 2003). A comprehensive list of other Fusarium

species responsible for ear and stalk rots is provided by Mesterházy et al. (2012).
The optimum temperature for F. graminearum development is 26–28 °C, while
F. verticillioides tends to grow best at higher temperatures (Reid et al. 1999); there-
fore, F. graminearum is predominantly found in northern regions worldwide and
F. verticillioides in the southern regions or in dryer years in a northern area (Reid
et al. 1999). A single ear or grain can occasionally be infected by different Fusarium
spp. (Logrieco et al. 2002). Pathogenicity between Fusarium spp. and aggressive-
ness within a species is quite variable and highly dependent on the environmental
conditions in a given field season (Reid et al. 2002; Garcia et al. 2009; Iglesias et al.
2010; Miedaner et al. 2010).
Fusarium spp. produce a large number of chemically very different mycotoxins
(Logrieco et al. 2002). Fusarium graminearum infected ears are usually contami-
nated with the trichothecene toxin DON before harvest and ZEA during storage. If
contaminated grain is fed to livestock, especially swine, DON results in vomiting,
feed refusal, decreased weight gain and reproductive problems (Vesonder et al.
1981; Prelusky et al. 1994). This toxin is also an immunosuppressant and thus pre-
disposes animals to other diseases and masks underlying toxicoses (Pestka and
Bondy 1994). ZEA causes reproductive problems including reduced litter size,
swine estrogenic syndrome and male infertility (Prelusky et al. 1994). Grain con-
taminated with the polyketide fumonisin mycotoxins produced by F. verticillioides
can result in equine leukoencephalomalacia (Kellerman et al. 1990), porcine pulmo-
nary edema (Harrison et al. 1990), liver cancer in rats (Gelderblom et al. 1988) and
neural tube defects in mice (Voss et al. 2006). Fumonisins have also been associated
with human esophageal cancer (International Agency for Research on Cancer
(ICARC) 1993). These fungal contaminations cause both direct and indirect eco-
nomic losses to the maize and livestock industry but they also affect the health of
grain handlers and processors.
There are many infection pathways by which Fusarium spp. can enter maize plants.
Stalk rot is often initiated from root infection, through stalk nodes or through holes in
the stalk often created by insects and sometimes mechanical damage from cultural
practices after planting. There are three potential fungal entry points for ear infection:
(1) by fungal spores landing on the silks of the flowering ears, germinating and then
the fungal mycelia grow down the silks to infect the kernels and cob (rachis) (Koehler
1942); (2) through wounds created by insects, hail, or birds on the ear (Sutton 1982);
and (3) from systemic stalk infections of F. verticillioides (Foley 1959; Munkvold
et al. 1997b). Which infection pathway is more important depends on the Fusarium
spp. that is predominant, the insect pressures in a given geographical location and the
environmental conditions. For example, Munkvold et al. (1997a) reported less ear rot
on maize hybrids with the Bt trait which considerably lowers European corn borer
Fig. 10.7 Symptoms of

Fusarium ear blight in maize
populations. Larger populations of thrips, especially on ears with looser husks, were
correlated to ear rot (Farrar and Davis 1991; Parsons and Munkvold 2010a, b).
The symptoms of ear rot are depicted in Fig. 10.7. Ear rot caused by F. gra-
minearum is characterized by a pinkish coloured mold (White 1999). Infection from
the silk commonly begins as white mycelium moving down from the ear tip. This
mycelium later turns reddish-pink on infected kernels. In some cases, pinkish fun-
gal growth can be found on the exterior husk leaves and in severe infections it is
impossible to separate the husks from the kernels as the entire ear becomes a tightly
bound mass of fungal and plant tissue that appears ‘mummified’. When infection
occurs through kernel wounds, a similar fungal growth pattern is seen but it starts
from the initial wound site and tends to spread to the tip of the ear faster than to the
butt of the ear (Reid and Sinha 1998). Once the kernels reach 22–23 % moisture it
is difficult for the fungus to further infect (Christensen and Kaufmann 1969; Xiang
et al. 2010a); however cob (rachis) moisture can be 15–25 % higher than kernel
moisture, so the infection may spread in the cobs and can enter younger kernels via
the pedicel (Reid and Sinha 1998). In some cases the ear may appear to be symp-
tomless but when squeezed by hand it will feel quite spongy and the cob will be wet
and often pink/red in colour. Symptoms of F. verticillioides infection on maize ears
are quite different from that of F. graminearum. Depending on the mode of fungal
entry, the symptoms often occur on individual kernels or on a limited area of the ear
(White 1999). Infected kernels develop a cottony white growth or may develop
white streaks on the pericarp and fungal growth on the cob. How fast symptoms
develop in a given year is highly dependent on the environment which, not only
influences ear development and subsequent kernel drydown, but also fungal growth.
Infection through the silks cannot proceed once the silks have dried out (Reid et al.
1992a; Reid and Sinha 1998) and there is a relationship between kernel drydown
rates and ear rot severity symptoms (Xiang et al. 2010a).
Maize plants with Fusarium stalk infections often wilt and the leaves may change
from a light to a dull green colour while the lower stalk becomes dry and the pith
tissue disintegrates to a shredded appearance. For F. graminearum, distinctive
symptoms are a tan to dark brown discolouration of the lower internodes and pink
to reddish discolouration of the pith tissue. Bluish-black coloured perithecia or
reddish-white asexual spores may form on the stalk surface. For F. verticillioides,
brown streaks appear on the lower internodes and the rotted pith tissue may be
whitish-pink to salmon in colour. For both pathogens, symptoms usually appear late
in the season and plants may lodge if infection is severe. Plants that are stressed,
such as from an early frost, are more susceptible to stalk rot.
For F. graminearum ear rot, visual symptoms are highly correlated to DON lev-
els (Reid et al. 1996; Perkowski et al. 1997; Reid and Sinha 1998; Bolduan et al.
2009). Correlations between symptoms and fumonisin levels are less reliable for
F. verticillioides infections possibly in part due to systemic infections from the stalk
leading to more asymptomatic infections (Pascale et al. 1997; Murillo-Williams and
Munkvold 2008).
10.4.3 Resistance Mechanisms
There is variability within the maize gene pool for levels of resistance to Fusarium
ear and stalk rots and breeders have successfully developed genotypes with high
levels of resistance to some of these diseases (Reid et al. 2001a, b, 2003); however,
it is not clear what the mechanism of this resistance is. Phenotypically, two forms of
resistance have been described in maize that are somewhat similar to resistance to
initial infection and disease spread, respectively, in cereals: (1) ‘silk resistance’,
where the fungus does not penetrate the silk channel, and thus does not infect the
kernels (Reid et al. 1992b); and (2) ‘kernel resistance’, where the fungus does not
penetrate the cob, and thus does not spread from kernel to kernel (Chungu et al.
1996). Studies have indicated that the resistance mechanisms may be associated
with flavone content in the silks, stalks and kernels (Reid et al. 1992a; Sekhon et al.
2006; Santiago et al. 2007), (E)-ferulic acid content and dehydrodimers of ferulic
acid in kernels (Assabgui et al. 1993; Bily et al. 2003), and 4-acetylbenzoxazolin-2-
one (4-ABOA) in kernels (Miller et al. 1997). Recently, Cao et al. (2011) researched
the role of hydroxycinnamic acids and reported that several changes in cell wall
bound compounds of silk tissues were observed after inoculation with F. gra-
minearum. It has been postulated that the An2 gene which encodes an ent-copalyl
synthase gene which has a role in gibberellin synthesis might play a role in silk
resistance as this gene is strongly up-regulated after maize silk is inoculated with
F. graminearum (Harris et al. 2005).
Hoenisch and Davis (1994) observed a correlation between higher pericarp
thickness and resistance to F. verticillioides. The thicker pericarp may inhibit
fungal growth as well as act as a barrier to insect feeding. Sampietro et al. (2009)
identified various properties of the pericarp and its wax layer as resistance factors.
Sweet corn, which has been bred to have a thin pericarp, is extremely susceptible to
both F. graminearum and F. verticillioides (Reid et al. 2000). Long chain alkanes on
the surface of maize silks have also been implicated in resistance to F. graminearum
(Miller et al. 2003).
Genotypes developed with selection for F. graminearum ear rot resistance also
exhibit high levels of resistance to F. verticillioides and common smut (Ustilago
zeae) in inoculated trials (Reid et al. 2009) indicating that there may be an associ-
ated resistance mechanism to multiple ear diseases. Resistance to ear rot and stalk
rot do not correlate (Mesterházy and Kovács 1988).
10.4.4 Genetics of Resistance
The inheritance of resistance to Fusarium spp. in maize is complex and maize geno-
types possess different resistance levels as regards to kernel and silk channel resis-
tance (Lemmens et al. 2005). Resistance to F. graminearum ear rot through kernel
infection is under both simple (additive and dominance) and digenic (dominance x
dominance) effects (Chungu et al. 1996). Estimates of the number of factors affect-
ing kernel resistance ranged from 4.6 to 13.7. For F. verticillioides, Boling and
Grogan (1965) estimated several additive, dominant and additive x dominant digenic
epistatic gene effects. They estimated an average dominance of approximately 0.5
and the number of participating genes was estimated at 1.47. Eller et al. (2008)
established that resistance to F. verticillioides ear rot is determined by polygenes.
Maternal effects for both species have also been reported (Headrick and Pataky
1991; Kovács et al. 1994).
Several studies have found QTL associated with resistance to Fusarium in maize.
Robertson-Hoyt et al. (2006) found 7 QTL that explained 47 % of the phenotypic
variation for F. verticillioides ear rot and nine were found for fumonisin content
explaining 67 % of the variation. Working with two maize populations, they found
that three QTL for ear rot and two for fumonisin were mapped in similar positions.
Two QTL, localized on chromosome 4 and 5, appeared to be consistent in both
populations. Ding et al. (2008) reported two QTL on chromosome 3. Pérez-Brito
et al. (2001) identified nine and seven QTL in two populations, three of which were
co-located. Recently, Martin et al. (2011) identified co-localized QTL for both F.
graminearum ear rot resistance and reduced levels of DON in different mapping
populations. Reinprecht et al. (2008) identified about 100 genes behind the QTL,
among them chitinase and protein kinase. A meta-analysis of QTL associated with
ear rot resistance (Xiang et al. 2010b) from the data of 14 studies representing
F. graminearum, F. verticillioides and Aspergillus flavus QTL studies found that
resistance QTL against the three fungi were clustered on the same chromosomes.
These data seem to support the idea of common resistance. Various other studies
have reported the identification of possible genes and genetic resistance mecha-
nisms related to ear rot resistance (Jenczmionka and Schäfer 2005; Igawa et al.
2007; Yuan et al. 2008; Lanubile et al. 2010; Zhang et al. 2011).
10.5 Management of Fusarium Head Blight Caused

by Fusarium graminearum
The occurrence of plant disease depends on the interaction of three factors that ‘have
often been visualized as a triangle…’ (Agrios 1988); a virulent pathogen, a suscep-
tible host and a favourable environment are needed for disease to occur. Variation in
any one factor will influence the ultimate level and severity of disease. For example,
disease severity may be low if the host has some resistance even though the environ-
ment is conducive and a pathogen is present at sufficient levels. Disease severity
may also be low if weather conditions are too hot, too cold or too dry, even with a
susceptible host and a source of disease inoculum. Where a virulent pathogen is not
present or is at low levels, disease may either not occur or be at low levels even when
the host is susceptible and there is a favourable environment. Disease management
strategies employed by farmers rely on manipulation of one or more components of
the disease triangle. The ultimate goal is to create cropping conditions that do not
favour pathogen survival and/or disease development. Unfortunately, effective man-
agement of FHB, while limiting its impact, cannot be achieved by simply manipulat-
ing a single component of the disease triangle (e.g. host resistance). As McMullen
et al. (2008, 2012) suggests, effective management of FHB and its impacts on crop
production and quality require the use of a combination of strategies.
10.5.1 Crop Rotation
Fusarium graminearum overwinters mainly on infected crop residue, but can also
be seed-borne (Wiese 1987; Mathre 1997; Gilbert and Tekauz 2000). Survival in
crop residue is highest in plant tissues that are resistant to decay, especially the node
tissues of small grain cereals (Burgess and Griffin 1968; Sutton 1982). Gilbert and
Tekauz (2000) suggested that F. graminearum was unlikely to survive in soil
without crop residues. Sutton (1982) also indicated that soil is not likely a ‘major
inoculum source’ and referred to work by Gordon (1954, 1956) in Canada where
F. graminearum was not isolated from soil samples collected from cereal fields. In
Australia, Wearing and Burgess (1977) were able to isolate F. graminearum from
soil, but it was mainly associated with small pieces of debris.
Given the key role of infested crop residues as a source of inoculum, crop rota-
tion to nongramineous hosts and avoiding corn in rotations, or in close proximity,
have been suggested as methods of reducing the risk from FHB or ear/stalk rot in
corn (Seaman 1982; Wiese 1987; Parry et al. 1995; Mathre 1997; White 1999;
Gilbert and Tekauz 2000; Stack 2000). Corn is an important host of F. gra-
minearum (White 1999) and can support extensive colonization of not only infected
ears, but also of stalks (Windels and Kommedahl 1984; Kommedahl and Windels
1985; Windels et al. 1988). Although Wiese (1987) and Mathre (1997) recom-
mended at least 1 year between grass or cereal production, rotations with at least 2
years between susceptible crops are needed to reduce the risk of FHB (Burgess
and Griffin 1968; Warren and Kommedahl 1973; Khonga and Sutton 1988).
For example, Khonga and Sutton (1988) placed infested corn and wheat residue in
the field for up to 3 years and found production of perithecia and ascospores by
Gibberella zeae (perfect state of F. graminearum) occurred primarily in the first
and second years. Inch and Gilbert (1999) also found that F. graminearum could
survive in infected seed for up to 2 years regardless of whether it was on the soil
surface or buried up to 10 cm deep in the soil.
Inclusion of highly susceptible crop types either directly in the rotation or in
adjacent fields can exacerbate FHB issues. Mathre (1997) reported that barley pro-
duction in the first half of the 1900s was more or less eliminated when corn was
grown in rotation with barley in the eastern and central corn belt of the United
States, because the level of FHB became so severe. Other research has highlighted
the risk of FHB associated with corn in rotation with small grain cereals. The first
report of significant levels of FHB and DON contamination in Manitoba wheat,
caused by F. graminearum, was associated with two fields that were previously
cropped to corn (Clear and Abramson 1986). In Ontario, Teich and Nelson (1984)
and Teich and Hamilton (1985) found that FHB levels were lower in wheat when it
was not sown after corn. More recently, Schaafsma et al. (2001) conducted a survey
of hand-harvested grain from commercial wheat fields in Ontario under a range of
agronomic practices. They found that in 2 of 4 years (1996–1999), DON levels in
wheat were significantly higher when planted on corn residue compared with wheat
or soybean residue. In 1996, Schaafsma et al. (2001) found that levels of DON were
similar when corn or wheat had been planted 2 years previously and were signifi-
cantly higher than when soybean was the previous crop. In a Minnesota trial, Dill-
Macky and Jones (2000) found that FHB and DON were higher when wheat
followed corn, lowest when wheat followed soybean and intermediate with wheat
on wheat. In contrast, Yi et al. (2001) found that FHB and DON levels were similar
when winter wheat was grown after maize or spring wheat, whether it had been
harvested for grain or silage. However, Yi et al. (2001) stated that inoculation of the
pre-crop treatments with infested oat grain may have precluded treatment differ-
ences. A spore trapping study by Francl et al. (1999) found that inoculum of G. zeae
was significantly higher on wheat spikes exposed in fields with corn residues than
wheat residues. Wheat heads exposed in fields with corn residue had an average
number of colony forming units (CFU) of G. zeae per wheat spike (head) per day of
126 versus 13 CFU for wheat heads sampled next to wheat residue. Khonga and
Sutton (1988) found that corn residue, including kernels and stalk pieces, tended to
be more abundant producers of both conidiospores and ascospores than wheat
stems, but not wheat kernels or spikelets.
10.5.2 Tillage
Tillage is a traditional strategy that has been recommended for managing FHB,
while conservation tillage has often been implicated as a risk factor for FHB caused
by F. graminearum, as crop residues are the most important source of inoculum
(Parry et al. 1995; McMullen et al. 1997; Stack 2000). Teich and Hamilton (1985)
found that FHB was lower in ploughed fields than fields with ‘light tillage’, but in
an earlier study, Teich and Nelson (1984) found that FHB levels were similar with
or without ploughing. In a separate study, FHB levels were found to be lower in
ploughed treatments versus treatments that had been ‘disc-cultivated’ (Teich unpub-
lished) (Teich 1989). Dill-Macky and Jones (2000) found that tillage regime did
have a significant effect on FHB and DON levels in wheat. When averaged over
tillage systems, the incidence of FHB was 63.5 %, 71.8 % and 70.8 % for mold-
board ploughing, chisel plough, and no-till, respectively. Small, but significant dif-
ferences in DON level were observed for the tillage treatments, with moldboard
ploughing having 8.1 ppm, compared to chisel plough (10.6 ppm), and no-till
(11.1 ppm) which were not significantly different. However, other work indicates
that FHB and DON may not always be reduced with tillage. Clear and Abramson
(1986) found that the initial appearance of significant levels of Fusarium damaged
kernel (FDK) and DON in Manitoba occurred in two wheat fields that had been
disced in the previous fall and in the following spring, a tillage regime that would be
considered to be conventional and fairly aggressive in western Canada. In a subse-
quent survey, Gilbert and Tekauz (1993) found no difference between tillage prac-
tices during the 1993 FHB epidemic in Manitoba. In Ontario, Miller et al. (1998)
found that tillage system (moldboard ploughing versus no-till) did not have a sig-
nificant influence on the level of FHB or kernel infection. The authors suggested
that under weather conditions favourable for disease, other factors such as variety
resistance, rotation and previous history of disease would likely be more critical for
FHB than the tillage system used. Schaafsma et al. (2001) found similar results
from a survey of hand-harvested grain from commercial fields in Ontario from 1996
to 1999. DON levels tended to be slightly higher under minimum tillage versus no-
till or conventional, which had similar levels. Overall, Schaafsma et al. (2001) found
that tillage system accounted for very little of the variation in DON levels from 1996
to 1999. Other factors such as year, cultivar, and rotation accounted for more varia-
tion in DON compared with tillage system. Fernandez et al. (2001) found zero till-
age did not result in more FHB compared with conventional tillage in eastern
Saskatchewan. FHB severity tended to be highest under minimum tillage, but was
lower under both zero and conventional tillage. Khonga and Sutton (1988) sug-
gested that complete burial of infested residue by moldboard ploughing may help to
prevent spore production, if residues are not brought back to the soil surface by
subsequent tillage. Earthworm activity, which is enhanced under conservation till-
age practices (House and Parmelee 1985; Wardle 1995; Kladivko et al. 1997; Chan
2001; Chan and Heenan 2006; Eriksen-Hamel et al. 2009), may help to reduce the
amount of F. graminearum-infested crop residue under direct seeding (Oldenburg
et al. 2008; Schrader et al. 2009; Wolfarth et al. 2011) and perhaps this has contrib-
uted to the variable effect of conservation tillage in relation to FHB. In areas where
F. graminearum is commonly found on crop residues, a general background level of
inoculum may preclude any differences in disease risk among tillage systems.
Ascospore dispersal from one field to another would introduce the pathogen into
fields where infested residues were not present either as a result of burial by tillage
or extended crop rotation to non-host crops.
10.5.3 Field Location
Head infections in wheat typically arise from wind-borne ascospores released from
fruiting bodies (perithecia) produced by the sexual stage of F. graminearum,
G. zeae, and are formed on old crop residue and infected seed left on the soil sur-
face. Although production of perithecia typically occurs in the spring, these fruiting
structures can also be found on harvested grain, especially barley, and can be pro-
duced in the fall depending on the location (Paulitz 1996; Mathre 1997). Old crop
residues including vegetative and reproductive plant tissues and infected seed are
the main sources of inoculum (Sutton 1982).
Dispersal of ascospores appears to occur over relatively short distances. Gilbert
and Tekauz (2000) have suggested that the appearance of FHB in eastern
Saskatchewan is not likely the result of long-distance (300 km) transport of asco-
spores, based on results from Fernando et al. (1997). Fernando et al. (1997) demon-
strated gradients of head and seed infection resulting from ascospores of G. zeae,
over distances of at least 22 m. Gilbert and Tekauz (2000) cited reports by Stack
(1997) who suggested, based on analysis of spore dispersal gradients, that asco-
spores could be dispersed and result in head blight symptoms in fields up to 1 mile
away from the source of inoculum. Francl et al. (1999) suggested that dispersal of
ascospores produced by G. zeae, may occur over ‘kilometers to tens of kilometers
or more….’ Based on current research, immediately adjacent fields or areas would
be most at risk from air-borne ascospores. Maldonado-Ramirez et al. (2005) and
Schmale III and Bergstrom (2007) demonstrated the presence of viable ascospores
in the planetary boundary layer suggesting the occurrence of long-distance transport
of G. zeae ascospores. Recent work using clonal sources of G. zeae inoculum iden-
tified using microsatellite markers demonstrated dispersal of a released clone up to
750 m, with the majority being collected within 100–250 m of the source (Prussin
2013). Keller et al. (2010) also used clones to study inoculum dispersal of G. zeae
and found that head infections resulting from a local source of inoculum decreased
by 90 % within 6 m of the source. Overall, research suggests that an FHB epidemic
within an individual field would largely originate from inoculum produced within
the field itself or in adjacent fields. However, as Schmale III and Bergstrom (2007)
suggest, long-distant transport of viable ascospores of G. zeae may result in the
introduction of novel strains into regions where they were not previously present.
Long-distance transport of ascospores into Alberta from eastern Saskatchewan
and Manitoba is unlikely. Moreover, there would be a greater potential for a signifi-
cant reduction in ascospore viability during long-distance dispersal as the asco-
spores would be exposed to greater periods of ultraviolet (UV) radiation (Waggoner
et al. 1983; Rotem and Aust 1991). Radiation has been shown to influence spore
survival for many fungi (Leach and Anderson 1982; Caesar and Pearson 1983;
Boland 1984; Rotem et al. 1985). Caesar and Pearson (1983) found that average
ascospore survival for Sclerotinia sclerotiorum was 51 and 22 % after 2 and 4 days
field exposure on the upper leaves of a bean canopy. Survival rates of <10 % were
observed after 6 days exposure. Ascospore survival also decreased rapidly at relative
humidities of >35 % and temperatures of ≥25 °C. Boland (1984) also demonstrated
decreased S. sclerotiorum ascospore viability, with average survival rates of <50 %
after 2 days and <1 % after 3 days field exposure of ascospores on Millipore filter
paper. Higher ascospore survival was observed by Boland (1984) and Caesar and
Pearson (1983) when ascospores were shielded from UV radiation. Caesar and
Pearson (1983) also found that survival was increased on shaded leaves in the lower
part of a bean canopy. Rotem and Aust (1991) found that exposure to UV radiation
reduced spore viability from up to several days to less than 50 min for various
pathogens including Aspergillus macrospora, A. niger and Mycosphaerella pinodes.
10.5.3.1 Integration of Strategies to Limit Inoculum Availability

and Host Infection
Development of less susceptible, and eventually more FHB-resistant cultivars, has

been a key focus of Canadian cereal breeding programmes. However, unlike resis-
tance to many of the cereal rusts, high levels of resistance to FHB have been elusive,
although substantial improvements in reducing the level of susceptibility and mov-
ing towards FHB resistance have been made since the early 1990s in western
Canada. Extensive reviews of the topic of host resistance have been published by
numerous authors (Parry et al. 1995; Gilbert and Tekauz 2000; Tekauz et al. 2000;
Mesterházy 2003a; Steffenson 2003; McMullen et al. 2012).
Like host resistance, fungicides have not provided high levels of FHB control
and DON suppression, but depending on the level of host resistance can provide
moderate reductions in FHB severity, Fusarium damaged kernel levels, and DON
contamination (Mesterházy 2003b; Paul et al. 2008; McMullen et al. 2012). The
other major approach to limiting inoculum availability is crop rotation, which if suf-
ficient time is given between host crops, substantial reductions in pathogen viability
and inoculum availability can be achieved. However, given the ability of the patho-
gen to produce wind-borne ascospores, which readily move to adjacent fields and
the potential for regional epidemics of FHB to occur as consequence of inoculum
dispersal over tens of kilometres, crop rotation in itself may not provide a high level
of FHB management where the pathogen is well established on crop residues.
McMullen et al. (2008, 2012) emphasized that effective FHB management cannot
rely on individual strategies, but rather an integration of multiple disease manage-
ment strategies that limit inoculum availability and host infection. The combination
of growing small grain cereals on residue of non-host crops, use of a moderately
resistance host genotype, and application of effective fungicides has been found to
greatly reduce the level of disease and DON contamination, while significantly
increasing crop yield (McMullen et al. 2008). The combination of host resistance,
rotation and fungicide represents a foundation on which other strategies can be
added to further reduce inoculum availability and disease development. For exam-
ple, producers growing small grain cereals under irrigation may be able to reduce
the risk of head and seed infection by careful water management (McLaren et al.
2003) In Washington State, FHB or scab, caused by various Fusarium spp. including
F. graminearum, was found in irrigated fields, but not in dryland wheat fields
(Strausbaugh and Maloy 1986). More recently in Idaho (Marshall et al. 2012) and
southern Alberta (Turkington et al. 2005, 2006) irrigation was an important contrib-
uting factor to FHB outbreaks in these areas. However, the most difficult aspect of
irrigation management for FHB control in the irrigated dry regions such as southern
Alberta will be trying to balance the water requirements of the crop during flower-
ing versus the need to reduce the risk of FHB. Efetha (2008) has produced a set of
recommendations to help producers meet the water needs of their cereal crops, but
at the same time reduce the risk of FHB and potential DON contamination of har-
vested grain.
Harvest management can be an important consideration when dealing with an
infected crop. In areas where the disease is severe, producers are advised to adjust
their combines to blow out scabby wheat kernels, FDK, (which are lighter than the
other seeds) and infected chaff as a way of improving the grade and reducing toxin
levels in harvested grain (Tkachuk et al. 1991; Anonymous 1996; Gilbert and
Tekauz 2000; Salgado et al. 2011; McMullen et al. 2012). However, this will not
completely eliminate problems in wheat, especially when wet harvest conditions
allow for continued fungal growth on the maturing crop and potential DON con-
tamination issues even though FHB and FDK levels appear to be low. Removing
severely infected kernels during harvesting is not very effective with barley and oat,
although removing the hull in hulless barley is an effective way of reducing DON
levels (Clear et al. 1997). The downside to harvest management is that it will typi-
cally return highly infected wheat kernels and chaff back into the field where this
material can act as a source of inoculum in future growing seasons.
McMullen et al. (2012) also suggest that effective chopping and distribution of
straw may help to encourage decomposition of infested residue, thereby reducing
the availability of inoculum for subsequent epidemics. Chopping of crop residues
into smaller pieces, which exposes a greater surface area to microbial activity
increases the rate of decomposition of crop residues (Sims and Frederick 1970;
Bremer et al. 1991; Angers and Recous 1997; Jensen and Ambus 1998; Gunnar
2001), thereby removing a potential source of FHB inoculum. Moreover, retention
of crop residues under conservation tillage can enhance soil flora and fauna activity
(House and Parmelee 1985; Chan 2001; Chan and Heenan 2006), which can result
in enhanced residue decomposition, especially where residues are chopped into
smaller pieces (Boström and Lofs-Holmin 1986; Lowe and Butt 2003). Ultimately,
enhanced activity of soil fauna such as earthworms may help to reduce FHB inocu-
lum availability (Schrader et al. 2009; Wolfarth et al. 2011).
Integration of irrigation and residue management with the combination of rota-
tion, host resistance and fungicide may help to further reduce the impact of
FHB. Moreover, strategies such as irrigation management may also help to reduce
the amount of infested residue, thereby reducing inoculum availability. The use
of more resistance crop varieties has been shown to reduce the amount of infested
residue thereby reducing the amount of inoculum available to initiate subsequent
epidemics (Salas and Dill-Macky 2003, 2004, 2005). Fungicide application may
also help to reduce the amount of infested residue and thus the level of inoculum.
There may be a synergistic effect of using crop rotation, host resistance, residue and
irrigation management, and fungicides in relation to the availability of inoculum to
initiate FHB. Further research is needed to study these interactive effects and
whether they have the potential to further reduce the impact of FHB. Ultimately, for
FHB management strategies employed by farmers to be more effective, they must
incorporate practices that influence all components of the disease triangle, with the
goal to create cropping conditions that do not favour pathogen survival, inoculum
production and/or disease development.
10.6 Modern Detection Methods for Fusarium-Related

Mycotoxins
Many jurisdictions, including Canada, have established regulations and guidelines

for the presence of Fusarium mycotoxins in grains that are used in the production
of food and feed in order to protect consumers. Health Canada has set maximum
limits of 1.0 and 2.0 mg/kg for DON in soft wheat used in baby foods and non-
staple foods, respectively. These limits are currently under review by Health Canada
(2011). The Canadian Food Inspection Agency (CFIA) has guidelines and recom-
mended tolerances for a wider range of Fusarium mycotoxins in feed, including
diacetoxyscirpenol, T-2 and HT-2 toxins, ZEA, and DON. These values range from
0.025 mg/kg for T-2 toxin in diets for dairy animals up to 5 mg/kg in diets for cattle
and poultry (CFIA 2012b). The Canadian regulatory limits for food and guidance
and recommended levels for feed are consistent with those in other countries.
In Canada, the analysis of grain and grain products is performed along the grain
handling and processing chains in order to demonstrate compliance with established
regulatory and guidance levels. Domestic and export shipments of bulk grain are
monitored by the Canadian Grain Commission (Tittlemier et al. 2014), feed compo-
nents are monitored by the Canadian Food Inspection Agency, and grain-based
foods are monitored by the Canadian Food Inspection Agency (CFIA 2012a) and
Health Canada (Scott 1997).
10.6.1 Sampling and Sample Preparation
The determination of any analyte in a given material involves the following general
steps: sampling of the material, processing of the sample and a chemical test to
detect and quantify the analyte. The initial sampling step is the basis of the entire
analysis—without proper sampling, the final analytical result will be meaningless if
it does not relate back to the original material of interest.
Proper sampling is especially important for the analysis of mycotoxins in
particulate material such as grains because mycotoxins are heterogeneously
distributed in this type of material. Consequently, small portions of the larger

sample can contain very different concentrations of mycotoxins such as DON
(Biselli et al. 2008) because kernel to kernel concentrations can vary over two
orders of magnitude (Sinha and Savard 1997). This effect of sampling is magnified
for samples composed of larger particles such as maize kernels. Concentrations of
mycotoxins in cereal kernels can also significantly differ from concentrations in
chaff and other non-kernel segments. DON concentrations were approximately
2–10 times higher in chaff, peduncle and rachis tissues from wheat heads (Sinha
and Savard 1997); ZEA was similarly elevated in chaff versus Fusarium damaged
kernels (Golinski et al. 2010).
Sample preparation can help to minimize the heterogeneous distribution of
mycotoxins in materials and reduce the variability in analytical results. For exam-
ple, grinding of whole grain samples reduces the variability of DON and NIV mea-
surements (Champeil et al. 2004). Increasing the size of the sample analyzed also
reduces the variance of the entire analysis (Whitaker et al. 2002).
10.6.2 Screening Methods for the Detection and Quantification

of Mycotoxins
There are a number of methods in use to detect and quantify Fusarium-related

mycotoxins based on a variety of technologies; Shephard et al. (2012) provide an
overview of recent advances. Methods can be classified and organized based on the
different technologies they are based upon, however a more user-friendly way to
classify methods is to place them along a continuum from screening to confirmatory
methods.
Screening methods generally emphasize ease of use, speed and an overall reduced
cost of analysis. Development of many screening methods is aimed towards use in
settings outside of the traditional laboratory, such as in-field assessment or monitor-
ing of incoming deliveries at processing facilities. However, screening methods can
still be useful in laboratory settings where large numbers of samples need analysis.
Screening methods often incorporate quick sample clean-up and rapid detection, but
depending on their scope, they may still require access to fume hoods and other
laboratory safety equipment due to the use of solvents for extraction.
The most basic screening method is visual inspection. Due to the physical
damage that can be produced by Fusarium infection, visual inspection of wheat
may be used as a screening method in order to estimate Fusarium mycotoxin
concentrations. Such visual inspection is feasible for wheat, since FDK can be
distinguished from healthy kernels due their shriveled and discoloured appear-
ance. However, visual inspection is not feasible for other grains because the phys-
ical damage is not as easily discerned. It has been shown that FDK can serve as an
estimate of DON (Miedaner et al. 2001; Mesterházy 2002) in wheat, and that
FDK are associated with MON in durum wheat (Tittlemier et al. 2014). In order
to manage DON concentrations in wheat, FDK is used as a grading factor in

Canada where tolerances for FDK in various wheat classes have been established
by the Canadian Grain Commission.
In addition to a restriction to wheat, visual inspection of Fusarium damage
has other limitations that confine its use to a screening tool. Asymptomatic wheat
kernels can still contain mycotoxins (Sinha and Savard 1997). As well, later stage
infection can also affect the presence of visual Fusarium damage. Reduced damage
can be observed from spikes infected past the soft dough stages of kernel develop-
ment (Del Ponte et al. 2007).
Commercially available chemistry-based screening methods are available for a
limited number of Fusarium-related mycotoxins in grain. The majority of kits are
for the analysis of DON, but some are available for ZEA and T-2/HT-2 (Meneely
et al. 2011). Technologies currently available are predominantly immuno-based and
include lateral flow devices, enzyme linked immunosorbent assays (ELISA)
(Meneely et al. 2011), and planar waveguide-based methods (Tittlemier et al. 2013a).
The performance of commercially available screening methods has been recently
reviewed by different groups. The Grain Inspection, Packers & Stockyards
Administration (GIPSA) of the United States Department of Agriculture evaluates
submitted screening methods against criteria for the quantitative determination of
mycotoxins in grains, oilseeds and processed-grain products. GIPSA has evaluated
a number of quantitative and qualitative screening methods for the analysis of DON
or ZEA, and has posted the results on their website (http://www.gipsa.usda.gov/
fgis/insp_weigh/raptestkit.html). Aamot et al. (2012) and Tangni et al. (2011) also
report on the performance of commercially available ELISA and lateral flow devices
for the analysis of DON in oats and wheat.
Screening methods are useful tools to gauge mycotoxin concentrations in grain
outside of a laboratory, or to process a large number of grain samples without requir-
ing complex laboratory equipment. However, there are limitations to screening
methods. One very important limitation is the potential for cross reactivity in
immuno-based methods. Methods that are based upon the recognition of the myco-
toxin analyte by an antibody or other receptor can return inaccurate results when
another molecule interacts with the antibody (Tangni et al. 2010). For example,
mean results from ELISA tests for DON submitted to an interlaboratory study were
approximately 2–3 times higher than those obtained from confirmatory methods
that had analyzed the same test material. The difference was attributed to the cross
reactivity of the ELISA tests towards 15-ADON, a metabolite of DON (Josephs
et al. 2001). There is no confirmation of analyte identity in these screening methods
that would avoid issues caused by cross reactivity.
Until recently, screening methods have also focused on single analytes, thus
additional tests would need to be run to obtain data on additional analytes. However,
multi-mycotoxin screening methods are being developed and commercialized for
use in laboratory (Dorokhin et al. 2011; Meneely et al. 2012; Tittlemier et al. 2013a)
and non-laboratory settings (He et al. 2012; Lattanzio et al. 2012).
10.6.3 Confirmatory Methods for the Detection

and Quantification of Mycotoxins
Confirmatory methods are more complex than screening methods, and require
expensive instrumentation and associated technical expertise to operate and main-
tain the instrumentation. These methods mainly employ chromatography with mass
spectrometry, and with advances in fast chromatography, can generate results as
quickly as screening methods.
The strength of modern confirmatory methods lies with their ability to confirm
analyte identity as well as perform a simultaneous sensitive analysis of many myco-
toxins. For example, methods that use liquid chromatography with tandem mass
spectrometry have been developed to analyze over 150 various fungal and bacterial
metabolites, including many Fusarium-related compounds (Vishwanath et al.
2009). The co-occurrence of multiple mycotoxins drives the need for multi-
mycotoxin methods, and almost all new methods incorporate multiple mycotoxin
analytes (Shephard et al. 2012).
Advances in confirmatory methods include a move towards ‘dilute and shoot’
methods that minimize sample clean-up in order to decrease analysis time and
increase sample throughput (van der Fels-Klerx et al. 2012; Warth et al. 2012).
Simple clean-up of sample extracts may also be used to minimize matrix effects and
increase sensitivity further. Methods incorporating simple clean-up predominantly
use solid phase extraction in cartridge (Schenzel et al. 2012) or dispersive format
(Rubert et al. 2012). Sorbents used for the clean-up of sample extracts containing
Fusarium-related mycotoxins include immunoaffinity materials (Tang et al. 2012)
as well as conventional abiotic materials such as silica or C18 (Rubert et al. 2012;
Schenzel et al. 2012).
10.6.4 General Considerations for the Detection

of Fusarium-Related Mycotoxins
Many chemical test methods are available for mycotoxin analysis, and as with any
tool, users need to ensure they are properly used in order to generate accurate and
precise data. As described above, proper sampling and sample preparation must be
performed for the results of the chemical test method to meaningfully relate back to
the original sample of interest.
Consumers of chemical test method data must also ensure the methods used fol-
low general proper analytical chemistry practices. All methods used to generate
data must be validated so that accurate and precise data are obtained. Validation
should be performed for different matrices of interest, because a method that works
for one matrix may not work for another (Malachova et al. 2012). There must be
routine monitoring of method performance as well. There are many commercially

available certified reference materials containing characterized amounts of the more
commonly analyzed Fusarium-related mycotoxins (DON, HT-2, T-2), as well as
many proficiency tests that have been established for laboratories to verify and
monitor their performance.
References
Aamot HU, Hofgaard IS, Brodal G, Elen O, Jestoi M, Klemsdal SS (2012) Evaluation of rapid test
kits for quantification of deoxynivalenol in naturally contaminated oats and wheat. World
Mycotoxin J 5:339–350
Abbax HK, Gelderblom WCA, Cawood ME, Shier WT (1993) Biological activities of fumonisins,
mycotoxins from Fusarium moniliforme, in jimsonweed (Datura stramonium L.) and mam-
malian cell cultures. Toxicon 31:345–353
Abdellatif L, Fernandez MR, Bouzid S, Vujanovic V (2010) Characterization of virulence and
PCR-DGGE profiles of Fusarium avenaceum from western Canadian Prairie Ecozone of
Saskatchewan. Can J Plant Pathol 32:468–480
Agrios GN (1988) Plant pathology, 3rd edn. Academic, San Diego
Agrios GN (1997) Plant pathology, 4th edn. Academic, San Diego, CA
Alexander NJ, McCormick SP, Waalwijk C, van der Lee T, Proctor RH (2011) The genetic basis
for 3-ADON and 15-ADON trichothecene chemotypes in Fusarium. Fungal Genet Biol
48:485–495
Angers D, Recous S (1997) Decomposition of wheat straw and rye residues as affected by particle
size. Plant and Soil 189:197–203
Anonymous (1996) Sustainable agriculture facts—growing for tomorrow: dealing with Fusarium
head blight. Canada-Manitoba Agreement on Agricultural Sustainability
Arunachalam C, Doohan FM (2013) Trichothecene toxicity in eukaryotes: cellular and molecular
mechanisms in plants and animals. Toxicol Lett 217:149–158
Assabgui RA, Reid LM, Hamilton RI, Arnason JT (1993) Correlation of kernel (E)-ferulic acid
content of maize with resistance to Fusarium graminearum. Phytopathology 83:949–953
Backhouse D, Abubakar AA, Burgess LW, Dennis JI, Hollaway GJ, Wildermuth GB et al (2004)
Survey of Fusarium species associated with crown rot of wheat and barley in eastern Australia.
Australas Plant Pathol 33:255–261
Bai G, Shaner G (1994) Scab of wheat: prospects for control. Plant Dis 78:760–766
Bai G-H, Desjardins AE, Plattner RD (2002) Deoxynivalenol-nonproducing Fusarium gra-
minearum causes initial infection, but does not cause disease spread in wheat spikes.
Mycopathologia 153:91–98
Bailey KL, Gossen BD, Derksen DA, Watson PR (2000) Impact of agronomic practices and envi-
ronment on diseases of wheat and lentil in southeastern Saskatchewan. Can J Plant Sci
80:917–927
Bailey KL, Gossen BD, Lafond GP, Watson PR, Derksen DA (2001) Effect of tillage and crop
rotation on root and foliar diseases of wheat and pea in Saskatchewan from 1991 to 1998: uni-
variate and multivariate analyses. Can J Plant Sci 81:789–803
Bailey KL, Gossen BD, Gugel RK, Morrall RAA (2003) Diseases of field crops in Canada, 3rd
edn. University Extension Press, University of Saskatchewan, Saskatoon, SK
Ban T, Watanabe N (2001) The effects of chromosomes 3A and 3B on resistance to Fusarium head
blight in tetraploid wheat. Hereditas 135:95–99
Bernardo A, Bai G, Guo P, Xiao K, Guenzi AC, Ayoubi P (2007) Fusarium graminearum-induced
changes in gene expression between Fusarium head blight-resistant and susceptible wheat
cultivars. Funct Integr Genomics 7:69–77
Berthiller F, Dall’Asta C, Schuhmacher R, Lemmens M, Adam G, Krska R (2005) Masked

mycotoxins: determination of a deoxynivalenol glucoside in artificially and naturally contami-
nated wheat by liquid chromatography-tandem mass spectrometry. J Agric Food Chem
53:3421–3425
Bilgi VN, Bradley CA, Khot SD, Grafton KF, Rasmussen JB (2008) Response of dry bean geno-
types to Fusarium root rot, caused by Fusarium solani f. sp. phaseoli, under field and controlled
conditions. Plant Dis 92:1197–1200
Bilgi VN, Bradley CA, Mathew FM, Ali S, Rasmussen JB (2011) Root rot of dry edible bean
caused by Fusarium graminearum. Plant Health Prog. doi:10.1094/PHP-2011-0425-01-RS
Bily AC, Reid LM, Taylor JH, Johnston D, Malouin C, Burt AJ et al (2003) Dehydrodimers of
ferulic acid in maize grain pericarp and aleurone: resistance factors to Fusarium graminearum.
Biselli S, Persin C, Syben M (2008) Investigation of the distribution of deoxynivalenol and ochra-
toxin A contamination within a 26 t truckload of wheat kernels. Mycotoxin Res 24:98–104
Boddu J, Cho S, Kruger WM, Muehlbauer GJ (2006) Transcriptome analysis of the barley-
Fusarium graminearum interaction. Mol Plant Microbe Interact 19:407–417
Boddu J, Cho S, Muehlbauer GJ (2007) Transcriptome analysis of trichothecene-induced gene
expression in barley. Mol Plant Microbe Interact 20:1364–1375
Bogale M, Wingfield BD, Wingfield MJ, Steenkamp ET (2007) Species-specific primers for
Fusarium redolens and a PCR-RFLP technique to distinguish among three clades of Fusarium
oxysporum. FEMS Microbiol Lett 271:27–32
Boland GL (1984) Epidemiology and management of diseases caused by Sclerotinia sclerotiorum
in white bean and soybean [Thesis]. Dissertation, University of Guelph, Guelph, ON
Bolduan C, Miedaner T, Schipprack W, Dhillon BS, Melchinger AE (2009) Genetic variation for
resistance to ear rots and mycotoxins contamination in early European maize inbred lines. Crop
Sci 49:2019–2028
Boling MB, Grogan CO (1965) Gene action affecting host resistance to Fusarium ear rot of maize.
Crop Sci 5:305–307
Boström U, Lofs-Holmin A (1986) Growth of earthworms (Allolobophora caliginosa) fed shoots
and roots of barley, meadow fescue and lucerne. Studies in relation to particle size, protein,
crude fiber content and toxicity. Pedobiologia 29:1–12
Boutigny AL, Richard FF, Barreau C (2008) Natural mechanisms for cereal resistance to the accu-
mulation of Fusarium trichothecenes. Eur J Plant Pathol 121:411–423
Boutigny A-L, Ward TJ, Van Coller GJ, Flett B, Lamprecht SC, O’Donnell K et al (2011) Analysis of
the Fusarium graminearum species complex from wheat, barley and maize in South Africa provides
evidence of species-specific differences in host preference. Fungal Genet Biol 48:914–920
Branham BE, Plattner RD (1993) Isolation and characterization of a new fumonisin from liquid
cultures of Fusarium moniliforme. J Nat Prod 56:1630–1633
Bremer E, Houtum W, Kessel C (1991) Carbon dioxide evolution from wheat and lentil residues as
affected by grinding, added nitrogen, and the absence of soil. Biol Fertil Soils 11:221–227
Brown DW, Dyer RB, McCormick SP, Kendra DF, Plattner RD (2004) Functional demarcation of
the Fusarium core trichothecene gene cluster. Fungal Genet Biol 41:454–462
Burgess LW, Griffin DM (1968) The recovery of Gibberella zeae from wheat straws. Aust J Exp
Agric Anim Hus 8:364–370
Burgess LW, Backhouse D, Summerell BA, Swan LJ (2001) Crown rot of wheat. In: Summerell B,
Leslie J, Backhouse D, Bryden W, Burgess L (eds) Fusarium: Paul E. Nelson memorial sym-
posium. APS Press, St. Paul, MN, pp 271–294
Bürstmayr H, Ban T, Anderson AJ (2009) QTL mapping and marker-assisted selection for
Fusarium head blight resistance in wheat: a review. Plant Breed 128:1–26
Bürstmayr M, Huber K, Heckmann J, Steiner B, Nelson J, Bürstmayr H (2012) Mapping of QTL for
Fusarium head blight resistance and morphological and developmental traits in three backcross
populations derived from Triticum dicoccum × Triticum durum. Theor Appl Genet 125:1751–1765
Bushnell WR, Hazen BE, Pritsch C (2003) Histology and physiology of Fusarium head blight. In:
Leonard KJ, Bushnell WR (eds) Fusarium head blight of wheat and barley. The American
Phytopathological Society, St. Paul, MN, pp 44–84
Caesar AJ, Pearson RC (1983) Environmental factors affecting survival of ascospores of Sclerotinia
sclerotiorum. Phytopathology 73:1024–1030
Canadian Food Inspection Agency (2012a) RG-8 regulatory guidance: contaminants in feed. http://
www.inspection.gc.ca/animals/feeds/regulatory-guidance/rg-8/eng/1347383943203/13473840
15909?chap=1#s1c1. Accessed 5 April 2013
Canadian Food Inspection Agency (2012b) 2009–2010 Ochratoxin A and deoxynivalenol in
selected foods. http://www.inspection.gc.ca/food/chemical-residues-microbiology/chemical-
residues/ochratoxin-a-and-deoxynivalenol/eng/1348258196979/1348258304536. Accessed 5
April 2013
Cao A, Reid LM, Butrón A, Malvar RA, Souto XC, Santiago R (2011) Role of hydroxycinnamic
acids in the infection of maize silks by Fusarium graminearum Schwabe. Mol Plant Microbe
Interact 24:1020–1026
Carapito R, Vorwerk S, Jeltsch J-M, Phalip V (2013) Genome-wide transcriptional responses of
Fusarium graminearum to plant cell wall substrates. FEMS Microbiol Lett 340:129–134
Champeil A, Fourbet J-F, Doré T (2004) Effects of grain sampling procedures on Fusarium myco-
toxin assays in wheat grains. J Agric Food Chem 52:6049–6054
Chan KY (2001) An overview of some tillage impacts on earthworm population abundance and
diversity—implications for functioning in soils. Soil Tillage Res 57:179–191
Chan KY, Heenan DP (2006) Earthworm population dynamics under conservation tillage systems
in south-eastern Australia. Soil Res 44:425–431
Chen X, Steed A, Travella S, Keller B, Nicholson P (2009) Fusarium graminearum exploits ethyl-
ene signalling to colonize dicotyledonous and monocotyledonous plants. New Phytol 182:
975–983
Chittem K, Porter L, McPhee K, Khan M, Goswami RS (2012) Fusarium avenaceum as causal
agent of root rot in field peas and its control. Phytopathology 100:S25
Cho S-H, Lee J, Jung K-H, Lee Y-W, Park J-C, Paek N-C (2012) Genome-wide analysis of genes
induced by Fusarium graminearum infection in resistant and susceptible wheat cultivars.
J Plant Biol 55:64–72
Chongo G, Gossen BD, Kutcher HR, Gilbert J, Turkington TK, Fernandez MR et al (2001)
Reaction of seedling roots of 14 crop species to Fusarium graminearum from wheat heads. Can
Christensen CM, Kaufmann HH (1969) Grain storage: the role of fungi in quality loss. University
of Minnesota Press, Minneapolis
Chungu C, Mather DE, Reid LM, Hamilton RI (1996) Inheritance of kernel resistance to Fusarium
graminearum in maize. J Heredity 87:382–385
Cichy K, Snapp S, Kirk W (2007) Fusarium root rot incidence and root system architecture in
grafted common bean lines. Plant and Soil 300:233–244
Clear RM, Abramson D (1986) Occurrence of Fusarium head blight and deoxynivalenol (vomi-
toxin) in two samples of Manitoba wheat in 1984. Can Plant Dis Surv 66:9–11
Clear RM, Babb J, Bullock P (1993) Fusarium head blight on the prairies: past, present, and future.
Agriforum 1993:1–4
Clear RM, Patrick SK, Nowicki T, Gaba D, Edney M, Babb JC (1997) The effect of hull removal and
pearling on Fusarium species and trichothecenes in hulless barley. Can J Plant Sci 77:161–166
Clear RM, Patrick SK, Gaba D, Abramson D, Smith DM (2005) Prevalence of fungi and fusario-
toxins on hard red spring and amber durum wheat seed from western Canada, 2000 to 2002.
Can J Plant Pathol 27:528–540
Clear RM, Tucker JR, Gaba D, Patrick SK, Lee SJ, Demeke T et al (2013) Deoxynivalenol levels
and chemotype frequency in barley cultivars inoculated with two chemotypes of Fusarium
graminearum. Can J Plant Pathol 35:37–45
Cole RJ, Cox RH (1981) The trichothecenes. In: Cole RA, Cox RH (eds) Handbook of toxic fungal
metabolites. Academic Press, Toronto, ON, pp 152–263
Coleman JJ, Rounsley SD, Rodriguez-Carres M, Kuo A, Wasmann CC, Grimwood J et al (2009)
The genome of Nectria haematococca: contribution of supernumerary chromosomes to gene
expansion. PLoS Genet 5:e1000618
Cuomo CA, Gcoldener U, Xu JR, Trail F, Turgeon BG, Di Pietro A et al (2007) The Fusarium
graminearum genome reveals a link between localized polymorphism and pathogen specializa-
tion. Science 317:1400–1402
Dall’Asta C, Berthiller F, Schuhmacher R, Adam G, Lemmens M, Krska R (2005) DON-
glycosides: characterisation of synthesis products and screening for their occurrence in DON-
treated wheat samples. Mycotoxin Res 21:123–127
de la Pena RC, Smith KP, Capettini F, Muehlbauer GJ, Gallo MM, Dill MR et al (1999) Quantitative
trait loci associated with resistance to Fusarium head blight and kernel discoloration in barley.
Theor Appl Genet 99:561–569
Del Ponte EM, Fernandes JMC, Bergstrom GC (2007) Influence of growth stage on Fusarium head
blight and deoxynivalenol production in wheat. J Phytopathol 155:577–581
Demeke T, Gräfenhan T, Clear RM, Phan A, Ratnayaka I, Chapados J et al (2010) Development of
a specific TaqMan real-time PCR assay for quantification of Fusarium graminearum clade 7
and comparison of fungal biomass determined by PCR with deoxynivalenol content in wheat
and barley. Int J Food Microbiol 141:45–50
Desjardins AE (2008) Natural product chemistry meets genetics: when is a genotype a chemotype?
J Agric Food Chem 56:7587–7592
Desmond OJ, Edgar CI, Manners JM, Maclean DJ, Schenk PM, Kazan K (2005) Methyl jasmonate
induced gene expression in wheat delays symptom development by the crown rot pathogen
Fusarium pseudograminearum. Physiol Mol Plant Pathol 67:171–179
Dill-Macky R, Jones RK (2000) The effect of previous crop residues and tillage on Fusarium head
blight of wheat. Plant Dis 84:71–76
Ding J-Q, Wang X-M, Chander S, Yan J-B, Li J-S (2008) QTL mapping of resistance to Fusarium
ear rot using a RIL population in maize. Mol Breed 22:395–403
Dokken-Bouchard FL, Banniza S, Bassendowski KA, Chant S, Cruise D, Gross G et al (2011)
Survey of field pea diseases in Saskatchewan, 2010. Can Plant Dis Surv 91:133–135
Domijan A-M, Abramov AY (2011) Fumonisin B1 inhibits mitochondrial respiration and deregu-
lates calcium homeostasis—implication to mechanism of cell toxicity. Int J Biochem Cell Biol
43:897–904
Dorokhin D, Haasnoot W, Franssen MR, Zuilhof H, Nielen MF (2011) Imaging surface plasmon
resonance for multiplex microassay sensing of mycotoxins. Anal Bioanal Chem 400:
3005–3011
Efetha A (2008) FHB and irrigation management—frequently asked questions. Alberta Agriculture,
Food and Rural Development, Lethbridge. http://www1.agric.gov.ab.ca/$department/deptdocs.
nsf/all/faq6824?opendocument
Eller MS, Robertson-Hoyt LA, Payne GA, Holland JB (2008) Grain yield and Fusarium ear rot of
maize hybrids developed from lines with varying levels of resistance. Maydica 53:231–237
Eriksen GS, Pettersson H (2004) Toxicological evaluation of trichothecenes in animal feed. Anim
Feed Sci Technol 114:205–239
Eriksen-Hamel NS, Speratti AB, Whalen JK, Légère A, Madramootoo CA (2009) Earthworm
populations and growth rates related to long-term crop residue and tillage management. Soil
Tillage Res 104:311–316
Esmaeili Taheri A, Hamel C, Gan Y, Vujanovic V (2011) First report of Fusarium redolens from
Saskatchewan and its comparative pathogenicity. Can J Plant Pathol 33:559–564
Eudes F, Comeau A, Rioux S, Collin J (2001) Impact of trichothecenes on Fusarium head blight
(Fusarium graminearum) development in spring wheat (Triticum aestivum). Can J Plant Pathol
23:318–322
Farrar JJ, Davis RM (1991) Relationships among ear morphology, western flower thrips, and
Fusarium ear rot of corn. Phytopathology 81:661–666
Feng J, Hwang R, Chang KF, Hwang SF, Strelkov SE, Gossen BD et al (2010) Genetic variation
in Fusarium avenaceum causing root rot on field pea. Plant Pathol 59:845–852
Feng J, Hwang R, Chang KF, Conner RL, Hwang SF, Strelkov SE et al (2011) Identification of
microsatellite markers linked to quantitative trait loci controlling resistance to Fusarium root
rot in field pea. Can J Plant Sci 91:199–204
Fernandez MR (2007) Fusarium populations in roots of oilseed and pulse crops grown in eastern
Saskatchewan. Can J Plant Sci 87:945–952
Fernandez MR (2009) Common root rot of barley in Saskatchewan and north—central Alberta.
Can J Plant Pathol 31:96
Fernandez MR, Stolhandske-Dale S, Zentner RP, Pearse P (2001) Progress in management of
Fusarium head blight in Saskatchewan. In: Fedak G, Choo A (eds) Proceedings Canadian
workshop on Fusarium head blight, Ottawa, ON
Fernandez MR, Huber D, Basnyat P, Zentner RP (2008) Impact of agronomic practices on popula-
tions of Fusarium and other fungi in cereal and noncereal crop residues on the Canadian
Prairies. Soil Tillage Res 100:60–71
Fernandez MR, Zentner RP, Basnyat P, Gehl D, Selles F, Huber D (2009) Glyphosate associations
with cereal diseases caused by Fusarium spp. in the Canadian Prairies. Eur J Agron 31:
133–143
Fernandez MR, Ulrich D, Brandt SA, Zentner RP, Wang H, Thomas AG et al (2011) Crop manage-
ment effects on root and crown rot of wheat in west-central Saskatchewan, Canada. Agron J
103:756–765
Fernando WGD, Paulitz TC, Seaman WL, Dutilleul P, Miller JD (1997) Head blight gradients
caused by Gibberella zeae from area sources of inoculum in wheat field plots. Phytopathology
87:414–421
Fernando WGD, Miller JD, Seaman WL, Seifert K, Paulitz TC (2000) Daily and seasonal dynam-
ics of airborne spores of Fusarium graminearum and other Fusarium species sampled over
wheat plots. Can J Bot 78:497–505
Foley DC (1959) Systemic infection of corn by Fusarium moniliforme. Phytopathology 49:538
Foroud NA (2011) Investigating the molecular mechanisms of Fusarium head blight resistance in
wheat [Thesis]. Dissertation, The University of British Columbia, Vancouver, BC
Foroud NA, Eudes F (2009) Trichothecenes in cereal grains. Int J Mol Sci 10:147–173
Foroud NA, McCormick SP, MacMillan T, Badea A, Kendra DF, Ellis BE et al (2012a) Greenhouse
studies reveal increased aggressiveness of emergent Canadian Fusarium graminearum chemo-
types in wheat. Plant Dis 96:1271–1279
Foroud NA, Ouellet T, Laroche A, Oosterveen B, Jordan MC, Ellis BE et al (2012b) Differential
transcriptome analyses of three wheat genotypes reveal different host response pathways asso-
ciated with Fusarium head blight and trichothecene resistance. Plant Pathol 61:296–314
Francl L, Bergstrom G, Gilbert J, Pedersen W, Dill-Macky R, Sweets L et al (1999) Daily inocu-
lum levels of Gibberella zeae on wheat spikes. Plant Dis 83:662–666
Fredlund E, Gidlund A, Pettersson H, Olsen M, Börjesson T (2010) Real-time PCR detection of
Fusarium species in Swedish oats and correlation to T-2 and HT-2 toxin content. World
Fredlund E, Gidlund A, Sulyok M, Borjesson T, Krska R, Olsen M et al (2013) Deoxynivalenol
and other selected Fusarium toxins in Swedish oats—occurrence and correlation to specific
Fusarium species. Int J Food Microbiol 167:276–283
Gale LR, Harrison SA, Ward TJ, O’Donnell K, Milus EA, Gale SW et al (2011) Nivalenol-type
populations of Fusarium graminearum and F. asiaticum are prevalent on wheat in Southern
Louisiana. Phytopathology 101:124–134
Garcia D, Ramos AJ, Sanchis V, Marín S (2009) Predicting mycotoxins in foods: a review. Food
Geddes J, Eudes F, Laroche A, Selinger LB (2008) Differential expression of proteins in response
to the interaction between the pathogen Fusarium graminearum and its host, Hordeum vulgare.
Proteomics 8:545–554
Geiser DM, Aoki T, Bacon CW, Baker SE, Bhattacharyya MK, Brandt ME et al (2013) One fun-
gus, one name: defining the genus Fusarium in a scientifically robust way that preserves long-
standing use. Phytopathology 103:400–408
Gelderblom WC, Jaskiewicz K, Marasas WF, Thiel PG, Horak RM, Vleggaar R et al (1988)
Fumonisins—novel mycotoxins with cancer-promoting activity produced by Fusarium monili-
forme. Appl Environ Microbiol 54:1806–1811
Gilbert J, Haber S (2013) Overview of some recent research developments in Fusarium head blight
of wheat. Can J Plant Pathol 35:149–174
Gilbert J, Tekauz A (1993) Effects of delayed harvest on Manitoba wheat. In: Proceedings of the
1993 regional scab forum, Moorhead, MN
Gilbert J, Tekauz A (2000) Review: recent developments in research on Fusarium head blight of
wheat in Canada. Can J Plant Pathol 22:1–8
Gilbert J, Tekauz A (2011) Strategies for management of Fusarium head blight (FHB) in cereals.
Prairie Soils Crops J 4:97–104
Gillespie ME, Brandt AS, Scofield SR (2012) Ethylene-signaling is essential for basal resistance
to Fusarium head blight in wheat. In: Proceedings of the national Fusarium head blight forum,
Orlando, FL
Gilmore SR, Grafenhan T, Louis-Seize G, Seifert KA (2009) Multiple copies of cytochrome oxi-
dase 1 in species of the fungal genus Fusarium. Mol Ecol Resour 9(suppl s1):90–98
Godfray HCJ, Beddington JR, Crute IR, Haddad L, Lawrence D, Muir JF et al (2010) Food secu-
rity: the challenge of feeding 9 billion people. Science 327:812–818
Golinski P, Waskiewicz A, Wisniewska H, Kiecana I, Mielniczuk E, Gromadzka K et al (2010)
Reaction of winter wheat (Triticum aestivum L.) cultivars to infection with Fusarium spp.:
mycotoxin contamination in grain and chaff. Food Addit Contam Part A 27:1015–1024
Golkari S, Gilbert J, Prashar S, Procunier JD (2007) Microarray analysis of Fusarium
graminearum-induced wheat genes: identification of organ-specific and differentially expressed
genes. Plant Biotechnol J 5:38–49
Golkari S, Gilbert J, Ban T, Procunier JD (2009) QTL-specific microarray gene expression analy-
sis of wheat resistance to Fusarium head blight in Sumai-3 and two susceptible NILs. Genome
52:409–418
Golrnski P, Kosteckt M, Lasocka I, Wisniewska H, Chelkowski J, Kaczmarek Z (1996)
Moniliformin accumulation and other effects of Fusarium avenaceum (Fr.) Sacc. on kernels of
winter wheat cultivars. J Phytopathol 144:495–499
Gordon WL (1954) The occurrence of Fusarium species in Canada. IV Taxonomy and prevalence
of Fusarium species in the soil of cereal plots. Can J Bot 32:622–629
Gordon WL (1956) The occurrence of Fusarium species in Canada. V Taxonomy and geographic
distribution of Fusarium species in soil. Can J Bot 34:833–846
Goswami RS, Matthew F, Gambhir A, Barasubiye T, Lamppa RS, Bradley C et al (2008) Fusarium
species associated with root rots of pulse crops in North Dakota. In: The proceedings of the
seventh Canadian pulse research workshop, Winnipeg, MB, 5–7 Nov 2008
Gräfenhan T, Patrick SK, Roscoe M, Trelka R, Gaba D, Chan JM et al (2013) Fusarium damage in
cereal grains from Western Canada. 1. Phylogenetic analysis of moniliformin-producing
Fusarium species and their natural occurrence in mycotoxin-contaminated wheat, oats, and
rye. J Agric Food Chem 61:5425–5437
Graham PH, Vance CP (2003) Legumes: importance and constraints to greater use. Plant Physiol
131:872–877
Grünwald NJ, Coffman VA, Kraft JM (2003) Sources of partial resistance to Fusarium root rot in
the Pisum core collection. Plant Dis 87:1197–1200
Gunawardena U, Rodriguez M, Straney D, Romeo JT, VanEtten HD, Hawes MC (2005) Tissue-
specific localization of pea root infection by Nectria haematococca. Mechanisms and conse-
quences. Plant Physiol 137:1363–1374
Gunnar L (2001) Cutting length of straw by combine harvesting—technical possibilities and bio-
logical effects. In: Reports Agriculture and Industry, TI—Swedish Institute of Agricultural and
Environmental Engineering. Report 282. http://www.jti.se/index.php?page=publicationinfo&p
ublicationid=229
Hadwiger LA (2008) Pea-Fusarium solani interactions contributions of a system toward under-
standing disease resistance. Phytopathology 98:372–379
Halstensen AS, Nordby KC, Eduard W, Klemsdal SS (2006) Real-time PCR detection of toxigenic
Fusarium in airborne and settled grain dust and associations with trichothecene mycotoxins.
J Environ Monit 8:1235–1241
Harris LJ, Saparno A, Johnston A, Prisic S, Xu M, Allard S et al (2005) The maize An2 gene is
induced by Fusarium attack and encodes an ent-copalyl diphosphate synthase. Plant Mol Biol
59:881–894
Harrison LR, Colvin BM, Greene JT, Newman LE, Cole JR (1990) Pulmonary edema and hydro-
thorax in swine produced by fumonisin B1, a toxic metabolite of Fusarium moniliforme. J Vet
Diagn Invest 2:217–221
He QH, Xu Y, Wang D, Kang M, Huang ZB, Li YP (2012) Simultaneous multiresidue determina-
tion of mycotoxins in cereal samples by polyvinylidene fluoride membrane based dot immuno-
assay. Food Chem 134:507–512
Headrick JM, Pataky JK (1991) Maternal influence of the resistance of sweet corn lines to kernels
infection by Fusarium moniliforme. Phytopathology 81:268–274
Health Canada (2011) Canadian standards (maximum levels) for various chemical contaminants in
food. www.hc-sc.gc.ca/fn-an/securit/chem-chim/contaminants-guidelines-directives-eng.php.
Accessed 18 March 2013
Henriquez MA, McLaren DL, Conner RL, Balasubramanian PB, Chang KF (2012a) The proceed-
ings of the ninth Canadian pulse research workshop, Niagara Falls, ON, 6–9 Nov 2012
Henriquez MA, McLaren DL, Conner RL, Penner WC, Kerley T (2012b) Diseases of field bean in
Manitoba in 2011. Can Plant Dis Surv 92:120–121
Hoenisch RW, Davis RM (1994) Relationship between kernel pericarp thickness and susceptibility
to Fusarium ear rot in field corn. Plant Dis 78:517–519
Hogg AC, Johnston RH, Johnston JA, Klouser L, Kephart KD, Dyer AT (2010) Monitoring
Fusarium crown rot populations in spring wheat residues using quantitative real-time poly-
merase chain reaction. Phytopathology 100:49–57
Hohn TM, McCormick SP, Desjardins AE (1993) Evidence for a gene cluster involving trichothecene-
pathway biosynthetic genes in Fusarium sporotrichioides. Curr Genet 24:291–295
House GJ, Parmelee RW (1985) Comparison of soil arthropods and earthworms from conventional
and no-tillage agroecosystems. Soil Tillage Res 5:351–360
Hwang SF, Howard RJ, Chang KF, Park B, Burnett PA (1994) Etiology and severity of Fusarium
root rot of lentil in Alberta. Can J Plant Pathol 16:295–303
Hwang SF, Howard RJ, Chang KF, Park B, Lopetinsky K, McAndrew DW (1995) Screening of
field pea cultivars for resistance to Fusarium root rot under field conditions in Alberta. Can
Plant Dis Surv 75:51–56
Hwang SF, Gossen BD, Turnbull GD, Chang KF, Howard RJ, Thomas AG (2000) Effect of tem-
perature, seeding date, fungicide seed treatment and inoculation with Fusarium avenaceum on
seedling survival, root rot severity and yield of lentil. Can J Plant Sci 80:899–907
Igawa T, Takahashi-Ando N, Ochiai N, Ohsato S, Shimizu T, Kudo T et al (2007) Reduced con-
tamination by the Fusarium mycotoxin zearalenone in maize kernels through genetic modifica-
tion with a detoxification gene. Appl Environ Microbiol 73:1622–1629
Iglesias J, Presello DA, Botta G, Lori GA, Fauguel CM (2010) Aggressiveness of Fusarium sec-
tion Liseola isolates causing maize ear rot in Argentina. J Plant Pathol 92:205–211
Ilgen P, Hadeler B, Maier FJ, Schäfer W (2009) Developing kernel and rachis node induce the
trichothecene pathway of Fusarium graminearum during wheat head infection. Mol Plant
Inch S, Gilbert J (1999) Survival of Fusarium graminearum on Fusarium damaged kernels. In:
Clear R (ed) Proceedings Canadian workshop on Fusarium head blight, Winnipeg, MB
Infantino A, Kharrat M, Riccioni L, Coyne CJ, McPhee KE, Grünwald NJ (2006) Screening tech-
niques and sources of resistance to root diseases in cool season food legumes. Euphytica
147:201–221
International Agency for Research on Cancer (ICARC) (1993) Monograph 56: some naturally
occurring substances: some food items and constituents heterocyclic amines and mycotoxins.
IARC, Lyon, France
Jansen C, von Wettstein D, Schaefer W, Kogel KH, Felk A, Maier FJ (2005) Infection patterns in
barley and wheat spikes inoculated with wild-type and trichodiene synthase gene disrupted
Fusarium graminearum. Proc Natl Acad Sci U S A 102:16892–16897
Jenczmionka NJ, Schäfer W (2005) The Gpmk1 MAP kinase of Fusarium graminearum regulates
the induction of specific secreted enzymes. Curr Genet 47:29–36
Jensen ES, Ambus P (1998) Plant litter particle size—effects on decomposition and nitrogen dynamics
in soil. In: Proceedings of the 16th International Soil Science Society Congress, CD-ROM,
Montpellier, France, August 1998. http://natres.psu.ac.th/Link/SoilCongress/bdd/symp41/482-t.pdf
Jia H, Cho S, Muehlbauer GJ (2009) Transcriptome analysis of a wheat near-isogenic line pair
carrying Fusarium head blight-resistant and -susceptible alleles. Mol Plant Microbe Interact
22:1366–1378
Jiménez-Fernández D, Navas-Cortés JA, Montes-Borrego M, Jiménez-Díaz RM, Landa BB (2011)
Molecular and pathogenic characterization of Fusarium redolens, a new causal agent of
Fusarium yellows in Chickpea. Plant Dis 95:860–870
Josephs RD, Schuhmacher R, Krska R (2001) International interlaboratory study for the determi-
nation of the Fusarium mycotoxins zearalenone and deoxynivalenol in agricultural commodi-
ties. Food Addit Contam 18:417–430
Kang Z, Buchenauer H (1999) Immunocytochemical localization of Fusarium toxins in infected
wheat spikes by Fusarium culmorum. Physiol Mol Plant Pathol 55:275–288
Kang Z, Buchenauer H (2000a) Cytology and ultrastructure of the infection of wheat spikes by
Fusarium culmorum. Mycol Res 104:1083–1093
Kang Z, Buchenauer H (2000b) Ultrastructural and cytochemical studies on cellulose, xylan and
pectin degradation in wheat spikes infected by Fusarium culmorum. J Phytopathol 148:263–275
Kang Z, Buchenauer H (2000c) Ultrastructural and immunocytochemical investigation of patho-
gen development and host responses in resistant and susceptible wheat spikes infected by
Fusarium culmorum. Physiol Mol Plant Pathol 57:255–268
Kang Z, Buchenauer H (2002a) Immunocytochemical localization of β-1,3-glucanase and chitin-
ase in Fusarium culmorum-infected wheat spikes. Physiol Mol Plant Pathol 60:141–153
Kang Z, Buchenauer H (2002b) Studies on the infection process of Fusarium culmorum in wheat
spikes: degradation of host cell wall components and localization of trichothecene toxins in
infected tissue. Eur J Plant Pathol 108:653–660
Kang Z, Buchenauer H (2003) Immunocytochemical localization of cell wall-bound thionins and
hydroxyproline-rich glycoproteins in Fusarium culmorum infected wheat spikes. J Phytopathol
151:120–129
Kang Z, Zingen-Sell I, Buchenauer H (2005) Infection of wheat spikes by Fusarium avenaceum
and alterations of cell wall components in the infected tissue. Eur J Plant Pathol 111:19–28
Keller MD, Waxman KD, Bergstrom GC, Schmale DG III (2010) Local distance of wheat spike
infection by released clones of Gibberella zeae disseminated from infested corn residue. Plant
Dis 94:1151–1155
Kellerman TS, Marasas WF, Thiel PG, Gelderblom WC, Cawood M, Coetzer JA (1990)
Leukoencephalomalacia in two horses induced by oral dosing of fumonisin B1. Onderstepoort
J Vet Res 57:269–275
Khonga EB, Sutton JC (1988) Inoculum production and survival of Gibberella zeae in maize and
wheat residues. Can J Plant Pathol 10:232–239
Kim H-S, Lee T, Dawlatana M, Yun S-H, Lee Y-W (2003) Polymorphism of trichothecene
biosynthesis genes in deoxynivalenol-and nivalenol-producing Fusarium graminearum iso-
lates. Mycol Res 107:190–197
Kladivko EJ, Akhouri NM, Weesies G (1997) Earthworm populations and species distributions
under no-till and conventional tillage in Indiana and Illinois. Soil Biol Biochem 29:613–615
Koehler B (1942) Natural mode of entrance of fungi into Corn ears and some symptoms that indi-
cate infection. J Agric Res 64:421–442
Koehler B (1957) Prevalence in dent corn and relation to seedling blights. Univ Illinois Ill Agric
Exp Stn Bull 617:1–72
Koehler B (1959) Corn ear rots in Illinois. Univ Illinois Ill Agric Exp Stn Bull 639:1–72
Köhl J, de Haas BH, Kastelein P, Burgers SLGE, Waalwijk C (2007) Population dynamics of
Fusarium spp. and Microdochium nivale in crops and crop residues of winter wheat.
Kommedahl T, Windels CE (1985) The changing nature of stalk rot of maize caused by Gibberella
zeae. In: Parker CA, Rovira AD, Moore KJ, Wong PTW, Kollmorgen JF (eds) Ecology and
management of soilborne plant pathogens. American Phytopathological Society, St. Paul, MN
Kovács K, Kovács G Jr, Mesterházy Á (1994) Expression of resistance to fusarial ear blight in corn
inbreds and their hybrids. Maydica 39:187–190
Kraft JM, Boge W (2001) Root characteristics in pea in relation to compaction and Fusarium root
rot. Plant Dis 85:936–940
Kulik T (2011) Development of TaqMan assays for 3ADON, 15ADON and NIV Fusarium geno-
types based on Tri12 gene. Cereal Res Commun 39:200–214
Langevin F, Eudes F, Comeau A (2004) Effect of trichothecenes produced by Fusarium gra-
minearum during Fusarium head blight development in six cereal species. Eur J Plant Pathol
110:735–746
Langseth W, Rundberget T (1999) The occurrence of HT-2 toxin and other trichothecenes in
Norwegian cereals. Mycopathologia 147:157–165
Lanubile A, Pasini L, Marocco A (2010) Differential gene expression in kernels and silks of maize
lines with contrasting levels of ear rot resistance after Fusarium verticillioides infection. J Plant
Physiol 167:1398–1406
Lattanzio VMT, Nivarlet N, Lippolis V, Gatta SD, Huet AC, Delahaut P et al (2012) Multiplex
dipstick immunoassay for semi-quantitative determination of Fusarium mycotoxins in cereals.
Anal Chim Acta 718:99–108
Leach CM, Anderson AJ (1982) Radiation quality and plant diseases. In: Hatfield J, Thomason IJ
(eds) Proceedings of a conference on biometeorology in integrated pest management.
Academic, New York
Lee T, Oh D-W, Kim H-S, Lee J, Kim Y-H, Yun S-H et al (2001) Identification of deoxynivalenol-
and nivalenol-producing chemotypes of Gibberella zeae by using PCR. Appl Environ Microbiol
67:2966–2972
Lee T, Han YK, Kim KH, Yun SH, Lee YW (2002) Tri13 and Tri7 determine deoxynivalenol- and
nivalenol-producing chemotypes of Gibberella zeae. Appl Environ Microbiol 68:2148–2154
Lemmens M, Scholz U, Berthiller F, Dall’Asta C, Koutnik A, Schuhmacher R et al (2005) The
ability to detoxify the mycotoxin deoxynivalenol colocalizes with a major quantitative trait
locus for Fusarium head blight resistance in wheat. Mol Plant Microbe Interact 18:1318–1324
Leslie JF, Summerell BA (2006) The Fusarium laboratory manual. Blackwell, Ames, IA
Li G, Yen Y (2008) Jasmonate and ethylene signaling pathway may mediate Fusarium head blight
resistance in wheat. Crop Sci 48:1888–1896
Li D, Sirakova T, Rogers L, Ettinger WF, Kolattukudy PE (2002) Regulation of constitutively
expressed and induced cutinase genes by different zinc finger transcription factors in Fusarium
solani f. sp. pisi (Nectria haematococca). J Biol Chem 277:7905–7912
Li H, Xie G, Ma J, Liu G, Wen S, Ban T et al (2010) Genetic relationships between resistances to
Fusarium head blight and crown rot in bread wheat (Triticum aestivum L.). Theor Appl Genet
121:941–950
Li WJ, Feng J, Chang KF, Conner RL, Hwang SF, Strelkov SE et al (2012) Microsatellite DNA
markers indicate quantitative trait loci controlling resistance to pea root rot caused by Fusarium
avenaceum (Corda ex Fries) Sacc. Plant Pathol J 11:114–119
Liddell CM (2003) Systematics of Fusarium species and allies associated with Fusarium head
blight. In: Leonard KJ, Bushnell WR (eds) Fusarium head blight of wheat and barley. The
American Phytopathological Society, St. Paul, MN, pp 35–43
Lindblad M, Gidlund A, Sulyok M, Borjesson T, Krska R, Olsen M et al (2013) Deoxynivalenol
and other selected Fusarium toxins in Swedish wheat—occurrence and correlation to specific
Fusarium species. Int J Food Microbiol 167:284–291
Links MG, Dumonceaux TJ, Hemmingsen SM, Hill JE (2012) The chaperonin-60 universal target
is a barcode for bacteria that enables de novo assembly of metagenomic sequence data. PLoS
One 7:e49755
Logrieco A, Mulè G, Moretti A, Bottalico A (2002) Toxigenic Fusarium species and mycotoxins
associated with maize ear rot in Europe. Eur J Plant Pathol 108:597–609
Lowe CN, Butt KR (2003) Influence of food particle size on inter- and intra-specific interactions of
Allolobophora chlorotica (Savigny) and Lumbricus terrestris (L.). Pedobiologia 47:574–577
Lutsky I, Mor N, Yagen B, Joffe AZ (1978) The role of T-2 toxin in experimental alimentary toxic
aleukia: a toxicity study in cats. Toxicol Appl Pharmacol 43:111–124
Ma Z, Steffenson BJ, Prom LK, Lapitan NL (2000) Mapping of quantitative trait loci for Fusarium
head blight resistance in barley. Phytopathology 90:1079–1088
Ma L-J, van der Does HC, Borkovich KA, Coleman JJ, Daboussi M-J, Di Pietro A et al (2010)
Comparative genomics reveals mobile pathogenicity chromosomes in Fusarium. Nature
464:367–373
Maier FJ, Miedaner T, Hadeler B, Felk A, Salomon S, Lemmens M et al (2006) Involvement of
trichothecenes in fusarioses of wheat, barley and maize evaluated by gene disruption of the
trichodiene synthase (Tri5) gene in three field isolates of different chemotype and virulence.
Mol Plant Pathol 7:449–461
Makandar R, Nalam V, Chaturvedi R, Jeannotte R, Sparks AA, Shah J (2010) Involvement of
salicylate and jasmonate signaling pathways in Arabidopsis interaction with Fusarium gra-
minearum. Mol Plant Microbe Interact 23:861–870
Malachova A, Varga E, Schwartz H, Krska R, Berthiller F (2012) Development, validation and
application of an LC-MS/MS based method for the determination of deoxynivalenol and its
conjugates in different types of beer. World Mycotoxin J 5:261–270
Maldonado-Ramirez SL, Schmale Iii DG, Shields EJ, Bergstrom GC (2005) The relative abun-
dance of viable spores of Gibberella zeae in the planetary boundary layer suggests the role of
long-distance transport in regional epidemics of Fusarium head blight. Agr Forest Meteorol
132:20–27
Markell SG, Francl LJ (2003) Fusarium head blight inoculum: species prevalence and Gibberella
zeae spore type. Plant Dis 87:814–820
Marshall J, Bissonnette K, Chen J (2012) The re-emergence of Fusarium head blight in Idaho.
Impact: University of Idaho, Extension, Idaho Falls Research and Extension Center, Idaho
Falls, ID. http://www.extension.uidaho.edu/impacts/Pdf_12/30-12jmarshall-fusarium.pdf
Martin M, Miedaner T, Dhillon BS, Ufermann U, Kessel B, Ouzunova M et al (2011) Colocalization
of QTL for Gibberella ear rot resistance and low mycotoxin contamination in early European
maize. Crop Sci 51:1935–1945
Massman J, Cooper B, Horsley R, Neate S, Dill-Macky R, Chao S et al (2011) Genome-wide
association mapping of Fusarium head blight resistance in contemporary barley breeding
germplasm. Mol Breed 27:439–454
Mathre DE (1997) Compendium of barley diseases, 2nd edn. APS Press, St. Paul, MN
McLaren DL, Irvine RB, Turkington TK (2003) Irrigation management strategies to reduce
Fusarium head blight and deoxynivalenol. Can J Plant Pathol 25:117–118 (Abstr.)
McLaren DL, Conner RL, Hausermann DJ, Henderson TL, Penner WC, Kerley TJ (2010) Field
pea diseases in Manitoba in 2009. Can Plant Dis Surv 90:148–149
McLaren DL, Hausermann DJ, Henderson TL, Kerley TJ (2011) Field pea diseases in Manitoba in
2010. Can Plant Dis Surv 91:140–141
McLaren DL, Hausermann DJ, Henriquez MA, Kerley TJ, Chang KF (2012) Field pea disease in
Manitoba in 2011. Can Plant Dis Surv 92:150–151
McLaughlin CS, Vaughn MH, Campbell JM, Wei CM, Stafford ME (1977) Inhibition of protein
synthesis by trichothecenes. In: Rodricks JV, Hesseltine CW, Mehlman MA (eds) Mycotoxins
in human and health. Pathotox Publishers, Park Forest South, IL, pp 263–275
McMullen M, Jones R, Gallenberg D (1997) Scab of wheat and barley: a re-emerging disease of
devasting impact. Plant Dis 81:1340–1348
McMullen M, Halley S, Schatz B, Meyer S, Jordahl J, Ransom J (2008) Integrated strategies for
Fusarium head blight management in the United States. Cereal Res Commun 36:563–568
McMullen MP, Bergstrom GC, De Wolf E, Dill-Macky R, Hershman DE, Shaner G et al (2012)
A unified effort to fight an enemy of wheat and barley: Fusarium head blight. Plant Dis
96:1712–1728
Meneely JP, Ricci F, van Egmond HP, Elliott CT (2011) Current methods of analysis for the
determination of trichothecene mycotoxins in food. Trends Analyt Chem 30:192–203
Meneely JP, Quinn JG, Flood EM, Hajšlová J, Elliott CT (2012) Simultaneous screening for T-2/
HT-2 and deoxynivalenol in cereals using a surface plasmon resonance immunoassay. World
Mesterházy Á (1995) Types and components of resistance to Fusarium head blight of wheat. Plant
Breed 114:377–386
Mesterházy Á (2002) Role of deoxynivalenol in aggressiveness of Fusarium graminearum and
F. culmorum and in resistance to Fusarium head blight. Eur J Plant Pathol 108:675–684
Mesterházy Á (2003a) Breeding wheat for Fusarium head blight resistance in Europe. In: Leonard
KJ, Bushnell WR (eds) Fusarium head blight of wheat and barley. The American
Phytopathological Society, St. Paul, MN, pp 211–240
Mesterházy Á (2003b) Control of Fusarium head blight of wheat by fungicides. In: Leonard KJ,
Bushnell WR (eds) Fusarium head blight of wheat and barley. The American Phytopathological
Society, St. Paul, MN, pp 363–380
Mesterházy Á, Kovács K (1988) Breeding corn against fusarial stalk rot, ear rot and seedling
blight. Acta Phytopathol Acad Sci Hung 21:231–249
Mesterházy Á, Lemmens M, Reid LM (2012) Breeding for resistance to ear rots caused by
Fusarium spp. in maize—a review. Plant Breed 131:1–19
Miedaner T, Reinbrecht C, Lauber U, Schollenberger M, Geiger HH (2001) Effects of genotype
and genotype-environment interaction on deoxynivalenol accumulation and resistance to
Fusarium head blight in rye, triticale, and wheat. Plant Breed 120:97–105
Miedaner T, Schilling A, Geiger HH (2004) Competition effects among isolates of Fusarium cul-
morum differing in aggressiveness and mycotoxin production on heads of winter rye. Eur J
Miedaner T, Bolduan C, Melchinger AE (2010) Aggressiveness and mycotoxin production of eight
isolates each of Fusarium graminearum and Fusarium verticillioides for ear rot on susceptible
and resistant early maize inbred lines. Eur J Plant Pathol 127:113–123
Miller JD, Young JC, Sampson DR (1985) Deoxynivalenol and Fusarium head blight resistance in
spring cereals. Phytopathol Z 113:359–367
Miller JD, Miles M, Fielder DA (1997) Kernel concentrations of 4-acetylbenzoxazolin-2-one and
diferuloylputrescine in maize genotypes and Gibberella ear rot. J Agric Food Chem 45:
4456–4459
Miller JD, Culley J, Fraser K, Hubbard S, Meloche F, Ouellet T et al (1998) Effect of tillage prac-
tice on fusarium head blight of wheat. Can J Plant Pathol 20:95–103
Miller SS, Reid LM, Butler G, Winter SP, McGoldrick NJ (2003) Long chain alkanes in silk
extracts of maize genotypes with varying resistance to Fusarium graminearum. J Agric Food
Chem 51:6702–6708
Miller SG, Dokken-Bouchard FL, Cruise D, Ippolito J, Schemenauer I (2012) Survey of lentil
diseases in Saskatchewan, 2010 and 2011. Can Plant Dis Surv 92:136–137
Mondal SN, Kageyama K, Hyakumachi M (1996) Chlamydospore formation in Fusarium solani
f. sp. phaseoli in root extracts of crop plants and their virulence to kidney beans (Phaseolus
vulgaris L.). Soil Biol Biochem 28:539–543
Morcia C, Rattotti E, Stanca AM, Tumino G, Rossi V, Ravaglia S et al (2013) Fusarium genetic
traceability: role for mycotoxin control in small grain cereals agro-food chains. J Cereal Sci
57:175–182
Mudge AM, Dill-Macky R, Dong Y, Gardiner DM, White RG, Manners JM (2006) A role for the
mycotoxin deoxynivalenol in stem colonisation during crown rot disease of wheat caused by
Fusarium graminearum and Fusarium pseudograminearum. Physiol Mol Plant Pathol
69:73–85
Müller S, Dekant W, Mally A (2012) Fumonisin B1 and the kidney: modes of action for renal tumor
formation by fumonisin B1 in rodents. Food Chem Toxicol 50:3833–3846
Munkvold GP, Hellmich RL, Showers WB (1997a) Reduced Fusarium ear rot and symptomless
infection in kernels of maize genetically engineered for European corn borer resistance.
Munkvold GP, McGee DC, Carlton WM (1997b) Importance of different pathways for maize ker-
nel infection by Fusarium moniliforme. Phytopathology 87:209–217
Murillo-Williams A, Munkvold GP (2008) Systemic infection by Fusarium verticillioides in maize
plants grown under three temperature regimes. Plant Dis 92:1695–1700
Musser SM, Gay ML, Mazzola EP, Plattner RD (1996) Identification of a new series of fumonisins
containing 3-hydroxypyridine. J Nat Prod 59:970–972
Muthomi JM, Schuetze A, Dehne HW, Mutitu EW, Oerke EC (2000) Characterization of Fusarium
culmorum isolates by mycotoxin production and aggressiveness to winter wheat. J Plant Dis
Prot 107:113–123
Naseri B, Marefat A (2011) Large-scale assessment of agricultural practices affecting Fusarium
root rot and common bean yield. Eur J Plant Pathol 131:179–195
Nelson EB (2004) Microbial dynamics and interactions in the spermosphere. Annu Rev Phytopathol
42:271–309
Nicolaisen M, Supronienė S, Nielsen LK, Lazzaro I, Spliid NH, Justesen AF (2009) Real-time
PCR for quantification of eleven individual Fusarium species in cereals. J Microbiol Methods
76:234–240
Nielsen LK, Jensen JD, Rodriguez A, Jorgensen LN, Justesen AF (2012) TRI12 based quantitative
real-time PCR assays reveal the distribution of trichothecene genotypes of F. graminearum and
F. culmorum isolates in Danish small grain cereals. Int J Food Microbiol 157:384–392
O’Donnell K, Cigelnik E (1997) Two divergent intragenomic rDNA ITS2 types within a monophy-
letic lineage of the fungus Fusarium are nonorthologous. Mol Phylogenet Evol 7:103–116
O’Donnell K, Kistler HC, Tacke BK, Casper HH (2000) Gene genealogies reveal global phylogeo-
graphic structure and reproductive isolation among lineages of Fusarium graminearum, the
fungus causing wheat scab. Proc Natl Acad Sci U S A 97:7905–7910
Obanor F, Neate S, Simpfendorfer S, Sabburg R, Wilson P, Chakraborty S (2013) Fusarium gra-
minearum and Fusarium pseudograminearum caused the 2010 head blight epidemics in
Australia. Plant Pathol 62:79–91
Oldenburg E, Kramer S, Schrader S, Weinert J (2008) Impact of the earthworm Lumbricus ter-
restris on the degradation of Fusarium-infected and deoxynivalenol-contaminated wheat straw.
Oyarzun PJ (1993) Bioassay to assess root rot in pea and effect of root rot on yield. Netherlands J
Oyarzun P, Gerlagh M, Hoogland AE (1993) Pathogenic fungi involved in root rot of peas in the
Netherlands and their physiological specialization. Netherlands J Plant Pathol 99:23–33
Oyarzun PJ, Gerlagh M, Zadoks JC (1998) Factors associated with soil receptivity to some fungal
root rot pathogens of peas. Appl Soil Ecol 10:151–169
Palacios SA, Ramirez ML, Cabrera Zalazar M, Farnochi MC, Zappacosta D, Chiacchiera SM et al
(2011) Occurrence of Fusarium spp. and fumonisin in durum wheat grains. J Agric Food Chem
59:12264–12269
Paper JM, Scott-Craig JS, Adhikari ND, Cuomo CA, Walton JD (2007) Comparative proteomics
of extracellular proteins in vitro and in planta from the pathogenic fungus Fusarium gra-
minearum. Proteomics 7:3171–3183
Parry DW, Jenkinson P, McLeod L (1995) Fusarium ear blight (scab) in small grain cereals—a
review. Plant Pathol 44:207–238
Parsons MW, Munkvold GP (2010a) Associations of planting date, drought stress, and insects with
Fusarium ear rot and fumonisin B1 contamination in California maize. Food Addit Contam
Part A 27:591–607
Parsons MW, Munkvold GP (2010b) Relationships of immature and adult thrips with silk-cut,
Fusarium ear rot and fumonisin B1 contamination of maize in California and Hawaii. Plant
Pathol 59:1099–1106
Pascale M, Visconti A, Prończuk M, Wiśniewska H, Chelkowski J (1997) Accumulation of fumoni-
sins in maize hybrids inoculated under field conditions with Fusarium moniliforme Sheldon.
J Sci Food Agric 74:1–6
Paul PA, Lipps PE, Hershman DE, McMullen MP, Draper MA, Madden LV (2008) Efficacy of
triazole-based fungicides for Fusarium head blight and deoxynivalenol control in wheat: a
multivariate meta-analysis. Phytopathology 98:999–1011
Paulitz TC (1996) Diurnal release of ascospores by Gibberella zeae in inoculated wheat plots.
Peraica M, Radić B, Lucić A, Pavlović M (1999) Toxic effects of mycotoxins in humans. Bull
World Health Organ 77:754–766
Pérez-Brito D, Jeffers D, González-de-León D, Khairallah M, Cortés-Cruz M, Velázquez-Cardelas
G et al (2001) QTL mapping of Fusarium moniliforme ear-rot resistance in highland maize,
Mexico. Agrosciencia 35:181–196
Perkowski J, Proñczuk M, Chelkowski J (1997) Deoxynivalenol and acetyldeoxynivalenol accu-
mulation in field maize inoculated with Fusarium graminearum. J Phytopathol 145:113–116
Persson L, Bødker L, Larsson-Wikström M (1997) Prevalence and pathogenicity of foot and root
rot pathogens of pea in southern Scandinavia. Plant Dis 81:171–174
Pestka J (2010) Toxicological mechanisms and potential health effects of deoxynivalenol and niva-
lenol. World Mycotoxin J 3:323–347
Pestka JJ, Bondy GS (1994) Immunotoxic effects of mycotoxins. In: Miller JD, Trenholm HL
(eds) Mycotoxins in grain: compounds other than aflatoxin. American Phytopathological
Society, St. Paul, MN
Phalip V, Delalande F, Carapito C, Goubet F, Hatsch D, Leize-Wagner E et al (2005) Diversity of
the exoproteome of Fusarium graminearum grown on plant cell wall. Curr Genet 48:366–379
Poppenberger B, Berthiller F, Lucyshyn D, Sieberer T, Schuhmacher R, Krska R et al (2003)
Detoxification of the Fusarium mycotoxin deoxynivalenol by a UDP-glucosyltransferase from
Arabidopsis thaliana. J Biol Chem 278:47905–47914
Prelusky DB, Rotter BA, Rotter RG (1994) Toxicology of mycotoxins. In: Miller JD, Trenholm
HL (eds) Mycotoxins in grain: compounds other than aflatoxin. American Phytopathological
Society, St. Paul, MN
Pritsch C, Muehlbauer GJ, Bushnell WR, Somers DA, Vance CP (2000) Fungal development and
induction of defense response genes during early infection of wheat spikes by Fusarium gra-
minearum. Mol Plant Microbe Interact 13:159–169
Pritsch C, Vance CP, Bushnell WR, Somers DA, Hohn TM, Muehlbauer GJ (2001) Systemic
expression of defense response genes in wheat spikes as a response to Fusarium graminearum
infection. Physiol Mol Plant Pathol 58:1–12
Proctor RH, Hohn TM, McCormick SP (1995) Reduced virulence of Gibberella zeae caused by
disruption of a trichothecene toxin biosynthetic gene. Mol Plant Microbe Interact 8:593–601
Proctor RH, Brown DW, Plattner RD, Desjardins AE (2003) Co-expression of 15 contiguous genes
delineates a fumonisin biosynthetic gene cluster in Gibberella moniliformis. Fungal Genet Biol
38:237–249
Proctor RH, Plattner RD, Desjardins AE, Busman M, Butchko RA (2006) Fumonisin production
in the maize pathogen Fusarium verticillioides: genetic basis of naturally occurring chemical
variation. J Agric Food Chem 54:2424–2430
Prussin AJ II (2013) Monitoring and predicting the long distance transport of Fusarium gra-
minearum, causal agent of Fusarium head blight in wheat and barley [Thesis]. Virginia
Polytechnic Institute and State University, Blacksburg, VA
Puri KD, Zhong S (2010) The 3ADON population of Fusarium graminearum found in North
Dakota is more aggressive and produces a higher level of DON than the prevalent 15ADON
population in spring wheat. Phytopathology 100:1007–1014
Rampitsch C, Day J, Subramaniam R, Walkowiak S (2013) Comparative secretome analysis of
Fusarium graminearum and two of its non-pathogenic mutants upon deoxynivalenol induction
in vitro. Proteomics 13:1913–1921
Reid LM (1996) Screening maize for resistance to Gibberella ear rot. Agric Agri Food Can Tech
Bull Publ 196-5E:1–40
Reid LM, Sinha RC (1998) Maize maturity and the development of Giberrella ear rot symptoms
and deoxynivalenol after inoculation. Eur J Plant Pathol 104:147–154
Reid LM, Bolton AT, Hamilton RI, Woldemariam T, Mather DE (1992a) Effect of silk age on
resistance of maize to Fusarium graminearum. Can J Plant Pathol 14:293–298
Reid LM, Mather DE, Hamilton RI, Bolton AT (1992b) Genotypic differences in the resistance of
maize silk to Fusarium graminearum. Can J Plant Pathol 14:211–214
Reid LM, Stewart DW, Hamilton RI (1996) A 4-year study of the association between Gibberella
ear rot severity and deoxynivalenol concentration. J Phytopathol 144:431–436
Reid LM, Nicol RW, Ouellet T, Savard M, Miller JD, Young JC et al (1999) Interaction of Fusarium
graminearum and F. moniliforme in maize ears: disease progress, fungal biomass, and myco-
toxin accumulation. Phytopathology 89:1028–1037
Reid LM, Zhu X, Savard ME, Sinha RC, Vigier B (2000) Pre-harvest accumulation of deoxynivale-
nol in sweet corn ears inoculated with Fusarium graminearum. Food Addit Contam
17:689–701
Reid LM, McDiarmid G, Parker AJ, Woldemariam T, Hamilton RI (2001a) CO388 and CO389
corn inbred lines. Can J Plant Sci 81:457–459
Reid LM, McDiarmid G, Parker AJ, Woldemariam T, Hamilton RI (2001b) CO430, CO431 and
CO432 corn inbred lines. Can J Plant Sci 81:283–284
Reid LM, Woldemariam T, Zhu X, Stewart DW, Schaafsma AW (2002) Effect of inoculation time
and point of entry on disease severity in Fusarium graminearum, Fusarium verticillioides, or
Fusarium subglutinans inoculated maize ears. Can J Plant Pathol 24:162–167
Reid LM, McDiarmid G, Parker AJ, Woldemariam T (2003) CO441 corn inbred line. Can J Plant
Sci 83:79–80
Reid LM, Zhu X, Parker A, Yan W (2009) Increased resistance to Ustilago zeae and Fusarium
verticillioides in maize inbred lines bred for Fusarium graminearum resistance. Euphytica
165:567–578
Reinprecht Y, Wu X, Yan S, Labey L, Dasilva E, Martin J, Pauls K (2008) A microarray-based
approach for identifying genes for resistance to Fusarium graminearum in maize (Zea Mays
L.). Cereal Res Commun 36:253–259
Reynoso MM, Ramirez ML, Torres AM, Chulze SN (2011) Trichothecene genotypes and chemo-
types in Fusarium graminearum strains isolated from wheat in Argentina. Int J Food Microbiol
145:444–448
Rheeder JP, Marasas WFO, Vismer HF (2002) Production of fumonisin analogs by Fusarium spe-
cies. Appl Environ Microbiol 68:2101–2105
Robertson-Hoyt LA, Jines MP, Balint-Kurti PJ, Kleinschmidt CE, White DG, Payne GA et al
(2006) QTL mapping for Fusarium ear rot and fumonisin contamination resistance in two
maize populations. Crop Sci 46:1734–1743
Rocha O, Ansari K, Doohan FM (2005) Effects of trichothecene mycotoxins on eukaryotic cells: a
review. Food Addit Contam 22:369–378
Román-Avilés B, Kelly JD (2005) Identification of quantitative trait loci conditioning resistance to
Fusarium root rot in common bean. Crop Sci 45:1881–1890
Ronquillo-López MG, Grau CR, Nienhuis J (2010) Variation in reaction to Fusarium spp. identified
in a common bean (Phaseolus vulgaris L.) population developed for field-based resistance to
root rot and wilt. Crop Sci 50:2303–2309
Rotem J, Aust HJ (1991) The effect of ultraviolet and solar radiation and temperature on survival
of fungal propagules. J Phytopathol 133:76–84
Rotem J, Wooding B, Aylor DE (1985) The role of solar radiation, especially ultraviolet, in the
mortality of fungal spores. Phytopathology 75:510–514
Rubert J, James KJ, Mañes J, Soler C (2012) Study of mycotoxin calibration approaches on the
example of trichothecenes analysis from flour. Food Chem Toxicol 50:2034–2041
Salas B, Dill-Macky R (2003) Previous crop affecting soil populations of Fusarium head blight
pathogens in Minnesota. In: Canty SM, Lewis J, Ward RW (eds) Proceedings of 2003 national
Fusarium head blight forum, Bloomington, MN, p 171
Salas B, Dill-Macky R (2004) Incidence of Fusarium graminearum in pre-harvest and overwin-
tered residues of wheat cultivars differing in Fusarium head blight resistance. In: Canty SM,
Boring T, Versdahl K, Wardwell J, Ward RW (eds) Proceedings of second international sympo-
sium on Fusarium head blight, incorporating the eighth European Fusarium seminar, Orlando,
FL, pp 502–503
Salas B, Dill-Macky R (2005) Effect of residue management and host resistance on the epidemiol-
ogy of Fusarium head blight. Phytopathology 95:952 (Abstr.)
Salgado JD, Wallhead M, Madden LV, Paul PA (2011) Grain harvesting strategies to minimize
grain quality losses due to Fusarium head blight in wheat. Plant Dis 95:1448–1457
Sampietro DA, Vattuone MA, Presello DA, Fauguel CM, Catalán CAN (2009) The pericarp and its
surface wax layer in maize kernels as resistance factors to fumonisin accumulation by Fusarium
verticillioides. Crop Prot 28:196–200
Santiago R, Reid LM, Arnason JT, Zhu X, Martinez N, Malvar RA (2007) Phenolics in maize
genotypes differing in susceptibility to Gibberella stalk rot (Fusarium graminearum Schwabe).
J Agric Food Chem 55:5186–5193
Schaafsma AW, Ilinic LT, Miller JD, Hooker DC (2001) Agronomic considerations for reducing
deoxynivalenol in wheat grain. Can J Plant Pathol 23:279–285
Schenzel J, Forrer H-R, Vogelgsang S, Bucheli T (2012) Development, validation and application
of a multi-mycotoxin method for the analysis of whole wheat plants. Mycotoxin Res
28:135–147
Schmale DG III, Bergstrom GC (2007) Aerobiology of Gibberella zeae: Whence come the spores
for Fusarium head blight? In: 2007 national Fusarium head blight forum, Kansas City, MO,
p 70
Schneider KA, Grafton KF, Kelly JD (2001) QTL analysis of resistance to Fusarium root rot in
bean. Crop Sci 41:535–542
Schollenberger M, Drochner W, Müller H-M (2007) Fusarium toxins of the scirpentriol subgroup:
a review. Mycopathologia 164:101–118
Schrader S, Kramer S, Oldenburg E, Weinert J (2009) Uptake of deoxynivalenol by earthworms
from Fusarium-infected wheat straw. Mycotoxin Res 25:53–58
Schroeder HW, Christensen JJ (1963) Factors affecting resistance of wheat to scab by Gibberella
zeae. Phytopathology 53:831–838
Schwartz HF, Steadman JR, Hall R, Forster RL (2005) Compendium of bean disease, 2nd edn.
APS Press, St. Paul, MN
Scott PM (1997) Multi‐year monitoring of Canadian grains and grain‐based foods for trichothe-
cenes and zearalenone. Food Addit Contam 14:333–339
Seaman WL (1982) Epidemiology and control of mycotoxigenic fusaria on cereal grains. Can J
Seifert KA, Aoki T, Baayen RP, Brayford D, Burgess LW, Chulze S et al (2003) The name
Fusarium moniliforme should no longer be used. Mycol Res 107:643–644
Sekhon RS, Kuldau G, Mansfield M, Chopra S (2006) Characterization of Fusarium-induced
expression of flavonoids and PR genes in maize. Physiol Mol Plant Pathol 69:109–117
Shank RA, Foroud NA, Hazendonk P, Eudes F, Blackwell BA (2011) Current and future
experimental strategies for structural analysis of trichothecene mycotoxins—a prospectus.
Toxins 3:1518–1553
Shephard GS, Berthiller F, Burdaspal PA, Crews C, Jonker MA, Krska R et al (2012) Developments
in mycotoxin analysis: an update for 2010–2011. World Mycotoxin J 5:3–30
Shier WT (1992) Sphingosine analogs: an emerging new class of toxins that includes the fumoni-
sins. Toxin Rev 11:241–257
Sims JL, Frederick LR (1970) Nitrogen immobilization and decomposition of corn residue in soil
and sand as affected by residue particle size. Soil Sci 109:355–361
Singh SP, Schwartz HF (2010) Breeding common bean for resistance to diseases: a review. Crop
Sci 50:2199–2223
Sinha RC, Savard ME (1997) Concentration of deoxynivalenol in single kernels and various tissues
of wheat heads. Can J Plant Pathol 19:8–12
Siranidou E, Kang Z, Buchenauer H (2002) Studies on symptom development, phenolic com-
pounds and morphological defence responses in wheat cultivars differing in resistance to
Fusarium head blight. J Phytopathol 150:200–208
Smiley RW, Gourlie JA, Easley SA, Patterson L-M, Whittaker RG (2005) Crop damage estimates
for crown rot of wheat and barley in the Pacific Northwest. Plant Dis 89:595–604
Somers DJ, Fedak G, Clarke J, Cao W (2006) Mapping of FHB resistance QTLs in tetraploid
wheat. Genome 49:1586–1593
Stack RW (1997) Gradients of Fusarium head blight in wheat along transects away from a concen-
trated source of Gibberella zeae ascospore inoculum. In: Dill-Macky R, Jones RK (eds)
National Fusarium head blight forum, St. Paul, MN
Stack RW (2000) Return of an old problem: Fusarium head blight of small grains. APSnet Plant
Health Reviews. http://www.apsnet.org/publications/apsnetfeatures/Pages/headblight.aspx
Stack RW, Elias EM, Fetch JM, Miller JD, Joppa LR (2002) Fusarium head blight reaction of
Langdon durum-Triticum dicoccoides chromosome substitution lines. Crop Sci 42:637–642
Stahl DJ, Theuerkauf A, Heitefuss R, Schäfer W (1994) Cutinase of Nectria haematococca
(Fusarium solani f. sp. pisi) is not required for fungal virulence or organ specificity on pea. Mol
Plant Microbe Interact 7:713–725
Starkey DE, Ward TJ, Aoki T, Gale LR, Kistler HC, Geiser DM et al (2007) Global molecular
surveillance reveals novel Fusarium head blight species and trichothecene toxin diversity.
Fungal Genet Biol 44:1191–1204
Statistics Canada. Table 001-0010 - Estimated areas, yield, production and average farm price of
principal field crops, in metric units, annual, CANSIM (database). (accessed: 2014-07–02)
Steffenson BJ (2003) Fusarium head blight of barley: impact, epidemics, management, and strate-
gies for identifying and utilizating genetic resistance. In: Leonard KJ, Bushnell WR (eds)
Fusarium head blight of wheat and barley. The American Phytopathological Society, St. Paul,
Minnesota, pp 241–295
Steiner B, Kurz H, Lemmens M, Buerstmayr H (2009) Differential gene expression of related
wheat lines with contrasting levels of head blight resistance after Fusarium graminearum inoc-
ulation. Theor Appl Genet 118:753–764
Strausbaugh CA, Maloy OC (1986) Fusarium scab of irrigated wheat in central Washington. Plant
Dis 70:1104–1106
Suga H, Gale LR, Kistler HC (2004) Development of VNTR markers for two Fusarium gra-
minearum clade species. Mol Ecol Notes 4:468–470
Sutton JC (1982) Epidemiology of wheat head blight and maize ear rot caused by Fusarium gra-
minearum. Can J Plant Pathol 4:195–209
Tang Y, Lin H, Chen Y, Su W, Wang S, Chiueh L et al (2012) Development of a quantitative multi-
mycotoxin method in rice, maize, wheat and peanut using UPLC-MS/MS. Food Anal Methods
6:727–736
Tangni EK, Motte J-C, Callebaut A, Pussemier L (2010) Cross-reactivity of antibodies in some
commercial deoxynivalenol test kits against some fusariotoxins. J Agric Food Chem 58:
12625–12633
Tangni E, Motte J-C, Callebaut A, Chandelier A, Schrijver M, Pussemier L (2011) Deoxynivalenol
loads in matched pair wheat samples in Belgium: comparison of ELISA VERATOX kit against
liquid chromatography. Mycotoxin Res 27:105–113
Teich AH (1989) Epidemiology of wheat (Triticum aestivum L.) scab caused by Fusarium spp. In:
Chelkowski J (ed) Topics in secondary metabolism 2: Fusarium—mycotoxins, taxonomy, and
pathogenicity. Elsevier Science, New York, NY, pp 269–282
Teich AH, Hamilton JR (1985) Effect of cultural practices, soil phosphorus, potassium, and pH on
the incidence of Fusarium head blight and deoxynivalenol levels in wheat. Appl Environ
Teich AH, Nelson K (1984) Survey of Fusarium head blight and possible effects of cultural prac-
tices in wheat fields in Lambton County in 1983. Can Plant Dis Surv 64:11–13
Tekauz A, McCallum B, Gilbert J (2000) Review: Fusarium head blight of barley in western
Canada. Can J Plant Pathol 22:9–16
Tekauz A, McCallum B, Ames N, Fetch JM (2004) Fusarium head blight of oat—current status in
western Canada. Can J Plant Pathol 26:473–479
Tekauz A, Mitchell Fetch JW, Rossnagel BG, Savard ME (2008) Progress in assessing the impact
of Fusarium head blight on oat in western Canada and screening of avena germplasm for resis-
tance. Cereal Res Commun 36:49–56
Terzi V, Morcia C, Faccioli P, Faccini N, Rossi V, Cigolini M et al (2007) Fusarium DNA trace-
ability along the bread production chain. Int J Food Sci Technol 42:1390–1396
Tittlemier SA, Roscoe M, Drul D, Blagden R, Kobialka C, Chan J et al (2013a) Single laboratory
evaluation of a planar waveguide-based system for a simple simultaneous analysis of four
mycotoxins in wheat. Mycotoxin Res 29:55–62
Tittlemier SA, Roscoe M, Trelka M, Gaba D, Chan J, Patrick S et al (2013b) Fusarium damage in
cereal grains from western Canada. Part II: occurrence of mycotoxins and their source organ-
isms in Fusarium damaged durum wheat harvested in 2010. J Agric Food Chem 61:
5438–5448
Tittlemier SA, Roscoe M, Trelka R, Patrick SK, Bamforth JM, Gräfenhan T et al (2014) Fate of
moniliformin during milling of Canadian durum wheat, processing, and cooking of spaghetti.
Can J Plant Sci 94:555–563
Tkachuk R, Dexter JE, Tipples KH, Nowicki W (1991) Removal by specific gravity table of tomb-
stone kernels and associated trichothecenes from wheat infected with Fusarium head blight.
Cereal Chem 68:428–431
Tóth B, Mesterházy Á, Horvath Z, Bartók T, Varga M, Varga J (2005) Genetic variability of central
European isolates of the Fusarium graminearum species complex. Eur J Plant Pathol
113:35–45
Trail F, Xu H, Loranger R, Gadoury D (2002) Physiological and environmental aspects of ascospore
discharge in Gibberella zeae (anamorph Fusarium graminearum). Mycologia 94:181–189
Turkington TK, Clear RM, Patrick SK (2005) Characteristics of wheat fields positive for Fusarium
graminearum in Alberta, in 2002 and 2003. Can J Plant Pathol 27:479 (Abstr.)
Turkington TK, Kuzyk A, Dunn R, McLaren D, Irvine B, Clear RM et al. (2006) Irrigation and
plant disease management. In: Proceedings of the irrigated crop production update: 2006 con-
ference, Lethbridge, AB. http://www1.agric.gov.ab.ca/$department/deptdocs.nsf/all/ind10759
Ueno Y (1983) Trichothecenes: chemical, biological and toxicological aspects. Elsevier Scientific,
Amsterdam
Ueno Y, Hosoya M, Morita Y, Ueno I, Tatsuno T (1968) Inhibition of the protein synthesis in rabbit
reticulocyte by nivalenol, a toxic principle isolated from Fusarium nivale-growing rice.
J Biochem 64:479–485
van der Fels-Klerx HJ, de Rijk TC, Booij CJH, Goedhart PW, Boers EAM, Zhao C et al (2012)
Occurrence of Fusarium head blight species and Fusarium mycotoxins in winter wheat in the
Netherlands in 2009. Food Addit Contam Part A 29:1716–1726
Vesonder RF, Ellis JJ, Rohwedder WK (1981) Elaboration of vomitoxin and zearalenone by
Fusarium isolates and the biological activity of Fusarium-produced toxins. Appl Environ
Vishwanath V, Sulyok M, Labuda R, Bicker W, Krska R (2009) Simultaneous determination of 186
fungal and bacterial metabolites in indoor matrices by liquid chromatography/tandem mass
spectrometry. Anal Bioanal Chem 395:1355–1372
Voigt CA, Schafer W, Salomon S (2005) A secreted lipase of Fusarium graminearum is a virulence
factor required for infection of cereals. Plant J 42:364–375
Volpi C, Janni M, Lionetti V, Bellincampi D, Favaron F, D’Ovidio R (2011) The ectopic expression
of a pectin methyl esterase inhibitor increases pectin methyl esterification and limits fungal
diseases in wheat. Mol Plant Microbe Interact 24:1012–1019
von der Ohe C, Gauthier V, Tamburic-Ilincic L, Brule-Babel A, Fernando W, Clear R et al (2010)
A comparison of aggressiveness and deoxynivalenol production between Canadian Fusarium
graminearum isolates with 3-acetyl and 15-acetyldeoxynivalenol chemotypes in field-grown
spring wheat. Eur J Plant Pathol 127:407–417
Voss KA, Gelineau-van Waes JB, Riley RT (2006) Fumonisins: current research trends in develop-
mental toxicology. Mycotoxin Res 22:61–69
Voss KA, Smith GW, Haschek WM (2007) Fumonisins: toxicokinetics, mechanism of action and
toxicity. Anim Feed Sci Technol 137:299–325
Waalwijk C, van der Heide R, de Vries I, van der Lee T, Schoen C, Costrel-de Corainville G et al
(2004) Quantitative detection of Fusarium species in wheat using TaqMan. Eur J Plant Pathol
110:481–494
Waalwijk C, Koch S, Ncube E, Allwood J, Flett B, de Vries I et al (2008) Quantitative detection of
Fusarium spp. and its correlation with fumonisin content in maize from South African subsis-
tence farmers. World Mycotoxin J 1:39–47
Waggoner PE, Green JSA, Smith FB (1983) The aerial dispersal of the pathogens of plant disease.
Philos Trans R Soc Lond B Biol Sci 302:451–462
Wang Y, Yang L, Xu H, Li Q, Ma Z, Chu C (2005) Differential proteomic analysis of proteins in
wheat spikes induced by Fusarium graminearum. Proteomics 5:4496–4503
Wanjiru MW, Kang Z, Buchenauer H (2002) Importance of cell wall degrading enzymes produced
by Fusarium graminearum during infection of wheat heads. Eur J Plant Pathol 108:803–810
Ward TJ, Bielawski JP, Kistler HC, Sullivan E, O’Donnell K (2002) Ancestral polymorphism and
adaptive evolution in the trichothecene mycotoxin gene cluster of phytopathogenic Fusarium.
Ward TJ, Clear RM, Rooney AP, O’Donnell K, Gaba D, Patrick S et al (2008) An adaptive evolu-
tionary shift in Fusarium head blight pathogen populations is driving the rapid spread of more
toxigenic Fusarium graminearum in North America. Fungal Genet Biol 45:473–484
Wardle DA (1995) Impacts of disturbance on detritus food webs in agro-ecosystems of contrasting
tillage and weed management practices. In: Begon M, Fitter AH (eds) Advances in ecological
research, vol 26. Academic, New York, pp 105–185
Warren HL, Kommedahl T (1973) Fertilization and wheat refuse effects on Fusarium species
associated with wheat roots in Minnesota. Phytopathology 63:103–108
Warth B, Parich A, Atehnkeng J, Bandyopadhyay R, Schuhmacher R, Sulyok M et al (2012)
Quantitation of mycotoxins in food and feed from Burkina Faso and Mozambique using a
modern LC-MS/MS multitoxin method. J Agric Food Chem 60:9352–9363
Wearing AH, Burgess LW (1977) Distribution of Fusarium roseum ‘Graminearum’ Group 1 and
its mode of survival in eastern Australian wheat belt soils. Trans Br Mycol Soc 69:429–442
Whitaker TB, Hagler WM Jr, Giesbrecht FG, Johannson AS (2002) Sampling wheat for deoxyni-
valenol. In: DeVries JW, Trucksess M, Jackson LS (eds) Mycotoxins and food safety. Kluwer,
New York, NY, pp 73–83
White DG (1999) Compendium of corn diseases, 3rd edn. APS Press, St. Paul, MN
Wiese MV (1987) Compendium of wheat diseases, 2nd edn. APS Press, St. Paul, MN
Windels CE, Kommedahl T (1984) Late-season colonization and survival of Fusarium gra-
minearum Group II in cornstalks in Minnesota. Plant Dis 68:791–793
Windels CE, Kommedahl T, Stienstra WC, Burnes PM (1988) Occurrence of Fusarium species in
symptom-free and overwintered cornstalks in northwestern Minnesota. Plant Dis 72:990–993
Wolfarth F, Schrader S, Oldenburg E, Weinert J, Brunotte J (2011) Earthworms promote the reduc-
tion of Fusarium biomass and deoxynivalenol content in wheat straw under field conditions.
Wolf-Hall CE (2007) Mold and mycotoxin problems encountered during malting and brewing. Int
J Food Microbiol 119:89–94
Wu W, Bates MA, Bursian SJ, Link JE, Flannery BM, Sugita-Konishi Y et al (2013) Comparison
of emetic potencies of the 8-ketotrichothecenes deoxynivalenol, 15-acetyldeoxynivalenol,
3-acetyldeoxynivalenol, fusarenon X, and nivalenol. Toxicol Sci 131:279–291
Xiang K, Reid LM, Zhu X (2010a) Relationship among kernel drydown rates, environmental fac-
tors and resistance to Gibberella ear rot, Fusarium ear rot and common smut of corn. In: Joint
annual meeting of the Canadian Phytopathological Society and the Pacific Division of the
American Phytopathological Society, Vancouver, BC
Xiang K, Zhang ZM, Reid LM, Zhu XY, Yuan GS, Pan GT (2010b) A meta-analysis of QTL
associated with ear rot resistance in maize. Maydica 55:281–290
Xue AG (2003) Efficacy of Clonostachys rosea strain ACM941 and fungicide seed treatments for
controlling the root rot complex of field pea. Can J Plant Sci 83:519–524
Yi C, Kaul HP, Kübler E, Schwadorf K, Aufhammer W (2001) Head blight (Fusarium graminearum)
and deoxynivalenol concentration in winter wheat as affected by pre-crop, soil tillage and nitro-
gen fertilization. J Plant Dis Protect 108:217–230
Yli-Mattila T, Gagkaeva T (2010) Molecular chemotyping of Fusarium graminearum, F. culmo-
rum, and F. cerealis isolates from Finland and Russia. In: Gherbawy Y, Voigt K (eds) Molecular
identification of fungi. Springer, Berlin, pp 159–177
Yli-Mattila T, Paavanen-Huhtala S, Parikka P, Jestoi M, Klemsdal SS, Rizzo A (2006) Genetic
variation, real-time PCR, metabolites and mycotoxins of Fusarium avenaceum and related
species. Mycotoxin Res 22:79–86
Yu GT, Franckowiak JD, Neate SM, Zhang B, Horsley RD (2010) A native QTL for Fusarium head
blight resistance in North American barley (Hordeum vulgare L.) independent of height, matu-
rity, and spike type loci. Genome 53:111–118
Yuan J, Ali ML, Taylor J, Liu J, Sun G, Liu W et al (2008) A guanylyl cyclase-like gene is associ-
ated with Gibberella ear rot resistance in maize (Zea mays L.). Theor Appl Genet
116:465–479
Zhang Y, Choi Y-E, Zou X, Xu J-R (2011) The FvMK1 mitogen-activated protein kinase gene
regulates conidiation, pathogenesis, and fumonisin production in Fusarium verticillioides.
Fungal Genet Biol 48:71–79
Zhang H, Van der Lee T, Waalwijk C, Chen W, Xu J, Xu J et al (2012) Population analysis of the
Fusarium graminearum species complex from wheat in China show a shift to more aggressive
isolates. PLoS One 7:e31722
Zhou W, Kolb FL, Riechers DE (2005) Identification of proteins induced or upregulated by
Fusarium head blight infection in the spikes of hexaploid wheat (Triticum aestivum). Genome
48:770–780
Zhou W, Eudes F, Laroche A (2006) Identification of differentially regulated proteins in response
to a compatible interaction between the pathogen Fusarium graminearum and its host, Triticum
aestivum. Proteomics 6:4599–4609
Zhu H, Gilchrist L, Hayes P, Kleinhofs A, Kudrna D, Liu Z et al (1999) Does function follow
form? Principal QTLs for Fusarium head blight (FHB) resistance are coincident with QTLs for
inflorescence traits and plant height in a doubled-haploid population of barley. Theor Appl
Genet 99:1221–1232
Zhuang Y, Gala A, Yen Y (2013) Identification of functional genic components of major Fusarium
head blight resistance quantitative trait loci in wheat cultivar Sumai 3. Mol Plant Microbe
Chapter 11
Pseudomonas fluorescens: A Potential
Biocontrol Agent for Management of Fungal
Diseases of Crop Plants
D. Majumder, J.D. Kongbrailatpam, E.G. Suting,

B. Kangjam, and D. Lyngdoh
11.1 Introduction
Rhizosphere region of the soil is inhabited by the large number of microorganisms

having potential to promote plant growth, yield, and also to provide protection against
diseases by suppressing pathogenic microorganisms. Several biologically important
processes and interactions take place in the region which is primarily due to the influx
of mineral nutrients from accumulation of plant root exudates. Rhizospheric micro-
organisms have the ability to solubilize the insoluble phosphates and maintain the
soil health and quality. Interest in biological control of plant pathogens has been
stimulated in recent years. Several bacteria belonging to the genera Bacillus and
Pseudomonas have been intensively investigated as biocontrol agents primarily due
to their ability to produce antimicrobial metabolites and ecological fitness in soil
(Shanahan et al. 1992; Nielsen et al. 2000). Fluorescent pseudomonads are often
predominant among plant rhizosphere-associated bacteria (Glick et al. 1995), make
up a diverse group that can be visually distinguish from other Pseudomonas by their
ability to produce a water-soluble yellow green pigment and has been considered as
an important group due to their biofertilizing and biocontrol properties. The rhizo-
bacteria are found in large numbers in all the major natural environments viz. terres-
trial, freshwater, and marine and they also form intimate associations with plants and
animals. This universal distribution suggests a remarkable degree of physiological
and genetic adaptability (Spiers et al. 2005). They comprise Pseudomonas aerugi-
nosa, the type species of the genus, P. aureofaciens, P. chlororaphis, P. fluorescens,
P. putida, and the plant pathogenic species P. cichorii and P. syringae (Dwivedi and
Johri 2003). P. fluorescens becomes a promising biocontrol agent for its noble
D. Majumder, Ph.D. (*) • J.D. Kongbrailatpam, M.Sc. • E.G. Suting, M.Sc.

B. Kangjam, M.Sc. • D. Lyngdoh, M.Sc.
School of Crop Protection, College of Post Graduate Studies, Central Agricultural University,
Umroi Road, Umiam, Shillong, Meghalaya 793 103, India
e-mail: dipali_assam@yahoo.co.in

318 D. Majumder et al.
antagonistic property against a wide variety of phytopathogenic fungi and bacteria.

Beneficial effect of P. fluorescens on plant also account for plant growth promotion.
Selective strains of fluorescent pseudomonads have also been reported for biodegra-
dation of agricultural pollutants and for weed control in agricultural fields as bioin-
oculants (Ramamoorthy et al. 2001; Sunish et al. 2005). In recent years, fluorescent
pseudomonads isolated from rhizosphere of several crops have drawn attention
worldwide owing to the ability of production of secondary metabolites such as anti-
biotics, volatile compounds, hydrogen cyanide (HCN), siderophores, cell wall-
degrading enzymes, and phytohormones (Bakker and Schippers 1987; O’Sullivan
and O’Gara 1992; Nielsen et al. 2000). Pseudomonads are aggressive colonizers of
the rhizosphere of various crop plants, and have a broad spectrum antagonistic activ-
ity against different group of plant pathogens. Plant pathologists have been enthralled
by the idea that antagonistic microorganisms could be used as environment friendly
biocontrol agents, both in the field and in greenhouses. However, as noted by Garrett
et al. (1965) that there were no shortcuts to biological control.
11.2 Genus Pseudomonas
Pseudomonads are rod-shaped Gram-negative bacteria that are characterized by

metabolic versatility, are oxidase positive with aerobic respiration (some strains
also have anaerobic respiration with nitrate as the terminal electron acceptor and/or
arginine fermentation), and are motile owing to one or several polar flagella. They
are ubiquitous in nature and belong to the Pseudomonadaceae family (subclass:
γ-Proteobacteria; order: Pseudomonadales). Pseudomonads have simple nutritional
requirements, and this is reflected by the relative abundance of these organisms in
nature. They are found in soils, foliage, fresh water, sediments, and sea water. The
genus Pseudomonas includes mostly fluorescent pseudomonads as well as a few
non-fluorescent species. Fluorescent Pseudomonas group represents: (1) phyto-
pathogenic cytochrome c oxidase-positive species, such as P. cichorii, P. margina-
lis, and P. tolaasii; (2) non-phytopathogenic, non-necrogenic strains, such as
P. fluorescens, P. putida, P. chlororaphis, P. aureofaciens, and P. aeruginosa type
species; (3) phytopathogenic necrogenic fluorescent Pseudomonas spp. without
cytochrome c oxidase: P. syringae and P. viridiflava. Non-fluorescent Pseudomonas
group constitutes P. stutzeri, P. mendocina, P. alcaligenes, and P. pseudoalcaligenes
(Palleroni 1984; Holt et al. 1994; Bossis et al. 2000).
Fluorescent pseudomonads are the most studied group within the genus
Pseudomonas that can generally be visually distinguished from other pseudomonads
by their ability to produce a water-soluble yellow-green pigment in culture media.
All fluorescent pseudomonads fall into one of the five rRNA group (Palleroni et al.
1973). The Guanine + Cytosine (G + C) content of their DNA ranges from 58 to 68 %
(Palleroni 1975). Pseudomonas is characterized by their ability to grow in simple
media at the expense of a great variety of simple organic compounds, without need-
ing organic growth factors. King’s medium B (KMB) is an optimal medium for isola-
tion of most species of Pseudomonas (King et al. 1954). The optimum temperature
11 Pseudomonas fluorescens: A Potential Biocontrol Agent... 319
for growth is between 25 and 30° C. As a group, the fluorescent pseudomonads are
of primary significance in diverse areas such as animal pathogenicity, plant pathoge-
nicity, food spoilage, and biological control.
11.3 Mechanisms of Biocontrol by P. fluorescens
Fluorescent pseudomonads have emerged as the largest and potentially the most
promising group of biocontrol agent as well as PGPR with their rapid growth, sim-
ple nutritional requirements, ability to utilize diverse organic substrates, and mobil-
ity. Several basic mechanisms of the bacterial-induced biocontrol, particularly
concerning the Pseudomonas genus are antibiosis, fungistasis, competition for
nutrients, modification of the biophysical root environment, active exclusion of
pathogenic organisms from the rhizosphere, detoxification of pathogen virulence
factors, and the induction of plant disease resistance (Bakker and Schippers 1987;
O’Sullivan and O’Gara 1992; Nielsen et al. 2000 and Daval et al. 2011). The fluo-
rescent pseudomonads also antagonize plant pathogens by producing a range of
metabolites like siderophores and other substances such as cyanide (O’Sullivan and
O’Gara 1992). They are aggressive colonizers of the rhizosphere of various crop
plants, and have a broad spectrum antagonistic activity against different group of
plant pathogens. Different mechanisms such as accumulation of phenolic com-
pounds, pathogenesis-related proteins (PR-proteins), lysis of cell wall of the fungal
pathogen, and secretion of extracellular lytic enzymes also lead to reduction of plant
diseases (O’Sullivan and O’Gara 1992; Saikia et al. 2004). Antagonistic potentiality
can be exploited successfully against plant pathogens. So far, several strains of
P. fluorescens have been exploited for the management of several soil-borne dis-
eases. The different diverse mechanisms of biocontrol include the following:
1. Antibiotic-mediated suppression
2. HCN production
3. Siderophores production
4. Competition for space and nutrients
5. Production of plant growth promoting substances (PGPS)
6. Mineral phosphate solubilization (MPS)
7. Induced systemic resistance
11.3.1 Antibiotic-Mediated Suppression
Antibiotic production has been recognized as an important trait in the biological

control of plant diseases by fluorescent pseudomonads (Gurusiddaiah et al. 1986;
Homma and Suzui 1989) and has been known for over 150 years. Advances
within the past 2 decades have provided new insight to the diversity of antibiotics
produced, regulation of synthesis, mode of action, and their functional roles.
Compounds important for biological control of plant pathogens, such as phenazines
(Thomashow and Weller 1988), pyoluteorin (Howell and Stipanovic 1980), pyrrolnitrin
(Howell and Stipanovic 1979), tropolone (Lindberg 1981), pyocyanin (Dahiya et al.
1988), and 2,4-diacetylphloroglucinol (Shanahan et al. 1992) have been isolated
from rhizospheric fluorescent pseudomonads. Naik et al. (2008) successfully
screened P. fluorescens isolates using pyrrolnitrin gene-specific primers which dur-
ing successive studies showed antagonistic effects against several fungal plant
pathogens including Pyricularia grisea, Fusarium oxysporum f. sp. cubense,
Macrophomina phaseolina, Colletotrichum falcatum, and C. Capsici. Homma and
Suzui (1989) correlated antibiotic production (purified pyrrolnitrin and pyoluteorin)
with disease suppression. Similarly DAPG, the antibiotic compound produced by
fluorescent pseudomonad, was found effective to suppress plant pathogens
(Shanahan et al. 1992). Hill et al. (1994) also correlated pyrrolnitrin synthesis by
P. fluorescens BL915 with biological control activity against Rhizoctonia solani-
incited disease of cotton. Antibiotic production indicated the involvement of DAPG,
pyrrolnitrin, and pyoluteorin in the natural antagonism between P. fluorescens and
pathogens (Rosales et al. 1995; El-Banna and Winkelmann 1998; Haas and Keel
2003; Brodhajen et al. 2005).
11.3.1.1 Screening of P. fluorescens Based on Amplification by Antibiotic

Biosynthetic Gene-Specific Primers
Different antibiotics have been found to be associated with inhibition of pathogen

growth by fluorescent pseudomonads. The biosynthetic genes for phenazine-1-
carboxylic acid (PCA), 2,4-DAPG, pyrrolnitrin, pyoluteorin, and the zwittermicin
(a self-resistance gene) have been sequenced (Hammer et al. 1997; Nowak-Thompson
et al. 1999; Stohl et al. 1999; Mavrodi et al. 1998; Bangera and Thomashow 1996).
Sequencing has enabled PCR-based detection of antibiotic-producing strains
(Bangera and Thomashow 1999; de Souza and Raaijmakers 2003; Raaijmakers et al.
1997; McSpadden Gardener et al. 2001; Raffel et al. 1996; Picard et al. 2000).
Svercel et al. (2007) selected strains of Pseudomonas spp. through PCR-RFLP
analysis that produced DAPG and HCN in Phl– HCN+. Zhang et al. (2006) used
thirty primers to amplify antibiotic biosynthetic genes encoding phenazine-1-
carboxylic acid, 2,4-diacetylphloroglucinol, pyoluteorin, pyrrolnitrin, the zwitter-
micin in P. chlororaphis PA23, Pseudomonas spp. strain DF41, and Bacillus
amyloliquefaciens BS6 (Table 11.1). The presence of antibiotic biosynthetic or self-
resistance genes in rhizobacterial strains can be investigated with polymerase chain
reaction and by Southern blotting.
11.3.2 HCN Production
HCN produced by rhizobacteria plays a role in biological control of phytopathogens

(Voisard et al. 1989; Defago et al. 1990). HCN inhibits the electron transport there
by the energy supply to the cell gets disturbed resulting in death of the organism.
11
Table 11.1 Polymerase chain reaction primers and amplification products from genes encoding enzymes involved in the biosynthesis of several antibiotics
(Data from Zhang et al. 2006)
Primer Sequence Gene (control strain) Expected size of PCR product
Phenazine
PHZ1a GGCGACATGGTCAACGG phzCD (P. fluorescens 2-79) 1,400 bp (PA23)
PHZ2a CGGCTGGCGGCGTATAT phzCD (P. fluorescens 2-79) 1,400 bp (PA23)
PCA2ab TTGCCAAGCCTCGCTCCAAC phzCD (P. fluorescens 2-79) 1,400 bp (not detected)
PCA3bb CCGCGTTGTTCCTCGTTCAT phzCD (P. fluorescens 2-79) 1,400 bp (not detected)
2,4-Diacetylphloroglucinol
Phl2ac GAGGACGTCGAAGACCACCA phlD (P. fluorescens CHA0; Pf-5; 745 bp (not detected)
Q8r1l-96; 1 M1-96; Q2-87)
Phl2bc ACCGCAGCATCGTGTATGAG phlD 745 bp (not detected)
BPF2d ACATCGTGCACCGGTTTCATGATG phlD ~470 bp (not detected)
B2BFd ACCCACCGCAGCATCGTTTATGAGC phlD ~470 bp (not detected)
BPF3d ACTTGATCAATGACCTGGGCCTGC phlD ~470 bp (PA23)
BPR2d GAGCGCAATGTTGATTGAAGGTCTC phlD ~470 bp (PA23)
BPR3d GGTGCGACATCTTTAATGGAGTTC phlD ~470 bp (PA23)
Pseudomonas fluorescens: A Potential Biocontrol Agent...
BPR4d CCGCCGGTATGGAAGATGAAAAAGTC phlD ~470 bp (PA23)

Pyrrolnitrin
PrnAFe GTGTTCTTCGACTTCCTCGG prnA (P. fluorescens Pf-5) 1,050 bp (PA23)
PrnARe TGCCGGTTCGCGAGCCAGA prnA (P. fluorescens Pf-5) 1,050 bp (PA23)
PRND1f GGGGCGGGCCGTGGTGATGGA prnD P. fluorescens BL915; 790 bp (PA23)
PRND2f YCCCGCSGCCTGYCTGGTCTG prnD P. fluorescens BL915; 720 bp (PA23)
PrnCfg CCACAAGCCCGGCCAGGAGC prnC (P. fluorescens BL915) 720 bp (PA23)
PrnCrg GAGAAGAGCGGGTCGATGAAGCC prnC (P. fluorescens BL915) 720 bp (PA23)
(continued)
321
322
Primer Sequence Gene (control strain) Expected size of PCR product

Pyoluteorin
PltCreg1Fe AGGCAATCACTACCATCCGTGCGC pltC (P. fluorescens Pf-5) 438 bp (not detected)
PltCreg2Re ATGAGGAGCAGGAGGTGTCGAGCAC pltC (P. fluorescens Pf-5) 438 bp (not detected)
PLTC1f AACAGATCGCCCCGGTACAGAACG pltC (P. fluorescens Pf-5) 438 bp (not detected)
PLTC2f AGGCCCGGACACTCAAGAAACTCG pltC (P. fluorescens Pf-5) 438 bp (not detected)
PltBfg CGGAGCATGGACCCCCAGC pltB (P. fluorescens Pf-5) 900 bp (PA23)
PltBrg GTGCCCGATATTGGTCTTGACC pltB (P. fluorescens Pf-5) 900 bp (PA23)
plt1g ACTAAACACCCAGTCGAAGG pltB (P. fluorescens Pf-5) 440 bp (not detected)
plt2g AGGTAATCCATGCCCAGC plt B (P. fluorescens Pf-5) 440 bp (not detected)
D. Majumder et al.
Cyanide ions are metabolized mainly to thiocyanate. The cyanide ion is exhaled as
HCN and metabolized to lesser degree to other compounds. It inhibits proper func-
tioning of enzymes as well as natural receptors by reversible mechanism of inhibi-
tion (Corbett 1974). HCN also inhibits the action of cytochrome oxidase (Gehring
et al. 1993). Voisard et al. (1989) reported cyanide production by P. fluorescens
which helped in suppression of black root rot (Thielaviopsis basicola) of tobacco.
HCN mutant (obtained by insertional inactivation) of the wild type strain had lost its
ability to suppress black root rot of tobacco was also reported. Haas et al. (1991)
also reported the role of HCN in biocontrol of take-all (G. graminis var. tritici) dis-
ease of wheat. P. fluorescens inhibited pathogens by inducing host defense.
Production of HCN by certain fluorescent Pseudomonas resulted in suppression of
root pathogens (O’Sullivan and O’Gara 1992). Ramette et al. (2003) reported that
HCN involved in biological control of root diseases is produced by many plant-
associated fluorescent pseudomonads. Ahmad et al. (2006) screened total of 72 rhi-
zobacterial isolates in vitro for different traits like production of IAA, NH3, HCN,
siderophore, phosphate solubility, and antifungal activity. Production of IAA and
HCN were found highest in Pseudomonas spp., followed by other isolates. Role of
HCN and pyocyanin of other fluorescent pseudomonads on the antifungal activity
have also been reported by Hassanein et al. (2009) for F. oxysporum and H. oryzae,
while Aspergillus niger was not affected. HCN synthase is encoded by three biosyn-
thetic genes viz. hcnA, hcnB, and hcnC (Ramette et al. 2003). However, little is
known about the diversity of these genes in fluorescent Pseudomonas sp. and other
bacteria. But, Bakker and Schippers (1987) suspected that HCN production by
some fluorescent pseudomonads might in fact be detrimental to plant growth.
11.3.3 Siderophores
Siderophores (Gr. “iron-bearers”) are low molecular weight compound synthesized

under iron-deficient concentration by many microorganisms, high affinity ferric-iron
chelators that transport iron into the bacterial cell (Mukherjee et al. 2004) via spe-
cific outer membrane receptor proteins, thereby providing iron for cellular functions
(Leong 1986; Loper and Buyer 1991). Siderophores chelate ferric ions with a high
specific activity and serve as vehicles for the transport of ferric iron into microbial
cells (Neilands 1981). Transport of iron into the cells is mediated by a membrane
receptor that specifically recognizes ferric-siderophore complex (Hemming 1986).
Buyer et al. (1986) found that the fluorescent pseudomonads produced yellow green
fluorescent siderophores (pyoverdine type) under low iron condition membrane
receptor proteins that recognize and take up ferric-pseudobactin complex (Magazin
et al. 1986). Siderophore sequesters the trace amount of iron (Fe++) from the rhizo-
sphere and thereby limits the availability of Fe++ to the pathogens and ultimately
suppresses the pathogen growth (Schroth and Hancock 1981). Siderophore produc-
tion was postulated to be an important mechanism for the biocontrol activity of PGPR
(Neilands 1986; Loper and Buyer 1991; Bakker et al. 1993). Suryakala et al. (2004)
reported that isolates belonging to P. fluorescens were reported to produce extracel-

lular siderophore when grown under iron-deficient condition. This siderophore is
responsible for the fluorescence of P. fluorescens. When iron concentrations are high,
pyoverdine is not needed so colonies will not fluoresce under ultraviolet light.
Unnamalai and Gnanamanickam (1984) reported that P. fluorescens could inhibit the
growth of X. campestris pv. citri and correlated the antagonism to the production of
siderophore. Similarly Elad and Baker (1985) reported that siderophore of fluores-
cent pseudomonads could suppress the chlamydospores germination of F. oxyspo-
rum in a trace iron condition. Observation of siderophore activity was also made by
Becker and Cook (1988) and noted that it inhibits the growth of Pythium ultimum
and other Pythium spp. in the wheat rhizosphere. Ciampi et al. (1997) observed that
Pf strain BC 8 produced siderophore like pigmented metabolites, which inhibited the
growth of R. solanacearum in vitro.
11.3.4 Competition for Space and Nutrients
Rhizosphere competence is a key character of fluorescent pseudomonads, since it

determines root colonization potential, competitive ability, and sustenance in the
crowded rhizosphere environment. Weller et al. (1985) found out that pseudomo-
nads catabolize diverse nutrients and have a fast generation time in the root zone.
Hence, they were projected as logical candidate for biocontrol by competition for
nutrients against slow growing plant pathogenic fungi. Similar opinion was also
made by Bull et al. (1991) and stated that suppression of take-all of wheat was cor-
related with colonization of roots by P. fluorescens strain 2-79. Genetic work of
Anderson et al. (1988) revealed that production of a particular plant glycoprotein
called agglutinin was correlated with potential of P. putida to colonize the root sys-
tem. P. putida mutants deficient in this ability exhibited reduced capacity to colo-
nize the rhizosphere and a corresponding reduction in Fusarium wilt suppression in
cucumber (Tari and Anderson 1988). Mohamed and Caunter (1995) observed
P. fluorescens to inhibit Bipolaris maydis both in vitro and in vivo in infected maize
plants but could not detect any inhibitory substances, assayed by a variety of meth-
ods, indicating nutrient competition as the operative component of antagonism.
11.3.5 Mineral Phosphate Solubilization
Phosphorus is one of the major nutrients, second only to nitrogen in requirement for
plants. Most of phosphorus in soil is present in the form of insoluble phosphates and
cannot be utilized by the plants (Pradhan and Sukla 2006). The biological process
of conversion of unavailable/fixed form of inorganic phosphorous into primary
orthophosphate (H2PO4¯) and secondary orthophosphate (HPO4¯2) is termed as MPS
(Goldstein 1986). Stalstorm (1903) first showed the involvement of microorganisms
in the solubilization of insoluble phosphate.
Indian soils are normally deficient in available phosphorus (Johri et al. 2003).
To circumvent the phosphorus deficiency, phosphate solubilizing microorganisms
play an important role in supplying phosphate to plants in a more environment
friendly and sustainable manner. Among phosphate solubilizing bacteria, fluorescent
pseudomonads that colonize aggressively at the plant roots have been considered as
an important group of bacteria due to their biofertilizing, biocontrol, and its capabil-
ity of utilizing a wide array of compounds as carbon and energy sources. Fluorescent
pseudomonad species such as P. chlororaphis, P. putida, P. aeruginosa, P. fluores-
cens, P. trivialis, P. striata, and P. poae have been identified as phosphate solubilizing
rhizobacteria (Cattelan et al. 1999; Gaind and Gaur 2002; Bano and Musarrat 2003;
Sunish et al. 2005; Gulati et al. 2008). Pseudomonas fluorescens were recorded for
solubilization of ZnPO4 in the presence of glucose as the carbon source (Di Simine
et al. 1998). Phosphate solubilizing Pseudomonas sp. showed significant increase in
maize plant height after 60 days of growth and an 18 % increase in lettuce shoot fresh
matter yield observed in Quebec (Canada) (Chabot et al. 1993). Rhizobacteria can
solubilize rock phosphate and calcium phosphate in culture medium (Nahas 1996).
Cold-tolerant mutants of P. fluorescens were reported as more efficient in tricalcium
phosphate solubilization than their respective wild type counterparts at low tempera-
tures (Das et al. 2003). P. fluorescens strain Psd isolated from rhizosphere of Vigna
mungo was also found to solubilize complex phosphates and synthesize phytohor-
mone, IAA. In Iran fluorescent pseudomonads from rice rhizosphere reported for
significant phosphate solubilization activity in addition to plant growth promoting
properties, IAA and siderophore production (Ramezanpour et al. 2010). Among the
different organic acids, gluconic acid seems to be most commonly produced acid by
phosphate solubilizing Pseudomonas fluorescens (Di Simine et al. 1998)
11.3.6 Production of Plant Growth Promoting Substances
Plant growth promoting rhizobacteria (PGPR) were first defined by Kloepper and
Schroth (1978) as the soil bacteria that colonize the roots of plants by following
inoculation on to seed and that enhance plant growth. PGPR competitively colonize
plant roots, stimulate plant growth, and/or reduce the incidence of plant disease
(Kloepper and Schroth 1978). Improvement in plant growth due to the action of
PGPR include increase in germination rates, root growth, yield including grain, leaf
area, chlorophyll content, magnesium, nitrogen and protein content, hydraulic
activity, tolerance to drought and salt stress, shoot and root weights, and delayed
leaf senescence. Several mechanisms that involve in the process include phosphate
solubilization, production of phytohormones (such as auxin and cytokinin), volatile
growth stimulants (such as ethylene and 2,3-butanediol) and nitrogen fixation
(Lifshitz et al. 1987; Vessey 2003). PGPR might enhance plant growth by excluding
the so-called deleterious rhizobacteria, which are thought to inhibit plant growth
without causing root invasion and classical disease (Schroth and Hancock 1982).
Pseudomonads make up a dominant population in soil and rhizosphere and exert
Table 11.2 Pseudomonas mediated induced systemic resistance in plant species investigated
against fungal pathogens
Plant Disease
species Strain Challenging pathogens symptoms Reference
Bean Pseudomonas Botrytis cinerea Grey mold De Meyer and
aeruginosa 7NSK2 Hofte (1997)
Cucumber Pseudomonas C. orbiculare Anthracnose Wei et al.
aureofaciens 25-33 (1991)
Pseudomonas Pythium Crown rot Chen et al.
corrugata 13 aphanidermatum (2000)
Radish P. fluorescens WCS374 F. oxysporum raphani Vascular wilt Leeman et al.
P. fluorescens WCS417 Alternaria brassicicola Necrotic (1995)
lesions Ton et al. (2002)
Tomato P. fluorescens WCS417 F. oxysporum f. sp. Vascular wilt Duijff et al.
lycopersici (1998)
growth promoting influence on a variety of plant species on account of their strong

competitive behavior, colonization potential, and sustainability (Glick 1995). Most
of these nonpathogenic strains of Pseudomonas found in the rhizospheric soils have
multiple traits that make them well suited as PGPR (O’Sullivan and O’Gara 1992).
Fluorescent Pseudomonas GRC2 from potato rhizosphere showed a strong antag-
onistic effect against Macrophomina phaseolina, a charcoal rot pathogen of peanut.
Bacterization of peanut seeds with fluorescent Pseudomonas GRC2 resulted in
increased seed germination, early seedling growth, fresh nodule weight, grain yield,
and reduced charcoal rot disease of peanut in M. phaseolina-infested soil (Gupta
et al. 2002). The presence of Pseudomonas fluorescence inoculant in the combina-
tion of microbial fertilizer plays an effective role in stimulating yield and growth
traits of chickpea (Rokhzadi et al. 2008). Pseudomonas fluorescens B16 isolated
from the roots of graminaceous plants has been shown to colonize the roots of vari-
ous plants, and to increase the height, flower number, fruit number, and total fruit
weight of tomato plants (Minorsky 2008). Ten strains of rhizospheric fluorescent
pseudomonads isolated from the soils of bajra (Pennisetum glaucum), jowar
(Sorghum vulgare), rice (Oryza sativa) and maize (Zea mays) showed positive plant
growth promoting activity and were found to produce IAA, protease, siderophores,
and HCN and were also found to exhibit antagonistic activity against four test fungi
viz. Fusarium oxysporum, Curvularia lunata, Colletotrichum falcatum,
Macrophomina phaseolina in vitro (Suresh et al. 2010).
11.3.7 Induced Systemic Resistance
Some antagonistic PGPR elicit a phenomenon that is known as induced systemic

resistance (ISR) in the host plant (Table 11.2). ISR allows plants to withstand
pathogen attack to the leaves or roots, without offering total protection (Haas and
Defago 2005). ISR triggered by PGPR fortifies plant cell wall strength and alters
host physiology, metabolic responses, leading to enhanced synthesis of plant

defense chemicals against pathogens and/or abiotic stress factors. ISR was discov-
ered as a mode of action of disease suppression by PGPR Pseudomonas spp. inde-
pendently by two research groups (Van Peer et al. 1991; Wei et al. 1991). In tomato,
seed treatment with P. fluorescens strain 63–28 resulted in induced resistance
against Fusarium oxysporum f. sp. lycopersici by triggering the host to synthesize
more phenolic substances (M’Piga et al. 1997). In tomato and hot pepper, enhanced
resistance against invasion of Pythium was found due to induction of defense-
related enzymes involved in the phenyl propanoid pathway and also due to direct
antagonism and plant growth promotion by fluorescent pseudomonads
(Ramamoorthy et al. 2002). Fallahzadeh et al. (2009) evaluated fluorescent pseudo-
monads from cotton rhizosphere for induction of systemic resistance (ISR) against
bacterial blight of cotton. After inoculation with the pathogen, PO and PAL activity
of all Pseudomonas-treated plants drastically increased and level of infected area
on leaves lower down. Pseudomonas metabolite salicylic acid (SA) was suggested
to trigger induced resistance (Leeman et al. 1996; De Meyer and Hofte 1997;
Maurhofer et al. 1998) and SA has been mostly observed under iron-limited condi-
tions. ISR was also triggered by P. fluorescens EP1 against red rot caused by
Colletotrichum falcatum on sugarcane (182), P. fluorescens 63-28 against F. oxys-
porum f. sp. radicis-lycopersici on tomato and Pythium ultimum and F. oxysporum
f. sp. pisi on pea roots.
A recent study on bacterial inoculation of wheat roots with P. fluorescens
Pf29Arp strain reduced the development of Gaeumannomyces graminis var. tritici
(Ggt)-induced disease (Daval et al. 2011). The plant host glutathione-S-transferase
gene was induced by Ggt alone and up-regulated by Pf29Arp bacteria in interaction
with the pathogen. Finally the study concluded that Pf29Arp antagonism acts
through the alteration of fungal pathogenesis and probably through the activation of
host defenses (Daval et al. 2011).
11.3.8 Enzyme Activity of the Bacteria
P. fluorescens can produce hydrolytic enzymes, i.e., chitinases and β-1,3-glucanases

(Fridlender et al. 1993). P. fluorescens strain 114 is known for production of a prote-
ase with molecular weight of 47,000 Da which was stable in the pH range of 5–9 and
worked optimally between pH 6.5–10 (Hamamoto et al. 1994). Siddiqui et al. (2005)
also reported production of extracellular protease by P. fluorescens CHA0, a biocon-
trol factor with activity against the root-knot nematode Meloidogyne incognita. P.
fluorescens strain Pf-5 possesses many extracellular hydrolytic enzymes that degrade
polymers found in soil as well as hydrolases used on plant-derived carbohydrates.
These enzymes are also capable of degrading and using components of plant tissues
like hydrocarbon molecules, fatty acids, and oils (Paulsen et al. 2005). Pseudomonas
fluorescens KD strain reduces the activity level of the pectinase polygalacturonase (a
key pathogenicity factor) from Pythium ultimum on cucumber (Rezzonico et al.
2005). In contrast, P. fluorescens strains induce laccase activity, enzymes putatively

involved in the pathogenicity of Rhizoctonia solani (Crowe and Olsson 2001).
P. fluorescens produces viscosin which is a peptidolipid that enhances antivirality.
Pseudomonas GRC2, fluorescent Pseudomonas strain showed necrotrophic anti-
biosis in vitro against Macrophomina phaseolina and Sclerotinia sclerotiorum (Gupta
et al. 2001) Scanning electron photomicrographs of zone of interaction showed loss
of sclerotial integrity, hyphal shrivelling, mycelial and sclerotial deformities, and
hyphal lysis in M. phaseolina, whereas hyphal perforations, lysis and fragmentation,
were observed in case of S. sclerotiorum. It was observed that Pseudomonas GRC2
produced enzyme chitinase along with other secondary metabolites, antibiotic sub-
stances (unidentified), siderophores volatile compound HCN, and IAA.
11.4 Successful Antagonism by P. fluorescens
P. fluorescens is becoming a promising biocontrol agent for its noble antagonistic

property against a wide variety of phytopathogenic bacteria and fungi particularly
the soil-borne pathogens (Weller 1988). Sarathchandra et al. (1993) reported that
antagonists competed with pathogen for nutrients and thereby reduced diseases.
Biocontrol strains can also promote plant growth.
The usefulness of fluorescent Pseudomonas as biocontrol agent has attracted the
attention of researchers for its effectiveness to colonize the rhizosphere of many
crop plants with the ability to inhibit the growth of a number of phytopathogens.
Some examples are given below (Tables 11.3 and 11.4).
11.5 Genomic Sequence of Pseudomonas fluorescens:

Insight into Biological Control
Currently, two strains of P. fluorescens viz., P. fluorescens Pf-5 and P. fluorescens

PfO-1 have their genomes sequenced completely (Paulsen et al. 2005). P. fluores-
cens Pf-5 is a rhizosphere bacterium that suppresses seedling emergence diseases
and produces a spectrum of antibiotics toxic to plant-pathogenic fungi and oomyce-
tes. The genome of Pf-5 is the largest Pseudomonas genome sequenced (Loper et al.
2007) to date (including plant pathogens). Complete genome of P. fluorescens Pf-5
is 7.1 Mbp, a circular chromosome has GC content of 63.3 % with 6,144 predicted
genes. It contains 87 RNAs and 6,137 proteins. The study revealed that 5.7 % of its
genome contributes to secondary metabolism which is the largest of the Pseudomonas
(Paulsen et al. 2005). In addition to six known secondary metabolites produced by
Pf-5, three novel secondary metabolite biosynthesis gene clusters identified in the
genome could also contribute to biological control.
Table 11.3 Effect of fluorescent pseudomonads against fungal pathogens of crop plants
Sl. No. Pseudomonas strains Name of the disease Fungal pathogen References
1. P. fluorescens Stem canker potato seeds bacterization R. solani Burr et al. (1978)
2. P. fluorescens strain Pf-5 Seedling diseases of cotton R. solani, P. ultimum Howell and Stipanovic (1979),
Howell and Stipanovic (1980)
3. P. fluorescens Black root rot of tobacco Thielaviopsis basicola Voisard et al. (1989)
4. Pseudomonas fluorescens Pf-5 Pythium damping off of cucumber Pythium spp. Kraus and Loper (1992)
5. P. fluorescens Tan spot of wheat Pyrenophora tritici-repentis Pfender et al. (1993)
6. P. fluorescens Fusarium wilt in radish F. oxysporum f. sp. raphani Leeman et al. (1995)
7. P. fluorescens strain Pf-5 Fusarium crown and root rot of tomato F. oxysporum f. sp. radicis-lycopersici Sharifi-Tehrani et al. (1998)
8. P. fluorescens Downy mildew in pearl millet Sclerospora graminicola Umesha et al. (1998)
9. P. fluorescens PF-1 Banded leaf and sheath blight of maize R. solani f. sp. sasakii Sivakumar et al. (2000)
10. P. fluorescens Sheath blight of maize R. solani Tripathi and Joshi (2002)
11. P. fluorescens IISR-51 Foot rot of black pepper P. capsici Diby et al. (2004)
12. Pseudomonas culture Damping off in tomato P. aphanidermatum Martin and Loper (1999);
Srivastava et al. (2004)
13. P. fluorescens (in combination with Stem rot of groundnut Sclerotium rolfsii Manjula et al. (2004)
T. viride)
14. P. fluorescens Wilt of citrange troyer plant F. solani and Phoma tracheiphila Cirvilleri et al. (2005)
15 Six isolates of fluorescent Wilt disease of pea complex F. oxysporum f. sp. pisi Siddiqui et al. (2005)
pseudomonads
16. Fluorescent pseudomonads White mould S. sclerotiorum Behboudi et al. (2005)
17. P. fluorescens Root and stem end rot of chick pea Macrophomina phaseolina Kumar et al. (2007)
18. P. fluorescens Biotype F isolate DF37 Wilt of potato Verticillium albo-atrum Uppal et al. (2008)
(continued)
Sl. No. Pseudomonas strains Name of the disease Fungal pathogen References
19. P. fluorescens Sheath blight of rice R. solani Singh and Sinha (2009)
20. Pseudomonas spp. FC-7B, FC-9B, Wilt of tomato F. oxysporum f. sp. lycopersici Srinivasan et al. (2009)
and FC-24B together with
Achromobacter sp. AM1 and
Serratia sp. DM1
21. P. fluorescens Rice fungal pathogen R. solani Battu and Reddy (2009)
22. P. fluorescens Rice blast and sheath blight P. oryzae and R. solani Reddy and Reddy (2009)
23. P. fluorescens Sheath blight of rice R. solani Singh and Sinha (2009)
24. Endophytic P. fluorescens strains EBC5, Damping-off of chilli P. aphanidermatum Muthukumar et al. (2010)
EBC7, and EBC6
25. Pseudomonas strain PCI2 Damping-off of tomato S. rolfsii Pastor et al. (2010)
26. P. fluorescens strain Pf29Arp Take-all disease of wheat Gaeumannomyces graminis Daval et al. (2011)
var. tritici
Table 11.4 Effect of fluorescent pseudomonads against bacterial pathogens of crop plants
Sl. No. Pseudomonas strains Name of the disease Bacterial pathogen References
1. P. fluorescens Banana, brinjal, and tomato R. solanacearum Chand and Logan (1984)
2. P. fluorescens strain Pf-5 Seed piece decay of potato E. carotovora Xu and Gross (1986)
3. P. fluorescens Wilt of tomato R. solanacearum Kalita (1994)
4. P. fluorescens Wilt of tomato R. solanacearum Karuna and Khan (199)
P. fluorescens Bacterial wilt disease in tomato R. solanacearum Kumar and Sood (2001)
5. P. fluorescens Bacterial blight of rice X. oryzae pv. oryzae Vidhyasekaran et al. (2001)
6. Fluorescent Pseudomonas strains Tomato bacterial spot X. vesicatoria Shukla and Gupta (2005)
7. P. fluorescens Bacterial wilt in chilli R. solanacearum Umesha et al. (2005)
8. P. fluorescens strain PfG32R Bacterial wilt of tomato R. solanacearum Alit-Susanta and Takikawa (2006)
9. P. fluorescens Eggplant R. solanacearum Ramesh et al. (2009)
10. P. fluorescens Pf 32, Pf93 Bacterial blight of cotton X. campestris pv. malvacearum Salaheddin et al. (2010)
11. P. fluorescens Bacterial blight and leaf spots X. campestris pv. malvacearum, Bhattiprolu (2010)
diseases of cotton X. vesicatoria
12. P. fluorescens Wilt of tomato R. solanacearum Bora et al. (2010)
13. Endophytic P. fluorescens strain PF-1 Black rot of cauliflower X. campestris pv. campesteris Singh et al. (2010)
The genomic sequence provides numerous information regarding catabolic and

transport capabilities for utilizing seed and root exudates; an expanded collection of
efflux systems for defense against environmental stress and microbial competition
and the presence of 45 outer membrane receptors that should allow for the uptake of
iron from a wide array of siderophores produced by soil microorganisms. Pf-5 has
an extensive collection of regulatory genes, as expected for a large genome bacte-
rium that lives in a rapidly changing environment. Only some of which have been
characterized for their roles in regulation of secondary metabolite production or
biological control in turn (Loper et al. 2007). Brief overview of the general features
of the Pf-5 genomic sequence (Loper et al. 2007) data discussed below:
Attachment: The Pf-5 genome contains several genes that have been implicated in
the attachment of Pseudomonas spp. to surfaces, including genes encoding for pre-
dicted hemagglutinins, hemolysins, and other adhesion-related proteins.
Environmental fitness: Pf-5 has the capacity to colonize seed and root surfaces, for
acquisition of diverse compounds for nutrition, attachment to surfaces, as well as
defense from environmental stress and rhizospheric microbial competition.
Catabolism: Genomic sequence of Pf-5 specifies a broad metabolic capacity that
is shared with other species of Pseudomonas and is consistent with a saprophytic
lifestyle in soil (dos Santos et al. 2004). The Pf-5 genome contains genes encod-
ing for utilization of a broad spectrum of organic acids, sugars, and amino acids,
including those typically found in seed or root exudates. The Pf-5 genome has
also genes for the metabolism of a number of plant-derived carbohydrates such
as maltose, sucrose, trehalose, and xylose. Presence of genes for utilization of
more complex plant-derived molecules such as the aromatic compounds vanil-
late, benzoate, and hydroxybenzoate, long chain fatty acids, and hydrocarbons
also observed.
Rhizosphere colonization: Rhizosphere competence of P. fluorescens is governed by
genes and presence of which was detected in P. fluorescens strain Q8r1-96 but absent
in a less rhizosphere competent strain as detected by subtractive hybridization
(Mavrodi et al. 2002). The putative rhizosphere competence genes identified in that
study were not present in P. fluorescens Pf-5 (Paulsen et al. 2005). Moreover, the
population size established by Pf-5 in the rhizosphere of pea or wheat was neither as
large nor as persistent as populations established by the most rhizosphere competent
strains of P. fluorescens, as represented by strain Q8r1-96 (Landa et al. 2002, 2003).
Siderophore-mediated iron acquisition: Plant pathogens are subject to iron competi-
tion by siderophore-producing biological control agents (Loper and Buyer 1991)
such as Pf-5. The Pf-5 genome specifies the biosynthesis of two siderophores—
pyoverdine and pyochelin (or related compounds). Genes required for pyoverdine
biosynthesis and uptake are organized in three gene clusters in the Pf-5 genome
(Ravel and Cornelis 2003). A putative pyochelin biosynthesis gene cluster is present
in the Pf-5 genome, although its organization differs from the well-characterized
pyochelin gene cluster of P. aeruginosa (Michel et al. 2005). Genes encoding outer
membrane receptors for 20–30 heterologous siderophores exist in the genomes of

all Pseudomonas spp. sequenced to date. In Pf-5 genome 45 genes predicted to
encode outer membrane proteins that bind the transmembrane protein TonB, a char-
acteristic of ferric siderophore receptors. Outer membrane receptors allow Pf-5 to
utilize a wide array of siderophores produced by soil microorganisms.
Self-defense: Genomic sequence of Pf-5 reveals an expanded collection of efflux
systems, which typically confer protection against a range of toxic metabolites.
Within the genome of Pf-5, 13 regions contain resistance-nodulation-cell division
(RND) homologs, with neighboring genes encoding partner proteins of the efflux
systems. Other genes are predicted to confer resistance to specific toxins, including
tabtoxin, a phytotoxin produced by P. syringae pv. tabaci, and fusaric acid, a toxin
produced by the soil-borne plant pathogen F. oxysporum that serves as a signal
repressing the production of 2,4 diacetylphloroglucinol by P. fluorescens CHA0
(Notz et al. 2002).
Secondary metabolites and other secreted products: Based on the sizes of the nine
biosynthetic genes clusters identified to date, it has been revealed that approxi-
mately 6 % of the Pf-5 genome is devoted to the production of secondary metabo-
lites. The nine gene clusters are distributed over a large portion of the genome. Six
of the gene clusters encode for the biosynthesis of compounds that were known to
be produced by Pf-5 before the genomic sequencing project was initiated (Loper
et al. 2007). Gene clusters for three other secondary metabolites were identified in
the genome of Pf-5 based upon characteristic sequences of polyketide or peptide
synthases. These enzymes catalyze the formation of secondary metabolites through
a non-ribosomal mechanism of biosynthesis (Wenzel and Muller 2005). Enzymes
involved in biosynthesis of these secondary metabolites have characteristic func-
tional domains. These domains are encoded by highly conserved sequences that can
be used to identify biosynthetic gene clusters containing polyketide or peptide syn-
thases. This approach was used to identify three gene clusters in the Pf-5 genome
that presumably encode for secondary metabolites. The three metabolites discov-
ered through genomic sequencing have not yet been characterized with respect to
their toxicities to plant pathogens or their roles in biological control. Their discov-
ery provides new directions for research evaluating mechanisms of biological
control. In addition to secondary metabolites, Pf-5 produces other products, includ-
ing exoenzymes and at least one bacteriocin. Many of these products, such as an
extracellular alkaline protease, suppress the root-knot nematode Meloidogyne
incognita (Siddiqui et al. 2005).
Lack of key pathogenicity factors: Consistent with its commensal lifestyle, Pf-5
lacks a number of virulence factors found in plant pathogens. No evidence for a type
III secretion system was found in the genomic sequence of Pf-5, although genes for
these export systems have been found in other nonpathogenic strains of Pseudomonas
spp. (including P. fluorescens) associated with plants (Preston et al. 2001; Mazurier
et al. 2004; Rezzonico et al. 2005). There is no evidence in the Pf-5 genome for the
biosynthesis of the known P. syringae phytotoxins, tabtoxin, syringomycin, syringo-
toxin, syringopeptin, or coronatine. Pf-5 lacks amylase, consistent with an inability

to utilize starch, and lacks cellulases and other exoenzymes often associated with
degradation of plant cell walls and cell wall components. Therefore, many genes
required for pathogenicity or virulence of plant or animal pathogens do not have
clear counterparts in the genome of this commensal bacterium.
As expected for a bacterium with a large genome that lives in a rapidly changing
environment, Pf-5 has an extensive collection of regulatory genes, only some of
which have been characterized for their roles in regulation of secondary metabolite
production or biological control. Consistent with its commensal lifestyle, Pf-5
appears to lack a number of virulence and pathogenicity factors found in plant
pathogens.
Pseudomonas fluorescens F113, a PGPR strain that has biocontrol activity
against fungal plant pathogens, is considered as a model for rhizosphere coloniza-
tion. Miguel Redondo-Nieto et al. (2012) presented complete genome sequence of
Pseudomonas fluorescens F113, which showed that besides a core genome very
similar to those of other strains sequenced within this species, F113 possesses a
wide array of genes encoding specialized functions for thriving in the rhizosphere
and interacting with eukaryotic organisms.
The genome of Pseudomonas fluorescens PfO-1 has one chromosome with
6.43841 Mbp and 60.5 % GC content. There are 95 RNAs and 5736 proteins. The
genome sequencing of P. fluorescens SBW25 is still in progress (http://www.ncbi.
nlm.nih.gov/entrez/query.fcgi). The genomic sequence available, coupled with
detailed knowledge of its biology provides a framework for distinguishing genes
governing growth, persistence, and activity of plant-associated bacteria.
11.6 Concluding Remarks
Fluorescent pseudomonads as biological control agent of plant pathogens gaining

importance in modern and organic agriculture as eco-friendly alternatives of chemi-
cals because it offers disease management with different mechanisms of action
unlike chemical pesticides. Although the number of biocontrol formulations is
increasing day by day, still it represents only about 1 % of agricultural chemicals.
Despite several studies on the complex regulatory gene network controlling the pro-
duction of effectors by rhizobacteria, very little information is available concerning
their effects on fungal pathogenicity and virulence. Very little is known about the
frequency and ecology of naturally occurring antibiotic-producing fluorescent
Pseudomonas spp. The availability of cloned and sequenced antibiotic-biosynthetic
genes has facilitated the development of specific primers and probes that can be
used to detect naturally occurring antibiotic-producing Pseudomonas spp. It can
also expedite the search for native antibiotic-producing strains that are better
adapted to local soil and environmental conditions and more effective in specific
crop-pathogen ecosystems. Sequencing the genome provided further information of
its environmental interaction and its metabolic capabilities, which can be used
against agricultural disease control. For attaining popularity and better commercial
application of biocontrol agents against plant pathogens, it requires increased
emphasis on combining various effective compatible strains of different antagonists
with each other and with other control methods as well as integration of biocontrol
into an overall system.
References
Ahmad F, Ahmad I, Khan NS (2006) Screening of free living rhizospheric bacteria for their
multiple plant growth promoting activities. Microbiol Res 163(2):173–181
Alit-Susanta WGN, Takikawa Y (2006) Phenotypic characterization of Pseudomonas fluorescens
PfG32R and its spontaneous gacS mutants and biocontrol activity against bacterial wilt disease
of tomato. J Genet Plant Pathol 72(3):168–175
Anderson AJ, Tari PH, Tepper CS (1988) Genetic studies on the role of an agglutinin in root colo-
nization by Pseudomonas putida. Appl Environ Microbiol 54:375–380
Bakker AW, Schippers B (1987) Microbial cyanide production in the rhizosphere in relation to
potato yield reduction and Pseudomonas spp. mediated plant growth stimulation. Soil Biochem
19:451–457
Bakker PAHM, Raaijamakers M, Schippers B (1993) Role of iron in the suppression of bacterial
plant pathogens by fluorescent pseudomonads. In: Barton LL, Hemming BC (eds) Iron chelat-
ing in plant and soil micro-organism. Academic, San Diego, pp 269–281
Bangera MG, Thomashaw LS (1996) Characterization of a genomiclocus required for synthesis of
the antibiotic 2,4-diacetylphloroglucinol by the biological control agent Pseudomonas fluores-
cens Q2-87. Mol Plant-Microb Interact 9:83–90
Bangera MG, Thomashow LS (1999) Identification and characterization of a gene cluster for
synthesis of the polyketide antibiotic 2,4-diacetylphloroglucinol from Pseudomonas fluores-
cens Q2-87. J Bacteriol 181:3155–3163
Bano N, Musarrat J (2003) Characterization of a new Pseudomonas aeruginosa strain NJ-15 as a
potential biocontrol agent. Curr Microbiol 46(5):324–328
Battu PR, Reddy MS (2009) Siderophore-mediated antibiosis of rhizobacterial fluorescent
Pseudomonads against rice fungal pathogens. Int J PharmTech Res 1(2):227–229
Becker JO, Cook RJ (1988) Role of siderophores in suppression of Pythium species and produc-
tion of increased growth response of wheat by fluorescent pseudomonads. Phytopathology
78:778–782
Behboudi K, Sharifi TA, Hedjaroude GA, Zad J, Mohammadi M, Rahimian H (2005) Effects of
fluorescent pseudomonads on Sclerotinia sclerotiorum, the causal agent of sunflower root rot.
Iranian J Agric Sci 36(4):791–803
Bhattiprolu SL (2010) Efficacy of Pseudomonas fluorescens against bacterial blight and leaf spot
diseases of cotton (Gossypium hirsutum). Indian J Agric Sci 80(3):235–237
Bossis E, Lemanceau P, Latour X, Garden L (2000) The taxonomy of Pseudomonas fluorescens
and Pseudomonas putida: current status and need for revision. Agronomie 20:51–63
Brodhajen M, Paulsen I, Loper JE (2005) Reciprocal regulation of pyoluteorin production with
membrane transporter gene expression in Pseudomonas fluorescens Pf-5. Appl Environ
Bull CT, Weller DM, Thomashow LS (1991) Relationship between root colonization and suppres-
sion of Gaeumannomyces graminis var. tritici by Pseudomonas fluorescens strain 2-79.
Burr TJ, Schroth MN, Suslow TV (1978) Increased potato yields by treatment of seed pieces with
specific strains of Pseudomonas fluorescens and Pseudomonas putida. Phytopathology
68:1377–1383
Buyer JS, Wright JM, Leong J (1986) Structure of pseudobactin A214, a siderophore from a bean-
deleterious Pseudomonas. Biochemistry 25:5492–5499
Cattelan AJ, Hartel PG, Furhmann JJ (1999) Screening for plant growth-promoting rhizobacteria
to promote early soybean growth. Soil Sci Soc Am J 63:1670–1680
Chabot R, Antoun H, Cescas M (1993) Stimulation de la croissance du maïset de la laitue romaine
par des microorganismesdissolvant le phosphoreinorganique. Can J Microbiol 39:941–947
Chand T, Logan C (1984) Antagonists and parasites of Rhizoctonia solani and their efficacy in
reducing stem canker of potato under controlled conditions. Trans Br Mycol Soc 38:107–112
Chen C, Belanger R, Benhamou N, Paulitz TC (2000) Defense enzymes induced in cucumber roots
by treatment with plant growth-promoting rhizobacteria (PGPR) and Pythium aphaniderma-
tum. Physiol Mol Plant Pathol 56:13–23
Ciampi PL, Burzio LO, Burzio LA (1997) Carriers for Pseudomonas fluorescens, antagonistic to
Pseudomonas (Ralstonia) solanacearum, causal agent of bacterial wilt. Fitopatologia 32(1):64–70
Cirvilleri G, Spina S, Scuderi G, Gentile A, Catara A (2005) Characterization of antagonistic root-
associated fluorescent Pseudomonads of transgenic and non-transgenic citrange troyer plants.
J Plant Pathol 87(3):179–186
Corbett JR (1974) Pesticide design. In: The biochemical mode of action of pesticides. Academic,
London, pp. 44–86
Crowe JD, Olsson S (2001) Induction of laccase activity in Rhizoctonia solani by antagonistic
Pseudomonas fluorescens strains and a range of chemical treatments. Appl Environ Microbiol
67:2088–2094
Dahiya JS, Woods DL, Tewari JP (1988) Control of Rhizoctonia solani, causal agent of brown
girdling root rot of rapeseed, by Pseudomonas fluorescens. Bot Bull Acad Sin 29:135–142
Das K, Katiyar V, Goel R (2003) P-solubilization potential of plant growth promoting Pseudomonas
mutant at low temperature. Microbiol Res 158:559–562
Daval S, Lebreton L, Gazengel K, Boutin M, Guillerm A, Sarniguet A (2011) The biocontrol bac-
terium Pseudomonas fluorescens Pf29Arp strain affects the pathogenesis-related gene expres-
sion of the take-all fungus Gaeumannomyces graminis var. tritici on wheat roots. Mol Plant
Pathol 12(9):839–854
De Meyer G, Hofte M (1997) Salicylic acid produced by the rhizobacterium Pseudomonas aeru-
ginosa 7NSK2 induces resistance to leaf infection by Botrytis cinerea on bean. Phytopathology
87:588–593
de Souza JT, Raaijmakers JM (2003) Polymorphisms within the prnD and pltC genes from pyr-
rolnitrin and pyoluteorin producing Pseudomonas and Burkholderia spp. FEMS Microbiol
Ecol 43:21–34
Defago G, Berling CH, Borger U, Keel C, Voisard C (1990) Suppression of black rot of tobacco by
a Pseudomonas strain: Potential Applications and Mechanisms. In: Cook RJ, Henis Y (eds)
Hornby D. Biological Control of Soil Borne Plant Pathogen, CAB International, pp 93–108
Di Simine CD, Sayer JA, Gadd GM (1998) Solubilization of zinc phosphate by a strain of
Pseudomonas fluorescens isolated from forest soil. Biol Fertil Soils 28:87–94
Diby P, Saju KA, Jisha PJ, Sarma YR, Kumar A, Anandaraj M (2004) Mycolytic enzymes produced
by Pseudomonas fluorescens and Trichoderma spp. against Phytophthora capsici, the foot rot
pathogen of black pepper (Piper nigrum L.). Ann Microbiol 55:129–133
dos Santos VAPM, Heim S, Moore ERB, Strätz M, Timmis KN (2004) Insights into the genomic
basis of niche specificity of Pseudomonas putida KT2440. Environ Microbiol 6:1264–1286
Duijff BJ, Pouhair D, Alivian C, Alabouvette C, Lemanceau P (1998) Implication of systemic
induced resistance in the suppression of Fusarium wilt of tomato by P. fluorescente WCS417r
and by non pathogenic Fusarium oxysporum by Fo47. Eur J Plant Pathol 104:903–910
Dwivedi D, Johri BN (2003) Antifungals from fluorescent pseudomonads: biosynthesis and regu-
lation. Curr Sci 85(12):1693–1702
Elad Y, Baker R (1985) The role of competition for iron and carbon in suppression of chlamydo-
spore germination of Fusarium sp. By Pseudomonas spp. Ecol Epidemiol 75:1053–1059
El-Banna N, Winkelmann G (1998) Pyrrolnitrin from Burkholderia cepacia: antibiotic activity
against fungi and novel activities against streptomyces. J Appl Microbiol 85:69–78
Fallahzadeh V, Ahmadzadeh M, Marefat A, Ghazanfary K (2009) Application of rhizobacteria for

induction of systemic resistance to bacterial blight of cotton caused by Xanthomonas campes-
tris pv. malvacearum using fluorescent pseudomonads of rhizosphere. J Plant Prot Res
49(4):416–42
Fridlender M, Inbar J, Chet I (1993) Biological control of soil borne plant pathogens by a
B 1,3-glucanase-producing Pseudomonas cepacia. Soil Biol Biochem 25:1211–1221
Gaind S, Gaur AC (2002) Impact of fly ash and phosphate solubilising bacteria on soybean produc-
tivity. Bioresour Technol 58:313–315
Garrett SD, Jackson RM, Katznelson H, Rovira AD (1965) Biocontrol mechanisms that operate in
the rhizosphere. In: Baker KF, Snyder WC (eds) Ecology of soil-borne plant pathogens: pre-
lude to biological control. University of California Press, Berkeley
Gehring PJ, Nolan RJ, Watanabe PG (1993) Solvents, fumigants and related compounds. In: Hayes
WJ, Laws ER (eds) Handbook of pesticide toxicology, vol 2. Academic, San Diego,
pp 646–649
Glick BR (1995) The enhancement of plant growth by free living bacteria. Can J Microbiol
41:109–117
Glick BR, Karaturovic DM, Newell PC (1995) A novel procedure for rapid isolation of plant
growth promoting pseudomonads. Can J Microbiol 41:533–536
Goldstein AH (1986) Bacterial solubilization of mineral phosphates: historical perspective and
future prospects. Am J Altern Agric 1:51–57
Gulati A, Rahli P, Pratibha V (2008) Characterization of phosphate solubilizing fluorescent pseu-
domonads from the rhizosphere of sea buckthorn growing in the cold deserts of Himalayas.
Gupta CP, Dubey RC, Kamng SC, Maheshwari DK (2001) Antibiosis-mediated necrotrophic
effect of Pseudomonas GRC2 against two fungal plant pathogens. Curr Sci 81(1):91–94
Gupta A, Meyer JM, Goel R (2002) Development of heavy metal resistant mutants of phosphate
solubilizing Pseudomonas sp. NBRI 4014 and their characterizaiton. Curr Microbiol 45:
323–327
Gurusiddaiah S, Weller MD, Sarkar A, Cook JR (1986) Characterization of an antibiotic produced
by a strain of Pseudomonas fluorescens inhibitory to Gaeumannomyces graminis var. tritici
and spp. Antimicrob Agents Chemother 29:488–495
Haas D, Defago G (2005) Biological control of soil borne pathogens by fluorescent Pseudomonads.
Nat Rev Microbiol 3:307–319
Haas D, Keel C (2003) Regulation of antibiotic production in root-colonizing Pseudomonas spp.
and relevance for biological control of plant disease. Annu Rev Phytopathol 41:117–153
Haas D, Keel C, Laville J, Maurhofer M, Oberhansli T, Schnider U, Voisard C, Wuthrich B, Defago
G (1991) Secondary metabolites of Pseudomonas fluorescens strain CHAO involved in the
suppression of root diseases. In: Hennecke H, Verma DPS (eds) Advances in molecular genet-
ics of plant-microbe interactions. Kluwer Academic, Dordrect
Hamamoto T, Kaned M, Horikoshi K, Kudo T (1994) Characterization of a protease from a
psychrotroph, Pseudomonas fluorescens 114. Appl Environ Microbiol 60:3878–3880
Hammer PE, Hill DS, Lam ST, Pee KH, Ligon JM (1997) Four genes from Pseudomonas fluores-
cens that present the biosynthesis of pyrrolnitrin. Appl Environ Microbiol 63:2147–2154
Hassanein WA, Awny NM, El-Mougith AA, Salah El-Dien SH (2009) The antagonistic activities
of some metabolites produced by Pseudomonas aeruginosa Sha8. J Appl Sci Res
5(4):404–414
Hemming BC (1986) Siderophore receptors of root colonizing Pseudomonas sp. J Plant Nutr
9:505–507
Hill DS, Stein JI, Torkewitz NR, Morse AM, Howell CR, Pachlatka JP, Becker JO, Ligon JM
(1994) Cloning of genes involved in the synthesis of pyrrolnitrin from Pseudomonas fluores-
cens and role of pyrrolnitrin synthesis in biological control of plant disease. Appl Environ
Holt JG, Krieg NR, Sneath PHA, Staley JT, Williams ST (1994) Bergey’s manual of determinative
bacteriology, 9th edn. Lippincott Williams & Wilkins, Baltimore
Homma Y, Suzui T (1989) Role of antibiotic production in suppression of radish dampingoff by

seed bacterization with Pseudomonas cepacia. Ann Phytopathol Soc Jpn 55:643–652
Howell CR, Stipanovic RD (1979) Control of Rhizoctonia solani on cotton seedlings with
Pseudomonas fluorescens and with an antibiotic produced by the bacterium. Phytopathology
69:480–482
Howell CR, Stipanovic RD (1980) Suppression of Pythium ultimum-induced damping off of
cotton seedling by Pseudomonas fluorescens and its antibiotic pyoluteorin. Phytopathology
70:712–715
Johri BN, Sharma A, Virdi JS (2003) Rhizobacterial diversity in India and its influence on soil and
plant health. Adv Biochem Eng Biotechnol 84:49–89
Kalita BC (1994) Epidemiology and management of bacterial wilt of tomato caused by
P. solanacearum (E.F. Smith). M.Sc. (Agri.). Thesis, Assam Agri. Univ, Jorhat, pp 49–50
Karuna K, Khan ANA (1994) Biological control of wilt of tomato caused by P. solanacearum
using antagonistic bacteria. Indian Phytopathol 47:326
King EO, Ward MK, Raney DE (1954) Two simple media for the demonstration of pyocyanin and
fluorescein. J Lab Clin Med 44:301–307
Kloepper JW, Schroth MN (1978) Plant growth promoting rhizobacteria on radish. In: Proceedings
of the fourth international conference on plant pathogenic bacteria, vol. 2. Station de Pathologie
Vegetale et Phytobacteriologie, INRA, Angers. pp 879–882
Kraus J, Loper JE (1992) Lack of evidence for a role of antifungal metabolite production by
Pseudomonas fluorescens Pf-5 in biological control of Pythium damping-off of cucumber.
Kumar P, Sood AK (2001) Integration of antagonistic rhizobacteria and soil solarization for the
management of bacterial wilt of tomato caused by Ralstonia solanacearum. Indian Phytopathol
54(1):12–15
Kumar V, Kumar A, Verma VC, Gond SK, Kharwar RN (2007) Induction of defense enzymes in
Pseudomonas fluorescens treated chickpea roots against Macrophomina phaseolina. Indian
Landa BB, Mavrodi OV, Raaijmakers JM, Mcspadden-Gardener BB, Thomashow LS, Weller DM
(2002) Differential ability of genotypes of 2,4- diacetylphloroglucinol-producing Pseudomonas
fluorescens strains to colonize the roots of pea plants. Appl Environ Microbiol 68:3226–3237
Landa BB, Mavrodi DM, Thomashow LS, Weller DM (2003) Interactions between strains of
2,4-diacetylphloroglucinol-producing Pseudomonas fluorescens in the rhizosphere of wheat.
Leeman M, Van Pelt JA, Hendrickx MJ, Scheffer RJ, Bakker PAHM, Schippers B (1995) Biocontrol
of Fusarium wilt of radish in commercial greenhouse trials by seed treatment with Pseudomonas
fluorescens WCS374. Phytopathology 85:1301–1305
Leeman M, Den Ouden FM, Van Pelt JA, Dirkx FPM, Steijl H, Bakker PAHM, Schippers B (1996)
Iron availability affects induction of systemic resistance against Fusarium wilt of radish by
Pseudomonas fluorescens. Phytopathology 86:149–155
Leong J (1986) Siderophores: their biochemistry and possible role in the biocontrol of plant patho-
gens. Annu Rev Phytopathol 24:187–209
Lifshitz R, Kloepper JW, Kozlowski M, Simonson C, Carlson J, Tipping EM, Zaleska I (1987)
Growth promotion of canola (rapeseed) seedlings by a strain of Pseudomonas putida under
gnotobiotic conditions. Can J Microbiol 33:390–395
Lindberg GD (1981) An antibiotic lethal to fungi. Plant Dis 65:680–683
Loper JE, Buyer JS (1991) Siderophores in microbial interactions on plant surfaces. Mol Plant
Loper JE, Kobayashi DY, Paulsen IT (2007) The genomic sequence of Pseudomonas fluorescens
Pf-5, insights into biological control. Phytopathology 97:233–238
porum f. sp. radicis-lycopersici in tomato plant treated with the endophytotic bacterium
Pseudomonas fluorescens strain 63-28. Mol Plant Pathol 50:301–320
Magazin MD, Moores JC, Leong J (1986) Cloning of gene coding for the outer membrane receptor
protein for ferric Pseudobactin, a siderophore from plant growth promoting Pseudomonas
strain. J Biol Chem 261:795–799
Manjula K, Krishna G, Kishore GAG, Singh SD (2004) Combined application of P. fluorescens
and Trichoderma viride has an improved biocontrol activity against stem rot in groundnut.
Plant Pathol J 20(1):75–80
Martin FN, Loper JE (1999) Soilborne plant diseases caused by Pythium spp.: Ecology, epidemiology,
and prospects for biological control. Crit. Rev. Plant Sci 18:111–181
Maurhofer M, Reimmann C, Schmidli-Sacherer P, Heeb S, Haas D, Défago G (1998) Salicylic acid
biosynthetic genes expressed in Pseudomonas fluorescens strain P3 improve the induction of
systemic resistance in tobacco against tobacco necrosis virus. Phytopathology 88:678–684
Mavrodi DV, Ksenzenko VN, Bonsall RF, Cook RJ, Boronin AM, Thomashow LS (1998) A seven-
gene locus for synthesis of phenazine-1-carboxylic acid by Pseudomonas fluorescens 2-79.
Mavrodi DV, Mavrodi OV, McSpadden-Gardener BB, Landa BB, Weller DM, Thomashow LS
(2002) Identification of differences in genome content among phlD-positive Pseudomonas
fluorescens strains by using PCR-based substractive hybridization. Appl Environ Microbiol
68:5170–5176
Mazurier S, Lemunier M, Siblot S, Mougel C, Lemanceau P (2004) Distribution and diversity of
type III secretion system-like genes in saprophytic and phytopathogenic fluorescent pseudomo-
nads. FEMS Microbiol Ecol 49:455–467
McSpadden Gardener BB, Mavrodi DV, Thomashow LS, Weller DM (2001) A rapid polymerase
chain reaction-based assay characterizing rhizosphere populations of 2,4-diacetylphloroglucinol-
producing bacteria. Phytopathology 91:44–54
Michel L, Gonzalez N, Jagdeep S, Nguyen-Ngoc T, Reimmann C (2005) PchR-box recognition by
the AraC-type regulator PchR of Pseudomonas aeruginosa requires the siderophore pyochelin
as an effector. Mol Microbiol 58:495–509
Minorsky PV (2008) On the inside. Plant Physiol 146:323–324
Mohamed S, Caunter IG (1995) Isolation and characterization of a Pseudomonas fluorescens strain
suppressive to Bipolaris maydis. J Phytopathol 143:111–114
Mukherjee PK, Latha J, Hadar R, Horwtiz BA (2004) Role of two G-protein alpha subunits, TgaA
and TgaB, in the antagonism of plant pathogens by Trichderma virens. Appl Environ Microbiol
70:542–549
Muthukumar A, Bhaskaran R, Sanjeevkumar K (2010) Efficacy of endophytic P. fluorescens
(Trevisan) migula against chilli damping-off. J Biopest 3(1):105–109
Nahas E (1996) Factors determining rock phosphate solubilization by micro organisms isolated
from soil. World J Microbiol Biotechnol 12:567–572
Naik PR, Raman G, Narayanan KB, Sakthivel N (2008) Assessment of genetic and functional
diversity of phosphate solubilizing fluorescent pseudomonads isolated from Rhizospheric soil.
BMC Microbiol 8(230):1–14
Neilands JB (1981) Microbial iron compounds. Annu Rev Biochem 50:715–731
Neilands JB (1986) Siderophores in relation to plant growth and disease. Annu Rev Plant Physiol
37:187–208
Nielsen TH, Thrane C, Christophersen C, Anthoni U, Sorensen J (2000) Structure, production,
characteristics and fungal antagonism of tensin- a new antifungal cyclic lipopeptide from
Pseudomonas fluorescens strain 95.578. J Appl Microbiol 89:992–1001
Notz R, Maurhofer M, Dubach H, Haas D, Defago G (2002) Fusaric acid-producing strains of
Fusarium oxysporum alter 2,4-diacetylphloroglucinol biosynthetic gene expression in
Pseudomonas fluorescens CHA0 in vitro and in the rhizosphere of wheat. Appl Environ
Nowak-Thompson B, Chaney N, Wing JS, Gould SJ, Loper JE (1999) Characterization of the
pyoluteorin biosynthetic gene cluster of Pseudomonas fluorescens Pf-5. J Bacteriol 181:
2166–2174
O’Sullivan DJ, O’Gara F (1992) Traits of fluorescent Pseudomonas spp. involved in suppression
of plant root pathogens. Microbiol Rev 56:662–676
Palleroni NJ (1975) General properties and taxonomy of the genus Pseudomonas. pi-36. In: Clarke
PH, Richmond MH (eds) Genetics and biochemistry of Pseudomonas. Wiley, Baltimore
Palleroni NJ (1984) Family I: Pseudomonadaceae. In: Tansil B (ed) Bergeys Manual of Systematic
Bacteriology. Williams and Wilkins, Baltimore, USA, pp 141–161
Palleroni S, Kunisawa R, Contopoolou R, Doudoroff IM (1973) Nucleic acid homologies in the
genus Pseudomonas. Int J Syst Evol Microbiol 23:333–339
Pastor NA, Reynoso MM, Tonelli ML, Masciarelli O, Rosas SB, Rovera M (2010) Potential bio-
logical control Pseudomonas sp. pci2 against damping-off of tomato caused by Sclerotium
rolfsii. J Plant Pathol 92(3):737–745
Paulsen IT, Press CM, Ravel J (2005) Complete genome sequence of the plant commensal
Pseudomonas fluorescens Pf-5. Nat Biotechnol 23:873–878
Pfender WF, Kraus J, Loper JE (1993) A genomic region from Pseudomonas fluorescens Pf-5
required for pyrrolnitrin production and inhibition of Pyrenophora tritici-repentis in wheat
straw. Phytopathology 83:1223–1228
Picard C, Cello FD, Ventura M, Fan R, Gucket A (2000) Frequency and diversity of 2, 4-diacetyl
phloroglucinol producing bacteria isolated from the maize rhizosphere at different stages of
plant growth. Appl Environ Microbiol 66:948–955
Pradhan N, Sukla LB (2006) Solubilization of inorganic phosphates by fungi isolated from agri-
culture soil. Afr J Biotechnol 5:850–854
Preston GM, Bertrand N, Rainey P (2001) Type III secretion inplant growth-promoting
Pseudomonas fluorescens SBW25. Mol Microbiol 41:999–1014
Raaijmakers JM, Weller DM, Thomashow LS (1997) Frequency of antibiotic-producing
Pseudomonas spp. in natural environments. Appl Environ Microbiol 63:881–887
Raffel SJ, Stabb EV, Milner JL, Handelsman J (1996) Genotypic and phenotypic analysis of zwit-
termicin A-producing strains of Bacillus cereus. Microbiology 142:3425–3436
Ramamoorthy V, Raguchander T, Samiyappan R (2001) Induction of systemic resistance by
plant growth promoting rhizobacteria in crop plants against pests and diseases. Crop Prot
20:1–11
Ramamoorthy V, Raguchander T, Samiyappan R (2002) Enhancing resistance of tomato and hot
pepper to Pythium diseases by seed treatment with fluorescent pseudomonads. Eur J Plant
Pathol 108:429–441
Ramesh R, Joshi AA, Ghanekar MP (2009) Pseudomonads: Major antagonistic endophytic bacte-
ria to suppress bacterial wilt pathogen, Ralstonia solanacearum in the egg-plant (Solanum
melongena L.). World J Microbial Biotechnol 25(1):47–55
Ramette A, Frapolli M, Défago G, Moënne-Loccoz Y (2003) Phylogeny of HCN synthase-
encoding hcnBC genes in biocontrol fluorescent pseudomonads and its relationship with host
plant species and HCN synthesis ability. Mol Plant Microbe Interact 16:525–535
Ramezanpour MR, Popov Y, Khavazi K, Rahmani HA (2010) Molecular geno systematic and
physiological characteristics of fluorescent pseudomonads isolated from the rice rhizosphere of
Iranian paddy fields. Afr J Agric Res 6(1):145–151
Ravel J, Cornelis P (2003) Genomics of pyoverdine-mediated iron uptake in pseudomonads.
Trends Microbiol 11:195–200
Reddy PK, Reddy MS (2009) Biochemical and PCR-RAPD characterization of Pseudomonas
fluorescens produced antifungal compounds inhibit the rice fungal pathogens in vitro. J Pure
Appl Microbiol 3:347–350
Redondo-Nieto M, Matthieu B, John PM, Kieran G, Martínez-Granero F, Emma B, Ana N,
Sánchez-Contreras M, Jennifer AM, Stephen RG, Eric RC, Candela M, Willem JS, Paul BR,
David D, O’Gara F, Marta M, Rafael R (2012) Genome Sequence of the Biocontrol Strain
Pseudomonas fluorescens F113. J Bacteriol 194(5):1273–1274
Rezzonico F, Binder C, Défago G, Moënne-Loccoz Y (2005) The type III secretion system of
biocontrol Pseudomonas fluorescens KD targets the phytopathogenic chromista Pythium ulti-
mum and promotes cucumber protection. Mol Plant Microbe Interact 18:991–1001
Rokhzadi A, Asgharzadeh A, Darvish F, Nourmohammadi G, Majidi E (2008) Influence of plant

growth-promoting rhizobacteria on dry matter accumulation and yield of chickpea (Cicer ari-
etinum L.) under field condition. Am-Euras J Agric Environ Sci 3(2):253–257
Rosales AM, Thomashow L, Cook RJ, Mew TW (1995) Isolation and identification of antifungal
metabolites produced by rice-associated antagonistic Pseudomonas spp. Phytopathology
85:1028–1032
Saikia R, Kumar R, Singh T, Srivastava AK, Arora DK, Lee MW (2004) Induction of defense
enzymes and pathogenesis related proteins in Pseudomonas fluorescens treated chickpea in
response to infection by Fusarium oxysporum f. sp. ciceri. Microbiology 32:47–53
Salaheddin K, Valluvaparidasan V, Ladhalakshmi D, Velezhahan R (2010) Management of bacte-
rial blight of cotton using a mixture of Pseudomonas fluorescens and Bacillus subtilis. Plant
Protect Sci 46(2):41–50
Sarathchandra U, Duganzich D, Burch G (1993) Occurrence of antifungal fluorescent Pseudomonas
spp. on some horticultural and pastoral plants. N Z J Crop Horticult Sci 21(3):267–272
Schroth MN, Hancock JG (1981) Selected topics in biological control. Annu Rev Microbial
35:453–476
Schroth MN, Hancock JG (1982) Disease suppressive soil and root-colonizing bacteria. Science
216(25):1376–1381
Shanahan P, O’Sullivan DJ, Glennon JD, O’Gara F (1992) Isolation and characterization of an
antibiotic-like compound from a fluorescent pseudomonad and investigation of physiological
parameters influencing its production. Appl Environ Microbiol 58:353–358
Sharifi-Tehrani A, Zala M, Natsch A, Moenne-Loccoz Y, Defago G (1998) Biocontrol of soil-borne
fungal plant diseases by 2,4- diacetylphloroglucinol-producing fluorescent pseudomonads with
different restriction profiles of amplified 16S rDNA. Eur J Plant Pathol 104:631–643
Shukla A, Gupta SK (2005) Integrated approach to management of tomato bacterial spot
(Xanthomonas vesicatoria). J Mycol Plant Pathol 35(2):317–319
Siddiqui S, Siddiqui ZA, Ahmad I (2005) Evaluation of fluorescent Pseudomonads and Bacillus
isolates for the biocontrol of a wilt disease complex of pigeon pea. World J Microbiol
Biotechnol 21(5):729–732
Singh R, Sinha AP (2009) Biological control of sheath blight of rice with Pseudomonas fluores-
cens. Indian Phytopathol 62(3):381–383
Singh D, Dhar S, Yadav DK (2010) Effect of endophytic bacterial antagonist against black rot
disease of cauliflower caused by Xanthomonas campestris pv. campestris. Indian Phytopathol
63(2):122–126
Sivakumar G, Sharma RC, Rai SN (2000) Biocontrol of banded leaf and sheath blight of maize by
peat based Psuedomonas fluorescens formulation. Indian Phytopathol 53(2):190–192
Spiers AJ, Bukling A, Rainey PB (2005) The causes of Pseudomonas diversity. Microbiology
146(10):2–9
Srinivasan K, Gilardi G, Garibaldi A, Gullino ML (2009) Bacterial antagonists from used rock-
wool soilless substrates suppress Fusarium wilt of tomato. J Plant Pathol 91(1):147–154
Srivastava S, Yadav KS, Kundu BS (2004) P0hosphate solubilizing pseudomonads suppress
damping-off disease in tomato. J Mycol Plant Pathol 34:662–664
Stalstorm YA (1903) Beitrag zur kennturs der ein-wisking sterilia and in ha hung botindlichen
strolte amt dil torlichkeit der phosphorsen der tricalcium phosphate. Zentralbl Baketeriol
11:724–732
Stohl EA, Milner JL, Handelsman J (1999) Zwittermicin A biosynthetic cluster. Gene 237:
403–411
Sunish KR, Ayyadurai N, Pandiaraja P, Reddy AV, Venkateswarku Y, Prakash O, Sakthival N
(2005) Characterization of antifungal metabolite produced by a new strain Pseudomonas aeru-
ginosa PUPa3 that exhibits broad spectrum antifungal activity and biofertilizing traits. J Appl
Microbiol 98(1):145–154
Suresh A, Pallavi P, Srinivas P, Praveen Kumar V, Jeevan Chandra S, Ram Reddy S (2010) Plant
growth promoting activities of fluorescent pseudomonads associated with some crop plants.
Afr J Microbiol Res 4(14):1491–1494
Suryakala D, Maheshwaridevi PV, Lakshmi KV (2004) Chemical characterization and in vitro

antibiosis of siderophores of rhizosphere fluorescent pseudomonads. Indian J Microbiol
44(2):105–108
Svercel M, Duffy B, Defago G (2007) PCR amplification of hydrogen cyanide biosynthetic locus
hcnAB in Pseudomonas spp. J Microbiol Methods 70:209–213
Tari PH, Anderson AJ (1988) Fusarium wilt suppression and agglutinability of Pseudomonas
putida. Appl Environ Microbiol 54:2037–2041
Thomashow LS, Weller DM (1988) Role of a phenazine antibiotic from Pseudomonas fluorescens
in biological control of Gaeumannomyces graminis var. tritici. J Bacteriol 170:3499–3508
Ton J, Van Pelt JA, Van Loon LC, Pieterse CMJ (2002) Differential effectiveness of salicylate-
dependent and jasmonate/ethylene-dependent induced resistance in Arabidopsis. Mol Plant
Tripathi M, Joshi BN (2002) In vitro antagonistic potential of pseudomonads and control of sheath
blight of maize caused by Rhizoctonia solani. Indian J Microbiol 42:207–214
Umesha S, Dharmesh SM, Shetty SA, Krishnappa M, Shetty HS (1998) Biocontrol of downy
mildew disease of pearl millet using Pseudomonas fluorescens. Crop Prot 17(5):387–392
Umesha S, Kavitha R, Shetty HS (2005) Transmission of seed-borne infection of chilli by
Burkholderia solanacearum and effect of biological seed treatment on disease incidence. Arch
Phytopathol Plant Prot 38(4):281–293
Unnamalai N, Gnanamanickam SS (1984) Pseudomonas fluorescens is an antagonistic to
Xanthomonas citri (Hasse) Dye. the incitant of citrus canker. Curr Sci 53:703–704
Uppal AK, El-Hadrami A, Adam LR, Tenuta M, Daaye F (2008) Biological control of potato
Verticillium wilt under controlled and field conditions using selected bacterial antagonists and
plant extracts. Biol Ctrl 44(1):90–100
Van Peer R, Niemann GJ, Schippers B (1991) Induced resistance andphytoalexin accumulation in
biological control of fusariumwilt of carnation by Pseudomonas sp. strain WCS417r.
Vessey KJ (2003) Plant growth promoting rhizobacteria as biofertilizers. Plant Soil 255:571–586
Vidhyasekaran P, Kamala N, Ramanathan A, Rajappan K, Paranidharan V, Velazhahan R (2001)
Induction of systemic resistance by Pseudomonas fluorescens Pf1 against Xanthomonas oryzae
pv. oryzae in rice leaves. Phytoparasitica 29:155–166
Voisard C, Keel C, Haas D, Defago G (1989) Cyanide production by Pseudomonas fluorescens
helps to suppress black root rot of tobacco under gnotobiotic conditions. EMBO J 8:351–358
Wei G, Kloepper JW, Tuzum S (1991) Induction of systemic resistance of cucumber to
Colletotrichum orbiculare by selected strains of plant growth promoting rhizobacteria.
Weller DM (1988) Biological control of soil borne plant pathogens in the rhizosphere with bacteria.
Annu Rev Phytopathol 26:379–407
Weller DM, Zhang BX, Cook RJ (1985) Application of a rapid screening test for selection of
bacteria suppressive to take-all of wheat. Plant Dis 69:710–713
Wenzel SC, Muller R (2005) Formation of novel secondary metabolites by bacterial multimodular
assembly lines: deviations from textbook biosynthetic logic. Curr Opin Chem Biol 9:447–458
Xu GW, Gross DC (1986) Field evaluations of the interactions among fluorescent pseudomonads,
Erwinia caratovora and potato yields. Phytopathology 76:432–430
Zhang Y, Fernando WGD, de Kievit TR, Berry C, Daayf F, Paulitz TC (2006) Detection of
antibiotic-related genes from bacterial biocontrol agents with polymerase chain Reaction. Can
J Microbiol 52:476–481
Chapter 12
Oat Fungal Diseases and the Application
of Molecular Marker Technology for Their
Control
Adrian Lester Cabral, Belaghihalli N. Gnanesh, Jennifer Mitchell Fetch,

Curt McCartney, Thomas Fetch, Robert F. Park, James G. Menzies,
Brent McCallum, Ganapathy Kuyyamudi Nanaiah, and Aakash Goyal
12.1 Introduction
Oat (Avena spp.) is an important cereal crop grown worldwide for grain and fodder.
Fungal diseases are an important constraint to oat production. Significant yield
losses have been attributed to crown rust (caused by Puccinia coronata Corda f. sp.
avenae Eriks. [Pca]) and stem rust (caused by Puccinia graminis Pers. f. sp. avenae
Eriks. and Henn. [Pga]), which persist in all major oat growing regions of the world.
Over the past century, severe rust epidemics have occurred in many of the major oat
growing regions of the world. Numerous stem rust epidemics occurred between the
early 1900s and the late 1970s in the Midwestern region of the USA, with yield
losses as high as 25 % (Roelfs 1978). Similar epidemics occurred in Saskatchewan
A.L. Cabral, Ph.D. • B.N. Gnanesh, Ph.D. (*) • C. McCartney, Ph.D.

T. Fetch, Ph.D. • J.G. Menzies, B.Sc., M.Sc., Ph.D. • B. McCallum, Ph.D.
Agriculture and Agri-Food Canada, 101 Route 100, Morden, MB, R6M 1Y5, Canada
e-mail: gnaneshbn@gmail.com; Tom.Fetch@agr.gc.ca
J. Mitchell Fetch, Ph.D.
Agriculture and Agri-Food Canada, 2701 Grand Valley Road, Brandon, MB,
R7A 5Y3, Canada
R.F. Park, B.Sc. (Hons.), Ph.D.
Plant Breeding Institute, The University of Sydney, Narellan, NSW, Australia
G.K. Nanaiah, Ph.D.
Directorate of Sorghum Research, Hyderabad, India
A. Goyal, Ph.D., F.I.C.N., F.S.A.B.
Biodiversity and Integrated Gene Management Program,
International Center for Agriculture Research in the Dry Area,
Rabat, Morocco

344 A.L. Cabral et al.
and Manitoba in Canada (Martens 1985), with a severe epidemic causing yield
losses of 35 % in 1977 (Martens 1978). In 2002, losses of nearly 7 % were reported
in the prairie provinces of Canada, likely the result of a new virulent race NA67
(Fetch 2005). During the first half of the twentieth century, rusts wreaked havoc on
wild oats in coastal areas of Australia during years favorable for the proliferation of
the fungus (Waterhouse 1952).
Crown rust is the most serious threat to oat production in North America. An
epidemic that occurred in 1904 in North Dakota, South Dakota, and Minnesota,
USA and in the neighbouring prairie provinces of Canada was favored by unusually
high quantities of moisture that prevailed at the grain-filling stages (Carleton 1905).
Between 1918 and 1930, annual estimated losses in the USA averaged greater than
13.7 million bushels (Murphy 1935). Simons and Murphy (1968) observed annual
losses of up to 30 % during years of severe infestation of crown rust.
Powdery mildew (caused by Blumeria graminis (DC.) Speer f. sp. avenae Em.
Marchal) and Fusarium head blight (FHB; Fusarium spp.) can also cause signifi-
cant losses depending on the climate and geographical region. Powdery mildew is
the most important foliar disease of oat in the cooler humid regions of Europe
(Roderick et al. 2000), including Poland (Sebesta et al. 1991). Crop losses caused
by powdery mildew are significant, with estimates up to 39 % from comparisons
between susceptible and resistant near-isogenic lines (Lawes and Hayes 1965).
Similarly, Jones (1977) found a yield reduction of 20 % in the susceptible cv. Sun
II, but only 9 % in the moderately resistant cv. Maldwyn. Clifford (1995) reported
annual crop losses from 5 to 10 % in Great Britain, with much higher reductions in
small plot trials. Hsam et al. (1997) investigated powdery-mildew resistance in 259
common oat cultivars and breeding lines. They found 67 % of the investigated
plants were susceptible to this disease. In contrast to wheat and barley, FHB has not
caused large epidemics or yield losses in oat. This may be attributable to a lack of
visual symptoms associated with infection (Tekauz et al. 2004). Nevertheless, FHB
can impact significantly on oat quality due to the production of mycotoxins.
One highly effective method to control fungal diseases is through the use of fun-
gicides. While fungicides have been shown to limit yield losses in oat during rust
outbreaks (Brink and Belay 2006), they do not necessarily provide complete protec-
tion of the crop and are less effective than host resistance in reducing the overall size
of rust populations (Park 2008). Fungicides are an added cost and their use may not
be economic in oat production. Additionally, they can have environment impacts
from residues in soil or runoff into groundwater. Harder and Haber (1992) cited
ecological concerns linked to their use, in addition to difficulties in obtaining fungi-
cide registration for smaller acreage crops such as oat. Other methods of control
include cropping strategies such as early planting (Fleischmann and McKenzie
1965), or the use of early maturing cultivars to escape disease (Simons and Michel
1968; Suttie and Reynolds 2004), maintaining an optimum plant density (Burdon
and Chilvers 1982), and crop rotations to avoid inoculum of stubble-borne diseases
such as FHB. However, the deployment of resistant cultivars is the most economic
and environmentally safe means to control diseases in oat.
12 Oat Fungal Diseases and the Application of Molecular Marker Technology… 345
12.2 Genetic Resistance
The incorporation of plant resistance genes to provide protection from various

diseases is used by oat breeders worldwide, primarily for the rust and smut diseases
(Ohm and Shaner 1992). Resistance genes conditioning hypersensitive responses at
the seedling stage (i.e. “major” genes) have been and continue to be the chief
method of control for crown rust and stem rust (Gnanesh et al. 2013). Although
major genes provide complete resistance against specific races of rust via a gene-
for-gene interaction (Flor 1955), they can be short lived, remaining effective for
between 3 and 7 years when deployed singly (Frey and Browning 1971). Adult
plant resistance (APR) genes (i.e. “minor” or slow-rusting resistances) can also be
effective in reducing the severity of rust outbreaks. APR can be durable (Johnson
and Law 1975; Johnson 1984) or non-durable (Dyck et al. 1966; Knott 1968), and
the resistance conferred is only expressed at the mature stages of plant growth (Hare
1997). Although previously reported only in hexaploid oat, APR was identified in
diploid and tetraploid oat accessions by Cabral et al. (2011). Cultivars with durable
APR remain resistant to a pathogen for longer periods of time compared to cultivars
with only major gene resistance. Carson (2009a) reported oat cultivars with major
gene resistance to crown rust in the USA generally succumbed to the pathogen
5 years or less after release. Besides using major and APR genes, several other strat-
egies can be applied in breeding for resistance to crown rust. These include gene
pyramiding, use of multiline cultivars, line or varietal mixtures, and selection for
partial resistance (Cabral 2009).
Multilines are a mixture of resistant genotypes that are known to reduce the
severity of rust infections. Jensen (1965) defined multiline varieties as composites,
which are phenotypically similar but genetically different. A line or varietal mixture
is broadly defined as a heterogeneous crop of a single species (Wolfe 1985).
Browning and Frey (1969) outlined the main relative advantages of multiline culti-
vars over pure line cultivars in disease control. These include an extended life span
for a useful resistance gene(s), and a decreased severity of rust infection on host
plants resulting in optimum crop yields. Carson (2009b) suggested that although
multilines or varietal mixtures might provide some initial protection against Pca,
they permit selection of complex races of the pathogen that reduce the long-term
durability of the Pc genes in the multiline or varietal mixture.
Partial resistance is a form of incomplete resistance, considered to be durable
(Long et al. 2006) and polygenic in inheritance. The use of recurrent selection for
partial resistance in oat as a means to provide protection against Pca has been
reported in several studies (Díaz-Lago et al. 2002; Long et al. 2006). Among the
various resistance breeding strategies, Holland and Munkvold (2001) considered
gene pyramiding and selection for partial resistance to be more advantageous than
single gene resistance and complete resistance (race-specific). Nevertheless, the use
of major genes in developing resistant oat cultivars is the most common because it
is easiest, and when effective, results in crops that are nearly entirely free from dis-
ease, while the resistance gene endures.
12.3 Crown Rust (Pca) and Stem Rust (Pga)

Resistance Genes
Previous research has identified numerous major resistance genes that protect culti-
vated oats against Pca and Pga. There are currently more than 100 described Pc
genes (Sanz et al. 2013; Gnanesh et al. 2014), but because their chromosomal loca-
tions have not been determined, many could be the same or allelic. Most Pc genes
are inherited dominantly, but some are either partially dominant or recessive
(Simons et al. 1978). Many genes were derived from accessions of hexaploid
A. sterilis collected in Israel and other Mediterranean countries during the 1960s
and the early 1970s (Leonard et al. 2004) and include Pc34, Pc35, Pc36, Pc38
Pc39, Pc40, Pc41, Pc42, Pc43, and Pc45–Pc77. Another source of many resistance
genes is the diploid species A. strigosa and include Pc15, Pc16, Pc17, Pc19, Pc23,
Pc30, Pc37, Pc81, Pc82, Pc83, Pc84, Pc85, Pc86, Pc87, Pc88, Pc89, Pc90, and
Pc94 (CDL 2013). Recently, Carson (2009a) identified 48 accessions of A. barbata
in a buckthorn nursery at St. Paul, Minnesota that were resistant to a diverse bulk
mixture of Pca races, which may be useful as new sources of resistance.
Several A. sterilis-derived resistance genes, such as Pc38, Pc39, Pc48, Pc58,
Pc59, Pc60, Pc61, and Pc68, have been used in breeding programs in North
America. Genes Pc38 and Pc39 were the first to be deployed widely in commercial
cultivars in Canada (Chong and Kolmer 1993; McCallum et al. 2007). The wide-
spread deployment of Pc38 and Pc39 in oat cultivars resulted in quickly increased
frequencies of virulence for these genes in the Pca population, thereby rendering
them ineffective (Chong and Seaman 1997). Similarly, virulence to Pc48 arose
quickly upon the release of the cultivar “Triple Crown” (Chong and Zegeye 2004)
because its resistance relied on only one effective gene. Virulence to gene Pc68
developed less rapidly in the pathogen population (10 years), perhaps due to its pres-
ence in combination with Pc38 + Pc39, but this gene combination was eventually
defeated in 2005 (Chong et al. 2008). While the resistance in “Leggett” (Pc68+Pc94)
and “HiFi” (Pc91) is effective (Chong et al. 2011), efforts to develop new cultivars
with different combinations of Pc genes is needed because both cultivars also rely
on only one currently effective gene. In Australia, “Drover” (Pc91) was for several
years the only oat cultivar with effective resistance to Pca (Park and Kavanagh
2009). However, virulence for Pc91 was detected in late 2012 in Queensland. The
cultivar “Aladdin” is hypothesised to carry Pc91 + Pc50 and remains resistant to this
new pathotype, possibly being protected by Pc50 (Park 2013).
While most Pc resistant genes have been identified from A. sterilis and A. stri-
gosa, most numbered Pg resistant genes are derived from the cultivated hexaploid
A. sativa. Genes Pg-1, Pg-2, Pg-3, Pg-4, Pg-5, Pg-8, Pg-9, Pg-10, Pg-11, Pg-12,
and Pg-14 were all derived from A. sativa, Pg-6 and Pg-7 from A. strigosa, Pg-13,
Pg-15, and Pg-17 from A. sterilis, and Pg-16 from A. barbata (Fetch and Jin 2007;
Gnanesh et al. 2014). Five Pg genes (Pg-1, Pg-2, Pg-4, Pg-9, and Pg-13) have been
deployed in Canadian oat cultivars. Genes Pg-2 and Pg-13 are thought to be present
in most currently resistant cultivars (Fetch and Dunsmore 2004), and were also
confirmed to be in “AC Ronald” and “AC Gwen” (Mitchell Fetch and Fetch 2011).
However, virulence for these two genes was detected in 1998 with the emergence of
races NA67 (TJJ) and NA76 (TJG), thereby rendering all current cultivars suscep-
tible to stem rust (McCallum et al. 2007). Nine Pg genes (Pg-1, Pg-2, Pg-3, Pg-4,
Pg-8, Pg-9, Pg-13, Pg-a, and Pg-Sa) have been deployed in Australian commercial
varieties (Adhikari et al. 2000). Of these Pg-8, Pg-13, and Pg-a were reported to be
effective against Pga in Australia up until the late 1980s (Oates 1992). No current
Australian oat cultivar is resistant to stem rust (Park 2008).
12.4 Powdery Mildew Resistance Genes
Based on the reaction of differential oat cultivars and lines to various pathotypes of
Blumeria graminis avenae, resistance to powdery mildew in oat is governed by
major genes that have been characterized as oat mildew resistance (OMR) groups
(Jones and Jones 1979). Several sources with major gene resistance to powdery
mildew, including common oats (Jones 1983; Hsam et al. 1997), wild oat species
such as A. barbata (Aung et al. 1977; Thomas et al. 1980), A. strigosa, A. occiden-
talis (Herrmann and Roderick 1996), A. pilosa (Hoppe and Kummer 1991), and
A. sterilis (Hayes and Jones 1966), have been reported. Two main sources of pow-
dery mildew resistance are currently deployed in European oat breeding programs
(Roderick et al. 2000). The first is derived from the A. sterilis line CAV1832 with
Pc54 (Sebesta et al. 1993). The second is from the lines APR 122 and APR 166,
derived from A. eriantha, controlled by a single gene. To date, six OMR groups
have been characterized in oat, but only three (OMR1, OMR2, and OMR3) have
been used commonly in breeding programmes (Kowalczyk et al. 2004; Okoń 2012).
12.5 Fusarium Head Blight Resistance Genes
Fusarium head blight (FHB) is a devastating fungal disease of cereal crops that is
prevalent in North America and northern Europe. FHB is caused by any 1 of the 17
species of the Fusarium fungus (Parry et al. 1995) that infect oat, wheat, barley, and
other grasses. In North America, Fusarium graminearum is the main causal organ-
ism of FHB in wheat (Schroeder and Christensen 1963), and results in shrivelled
and chalky kernels that have a low germination percentage (Gilbert and Tekauz
1995). In oat, symptoms are not as obvious as they are in wheat and barley, but
occasionally bleached spikelets are found (Tekauz et al. 2004). In areas with FHB,
oat was found to be infected with Fusarium species, but at a lower frequency than
either wheat or barley (Tekauz et al. 2004). The main causal species in Manitoba,
Canada are Fusarium graminearum, Fusarium poae, Fusarium sporotrichiodes,
and Fusarium avenaceum, in the order of their prevalence when isolated from
oat groats collected from commercially produced crops (Tekauz et al. 2008).
However, F. avenaceum predominated in the neighbouring province of

Saskatchewan and in Manitoba in years prior to major FHB epidemics during the
early 2000s (Tekauz et al. 2008). A majority of the commonly grown oat cultivars do
not possess good resistance to FHB (Mielniczuk et al. 2004; Tekauz et al. 2008).
Additionally, Gibberella zeae, the teleomorph (sexual stage) of F. graminearum,
produces large amounts of the mycotoxin deoxynivalenol (DON) on oat seed
(Tekauz et al. 2008), besides other toxins like acetyl-deoxynivalenols (3-ADON or
15-ADON) and nivalenol (NIV). At present, information on the resistance of oats to
Fusarium is limited but genetic differences in the resistance levels of cultivars do
exist and progress can be made by breeding for resistance (Tekauz et al. 2008). Since
visual symptoms of FHB are so difficult to observe in oat, other methods of assess-
ment, such as the evaluation of groat colonization by the fungus and mycotoxin
measurement, need to be employed to effectively develop resistant oat cultivars.
12.6 The Role of Molecular Markers
Genetic markers are pivotal to modern genomics research. Molecular markers are
useful tools in plant disease resistance breeding programs for the evaluation of
germplasm for disease resistance, mapping major and minor resistance genes, pos-
tulation of resistance genes, marker-assisted selection, and map-based cloning of
resistance genes. The relatively small and scattered international oat research com-
munity is continually challenged by the large and complex genome of hexaploid oat
and by a scarcity of genetic sequence data.
Molecular markers, mainly restriction fragment length polymorphisms (RFLP),
amplified fragment length polymorphisms (AFLP), simple sequence repeats (SSR),
and diversity array (DArT) markers, have played a major role in the genetic map-
ping of economically important disease resistance genes to linkage groups. The
construction of a genetic map of the Kanota × Ogle population (A. sativa) using
restriction fragment length polymorphisms (RFLP) (O’Donoughue et al. 1995) pro-
vided a reference genetic map that has aided comparative mapping studies and will
enable future development of molecular markers for other traits (Wight et al. 2003).
More recently, DArT markers were placed on the Kanota × Ogle map (Tinker et al.
2009). Microsatellite (SSR) markers are broadly used for marker-assisted selection
in crop breeding because of ease of implementation and codominance. EST-derived
SSRs (Becher 2007) and genomic SSRs (Li et al. 2000; Pal et al. 2002) have been
developed and screened in oat cultivars. A total of 216 SSR primer sequences were
developed from ESTs (Becher 2007). These Avena EST-derived microsatellite loci
(AME) were developed by screening a set of 7,021 EST sequences that were pub-
lished earlier by Rines et al. (2004). Forty-five AME loci have been placed onto 24
of the 29 linkage groups of the Kanota × Ogle map developed by Wight et al. (2003).
Recently, Gutierrez-Gonzalez et al. (2013) developed gene-derived SSR markers
with the potential to be used in oat breeding programs. In total, 4,639 SSRs were
found within 4,128 different transcripts. The most abundant SSRs were trinucleo-
tide repeats (2,841; 61.2 %).
Oliver and coworkers (2011) provided the first set of oat-based single nucleotide
polymorphism (SNP) markers, and a pipeline for the large scale development of a
much-needed genomic resource. The SNP discovery and validation pipeline is an
effective method to identify SNP markers in oat. These markers have a high assay
validation rate and proven utility in a variety of applications. Collaborative initia-
tives, such as the Collaborative Oat Research Enterprise (CORE) (http://wheat.
pw.usda.gov/CORE600/home), are now delivering genomics platforms for oat that
are revolutionizing the possibilities for research and innovation. The CORE is a
global research partnership represented by 28 oat research sites that was funded by
the United States Department of Agriculture, the North American Millers
Association, and the Prairie Oat Growers Association. Ever since the first publica-
tion of a diploid oat map (O’Donoughue et al. 1992), the oat research community
has made efforts in developing oat linkage maps, which include Kanota × Ogle
(O’Donoughue et al. 1995; Tinker et al. 2009; Wight et al. 2003), Ogle × TAM
O-301 (Portyanko et al. 2001), Ogle × MAM17-5 (Zhu and Kaeppler 2003),
Terra × Marion (DeKoeyer et al. 2004), and Aslak × Matilda (Tanhuanpää et al.
2008). However, all of these maps are incomplete and fragmented, and a map with
21 linkage groups (LG), well defined by chromosomal assignments was achieved
only recently when Oliver et al. (2013) developed a physically anchored consensus
map with 21 LGs through SNP mapping in six hexaploid oat populations and SNP
deletion analysis in a set of monosomic stocks. This map provides substantial
improvements over previous maps because of low error rates in the scoring of SNP
markers, and the joint mapping of markers assayed in parallel across multiple popu-
lations. The current availability of a large number of SNP markers and relatively
inexpensive high and low-plexity SNP assays (e.g. Infinium SNP assay from
Illumina, Inc. and KASP™ar assays from LGC Genomics Ltd.) have made it pos-
sible to assign resistance genes to oat chromosomes rapidly (Gnanesh et al. 2013).
Impacts of CORE work will be seen in areas of QTL and association mapping, and
studies of genome structure and evolution, leading to the accelerated improvement
of oat through marker-assisted breeding.
12.7 Mapping of Resistance Genes/QTLs
12.7.1 Rust
A number of race-specific resistance genes, such as Pc68 (Chen et al. 2006;

Satheeskumar et al. 2011), Pc71 (Bush and Wise 1998), Pc92 (Rooney et al. 1994),
Pc94 (Chong et al. 2004) and Pc91 (McCartney et al. 2011), have been mapped and
markers that are closely linked to crown and stem rust genes have been identified
(reviewed in detail by Gnanesh et al. 2014). Currently, the most commonly utilized
Pc genes in North America oat breeding programs are Pc: 38, 39, 48, 58, 59, 60, 61,
62, 68, 91, 94, 96, 97, 101, and 103. Similarly, for stem rust Pg: a, 2, 9, 10, 11, 12,
13, and 16 are the most commonly utilized resistance genes. A few of these genes
have been defeated, but they can be very effective when they are pyramided in a
single variety. Markers have been developed for many of the commonly utilized Pc
genes like Pc68, Pc91, and Pc94. However, the use of these markers in oat breeding
has been limited, because most of the reported markers (RAPDs, AFLPs, and
DArTs) are dominant in nature and are not suitable for high-throughput genotyping.
Also, their use in early generation MAS is limited as they cannot reliably detect
heterozygous genotypes. Hence, KASPar markers linked to resistance genes will be
very effective and they have been used successfully in high-throughput marker-
assisted selection of oat crown rust gene Pc91 (Gnanesh et al. 2013). Allele-specific
markers for the crown rust resistant genes, Pc68, Pc94 and PcKM have also been
developed (Gnanesh et al. unpublished). Further, it would be useful to find markers
for the newly identified genes Pc101 and Pc103.
Host resistance is usually based on single major genes conferring complete
resistance, but with the emergence of new pathogen races this resistance may be
easily overcome. Partial resistance is believed to be more effective in controlling
plant diseases because it allows sporulation of the pathogen, reduces selection
pressure for virulence, and thus slows the evolution of pathogen virulence. A num-
ber of breeding techniques are recommended to acquire durable resistance. Among
these are recurrent selection, which, by definition, is increasing the frequency of
desirable alleles and consequently gains in the population due to repeated cycles of
selection and recombination of selected lines (Díaz-Lago et al. 2002). The authors
demonstrated the usefulness of rapid cycle recurrent selection as a population
improvement procedure capable of effectively increasing the level of partial resis-
tance to crown rust in an adapted and high-yielding oat population. Their results
indicated that selection for partial crown rust resistance in early generations can
produce adequate gains per recurrent selection cycle with a minimum cycle length.
Another breeding technique is advanced backcross—QTL (AB-QTL), which
incorporates genes located in different linkage groups into a single variety by suc-
cessive backcrosses with selection based on the use of molecular markers (Lambalk
et al. 2004). Several studies have identified QTLs conferring durable crown rust
resistance in oat. For example Portyanko et al. (2005) utilized 230 markers, a
majority of which were RFLP and AFLP, and identified four major and three minor
QTLs for partial resistance to Pca in the oat line MN841801-1. Hoffman et al.
(2006) used six crown rust isolates, avirulent on TAM O-301 and virulent on Ogle,
to test the parents and TAM O-301 × Ogle RILs. Genetic analyses of the segrega-
tion data for each of the six isolates indicated that the resistance was conditioned
by a complex of three loci (Pc58a, 58b, and 58c), two of which (Pc58a and Pc58c)
were tightly linked. Zhu and Kaeppler (2003) found two consistent QTLs (Pcq1
and Pcq2) for crown rust resistance in Ogle × MAM 17-5 that explained 48.5–
70.1 % and 9.6–14.0 % of resistance, respectively. Similarly, 4–8 QTLs using
AFLP, RFLP, SCAR markers for crown rust APR were detected by Jackson et al.
(2007, 2008, 2010) and Acevedo et al. (2010). Most of the QTLs for APR in oat
reported so far have not been successfully validated and used in MAS. The crown
rust resistance in the oat line MN841801 has been effective for more than 30 years,
but it is not known whether or not this resistance has been widely deployed in oat
varieties. Lin et al. (unpublished) identified a major APR QTL explaining up to

74 % of the phenotypic variance in a RIL population of the cross AC
Assiniboia × MN841801. A single QTL segregating in this population makes it a
suitable candidate for use in marker-assisted breeding and also an ideal target for
map-based cloning of the gene underlying the QTL.
Lange (2012) evaluated winter and spring oat resistance to crown rust in four
field environments in Texas, Louisiana, Minnesota, and North Dakota during a
2-year study in 2010 and 2011. Plants representing 702 elite lines of oat phenotyped
for crown rust resistance were found to have highly diverse responses. The winter
oat lines demonstrated the best crown rust resistance and are expected to yield the
most genes/QTL to be used in developing durable crown rust resistance. Oat lines
developed in the US states along the Puccinia pathway in Texas, Louisiana,
Minnesota, North Dakota, and Wisconsin on average exhibited the best crown rust
resistance as compared to other areas in the country. GGE biplot analysis indicated
that Castroville, TX was the most representative and most ideal testing location
(Lange 2012). The above results are expected to increase knowledge of the genetic
diversity of the oat germplasm, and yield comprehensive genotyping and phenotyp-
ing information for North American oat breeding programs. Another approach is
the cloning and study of resistance gene analogs (RGAs) (Irigoyen et al. 2004;
Kremer et al. 2001; Portyanko et al. 2005; Satheeskumar et al. 2011). Cloning and
study of members of defined resistant gene families, such as wheat Lrk10-type
genes in oats (Cheng et al. 2003). Sanz et al. (2013) found that nucleotide binding
site (NBS) and protein kinase (PK) based markers cover partly complementary
regions of oat genomes. Markers of the different classes obtained were found to be
associated with the two resistance loci, PcA and R-284B-2, mapped on A. stri-
gosa × A. wiestii (Asw map), and with five out of eight QTLs for partial resistance
in the MN841801-1 × Noble-2 (MN) map. Fifty-three RGA-RFLPs and 187 NBS/
PK profiling markers were also mapped on the hexaploid map A. byzantina cv.
Kanota × A. sativa cv. Ogle.
12.7.2 Powdery Mildew and FHB
Very few linked molecular markers have been developed for oat powdery mildew
and FHB resistances. Therefore, developing molecular markers tightly linked to the
resistance genes would be beneficial both for oat breeding purposes and to investi-
gate oat genomic regions containing interesting resistance genes.
Yu and Herrmann (2006) were the first to map powdery-mildew resistance in
hexaploid oat. A resistance source from A. macrostachya was successfully intro-
gressed into hexaploid oat and their work revealed the resistance is controlled by a
dominant gene, designated Eg-5. One SSR marker AM102 and four AFLP-derived
PCR-based markers were identified linked to Eg-5. The powdery mildew resistance
gene Eg-3 was mapped with RFLP markers from Triticeae group-1 chromosomes
using an F3 population from a cross between A. byzantina cv. Kanota and A. sativa
cv. Rollo (Mohler et al. 2012). This comparative mapping approach positioned Eg-3
between cDNA-RFLP marker loci cmwg706 and cmwg733. Okoń and Kowalczyk
(2012) identified a SCAR-BG8 marker linked to oat mildew resistance group 2
(OMR2) and this marker might be used to select genotypes that are resistant to
OMR2. Hagmann et al. (2012) developed a linkage map with 366 DArT markers
and detected a major QTL for adult plant/field powdery mildew resistance, located
close to the DArT marker oPt-6125 in a region corresponding to linkage group 5_30
on the K × O map. This QTL accounted for 31 % of the phenotypic variation in the
mapping population. A BLAST search of the oPt-6125 clone sequence revealed a
high degree of similarity to a wheat mRNA expressed under mildew infection pres-
sure. By contrast, no major QTL were found for seedling-stage resistance under
artificial infection of powdery mildew.
Breeding FHB resistant cultivars is an economically and environmentally
friendly way to reduce mycotoxins on grain (DON), either by the identification of
resistance QTL or phenotypic evaluation. A DON resistance QTL was identified in
the recombinant inbred line population Hurdal × Z595-7 (He et al. 2013). The QTL
Qdon.umb-17A/7C, located on chromosome 17A/7C, was detected in all experi-
ments using composite interval mapping, with phenotypic effects of 12.2–26.6 %.
In addition, QTL for DON were also found on chromosomes 5C, 9D, 13A, 14D and
unknown_3, while a QTL for FHB was found on 11A. A half-sib population of
HZ595, Hurdal × Z615-4, was phenotyped in 2011 for validation of QTL found in
HZ595, and Qdon.umb-17A/7C was again localized with a phenotypic effect of
12.4 %. Three SNPs closely linked to Qdon.umb-17A/7C were identified in both
populations, and one each for QTL on 5C, 11A, and 13A were identified in HZ595.
These SNPs, together with those yet to be identified, could be useful in marker-
assisted selection of resistance QTL.
12.8 The Future of Molecular Approaches in Disease

Resistance Breeding in Oats
Advances in sequencing technologies, collectively known as next generation

sequencing (NGS), provides new opportunities to explore transcriptomes. However,
the genome and transcriptome of oats are among the least explored of cereal grain
crops. While the complexity associated with its large and repetitive genome (allo-
hexaploid, 2n = 6× = 42) is an impediment, it is clear that less effort has been devoted
to oat genome research (Gutierrez-Gonzalez et al. 2013). NGS has made possible
high-throughput transcriptome sequencing (RNA-Seq), giving rise to a multitude of
transcriptomes and transcript profiling studies in many organisms, including numer-
ous plant species. In oat, Gutierrez-Gonzalez et al. (2013) employed RNA-Seq to
generate and characterize the first gene expression atlas for hexaploid oat. Huang
et al. (2013) used genotyping-by-sequencing (GBS) to genotype 746 diverse oat vari-
eties and 622 progenies from 8 biparental populations. The number of segregating
SNPs observed inside the subpopulations reflects the intrapopulation diversity, both
for biparental populations and diversity panels used in different breeding programs.
The availability of these data will improve the oat consensus map, association map-
ping studies, and generate predictions regarding breeding value and QTL present in
North American oat germplasm. Oat genetic and genomic research has advanced
rapidly in recent years and further progress is needed to keep oat competitive with
other cereal crops. The development of new selection tools for developing disease
resistant oat varieties will play an important role.
Acknowledgement The authors thank Prairie Oat Growers Association (POGA), Regina,
Saskatchewan, Canada for supporting oat research.
References
Acevedo M, Jackson EW, Chong J, Rines HW, Harrison S, Bonman JM (2010) Identification and
validation of quantitative trait loci for partial resistance to crown rust in Oat. Phytopathology
100(5):511–521
Adhikari KN, McIntosh RA, Oates JD (2000) Distribution and temperature sensitivities of genes
for stem rust resistance in Australian oat cultivars and selected germplasm. Aust J Agr Res
51:75–83
Aung T, Thomas H, Jones IT (1977) The transfer of the gene for mildew resistance from Avena
barbata (4×) into the cultivated oat A. sativa by an induced translocation. Euphytica
26(3):623–632
Becher R (2007) EST-derived microsatellites as a rich source of molecular markers for oats. Plant
Breed 126:274–278
Brink M, Belay G (2006) Plant resources of tropical Africa, vol I, Cereals and pulses. PROTA
Foundation, Wageningen
Browning JA, Frey KJ (1969) Multiline cultivars as a means of disease control. Annu Rev
Burdon JJ, Chilvers GA (1982) Host-density as a factor in plant disease ecology. Annu Rev
Bush AL, Wise RP (1998) High-resolution mapping adjacent to the Pc71 crown-rust resistance
locus in hexaploid oat. Mol Breed 4(1):13–21
Cabral AL (2009) The genetics of host: pathogen interactions in wild and cultivated Avena: oat rust
pathogens Puccinia coronata f. sp. avenae and Puccinia graminis f. sp. avenae [Ph.D. disserta-
tion]. University of Sydney, Plant Breeding Institute, Cobbitty
Cabral AL, Singh D, Park RF (2011) Identification and genetic characterization of adult plant
resistance to crown rust in diploid and tetraploid accessions of Avena. Ann Appl Biol
159(2):220–228
Carleton MA (1905) Lessons from the grain-rust epidemic of 1904. USDA Farmers Bull 219
Carson ML (2009a) Broad-spectrum resistance to crown rust, Puccinia coronata f. sp. avenae, in
accessions of the tetraploid slender oat, Avena barbata. Plant Dis 93:63–366
Carson ML (2009b) Crown rust development and selection for virulence in Puccinia coronata f.
sp. avenae in an oat multiline cultivar. Plant Dis 93:347–353
CDL (2013) [Internet]. Cereal Disease Laboratory, St. Paul [cited 2013 Sept 6]. Available from
http://www.ars.usda.gov/Main/docs.htm?docid=10342
Chen G, Chong J, Gray M, Prashar S, Procunier DJ (2006) Identification of single-nucleotide
polymorphisms linked to resistance gene Pc68 to crown rust in cultivated oat. Can J Plant
Pathol 28(2):214–222
Cheng DW, Armstrong KC, Drouin G, McElroy A, Fedak G, Molnar SD (2003) Isolation and
identification of Triticeae chromosome 1 receptor-like kinase genes (Lrk10) from diploid, tet-
raploid, and hexaploid species of the genus Avena. Genome 46(1):119–127
Chong J, Kolmer JA (1993) Virulence dynamics and phenotypic diversity of Puccinia coronata
f. sp. avenae in Canada from 1974 to 1990. Can J Bot 71:248–255
Chong J, Seaman WL (1997) Incidence and virulence of Puccinia coronata f. sp. avenae in Canada
in 1995. Can J Plant Pathol 19:176–180
Chong J, Zegeye T (2004) Physiologic specialization of Puccinia coronata f. sp. avenae, the cause
of oat crown rust, in Canada from 1999 to 2001. Can J Plant Pathol 26(1):97–108
Chong J, Reimer E, Somers D, Aung T, Penner GA (2004) Development of sequence-characterized
amplified region (SCAR) markers for resistance gene Pc94 to crown rust in oat. Can J Plant
Pathol 26(1):89–96
Chong J, Gruenke J, Dueck R, Mayert W, Woods S (2008) Virulence of oat crown rust [Puccinia
coronata f. sp. avenae] in Canada during 2002–2006. Can J Plant Pathol 30:115–123
Chong J, Gruenke J, Dueck R, Mayert W, Mitchell Fetch J, McCartney CA (2011) Virulence of
Puccinia coronata f. sp. avenae in the eastern prairie region of Canada during 2007–2009. Can
J Plant Pathol 33(1):77–87
Clifford BC (1995) Diseases, pest and disorders of oat. In: Welch RW (ed) The oat crop. Chapman
& Hall, London, pp 252–278
DeKoeyer DL, Tinker NA, Wight CP, Deyl J, Burrows VD, O’Donoughue LS, Lybaert A, Molnar
SJ, Armstrong KC, Fedak G, Wesenberg DM, Rossnagel BG, McElroy AR (2004) A molecular
linkage map with associated QTLs from a hulless × covered spring oat population. Theor Appl
Genet 108(7):1285–1298
Díaz-Lago JE, Stuthman DD, Abadie TE (2002) Recurrent selection for partial resistance to crown
rust in oat. Crop Sci 42:1475–1482
Dyck PL, Samborski DJ, Anderson RG (1966) Inheritance of adult-plant leaf rust resistance
derived from the common wheat varieties Exchange and Frontana. Can J Genet Cytol
8:665–671
Fetch TG (2005) Races of Puccinia graminis on wheat, barley, and oat in Canada, in 2002 and
2003. Can J Plant Pathol 27(4):572–580
Fetch TG Jr, Dunsmore KM (2004) Physiologic specialization of Puccinia graminis on wheat,
barley and oat in Canada in 2001. Can J Plant Pathol 26:148–155
Fetch TG Jr, Jin Y (2007) Letter code system of nomenclature for Puccinia graminis f. sp. avenae.
Fleischmann G, Mckenzie RIH (1965) Yield losses in Gary oats infected with crown rust.
Flor HH (1955) Host parasite interactions in flax rust: its genetics and other implications.
Frey K, Browning JA (1971) Breeding crop plants for disease resistance. In: Mutation breeding for
disease resistance. Proc. Int. Atomic Energy Assoc., 12–16 Oct. IAEA Vienna, pp 45–54
Gilbert J, Tekauz A (1995) Effects of Fusarium head blight and seed treatment on germination,
emergence, and seedling vigour of spring wheat. Can J Plant Pathol 17:252–259
Gnanesh BN, Mitchell Fetch J, Menzies JG, Beattie AD, Eckstein PE, McCartney CA (2013)
Chromosome location and allele-specific PCR markers for marker-assisted selection of the oat
crown rust resistance gene Pc91. Mol Breed 32(3):679–686. doi:10.1007/s11032-013-9900-6
Gnanesh BN, Mitchell Fetch J, Zegeye T, McCartney C, Fetch T (2014) Oat. In: Pratap A, Kumar
J (eds) Alien Gene Transfer in Crop Plants, vol. 2. Springer New York, pp 51–73
Gutierrez-Gonzalez J, Tu Z, Garvin D (2013) Analysis and annotation of the hexaploid oat seed
transcriptome. BMC Genomics 14(1):471
Hagmann E, von Post L, von Post R, Eklund M, Larsson C-T, Tuvesson S, Vallenback P, Ceplitis
A (2012) QTL mapping of powdery mildew resistance in oats using DArT markers. In:
Proceedings of 15th International EWAC Conference, 7–11 Nov 2011, Novi Sad, Serbia,
European Cereals Genetics Co-operative Newsletter, pp 91–94
Harder DE, Haber S (1992) Oat diseases and pathologic techniques. In: Marshall HG, Sorrells ME
(eds) Oat science and technology, vol 33, ASA monograph. ASA-CSSA-SSSA, Madison,
pp 307–425
Hare RA (1997) Characterization and inheritance of adult plant stem rust resistance in durum
wheat. Crop Sci 37:1094
Hayes JD, Jones IT (1966) Variation in the pathogenicity of Erysiphe graminis D.C. f. sp. avenae,
and its relation to the development of mildew resistant oat cultivars. Euphytica 15:80–86
He X, Skinnes H, Oliver R, Jackson E, Bjørnstad Å (2013) Linkage mapping and identification of
QTL affecting deoxynivalenol (DON) content (Fusarium resistance) in oats (Avena sativa L.).
Theor Appl Genet 126(10):2655–70
Herrmann M, Roderick HW (1996) Characterisation of new oat germplasm for resistance to
powdery mildew. Euphytica 89:405–410
Hoffman DL, Chong J, Jackson EW, Obert DE (2006) Characterization and mapping of a crown
rust resistance gene complex (Pc58) in TAM O-301. Crop Sci 46(6):2630–2635
Holland JB, Munkvold GP (2001) Genetic Relationships of Crown Rust Resistance, Grain Yield,
Test Weight, and Seed Weight in Oat. Crop Sci 41:1041
Hoppe HD, Kummer M (1991) New productive hexaploid derivatives after introgression from
A. pilosa features. Vortr Pflanzenzüchtg 20:56–61
Hsam SLK, Peters N, Paderina EV, Felsenstein F, Oppitz K, Zeller FJ (1997) Genetic studies of
powdery mildew resistance in common oat (Avena sativa L.). I. Cultivars and breeding lines
grown in Western Europe and North America. Euphytica 96:421–427
Huang Y, Poland J, Jackson EW, Tinker N ( 2013) Genotyping-by-sequencing (GBS) in the real oat
world: making the data talk. Proceedings of the XXI plant and animal genome conference, Jan
12–16, San Diego. Available from https://pag.confex.com/pag/xxi/webprogram/Paper6751.html
Irigoyen ML, Loarce Y, Fominaya A, Ferrer E (2004) Isolation and mapping of resistance gene
analogs from the Avena strigosa genome. Theor Appl Genet 109(4):713–724
Jackson EW, Obert DE, Menz M, Hu G, Avant JB, Chong J, Bonman JM (2007) Characterization
and mapping of oat crown rust resistance genes using three assessment methods. Phytopathology
97(9):1063–1070. doi:10.1094/phyto-97-9-1063
Jackson EW, Obert DE, Menz M, Hu G, Bonman JM (2008) Qualitative and quantitative trait loci
conditioning resistance to Puccinia coronata pathotypes NQMG and LGCG in the oat (Avena
sativa L.) cultivars Ogle and TAM O-301. Theor Appl Genet 116(4):517–527
Jackson EW, Obert DE, Avant JB, Harrison SA, Chong J, Carson ML, Bonman JM (2010)
Quantitative trait loci in the Ogle/TAM O-301 oat mapping population controlling resistance to
Puccinia coronata in the field. Phytopathology 100(5):484–492. doi:10.1094/phyto-100-5-0484
Jensen NF (1965) Multiline superiority in cereals. Crop Sci 5(6):566–568
Johnson R (1984) A critical analysis of durable resistance. Annu Rev Phytopathol 22(1):309–330
Johnson R, Law CN (1975) Genetic control of durable resistance to yellow rust (Puccinia striiformis)
in the wheat cultivar Hybride de Bersee. Ann Appl Biol 81:385–91
Jones IT (1977) The effect on grain yield of adult plant resistance to mildew in oats. Ann Appl Biol
86:267–277
Jones IT (1983) Transgressive segregation for enhanced level of adult plant resistance to mildew
in the oat cross Mostyn × Maldwyn. Euphytica 32:499–503
Jones IT, Jones ERL (1979) Mildew of oats. UK Cereal Pathogen Virulence Survey 1978. Annual
Report, pp 59–63
Knott DR (1968) The inheritance of resistance to stem rust races 56 and 15B-1L (Can.) in the
wheat varieties Hope and H-44. Can J Genet Cytol 10:311–320
Kowalczyk K, Hsam SLK, Zeller FJ (2004) Identification of oat powdery mildew resistance group
2 (OMR2) and Polish common oat (Avena sativa L.) cultivars. Workshop “Resistance of cere-
als to biotic stresses,” Nov 28–Dec 1, Radzików, pp 122–125
Kremer CA, Lee M, Holland JB (2001) A restriction fragment length polymorphism based linkage
map of a diploid Avena recombinant inbred line population. Genome 44(2):192–204
Lambalk JJM, Faber NM, Bruijnis AB, Conijn PCJ, Witte IAD, Nieuwenhuis J, De Jong CJ (2004)
A method for obtaining a plant with a lasting resistance to a pathogen. United States Patent
Application Publication No. US 2004/0226060 A1
Lange C (2012) Reaction of North American Oats (Avena sativa L.) to crown rust [dissertation].
Texas A&M University, College Station
Lawes DA, Hayes JD (1965) The effect of mildew (Erysiphe graminis f. sp. avenae) on spring oats.
Plant Pathol 14(3):125–128
Leonard KJ, Anikster Y, Manisterski J (2004) Patterns of virulence in natural populations of
Puccinia coronata on wild oat in Israel and in agricultural populations on cultivated oat in the
United States. Phytopathology 94:505–514
Li CD, Rossnagel BG, Scoles GJ (2000) The development of oat microsatellite markers and their
use in identifying relationships among Avena species and oat cultivars. Theor Appl Genet
101(8):1259–1268
Long J, Holland JB, Munkvold GP, Jannink JL (2006) Responses to selection for partial resistance
to crown rust in oat. Crop Sci 46:1260–1265
Martens JW (1978) Stem rust of oats in Canada in 1977. Can Plant Dis Surv 58:51–52
Martens JW (1985) Stem rust of oats. In: Roelfs AP, Bushnell WR (eds) The cereal rusts, vol II,
Diseases, distribution, epidemiology, and control.. Academic Press, New York
McCallum BD, Fetch T, Chong J (2007) Cereal rust control in Canada. Aust J Agr Res
58:639–647
McCartney CA, Stonehouse RG, Rossnagel BG, Eckstein PE, Scoles GJ, Zatorski T, Beattie AD
(2011) Chong J Mapping of the oat crown rust resistance gene Pc91. Theor Appl Genet
122(2):317–325
Mielniczuk E, Kiecana I, Perkowski J (2004) Susceptibility of oat genotypes to Fusarium crook-
wellense Burgess, Nelson and Toussoun infection and mycotoxin accumulation in kernels.
Biologia, Bratislava 59(6):809–816
Mitchell Fetch J, Fetch T Jr (2011) Inheritance of resistance to oat stem rust in the cultivars Ronald
and AC Gwen. Can J Plant Sci 91:419–423
Mohler V, Zeller F, Hsam SK (2012) Molecular mapping of powdery mildew resistance gene Eg-3
in cultivated oat (Avena sativa L. cv. Rollo). J Appl Genet 53(2):145–148
Murphy HC (1935) Effects of crown rust infection on yield and water requirement of oats. J Agr
Res 50(5):387–411
O’Donoughue LS, Wang Z, Röder M, Kneen B, Leggett M, Sorrells ME, Tanksley SD (1992) An
RFLP-based linkage map of oats based on a cross between two diploid taxa (Avena atlan-
tica × A. hirtula). Genome 35(5):765–771
O’Donoughue LS, Kianian SF, Rayapati PJ, Penner GA, Sorrells ME, Tanksley SD, Phillips RL,
Rines HW, Lee M, Fedak G, Molnar SJ, Hoffman D, Salas CA, Wu B, Autrique E, Deynze V
(1995) A molecular linkage map of cultivated oat. Genome 38:68–380
Oates JD (1992) Australian Oat Rust Survey, 1991–1992. University of Sydney, Plant Breeding
Institute, Cobbitty
Ohm HW, Shaner G (1992) Breeding oat for resistance to diseases. In: Marshall HG, Sorrells ME
(eds) Oat science and technology, vol 33, ASA monograph. ASA-CSSA-SSSA, Madison,
pp 657–698
Okoń S (2012) Identification of powdery mildew resistance genes in polish common oat (Avena
sativa L.) cultivars using host-pathogen tests. Acta Agrobot 65(3):63–68
Okoń S, Kowalczyk K (2012) Identification of SCAR markers linked to resistance to powdery
mildew in common oat (Avena sativa). J Plant Dis Protect 119:179–181
Oliver RE, Lazo GR, Lutz JD, Rubenfield MJ, Tinker NA, Anderson JM, Wisniewski Morehead
NH, Adhikary D, Jellen EN, Maughan PJ, Brown Guedira GL, Chao S, Beattie AD, Carson
ML, Rines HW, Obert DE, Bonman JM, Jackson EW (2011) Model SNP development for
complex genomes based on hexaploid oat using high-throughput 454 sequencing technology.
BMC Genomics 12(1):77. doi:10.1186/1471-2164-12-77
Oliver RE, Tinker NA, Lazo GR, Chao S, Jellen EN, Carson ML, Rines HW, Obert DE, Lutz JD,
Shackelford I, Korol AB, Wight CP, Gardner KM, Hattori J, Beattie AD, Bjørnstad Å, Bonman
JM, Jannink J-L, Sorrells ME, Brown-Guedira GL, Mitchell Fetch JW, Harrison SA, Howarth
CJ, Ibrahim A, Kolb FL, McMullen MS, Murphy JP, Ohm HW, Rossnagel BG, Yan W, Miclaus
KJ, Hiller J, Maughan PJ, Redman Hulse RR, Anderson JM, Islamovic E, Jackson EW (2013)
SNP discovery and chromosome anchoring provide the first physically-anchored hexaploid oat
map and reveal synteny with model species. PLoS One 8(3):e58068. doi:10.1371/journal.
pone.0058068
Pal N, Sandhu JS, Domier LL, Kolb FL (2002) Development and characterization of microsatellite
and RFLP derived PCR markers in oat. Crop Sci 42:912–918
Park RF (2008) Breeding cereals for rust resistance in Australia. Plant Path 57:591–602
Park RF (2013) New oat crown rust pathotype with virulence for Pc91. Cereal rust report—season
2013, vol 11(1), Plant Breeding Institute, University of Sydney, Cobbitty
Park RF, Kavanagh P (2009) Cereal rust survey–annual report 2008–2009. Plant Breeding Institute,
University of Sydney, Cobbitty
Parry DW, Jenkinson P, McLeod L (1995) Fusarium ear blight (scab) in small grain cereals- a
review. Plant Pathol 44:207–238
Portyanko VA, Hoffman DL, Lee M, Holland JB (2001) A linkage map of hexaploid oat based on
grass anchor DNA clones and its relationship to other oat maps. Genome 44(2):249–265.
doi:10.1139/g01-003
Portyanko VA, Chen G, Rines HW, Phillips RL, Leonard KJ, Ochocki GE, Stuthman DD (2005)
Quantitative trait loci for partial resistance to crown rust, Puccinia coronata, in cultivated oat,
Avena sativa L. Theor Appl Genet 111(2):313–324. doi:10.1007/s00122-005-2024-6
Rines HW, Phillips RL, Anderson OD, Vance CP, Crossman CC, Lazo GR, Miller SS, Taller J
(2004) ESTs, cytogenetic stocks, and other tools for oat genomics (abstract). Proceedings of
the 7th international oat conference, July 17–22, Helsinki
Roderick HW, Jones ERL, Šebesta J (2000) Resistance to oat powdery mildew in Britain and
Europe: a review. Ann Appl Biol 136(1):85–91
Roelfs AP (1978) Estimated losses caused by rust in small grains cereals in the United States,
1918-1976. US Dept Agric Misc Publ 1363:85
Rooney WL, Rines HW, Phillips RL (1994) Identification of RFLP markers linked to crown rust
resistance gene Pc91 and Pc92 in oat. Crop Sci 34:940–944
Sanz M, Loarce Y, Fominaya A, Vossen J, Ferrer E (2013) Identification of RFLP and NBS/PK
profiling markers for disease resistance loci in genetic maps of oats. Theor Appl Genet
126(1):203–218
Satheeskumar S, Sharp PJ, Lagudah ES, McIntosh RA, Molnar SJ (2011) Genetic association of
crown rust resistance gene Pc68, storage protein loci, and resistance gene analogues in oats.
Genome 54:484–497
Schroeder HW, Christensen JJ (1963) Factors affecting resistance of wheat to scab caused by
Gibberella zeae. Phytopathology 53(7):831–838
Sebesta J, Kummer M, Roderick HW, Hoppe HD, Cervenka J, Swierczewski A, Muller K (1991)
Breeding oats for resistance to rusts and powdery mildew in central Europe. Ochrana rostlin
27:229–238
Sebesta J, Roderick HW, Chong J (1993) The oat line Pc54 as a source of resistance to crown rust,
stem rust and powdery mildew in Europe. Euphytica 71:91–97
Simons MD, Michel LJ (1968) Oat maturity and crown rust response. Crop Sci 8:254–256
Simons MD, Murphy HC (1968) Oat diseases and their control. ARS-USDA Handbook No. 343.
USDA, Washington, DC
Simons MD, Martens JW, McKenzie RIH, Nishiyama I, Sadanaga K, Sebesta J, Thomas H (1978)
Oats: a standardized system of nomenclature for genes and chromosomes and catalogue of
genes governing characters. USDA Agriculture handbook No. 509. USDA, Washington, DC
Suttie JM, Reynolds SG (2004) Fodder oats: a world overview, vol 33, Plant production and pro-
tection series. Food and Agriculture Organization of the United Nations, Rome
Tanhuanpää P, Kalendar R, Schulman AH, Kiviharju E (2008) The first doubled haploid linkage
map for cultivated oat. Genome 51(8):560–569
Tekauz A, McCallum B, Ames N, Mitchell FJ (2004) Fusarium head blight of oat—current status
in western Canada. Can J Plant Pathol 26(4):473–479. doi:10.1080/07060660409507167
Tekauz A, Mitchell Fetch J, Rossnagel BG, Savard ME (2008) Progress in assessing the impact of
Fusarium head blight on oat in western Canada and screening of Avena germplasm for resis-
tance. Cereal Research Communications 36:49–56
Thomas H, Powell W, Aung T (1980) Interfering with regular meiotic behaviour in Avena sativa
as a method of incorporating the gene for mildew resistance from A. barbata. Euphytica 29:
635–640
Tinker NA, Kilian A, Wight CP, Uszynska KH, Wenzl P, Rines HW, Bjørnstad A, Howarth CJ,
Jannink JL, Anderson JM, Rossnagel BG, Stuthman DD, Sorrells ME, Jackson EW, Tuvesson
S, Kolb FL, Olsson O, Federizzi LC, Carson ML, Ohm HW, Molnar SJ, Scoles GJ, Eckstein
PE, Bonman JM, Ceplitis A, Langdon T (2009) New DArT markers for oat provide enhanced
map coverage and global germplasm characterization. BMC Genomics 10:39
Waterhouse WL (1952) Australian rust studies. IX. Physiological race determinations and surveys
of cereal rusts. P Linn Soc NSW 77:209–58
Wight CP, Tinker NA, Kianian SF, Sorrells ME, O’Donoughue LS, Hoffman D, Groh S, Scoles GJ,
Li CD, Webster FH, Phillips RL, Rines HW, Livingston SM, Armstrong KC, Fedak G, Molnar
SJ (2003) A molecular marker map in ‘Kanota’ × ‘Ogle’ hexaploid oat (Avena spp.) enhanced
by additional markers and a robust framework. Genome 46(1):28–47
Wolfe MS (1985) The current status and prospects of multiline cultivars and variety mixtures for
disease resistance. Annu Rev Phytopathol 23:251–273
Yu J, Herrmann M (2006) Inheritance and mapping of a powdery mildew resistance gene intro-
gressed from Avena macrostachya in cultivated oat. Theor Appl Genet 113(3):429–437
Zhu S, Kaeppler HF (2003) Identification of quantitative trait loci for resistance to crown rust in
oat line MAM17-5. Crop Sci 43(1):358–366
Index
A Aspergillus
Abiotic elicitors, 118, 125, 187 A. flavus, 12, 14, 26, 33, 134,
Abiotic stress, 25, 59–88, 185, 197, 198, 205, 201, 216, 287
218, 234, 327 A. niger, 12, 13, 26, 33, 134, 219, 292, 323
Abscisic acid (ABA), 68–69, 86, 88, 119, 191,
192, 194, 197
signaling pathway, 194 B
Adult plant resistance (APR) genes, Bacillus
239, 241–243, 345 B. amyloliquefaciens, 33, 35, 41,
AFLP. See Amplified fragment length 69, 84, 320
polymorphism (AFLP) B. pumilus, 34, 36, 38, 41, 42, 46, 121
Agrobacterium radiobacter, 33, 36 B. subtilis, 33–34, 46, 48, 49, 64, 69, 75,
Alternaria 121, 159, 162, 163, 167, 173
A. alternata, 6, 157, 204, 221 β-aminobutryic acid (BABA), 118, 194,
A. arachidis, 6 196–198
A. brassicicola, 40, 134, 198, 326 BGRI. See Borlaug Global Rust Initiative
A. consortialis, 157 (BGRI)
A. solani, 157–159, 197, 198 Bioinformatics, 131–133, 137–141, 143, 144
A. tenuissima, 6 Biotic stress, 25, 26, 59–88, 185, 197, 198,
leaf blight, 2, 6 205, 218, 234, 327
leaf spot, 6 Bipolaris sorghicola, 140
Amplified fragment length polymorphism Blackhull, 20–21
(AFLP), 114, 136, 348, 350, 351 Black scurf, 149, 160, 162, 163, 217
Anthracnose of groundnut, 11 Blitecast, 154
Antibiotic mediated suppression, 319–320 Borlaug global rust initiative (BGRI),
Antibiotics, 31, 32, 38, 40, 42, 46, 61, 64, 239, 243, 244, 253, 254
75–81, 118, 119, 163, 208, Botanicals, 203, 209, 216, 217
318–321, 328, 334 Botryodiplodia solani-tuberosi, 173
Antioxidative enzyme system, 189–191 Botrytis
AP2/ERF transcription factors, 199 B. cinerea, 2, 17, 19, 24, 33, 134, 142,
APR genes. See Adult plant resistance 188, 190, 197, 198, 202, 211, 215,
(APR) genes 219, 326
Arabidopsis, 42, 44, 46–48, 62, 69, 74, 82–84, blight, 17
135, 188–190, 192, 194–199, 283 Bradyrhizobium japonicum, 35
Arachis hypogaea, 1, 8 Burkholderia, 32–34, 40, 70, 77, 81
Arbuscular mycorrhiazal fungi (AMF), 218 BZIP transcription factors, 193, 199

Against Fungal Pathogens, Fungal Biology, DOI 10.1007/978-1-4939-1188-2,
360 Index
C DON. See Deoxynivalenol (DON)

Candidate cytoplasmic effector (CE) Durable Rust Resistance in Wheat
genes, 138 (DRRW), 239
Catabolism, 332
cDNA, 138–140, 352
Cell wall fortification, 189 E
Cercospora Early blight, 149, 156–160, 206
C. arachidicola, 3, 201 Early leaf spot, 3–4
C. canescens, 6 Effector-triggered immunity (ETI), 44
leaf blight, 4, 6–7, 205 Endophytes, 41, 42, 144, 214–215
Cercosporidium personatum, 4, 37, 198, 201 Endophytic bacteria, 41
Chaetomium brasiliense, 156 Environmental fitness, 332
Charcoal rot, 18–19, 38, 149, 172–173, 326 Enzyme activity of the bacteria, 327–328
Chinese Yellow Rust, 260 Epiccocum purpurascens, 156
Choanephora cucurbitarum, 11 Epidemiology and forecasting of diseases,
Choanephora wet blight, 11, 12 205–206
CIMMYT, 234–236, 239, 240, 242, 243 Erwinia spp., 164
Claviceps fusiformis, 109, 201, 217 Ethylene (ET), 31, 44, 60, 67–69, 82–84,
Climate change, 205–206, 222, 231 86–88, 162, 187, 189, 192–195,
Collar rot, 2, 13–15, 21, 33 197, 199, 283, 325
Colletotrichum dematium, 11, 119 signaling pathway, 193–194
Comparative genomics, 136–137, 139 Evolutionary genomics, 136, 137
Competition for space and nutrients, 61–65, Expressed Sequence Tags (ESTs),
319, 324 138–139, 348
Consultative Group on International
Agricultural Research
(CGIAR), 239 F
Corticum vagum, 160 FHB. See Fusarium head blight (FHB)
Cristulariella moricola, 8 Formulation of PGPR, 48–49
Cross protection, 215–216 Fumonisins, 269, 270, 276, 284, 286, 287
Cross talk, 83, 194, 220 Functional genomics, 138–143, 220, 223, 283
Crown rot, 2, 13, 21, 272, 276, 326 Fungicidal resistance, 207–212
Cryptococcus neoformans, 140 Fusarium
Cylindrocladium diseases of maize, 283–287
black rot, 2, 17 dry rot, 149, 163–167
C. crotalariae, 17 ear blight, 285
Cytokinins, 31, 60, 65, 68, 69, 86, 158, 325 F. acuminatum, 164, 273
F. avenaceum, 164, 267, 268, 272–275,
277, 279, 347, 348
D F. coeruleum, 164, 166
DArT markers. See Diversity array (DArT) F. culmorum, 164, 195, 219, 267, 268, 270,
markers 276–278
Datura stramonium, 171 F. equiseti, 165
Deoxynivalenol (DON), 270, 277, 280, 282, F. graminearum, 133, 134, 143, 156, 165,
284, 286, 287, 289, 290, 292–296, 201, 267–271, 273–277, 280–294,
298, 348, 352 347, 348
Detection and quantification of mycotoxins, F. graminearum genome, 133, 269
270, 271, 295–297 F. oxysporum, 19, 32–35, 38, 40–42, 46, 119,
Didymella arachidicola, 7 134, 140, 164, 166, 167, 190, 196,
Diplodia collar rot, 2, 15 198, 201, 202, 204, 215, 217–219,
Diversity array (DArT) markers, 348, 350, 352 221, 267, 269, 273, 291, 320, 323,
DNA 324, 326, 327, 329, 330, 333
marker analysis, 187, 202, 219, 257 F. oxysporum f. sp. cubense, 35, 140,
sequencing, 140 217, 320
Index 361
F. sambucinum, 164, 165 I

F. scirpi, 165 ICARDA, 239
F. semitectum, 165 Indian preparedness for Ug99, 243–244
F. solani f. sp. phaseoli, 19, 272, 273, 275 Indole acetic acid (IAA), 60, 65–67, 86
F. solani var. coeruleum, 164 Induced defense responses, 188–200
F. sporotrichioides, 165, 267, Induced resistance, 36, 37, 47, 49, 81,
270, 277, 347 123–124, 187, 194–198, 200,
F. sulphureum, 164, 166 215–216, 327
F. tricintum, 165 Induced systemic resistance (ISR), 32, 36–49,
related mycotoxins, 294–298 51, 61, 74, 77, 81–84, 187, 195,
stalk (stem) rot, 286 233, 319, 326–327
Fusarium crown rot (FCR), 276–279, 281, 283 Induced systemic tolerance (IST), 61, 84–88
Fusarium head blight (FHB), 134, 203, 206, Insect pests, 38–40, 43, 201
231, 272, 273, 276, 277, 279–283, Integrated disease management, 21–25, 200,
288–294, 344, 351–353 221–223
resistance genes, 347–348 International Potato Centre, 154
Fusarium spp., 12, 163–167, 217, 267, 269, ISR. See Induced systemic resistance (ISR)
270, 272, 273, 275–277, 284, 287,
292, 344
J
Jasmonic acid (JA )
G and related compounds, 196, 297, 332
Gene ontology (GO), 138 signaling pathway, 187, 192, 193
Genetic resistance, 187–200, 222, 234, 240,
276, 287, 345
Genome-scale metabolic reconstruction L
(GEMR), 142 Lack of key pathogenicity factors, 333
Genomic Sequence of Pseudomonas Lasiodiplodia theobromae, 12, 15
fluorescens, 328–334 Late blight, 135, 149–156, 159, 197, 200, 201,
Genotypic diversity, 114 205, 219
Genus Pseudomonas, 318–319 Late leaf spot, 4–5, 21, 37
Geographical information system (GIS), 154, Leaf rust, 203, 206, 240, 241, 249, 250,
206, 237 254–258
Gibberellins, 31, 60, 65, 67, 68, 286 Leptosphaerulina crassiasca, 9
Gliocladium Lipopeptides, 32, 47
G. catenulatum, 162 Lipopolysaccharides (LPS), 44, 46–47, 63, 76,
G. virens, 162, 213 83, 85
Global Cereal Rust Monitoring System Long-distance dispersal (LDD), 233, 235, 291
(GCRMS), 239 Lytic enzymes, 38, 42, 64, 74–76, 163, 167,
Gray mold, 17, 134 319, 327
Green ear, 110
Groundnut rust, 5
M
Macrophomina phaseolina, 12, 18, 172, 173,
H 198, 201, 202, 204, 218, 221, 320,
HCN production, 38, 319–323 326, 328, 329
Hordeum vulgare, 132, 192 Mapping of resistance genes/QTLs, 349–352
Horizontal gene transfer (HGT), 137 Maximum likelihood (ML), 137
Host differentials, 113, 114 MBDS race cluster, 256
Host–pathogen barriers, 185–187 Mechanisms of Biocontrol by P. Fluorescens,
Host–pathogen interaction, 138, 185–223 319–328
Hybrid Single-Particle Lagrangian Integrated Meloidogyne incognita, 39, 327, 333
Trajectory (HYSPLIT), 237 Metabolomics, 131, 142
Hypovirulence, 213–214 Metagenomics, 60, 136, 143–144
362 Index
Mineral phosphate solubilization (MPS), 61, PGIPs. See Polygalacturonase inhibiting

71, 319, 324–325 proteins (PGIPs)
Moesziomyces penicillariae, 109 PGPR. See Plant growth promoting
Molecular markers, 135–137, 139, 243, 255, rhizobacteria (PGPR)
256, 258, 343–353 PGPS. See Production of plant growth
Multilocus sequence analysis (MLSA), 136 promoting substances (PGPS)
MYB transcription factors, 199 Phaeoisariopsis personata, 4
Mycorrhiza helper bacteria (MHB), 35 Phosphate solubilization, 64, 70–72, 325
Mycosphaerella musicola, 140, 201 Phyllanthus amarus, 49
Mycotoxins, 269, 271, 276–278, 281, Phyllosticta
283–284, 294–298, 344, 348, 352 leaf spot, 2, 7–8
Myrothecium P. arachidis-hypogaea, 7
leaf blight, 2, 9 Phythium spp., 12
M. roridum, 9 Phytoalexin synthesis, 189
M. verrucaria, 156, 215 Phytohormones, 65, 78, 87, 189, 318
Phytophthora
P. capsici, 132, 133, 135, 138–140, 196,
N 198, 216, 320, 329
Nanotechnology, 219, 223 P. infestans, 46, 47, 132, 135, 142, 143,
NBS. See Nucleotide-binding site (NBS) 149–153, 155, 156, 159, 171,
Necrotrophic fungal pathogen, 132 197, 198, 200, 201, 205, 207, 211,
Nematode pests, 37, 39, 51 212, 215
Next-generation sequencing, 131, 132, 138, Plant-associated microbe gene ontology
140, 144 (PAMGO), 138, 141
Nivalenol (NIV), 270, 277, 295, 348 Plant growth promoting rhizobacteria (PGPR),
Nucleotide-binding site (NBS), 124, 188, 351 31–51, 59–88, 120, 141, 195, 319,
323, 325–327, 334
application of mixtures, 32, 37–40, 42,
O 43, 49, 60
Oat mildew resistance (OMR) groups, broad spectrum of activity, 40
347, 352 imparting ISR, 46–48
Oidium arachidis, 8 induced systemic resistance (ISR), 36–39,
Organic farming, 216–218 46–48
Oxidative burst, 189–191 induction of ISR by endophytic, 41
Plant pathogen diagnosis, 187
Plant-signaling molecules, 44
P Pod rot, 2, 19–20, 22, 23
Paenibacillus brasiliensis, 35 Polygalacturonase inhibiting proteins (PGIPs),
PAMP triggered immunity (PTI), 44 122, 214, 275
Pantoea agglomerans, 36 Powdery mildew, 2, 8–9, 33, 37, 134, 191,
Parasexual recombination, 255, 258 201, 203, 205, 209, 210, 213, 216,
Passive resistance, 188 217, 219, 231, 344, 347
Pathogenesis-related proteins, 42, 82, 83, 138, Powdery mildew and FHB, 344, 351–352
189, 191, 275, 319 Powdery mildew resistance genes, 241, 344,
Pathogen-induced resistance, 195 347, 351
Pathogens associated molecular patterns Powdery scab of potato, 170
(PAMPs), 43, 44 Probenazole, 197
Pathogen variability, 112–117 Production of plant growth promoting
Penicillium spp., 12, 23, 119, 156, 198, 202, 213 substances (PGPS), 319, 325–326
Pennisetum glaucum, 109, 326 Proteomics, 125, 131, 141–143, 220, 223
Pepper spot and leaf scorch, 2, 9–10 Protomyces graminicola, 110
Peronosclerospora graminicola, 110 Pseudomonas
Pestalotiopsis genus, 318–319
leaf blight, 2, 11–12 P. aeruginosa, 34, 46, 48, 50, 63, 159, 167,
P. arachidis, 11 317, 318, 325, 326, 332
Index 363
P. fluorescens, 33–36, 38–42, 46–49, 63, Root-knot nematode, 39, 327, 333
68, 82, 84, 121, 167, 195, 317–335 Rust-resistant cultivars, 346
genomic sequence of, 328–334 Rye (Secale cereal), 234
by mechanisms of biocontrol, 319–328
by successful antagonism, 33, 36,
38–42, 46–49, 121, 317–335 S
P. syringae, 33, 36, 38, 40, 44, 45, 84, 156, Saccharomyces cerevisiae, 77, 132
190, 195, 198, 317, 318, 333 Salicylic acid (SA), 36, 44, 46, 48, 72, 82–84,
pv. lachrymans, 38 120, 187–189, 191–199, 283, 327
pv. tomato, 38, 40, 84, 198 and SA analogues, 196
Puccinia signaling pathway, 193, 283
P. arachidis, 5, 201 Scab, 8, 170, 200–202, 206, 210, 231, 292
P. graminis f. sp. tritici, 135, 201, Sclerospora graminicola, 109–117, 121–125,
250–254, 258–261 134, 198, 201, 232, 329
P. substriata, 109 Sclerotinia
Pyremophora teres f. teres, 132 blight, 16–17, 22, 24
Pyricularia grisea, 109, 320 S. minor, 2, 16, 17, 24, 242
Pythium S. sclerotiorum, 2, 16, 17, 24, 34, 135, 140,
P. aphanidermatum, 33, 40, 202, 326, 330 196, 206, 215, 291, 292, 328, 329
P. irregular, 7, 19 Sclerotium
P. myriotylum, 19 leaf spot, 2, 10–11
P. ultimum, 19, 33, 34, 42, 77, 79, 135, S. rolfsii, 2, 10, 12, 15, 16, 19, 22–24, 26,
156, 324, 327, 329 33, 41, 329, 330
Secondary metabolites and other secreted
products, 333
Q Self-defense, 333
Quantitative trait loci (QTL), 241, 275, 282, Serial analysis of gene expression (SAGE),
283, 287, 349–353 140, 220
Setaria verticillata, 110
Siderophore-mediated iron acquisition,
R 332–333
Random amplified polymorphic DNA Siderophores, 31, 32, 38, 46, 47, 61, 64,
(RAPD), 114, 115, 136, 187, 350 72–74, 318, 319, 323–326, 328,
Reactive oxygen species, 44, 78, 86, 189 332, 333
Recovery resistance, 124 Siderophores production, 319
Resistance breeding, 122–124, 223, 345, 348, Signal transduction, 83, 141, 186, 187,
352–353 192–193, 199
Resistance gene analogues (RGAs), 124, 351 Simcast, 154
Resistance gene characterization, 124 Simple sequence repeats (SSR), 135, 136, 236,
Resistance mechanisms, 61, 82, 122–124, 194, 348, 351
275–276, 281, 286–287 Single nucleotide polymorphism (SNP)
Restriction fragment length polymorphism markers, 136, 271, 349, 352
(RFLP), 136, 320, 348, 350–352 Solanum
Rhizobium leguminosarum, 35 S. bulbocastanum, 155
Rhizoctonia S. chacoense, 155, 159, 173
damping-off, 2, 14 S. phureja, 159
R. solani, 2, 12, 14, 19, 20, 22–24, 32–34, S. tuberosum, 143, 159
40, 43, 157, 160–163, 213, 217, Sphaceloma arachidis, 8
219, 328–330 Spongospora subterranea, 171
Rhizopus spp., 12 SSR. See Simple sequence repeats (SSR)
Rhizosphere colonization, 332, 334 Stem rot of groundnut, 15, 329
Role of molecular markers, 348–349 Stem rust, 135, 188, 203, 232–235, 238–243,
Root exudates, 18, 43, 59, 60, 62, 63, 66, 70, 249–254, 259, 343–346, 349
317, 332 Stem rust epidemiology, 233, 250
364 Index
Streptomyces griseoviridis, 36 U
Synchytrium endobioticum, 167, 168, 201 Ug99 race migration, 237
Systemic acquired resistance (SAR), 32, 36, Ug99 resistance genes, 234, 239–241
37, 46, 82–84, 187, 193, Ug99-Risk Mitigation Strategies, 238
195–197
Systemic resistance, 195, 215
Systems biology, 131–144 V
Verticillium
V. albo-atrum, 17, 217, 329
T V. dahliae, 17, 135, 190, 198, 218
Thalictrum speciosissimum, 255, 258 wilt of groundnut, 17
Thanatephorus cucumeris, 20, 160 Volatiles, 39, 60, 69, 76, 78, 81, 83, 84, 86,
Thielaviopsis basicola, 20, 323, 329 166, 203, 318, 325, 328
Transcription factors, 138, 189, 193, 194,
198–200
Transcriptomics, 131, 139–142, 144, W
220, 223, 352 Wart of potato, 168
Transgenics, 4, 5, 26, 39, 125, 159, 167, 197, Web blotch, 7
219, 223, 282 Wheat stripe rust, 41, 258–261
Trichoderma WRKY Transcription factors, 194, 199–200
as biocontrol agent, 213
T. atroviride, 162, 213
T. harzianum, 14, 16, 18, 25, 120, 121, X
162, 167, 213, 214 Xanthomonas campestris pv. campestris, 32
T. viride, 14, 16, 18, 25, 120, 121, 156,
162, 163, 213, 214, 329
Trichothecenes, 269–271, 276–278, Y
280, 281, 284 Yellow mold, 2, 14
Triticum
T. aestivum, 231, 250
T. turgidum var. durum, 231 Z
Tryptophan, 66 Zonate leaf spot, 2, 8

Future Challenges in Crop Protection 978149391188

Uploaded by

Copyright:

Available Formats

Future Challenges in Crop Protection 978149391188

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Future Challenges in Crop Protection 978149391188

Uploaded by

Copyright:

Available Formats

Fungal Biology

Maria G. Tuohy, PhD

For further volumes:

Future Challenges in Crop

ISSN 2198-7777 ISSN 2198-7785 (electronic)

Library of Congress Control Number: 2014946211

© Springer Science+Business Media New York 2014

Printed on acid-free paper

Springer is part of Springer Science+Business Media (www.springer.com)

World agriculture has shown phenomenal growth in recent past due to

facilitated by marker-assisted selection. The transgenic approach and its modification

4. Scientifically accurate data has to be generated in the field of inoculum quality,

Rabat, Morocco Aakash Goyal

1 Fungal Diseases of Groundnut: Control and Future Challenges ....... 1

10 Fusarium Diseases of Canadian Grain Crops:

Index ................................................................................................................. 359

K. Ramachandra Kini, M.Sc., Ph.D. Department of Studies in Biotechnology,

Mohinder Prashar, Ph.D. Maharashtra Hybrid Seeds Company Limited, Jalna,

Kamal Krishna Pal, Rinku Dey, and K.V.B.R. Tilak

K.K. Pal, Ph.D. (*) • R. Dey, Ph.D.

A. Goyal and C. Manoharachary (eds.), Future Challenges in Crop Protection 1

1.2 Fungal Diseases of Groundnut

1.2.1 Foliar Diseases

1.2.1.1 Early Leaf Spot

It is caused by Cercospora arachidicola Hori. This is a very widely seen foliar

Management of Early Leaf Spot

• Intercropping cereals like pearlmillet or sorghum with groundnut is helpful in

1.2.1.2 Late Leaf Spot

Management of Late Leaf Spot

• A cereal–cereal–groundnut crop rotation should be followed.

• The buildup of rust inoculum should be avoided by a cereal–cereal–groundnut

1.2.1.4 Alternaria Leaf Spot

This disease is caused by Alternaria alternata (Fries) Keissler. The symptoms

1.2.1.5 Alternaria Leaf Blight

1.2.1.6 Cercospora Leaf Blight

Fig. 1.4 (a, b) Symptoms of web blotch

1.2.1.7 Web Blotch

1.2.1.8 Phyllosticta Leaf Spot

The causal organism for this disease is Phyllosticta arachidis-hypogaea Vasant

Fig. 1.5 (a, b) Phyllosticta leaf spot of groundnut

1.2.1.10 Zonate Leaf Spot

Zonate leaf spot of groundnut is caused by Cristulariella moricola (Hino) Redhead.

1.2.1.11 Powdery Mildew

Fig. 1.6 (a, b) Symptom of Myrothecium leaf blight

1.2.1.12 Myrothecium Leaf Blight

1.2.1.13 Pepper Spot and Leaf Scorch

This disease is caused by Leptosphaerulina crassiasca (Sechet) Jackson & Bell.

Fig. 1.7 Pepper leaf spot of

Fig. 1.8 (a, b) Leaf scorch of groundnut

Fig. 1.9 Sclerotium leaf

1.2.1.14 Sclerotium Leaf Spot

Fig. 1.10 (a, b) Anthracnose of groundnut caused by Colletotrichum dematium

give blighted appearance to the leaves. Sclerotia (about 0.5–0.8 mm in diameter)

1.2.1.16 Choanephora Wet Blight

1.2.1.17 Pestalotiopsis Leaf Blight

Fig. 1.11 (a, b) Choanephora wet blight of groundnut

Fig. 1.12 (a, b) Pestalotiopsis leaf blight of groundnut

1.2.2 Seed and Seedling Diseases

1.2.2.1 Seed and Seedling Rots

1.2.2.2 Crown/Collar Rot